CN106244557A - Rite-directed mutagenesis ApoE gene and the method for LDLR gene - Google Patents
Rite-directed mutagenesis ApoE gene and the method for LDLR gene Download PDFInfo
- Publication number
- CN106244557A CN106244557A CN201610756699.3A CN201610756699A CN106244557A CN 106244557 A CN106244557 A CN 106244557A CN 201610756699 A CN201610756699 A CN 201610756699A CN 106244557 A CN106244557 A CN 106244557A
- Authority
- CN
- China
- Prior art keywords
- gene
- sequence
- grna
- ldlr
- apoe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/775—Apolipopeptides
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New breeds of animals
- A01K67/027—New breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
- A01K2217/054—Animals comprising random inserted nucleic acids (transgenic) inducing loss of function
- A01K2217/056—Animals comprising random inserted nucleic acids (transgenic) inducing loss of function due to mutation of coding region of the transgene (dominant negative)
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/108—Swine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
Abstract
The method that the invention discloses rite-directed mutagenesis ApoE gene and LDLR gene.Rite-directed mutagenesis ApoE gene disclosed by the invention and the method for LDLR gene, including the encoding gene of the encoding gene of the gRNA of the importing encoding gene of gRNA of targeting ApoE gene target sequence, targeting LDLR gene target sequence in receptor cell with Cas9, obtain ApoE gene with LDLR gene by the zooblast of rite-directed mutagenesis；Experiment proves, the gRNA of the targeting ApoE gene target sequence of the present invention and the gRNA of targeting LDLR gene target sequence can distinguish efficient identification ApoE gene and LDLR gene, under their effect, the average diallele editorial efficiency of APOE and LDLR gene, up to 31%, shows that the method for the present invention can be used to rite-directed mutagenesis ApoE gene and LDLR gene.
Description
Technical field
The present invention relates to rite-directed mutagenesis ApoE gene and the method for LDLR gene in biological technical field.
Background technology
CRISPR/Cas is a kind of effective acquired immunity mechanism in antibacterial and archeobacteria, CRISPR bunch be one extensively
The special repetitive dna sequence family being present in antibacterial and Archimycetes genome, participation tissues-derived according to Cas locus gene
The difference of Cas protein, CRISPR/Cas system is divided into I type, II type and type III.II type CRISPR/Cas system only exists
In antibacterial, it is core composition with Cas9 albumen and guide RNA (gRNA), resists the foreign DNA invasions such as phage when body
Time, under the regulation and control of leader region, CRISPR is transcribed into long RNA precursor (pre-crRNA), is subsequently processed into a series of short
Containing guarding repetitive sequence and the ripe crRNA, crRNA of spacer and the trans-activation complementary with crRNA repetitive sequence
CrRNA (tracrRNA) and Cas9 three form complex, finally identify, be attached on the exogenous DNA array that is complementary to send out
Wave shear action.II type CRISPR/Cas system is at each species such as: mice, rat, pig, cattle, sheep, baboon, Oryza sativa L., Semen Tritici aestivi, plan
South mustard etc. has all obtained relatively broad utilization.Its editorial efficiency relatively earlier generations such as homologous recombination, ZFNs, TALEN gene editing
Means are greatly improved, and experiment link is few, the cycle is short, expense is lower.
ApoE albumen is a kind of apolipoprotein, is present in very low density lipoprotein (VLDL) (very low-density
Lipoprotein, VLDL), Chylomicron (chylomicrons, CM), intermediated-density lipoprotein (Intermediate-
Density lipoprotein, IDLs) and high density lipoprotein (high-density lipoprotein, HDL) in, for richness
Necessary to the homergy of the lipoprotein component containing triglyceride.Mankind's ApoE genetic flaw or genovariation and cardiovascular disease
The diseases such as disease, senile dementia are relevant, are hypercholesterolemia and atherosclerotic major gene resistance.
Low density lipoprotein receptor (LDLR, low-density lipoprotein receptor) is gallbladder in regulation blood
The amount of sterin plays the effect of key.They are distributed the abundantest in liver, the low-density lipoprotein receptor of surface of hepatocytes
The quantity of body determines how quickly to be removed from blood by cholesterol.LDLR has high polymorphism, at present about LDLR
The mutation type that gene has determined that is just more than 1000 kinds.The LDLR type of these sudden changes increases by affecting blood cholesterol levels
Add the disease incidence such as heart disease and atherosclerosis.
In biomedical research, study of disease occurs in the foundation of animal model of human disease and treatment has most important
Effect.Along with the aggravation of Chinese society aging, cardiovascular patient will continue to increase.ApoE/LDLR is dual-gene in preparation
Mutant animals model has important scientific research and medical value.
Summary of the invention
The technical problem to be solved is how ApoE gene and LDLR gene to be carried out rite-directed mutagenesis.
For solving above-mentioned technical problem, the method that present invention firstly provides rite-directed mutagenesis ApoE gene and LDLR gene,
Described method carries out rite-directed mutagenesis for employing CRISPR/Cas9 method, the ApoE gene used in described CRISPR/Cas9 method
Target sequence is following A1), A2) or A3):
A1) nucleotide sequence of sequence 1 in sequence table；
A2) DNA sequence and A1) limited have 75% or more than 75% homogeneity by A1) derivative DNA sequence；
A3) under strict conditions with A1) limit DNA sequence hybridization by A1) derivative DNA sequence；
The LDLR gene target sequence used in described CRISPR/Cas9 method is target sequence 1 or target sequence 2, described target sequence
Row 1 are following B1), B2) or B3):
B1) nucleotide sequence of sequence 3 in sequence table；
B2) DNA sequence and B1) limited have 75% or more than 75% homogeneity by B1) derivative DNA sequence；
B3) under strict conditions with B1) limit DNA sequence hybridization by B1) derivative DNA sequence；
Described target sequence 2 is following C1), C2) or C3):
C1) nucleotide sequence of sequence 4 in sequence table；
C2) DNA sequence and C1) limited have 75% or more than 75% homogeneity by C1) derivative DNA sequence；
C3) under strict conditions with C1) limit DNA sequence hybridization by C1) derivative DNA sequence.
Term used herein " homogeneity " refers to the sequence similarity with native sequence nucleic acid." homogeneity " includes and this
The nucleotide sequence of bright sequence 1, sequence 3 or sequence 4 has 75% or higher, or 85% or higher, or 90% or higher, or
The nucleotide sequence of 95% or higher homogeneity.Homogeneity can with the naked eye or computer software is evaluated.Use computer
Software, the homogeneity between two or more sequences can use percentage ratio (%) to represent, its can be used to evaluate correlated series it
Between homogeneity.
In said method, described stringent condition is at 2 × SSC, in the solution of 0.1%SDS, hybridizes and wash film at 68 DEG C
2 times, each 5min, again in 0.5 × SSC, in the solution of 0.1%SDS, hybridize at 68 DEG C and wash film 2 times, each 15min；
Or, 0.1 × SSPE (or 0.1 × SSC), 0.1%SDS solution in, hybridize under the conditions of 65 DEG C and wash film.
Above-mentioned 75% or more than 75% homogeneity, can be the homogeneity of 80%, 85%, 90% or more than 95%.
Above-mentioned rite-directed mutagenesis ApoE gene can include importing in vitro receptor cell with the method for LDLR gene
The encoding gene of gRNA of targeting ApoE gene target sequence, encoding gene and the Cas9 of gRNA of targeting LDLR gene target sequence
Encoding gene, obtains ApoE gene with LDLR gene by the zooblast of rite-directed mutagenesis.
In said method, the encoding gene of the gRNA of described targeting ApoE gene target sequence can be imported by expression vector 1
In described receptor cell, described expression vector 1 is the encoding gene of the gRNA containing described targeting ApoE gene target sequence
The expression vector of expression cassette.
In one embodiment of the invention, described expression vector 1 is that U6-sgRNA-ApoE2, U6-sgRNA-ApoE2 are
The weight that the oligonucleotide dimer of recognizable sequence 1 obtains is inserted in the sequence of pGL3-U6-sgRNA-PGK-puromycin
Group carrier.
In said method, the encoding gene of the gRNA of described targeting LDLR gene target sequence can be imported by expression vector 3
In described receptor cell, described expression vector 3 is the encoding gene of the gRNA containing described targeting LDLR gene target sequence
The expression vector of expression cassette.
In one embodiment of the invention, described expression vector 3 is U6-sgRNA-LDLR1 or U6-sgRNA-LDLR2,
U6-sgRNA-LDLR1 is the oligonucleoside inserting recognizable sequence 3 in the sequence of pGL3-U6-sgRNA-PGK-puromycin
The recombinant vector that acid dimer obtains, U6-sgRNA-LDLR2 is in the sequence of pGL3-U6-sgRNA-PGK-puromycin
Insert the recombinant vector that the oligonucleotide dimer of recognizable sequence 4 obtains.
In said method, the encoding gene of described Cas9 can import in described receptor cell by expression vector 2, institute
State the expression vector of the expression cassette that expression vector 2 is encoding gene containing described Cas9.
In one embodiment of the invention, described expression vector 2 is the Cas9 that article No. the is #44758 expression of Addgene
Carrier.
In said method, the sequence of the gRNA of described targeting ApoE gene target sequence can be by the T in sequence in sequence table 2
Replace with the sequence that U obtains；The encoding gene of the gRNA of described targeting ApoE gene target sequence is in sequence table shown in sequence 2
DNA molecular.The sequence of the gRNA of described targeting LDLR gene target sequence is to be replaced with by the T in sequence in sequence table 5 or sequence 6
The sequence that U obtains；The encoding gene of the gRNA of described targeting LDLR gene target sequence is in sequence table shown in sequence 5 or sequence 6
DNA molecular.
In said method, described receptor cell can be mammalian cell.Described mammalian cell is concretely
Pig cell, such as porcine fetus fibroblasts.
For solving above-mentioned technical problem, present invention also offers following arbitrary product:
P1, complete RNA, by the gRNA (by named for this gRNA ApoE-gRNA) of described targeting ApoE gene target sequence with
GRNA (by named for this gRNA LDLR-gRNA) composition of described targeting LDLR gene target sequence；
P2, complete gene, be made up of the encoding gene of the encoding gene of ApoE-gRNA with LDLR-gRNA；
The expression cassette of P3, encoding gene containing ApoE-gRNA and the encoding gene of LDLR-gRNA；
P4, complete expression cassette, by the encoding gene of the expression cassette of the encoding gene containing ApoE-gRNA Yu LDLR-gRNA
Expression cassette composition；
P5, the recombinant vector of encoding gene and the encoding gene of LDLR-gRNA of encoding gene containing ApoE-gRNA；
P6, recombinant vector containing expression cassette described in P3；
P7, recombinant vector containing expression cassette complete described in P4；
P8, complete carrier, by recombinant vector and the LDLR-gRNA of the encoding gene of the encoding gene containing ApoE-gRNA
Encoding gene recombinant vector composition；
P9, complete target sequence, be made up of with described LDLR gene target sequence described ApoE gene target sequence.
In an embodiment of the present invention, LDLR-gRNA is LDLR1-gRNA or LDLR2-gRNA.The sequence of LDLR1-gRNA
For the T in sequence in sequence table 5 is replaced with the sequence that U obtains, the sequence of LDLR2-gRNA is by sequence in sequence table 6
T replaces with the sequence that U obtains.
In the said goods, the expression cassette of the described encoding gene containing ApoE-gRNA, refer to table in host cell
Reaching the DNA of ApoE-gRNA, this DNA not only can include starting the promoter that the encoding gene of ApoE-gRNA is transcribed, and may also include
Terminate the terminator that the encoding gene of ApoE-gRNA is transcribed.The expression cassette of the described encoding gene containing LDLR-gRNA, refers to
Can express the DNA of LDLR-gRNA in host cell, this DNA not only can include that the encoding gene starting LDLR-gRNA is transcribed
Promoter, may also include the terminator transcribed of encoding gene terminating LDLR-gRNA.Further, described expression cassette also can wrap
Include enhancer sequence.
Available existing expression vector establishment contains the restructuring of the encoding gene expression cassette of ApoE-gRNA or LDLR-gRNA
Carrier.Described expression vector concretely pGL3-U6-sgRNA-PGK-puromycin.
For solving above-mentioned technical problem, present invention also offers the complete examination of rite-directed mutagenesis ApoE gene and LDLR gene
Agent, described reagent set includes any one composition in described product and following M1-M3；
The encoding gene of M1, Cas9；
M2, the expression cassette of encoding gene containing Cas9；
M3, the expression vector of encoding gene containing Cas9.
In above-mentioned reagent set, the expression cassette of the encoding gene containing Cas9 described in M2, refer at host cell
The DNA, this DNA of middle expression Cas9 not only can include starting the promoter that the encoding gene of Cas9 is transcribed, and may also include termination
The terminator that the encoding gene of Cas9 is transcribed.Further, described expression cassette may also include enhancer sequence.
Available existing expression vector establishment contains the recombinant vector of the encoding gene expression cassette of Cas9.Described containing Cas9
The Cas9 expression vector that article No. is #44758 of expression vector concretely Addgene of encoding gene.
For solving above-mentioned technical problem, present invention also offers following arbitrary application:
The application in rite-directed mutagenesis ApoE gene with LDLR gene of X1, described product；
The application in rite-directed mutagenesis ApoE gene with LDLR gene of X2, described reagent set.
The application in preparing ApoE gene and LDLR site-directed point mutation animal model of X3, described product；
The application in preparing ApoE gene and LDLR site-directed point mutation animal model of X4, described reagent set.
In above-mentioned application, described animal can be mammal.Described mammal concretely pig.
In the present invention, pGL3-U6-sgRNA-PGK-puromycin is the product that article No. is #51133 of addgene.
It is demonstrated experimentally that ApoE-gRNA Yu LDLR1-gRNA and ApoE-gRNA Yu LDLR2-gRNA of the present invention can distinguish
Efficient identification ApoE gene and LDLR gene, realize accurately cutting under CAS9 enzyme effect, and ApoE gene and LDLR gene exist
The mutation type occurred near cas9 cleavage site all has: single base is inserted, many bases are inserted, single base is deleted and many bases are deleted
Except four kinds of mutation types.The average diallele of APOE and LDLR gene under the effect of ApoE-gRNA Yu LDLR1-gRNA
Editorial efficiency is 31%；The average diallele of APOE and LDLR gene under the effect of ApoE-gRNA Yu LDLR2-gRNA
Editorial efficiency is 14%.The cell that the LDLR gene carrying various mutations type all suddenlys change can be prepared with APOE gene, for
Sudden change and the functional analysis of APOE gene/LDLR gene provide experiment basis.The rite-directed mutagenesis ApoE gene of the present invention with
The method of LDLR gene can be used to rite-directed mutagenesis ApoE gene and LDLR gene, it is also possible to is used for preparing ApoE gene and LDLR
Genetic flaw disease animal model.
Accompanying drawing explanation
Fig. 1 mixes pond PCR order-checking for cell after transfection U6-sgRNA-ApoE2 48h.In figure, black region show gRNA and sets
Meter site.
Fig. 2 is cell monoclonal mutation type analysis.
Fig. 3 mixes pond PCR order-checking for cell after transfection U6-sgRNA-LDLR1 Yu U6-sgRNA-LDLR2 48h.A:CAS9/
Mixed pond PCR order-checking peak figure after U6-sgRNA-LDLR1 transfection；Mixed pond PCR order-checking peak after B:CAS9/U6-sgRNA-LDLR2 transfection
Figure；In figure, LDLR-E2-1 Yu LDLR-E2-2 represents the recognition site of LDLR1-gRNA Yu LDLR2-gRNA respectively.
Fig. 4 analyzes for cell monoclonal mutation type after transfection U6-sgRNA-LDLR1 Yu U6-sgRNA-LDLR2.Wherein,
LDLR-e2-1 Yu LDLR-e2-2 represents transfection U6-sgRNA-LDLR1 and U6-sgRNA-LDLR2 respectively；"+" represents inserts；
" △ " represents deletion；" wt " represents wild type.
Fig. 5 mixes for cell after transfection U6-sgRNA-LDLR1 Yu U6-sgRNA-LDLR2 and U6-sgRNA-ApoE2 48h
Pond PCR checks order.In figure APOE-E2, LDLR-E2-1 and LDLR-E2-2 represent respectively APOE-gRNA, LDLR1-gRNA with
The recognition site of LDLR2-gRNA.After A Yu B is respectively transfection U6-sgRNA-ApoE2/U6-sgRNA-LDLR1, cell mixes pond
APOE and LDLR gene PCR order-checking peak figure；After C Yu D is respectively transfection U6-sgRNA-ApoE2/U6-sgRNA-LDLR1, cell mixes
Pond APOE and LDLR gene PCR order-checking peak figure.
Fig. 6 is cell monoclonal mutation type analysis, and wherein, A is transfection U6-sgRNA-ApoE2/U6-sgRNA-LDLR1
Result, B be transfection U6-sgRNA-ApoE2/U6-sgRNA-LDLR2 after result；APOE-e2 represents the sudden change of ApoE gene
Result；LDLR-e2-1 Yu LDLR-e2-2 represents transfection U6-sgRNA-LDLR1 Yu U6-sgRNA-LDLR2LDLR gene respectively
Catastrophe；"+" represents inserts；" △ " represents deletion；" wt " represents wild type；" # " is clone's numbering.
Detailed description of the invention
Being further described in detail the present invention below in conjunction with detailed description of the invention, the embodiment be given is only for explaining
The bright present invention rather than in order to limit the scope of the present invention.
Experimental technique in following embodiment, if no special instructions, is conventional method.
Material used in following embodiment, reagent etc., if no special instructions, the most commercially obtain.
Porcine fetus fibroblasts (porcine embryonic fibroblast, PEF) in following embodiment according to
Prepared by following method: by Ba-Ma mini pig 37 day Embryos, removes the head of fetus, tail, extremity, internal organs and bone, and by blood
Clean out.Persistently shear fetus 30min with elbow eye scissors to ensure fully to shred, the indigo plant of fetal tissue's haircut that will shred
Rifle head is drawn in 15mL centrifuge tube, adds the full culture medium of 5mL, removes solution above after natural subsidence several minutes, and in lower floor
Piece of tissue adds several FBS, the 15cm glass Pasteur's pipe sucking-off bent with most advanced and sophisticated 1cm place, it is laid in two T75 culture bottles
In, place upward at the bottom of bottle, and add the full culture fluid of 15mL at offside, after 6-8h, be carefully turned over culture bottle, piece of tissue is immersed
In culture fluid, within every two days, change a not good liquor, frozen standby after cell covers with T75 culture bottle.Wherein, Ba-Ma mini pig is China's agriculture
The pig that pig farm, base, animal and veterinary institute Tianjin, industry academy of science Beijing is raised.
Embodiment 1, the rite-directed mutagenesis of ApoE gene
Specific recognition pig ApoE gene gRNA (by its named ApoE-gRNA) that the present embodiment is provided is held to 3 ' from 5 '
End is followed successively by: (with the sequence of ApoE gene target sequence specific bond, ApoE gene target sequence is sequence in sequence table to the base of 19nt
Row 1), the hairpin structure (being responsible for guiding Cas9 nuclease that DNA is cut with Cas9 protein binding) of a long 42nt, 3 ' ends
The transcription terminator of one long 40nt.The sequence of ApoE-gRNA is that the T in sequence in sequence table 2 is replaced with the sequence that U obtains
Row, ApoE-gRNA is encoded by the DNA molecular shown in sequence in sequence table 2.Under the guiding function of ripe ApoE-gRNA
Cas9 is attached to ApoE gene, and cuts it, introduces double-strand break (DSB), and radiation-indued DNA damage reparation, at target site
Neighbouring introducing is suddenlyd change, and manufactures multiple ApoE gene mutation body.
One, expression vector establishment
Skeleton carrier used be pGL3-U6-sgRNA-PGK-puromycin (addgene product, article No. is #51133, with
Lower abbreviation U6-sgRNA), the concrete building process of gRNA expression vector is as follows:
1, prepared by skeleton carrier
U6-sgRNA skeleton carrier enzyme action reclaims: 50 μ l enzyme action systems are as follows: 10 μ g U6-sgRNA, 5 μ l BbsI
(NEB), 5 μ l cutsmart buffer (NEB), ddH2O mends to 50 μ l.
2, oligonucleotide dimer is formed and dephosphorylation
Reaction system is as follows:
The primer sequence of ApoE-e2-F with ApoE-e2-R is as shown in table 1.
Table 1, ApoE-gRNA build primer sequence
| Title | Sequence (5 '-3 ') |
| ApoE-e2-F | ACCGgaggtgcacgtgtggtggg |
| ApoE-e2-R | AAACcccaccacacgtgcacctc |
Mixing above-mentioned system, use PCR instrument to carry out annealing reaction, program is as follows:
3, the preparation of U6-sgRNA-ApoE2
The skeleton carrier that oligonucleotide dimer and the step 1 step 2 obtained obtains is attached, and 16 DEG C connect 1h,
Obtain recombinant vector.Concrete reaction system is as follows: the skeleton carrier that 50ng step 1 obtains, the oligonucleotide dimerization that step 2 obtains
Body (1:200 dilution), 1 μ l 10 × T4Ligase Buffer (TKARA), 1 μ l T4Ligase (TKARA), ddH2O mends to 11 μ
l。
Product will be connected and convert escherichia coli, and sequence verification will obtain the restructuring load of the correct expression ApoE-gRNA of sequence
Body, by its named U6-sgRNA-ApoE2.
Two, transfection porcine fetus fibroblasts and checking
Experiment in triplicate, repeats specifically comprising the following steps that of experiment every time
Use U6-sgRNA-ApoE2 and the Cas9 expression vector (Addgene that step one is obtained by the method for consideration convey dye
Product, article No. is #44758) each 5 μ g transfection porcine fetus fibroblastses (about 1 × 106Individual), consideration convey contaminates in strict accordance with test kit
Transfection instrument (Amaxa company) the description operation of (Catalog Number:VPI-1002, Lonza) and nucleus, selects T-016
Program.48h after consideration convey dye, utilizes cell/tissue genome DNA extracting reagent kit (bioteke, DP1901) to extract cytogene
Group DNA.
With the DNA of said extracted as template, amplification comprises the ApoE gene of ApoE-gRNA binding site, and amplimer is such as
Following table, reclaims about 698bp PCR primer.Amplification condition is as follows: 98 DEG C of 3min of denaturation, 98 DEG C of 10s, 63 DEG C of 15s, 72 DEG C of 40s,
Circulate 33 72 DEG C of 5min to re-extend.
Table 2, ApoE amplimer
| Title | Sequence (5 '-3 ') |
| ApoE-F | GCAGGGCGTGAGCATTAGAT |
| ApoE-R | AGGACGGCAAGACTGACCCA |
Checking order PCR primer, sequencing result as it is shown in figure 1, start appearance in cas9 nuclease cleavage site downstream
Set peak, it was demonstrated that pig ApoE gene is successfully cut by cas9 nuclease.Figure combines for ApoE-gRNA shown in black box
Position, set peak shows that there is multiple base type in this site.
Three, clonality and clonal mutation type analysis
Experiment in triplicate, repeats specifically comprising the following steps that of experiment every time
Use U6-sgRNA-ApoE2 and the Cas9 expression vector (Addgene that step one is obtained by the method for consideration convey dye
Product, article No. is #44758) each 5 μ g transfection porcine fetus fibroblastses (about 1 × 106Individual), consideration convey contaminates in strict accordance with test kit
Operate with consideration convey instrument description, select T-016 program.24h after consideration convey dye, adds 1 μ g/mL puromycin and processes, use after 36h
0.1% trypsinization, collects cell, is inoculated in 3 100mm Tissue Culture Dishs (1 × 104Individual/ware), Tissue Culture Dish contains
There is DMEM culture medium (Thermo Fisher Scientific), cultivate 15 days and formed to monoclonal, within every two days, change fresh training
Support base.Picking monoclonal cell, extracts monoclonal genome, amplification ApoE gene check order (the same step 2 of PCR amplification condition).
The monoclonal of picking is done mutation type analysis, single base insertion, many bases occur near cas9 cleavage site
Insert, single base is deleted and many bases delete four kinds of mutation types (Fig. 2).Figure Green short-term signal ApoE-gRNA identifies sequence
Being listed in the position in ApoE gene, red short-term signal PAM sequence, alignment's figure shows detailed mutation type situation, its
Middle first trip sequence is wild type ApoE gene order.
Table 3, averagely knock out efficiency
Result shows, the ApoE-gRNA energy efficient identification pig ApoE gene Second Exon of the present invention, in CAS9 enzyme effect
Lower realization is accurately cut, and result (table 3) shows, CAS9/U6-sgRNA-ApoE2 system is to the pig average editorial efficiency of ApoE gene
Being 86%, (i.e. ApoE gene on two chromosomes of pig cell is all edited that (genotype is APOE-/-) monoclonal account for total Dan Ke
The ratio of grand number and the ApoE gene on item chromosome are edited, and (genotype is APOE-/+) monoclonal account for total monoclonal number
Ratio sum), wherein, average monoallelic editorial efficiency is 72% (i.e. in pig cell only on item chromosome
ApoE gene is edited, and (genotype is APOE-/+) monoclonal account for the ratio of total monoclonal number), average diallele (gene
Type is APOE-/-) editorial efficiency is the 14% (monoclonal that i.e. the ApoE gene on two chromosomes in pig cell is all edited
Account for the ratio of total monoclonal number).Manufactured substantial amounts of gene mutation type, for the later stage to the sudden change of pig ApoE gene and merit simultaneously
Can analyze and provide experiment basis.
Embodiment 2, the rite-directed mutagenesis of LDLR gene
The present embodiment provide the gRNA, respectively LDLR1-gRNA of two specific recognition pig LDLR genes with
LDLR2-gRNA, LDLR1-gRNA and LDLR2-gRNA are all followed successively by 3 ' ends from 5 ' ends: the base of 19nt or 20nt is (with LDLR
The sequence of gene target sequence specific bond, LDLR1-gRNA target sequence in LDLR gene is sequence 3, LDLR2-in sequence table
GRNA target sequence in LDLR gene is sequence 4 in sequence table), the hairpin structure of a long 42nt (is responsible for and Cas9 albumen
In conjunction with guiding Cas9 nuclease, DNA is cut), the transcription terminator of 3 ' one long 40nt of end.The sequence of LDLR1-gRNA
For the T in sequence in sequence table 5 is replaced with the sequence that U obtains, LDLR1-gRNA is divided by the DNA shown in sequence in sequence table 5
Son coding；The sequence of LDLR2-gRNA is that the T in sequence in sequence table 6 is replaced with the sequence that U obtains, and LDLR2-gRNA is by sequence
DNA molecular coding shown in sequence 6 in list.Cas9 knot under the guiding function of ripe LDLR1-gRNA or LDLR2-gRNA
Close LDLR gene, and it is cut, introduce double-strand break (DSB), radiation-indued DNA damage reparation, draw near target site
Enter sudden change, manufacture multiple LDLR gene mutation body.
One, expression vector establishment
Skeleton carrier used be pGL3-U6-sgRNA-PGK-puromycin (addgene product, article No. is #51133, with
Lower abbreviation U6-sgRNA), the concrete building process of gRNA expression vector is as follows:
1, prepared by skeleton carrier
With in embodiment 1 step one 1.
2, oligonucleotide dimer is formed and dephosphorylation
According to the method for 2 in embodiment 1 step one, ApoE-e2-F Yu ApoE-e2-R is replaced with LDLR-e2-1-F with
LDLR-e2-1-R, other steps are the most constant, obtain LDLR1 oligonucleotide dimer.
According to the method for 2 in embodiment 1 step one, ApoE-e2-F Yu ApoE-e2-R is replaced with LDLR-e2-2-F with
LDLR-e2-2-R, other steps are the most constant, obtain LDLR2 oligonucleotide dimer.
LDLR-e2-1-F with LDLR-e2-1-R, LDLR-e2-2-F with LDLR-e2-2-R sequence as shown in table 4.
Table 4, gRNA build primer sequence
| Title | Sequence (5 '-3 ') |
| LDLR-e2-1-F | ACCGGAAATGCATCTCCTACAAG |
| LDLR-e2-1-R | AAACCTTGTAGGAGATGCATTTC |
| LDLR-e2-2-F | ACCGGCACGTCTCCAGGGACTCAT |
| LDLR-e2-2-R | AAACATGAGTCCCTGGAGACGTGC |
3, the preparation of U6-sgRNA-LDLR1 Yu U6-sgRNA-LDLR2
The skeleton carrier that LDLR1 oligonucleotide dimer and the step 1 step 2 obtained obtains is attached, 16 DEG C of companies
Meet 1h, obtain recombinant vector.Concrete reaction system is as follows: the skeleton carrier that 50ng step 1 obtains, and the LDLR1 that step 2 obtains is few
Nucleotide dimer (1:200 dilution), 1 μ l 10 × T4Ligase Buffer (TKARA), 1 μ l T4Ligase (TKARA),
ddH2O mends to 11 μ l.Product will be connected and convert escherichia coli, and sequence verification will obtain the correct expression LDLR1-gRNA's of sequence
Recombinant vector, by its named U6-sgRNA-LDLR1.
The skeleton carrier that LDLR2 oligonucleotide dimer and the step 1 step 2 obtained obtains is attached, 16 DEG C of companies
Meet 1h, obtain recombinant vector.Concrete reaction system is as follows: the skeleton carrier that 50ng step 1 obtains, and the LDLR2 that step 2 obtains is few
Nucleotide dimer (1:200 dilution), 1 μ l 10 × T4Ligase Buffer (TKARA), 1 μ l T4Ligase (TKARA),
ddH2O mends to 11 μ l.Product will be connected and convert escherichia coli, and sequence verification will obtain the correct expression LDLR1-gRNA's of sequence
Recombinant vector, by its named U6-sgRNA-LDLR2.
Two, transfection porcine fetus fibroblasts and checking
Experiment in triplicate, repeats specifically comprising the following steps that of experiment every time
U6-sgRNA-LDLR1 and Cas9 that step one is obtained by the method contaminated according to the consideration convey in embodiment 1 step 2
The each 5 μ g of expression vector (Addgene product, article No. is #44758) transfect porcine fetus fibroblasts (about 1 × 106Individual).Consideration convey
48h after dye, utilizes cell/tissue genome DNA extracting reagent kit to extract cell genomic dna.
With the DNA of said extracted as template, amplification comprises the LDLR gene of LDLR1-gRNA binding site, and amplimer is such as
Table 5 below, reclaims about 850bp PCR primer.Amplification condition is as follows: 98 DEG C of 3min of denaturation, 98 DEG C of 10s, 63 DEG C of 15s, 72 DEG C
40s, circulates 33 72 DEG C of 5min and re-extends.
Table 5, LDLR amplimer
U6-sgRNA-LDLR2 and Cas9 that step one is obtained by the method contaminated according to the consideration convey in embodiment 1 step 2
The each 5 μ g of expression vector (Addgene product, article No. is #44758) transfect porcine fetus fibroblasts (about 1 × 106Individual).Consideration convey
48h after dye, utilizes cell/tissue genome DNA extracting reagent kit to extract cell genomic dna.Utilize LDLR-F and LDLR-R
Carrying out PCR amplification, amplification condition is ibid.
Sequencing result such as Fig. 3 shows, transfection U6-sgRNA-LDLR1 starts appearance in cas9 nuclease cleavage site downstream
Set peak (A in Fig. 3), it was demonstrated that pig LDLR gene is cut by this Success in Experiment.GRNA binding site and PAM sequence such as scheme institute
Showing, set peak shows that there is multiple base type in this site.Wherein U6-sgRNA-LDLR2 set peak is the most visible, B in Fig. 3.
Reclaim above-mentioned PCR primer, connect with PMD-18T carrier (precious biological engineering (Dalian) company limited, D101A) respectively
Rear conversion escherichia coli, often group 40 clones of picking check order, and calculate mutation efficiency according to positive colony number, transfect U6-
The average mutation rate of sgRNA-LDLR1 is 26.7%, and the average mutation rate of transfection U6-sgRNA-LDLR2 is 9.7%.
Three, clonality and clonal mutation type analysis
Experiment in triplicate, repeats specifically comprising the following steps that of experiment every time
U6-sgRNA-LDLR1 or U6-that step one is obtained by the method contaminated according to the consideration convey in embodiment 1 step 2
SgRNA-LDLR2 Yu Cas9 expression vector transfection porcine fetus fibroblasts, 24h after consideration convey dye, add 1 μ g/mL puromycin
Process, after 36h, use 0.1% trypsinization, collection cell, it is inoculated in 3 100mm Tissue Culture Dishs (1 × 104Individual/ware), carefully
Containing DMEM culture medium (Thermo Fisher Scientific) in born of the same parents' culture dish, cultivate 15 days and formed to monoclonal, every two
It changes fresh culture.Picking monoclonal cell, extracts monoclonal genome, and amplification ApoE gene also checks order that (PCR expands bar
The same step 2 of part).
The monoclonal of picking is done mutation type analysis (Fig. 4), occur near cas9 cleavage site single base insert, many
Base is inserted, single base is deleted and many bases delete four kinds of mutation types.The identification sequence of underscore signal gRNA or gRNA in figure
Being listed in the position in LDLR gene, alignment's figure shows detailed mutation type situation, and wherein first trip sequence is wild type
LDLR gene order.
Table 6, averagely knock out efficiency
| Title | Monoallelic knocks out efficiency | Diallele knocks out efficiency | Knock out efficiency to amount to |
| LDLR1 | 19% | 31% | 50% |
| LDLR2 | 32% | 14% | 46% |
Result shows, LDLR1-gRNA Yu LDLR2-gRNA of the present invention all can show outside efficient identification pig LDLR gene second
Son, realizes accurately cutting under CAS9 enzyme effect, and wherein pig LDLR gene is averagely edited by CAS9/U6-sgRNA-LDLR1 system
Efficiency be 50% (monoclonal that i.e. the LDLR gene on two chromosomes of pig cell is all edited account for the ratio of total monoclonal number with
The monoclonal that LDLR gene on item chromosome is edited accounts for the ratio sum of total monoclonal number), wherein, average single equipotential base
Because editorial efficiency is 19%, (monoclonal that i.e. in pig cell, only the LDLR gene on item chromosome is edited accounts for total monoclonal
(genotype is LDLR to the ratio of number-/+)), average diallele editorial efficiency is 31% (i.e. two chromosomes in pig cell
On the monoclonal all edited of LDLR gene account for the ratio of total monoclonal number (genotype be LDLR-/-))；CAS9/U6-
SgRNA-LDLR2 system is 46% (i.e. LDLR gene on two chromosomes of pig cell to the pig average editorial efficiency of LDLR gene
The monoclonal all edited accounts for the monoclonal that the ratio of total monoclonal number and the LDLR gene on item chromosome edited and accounts for always
The ratio sum of monoclonal number), wherein, average monoallelic editorial efficiency is a 32% (i.e. only dyeing in pig cell
The monoclonal that LDLR gene on body is edited accounts for the ratio of total monoclonal number), average diallele editorial efficiency is 14%
The ratio of total monoclonal number (monoclonal that i.e. the LDLR gene on two chromosomes in pig cell is all edited account for).Make simultaneously
Make substantial amounts of gene mutation type, for the later stage, sudden change and the functional analysis of pig LDLR gene are provided experiment basis.
Embodiment 3, ApoE gene and the rite-directed mutagenesis of LDLR gene
The present embodiment utilizes the ApoE-gRNA of embodiment 1 LDLR1-gRNA or LDLR2-gRNA with embodiment 2 to ApoE
Gene and LDLR gene carry out rite-directed mutagenesis simultaneously.Experiment in triplicate, repeats specifically comprising the following steps that of experiment every time
One, transfection porcine fetus fibroblasts and checking
Use the method for consideration convey dye by the U6-sgRNA-of the U6-sgRNA-ApoE2 (2.5 μ g) of embodiment 1 Yu embodiment 2
LDLR1 (2.5 μ g) mixing after respectively with 5 μ g Cas9 expression vectors (Addgene product, article No. is #44758) cotransfection pig tire
Youngster fibroblast (about 1 × 106Individual), consideration convey dye operates in strict accordance with test kit and consideration convey instrument description, selects T-016 journey
Sequence.48h after consideration convey dye, utilizes cell/tissue genome DNA extracting reagent kit (bioteke, DP1901) to extract cytogene
Group, the named genome of genome 1 that will obtain.
According to the method described above, U6-sgRNA-LDLR1 being replaced with U6-sgRNA-LDLR2, other steps are constant, obtain thin
Born of the same parents' genome, the named genome of genome 2 that will obtain.
Utilize LDLR-F Yu LDLR-R of ApoE-F Yu ApoE-R of embodiment 1 and embodiment 2 respectively to genome 1 with
Genome 2 carries out PCR amplification, and condition is with embodiment 1 and embodiment 2.It is separately recovered about 698bp and 850bp PCR primer to carry out
Order-checking.
Sequencing result such as Fig. 5 shows, U6-sgRNA-ApoE2/U6-sgRNA-LDLR1 is at cas9 nuclease cleavage in transfection
Point downstream, all there is set peak (A and B in Fig. 5) in APOE gene and LDLR gene, it was demonstrated that this Success in Experiment to pig APOE gene with
LDLR gene carries out fixed point cutting, and gRNA binding site and PAM sequence are as it can be seen, set peak shows that there is multiple base class in this site
Type.In transfection U6-sgRNA-ApoE2/U6-sgRNA-LDLR2, the set peak of LDLR gene is the most visible, C and D in Fig. 5.
Two, clonality and clonal mutation type analysis
Use the method for consideration convey dye by the U6-sgRNA-of the U6-sgRNA-ApoE2 (2.5 μ g) of embodiment 1 Yu embodiment 2
LDLR1 (2.5 μ g) mixing after respectively with 5 μ g Cas9 expression vectors (Addgene product, article No. is #44758) cotransfection pig tire
Youngster fibroblast, consideration convey dye operates in strict accordance with test kit and consideration convey instrument description, selects T-016 program.After consideration convey dye
24h, adds 1 μ g/mL puromycin and processes, use 0.1% trypsinization after 36h, collect cell, collect cell, be inoculated into 3
In 100mm Tissue Culture Dish (1 × 104Individual/ware), containing DMEM culture medium (Thermo Fisher in Tissue Culture Dish
Scientific), cultivate 15 days and formed to monoclonal, within every two days, change fresh culture.Picking monoclonal cell, extracts Dan Ke
Grand genome, utilizes ApoE-F Yu ApoE-R of embodiment 1 and LDLR-F Yu LDLR-R of embodiment 2 to carry out PCR amplification, bar
Part is with embodiment 1 and embodiment 2.
According to the method described above, U6-sgRNA-LDLR1 being replaced with U6-sgRNA-LDLR2, other are the most constant, to transfection
The monoclonal cell obtained detects.
The monoclonal of picking is done mutation type analysis (Fig. 6), occur near cas9 cleavage site single base insert, many
Base is inserted, single base is deleted and many bases delete four kinds of mutation types.In figure underscore signal gRNA sequence at APOE and
Position in LDLR gene, alignment's figure shows detailed mutation type situation, and wherein first trip sequence is that corresponding gene is wild
Type sequence.
Result shows, gRNA of the present invention energy efficient identification pig APOE and LDLR gene Second Exon simultaneously,
Realizing accurately cutting under CAS9 enzyme effect, wherein CAS9/U6-sgRNA-ApoE2/U6-sgRNA-LDLR1 system is to pig APOE/
It is 31% (i.e. on two chromosomes of pig cell that two genes of LDLR complete the diallele editorial efficiency of editor simultaneously
(genotype is APOE to the efficiency that APOE gene is all edited to and LDLR gene on two chromosomes is all edited-/-/
LDLR-/-))；CAS9/U6-sgRNA-ApoE2/U6-sgRNA-LDLR2 system is to pig APOE/LDLR gene the most double equipotential base
Because editorial efficiency is that 14% (genotype is APOE-/-/LDLR-/-).Obtain the LDLR gene carrying various mutations type simultaneously
The cell all suddenlyd change with APOE gene, provides experiment for the later stage to sudden change and the functional analysis of pig APOE gene/LDLR gene
Basis.
Claims (10)
1. rite-directed mutagenesis ApoE gene and the method for LDLR gene, carry out rite-directed mutagenesis for employing CRISPR/Cas9 method, and it is special
Levy and be: the ApoE gene target sequence used in described CRISPR/Cas9 method is following A1), A2) or A3):
A1) nucleotide sequence of sequence 1 in sequence table；
A2) DNA sequence and A1) limited have 75% or more than 75% homogeneity by A1) derivative DNA sequence；
A3) under strict conditions with A1) limit DNA sequence hybridization by A1) derivative DNA sequence；
The LDLR gene target sequence used in described CRISPR/Cas9 method is target sequence 1 or target sequence 2, and described target sequence 1 is
Following B1), B2) or B3):
B1) nucleotide sequence of sequence 3 in sequence table；
B2) DNA sequence and B1) limited have 75% or more than 75% homogeneity by B1) derivative DNA sequence；
B3) under strict conditions with B1) limit DNA sequence hybridization by B1) derivative DNA sequence；
Described target sequence 2 is following C1), C2) or C3):
C1) nucleotide sequence of sequence 4 in sequence table；
C2) DNA sequence and C1) limited have 75% or more than 75% homogeneity by C1) derivative DNA sequence；
C3) under strict conditions with C1) limit DNA sequence hybridization by C1) derivative DNA sequence.
Method the most according to claim 1, it is characterised in that: described rite-directed mutagenesis ApoE gene and the side of LDLR gene
Method, including importing the encoding gene of gRNA of targeting ApoE gene target sequence, targeting LDLR gene target in receptor cell
The encoding gene of the gRNA of sequence and the encoding gene of Cas9, obtain ApoE gene thin by the animal of rite-directed mutagenesis with LDLR gene
Born of the same parents.
Method the most according to claim 2, it is characterised in that: the coding base of the gRNA of described targeting ApoE gene target sequence
Because importing in described receptor cell by expression vector 1, described expression vector 1 is containing described targeting ApoE gene target sequence
The expression vector of the expression cassette of the encoding gene of the gRNA of row；
The encoding gene of the gRNA of described targeting LDLR gene target sequence imports described receptor cell by expression vector 3
In, described expression vector 3 is that the expression of the expression cassette of the encoding gene of the gRNA containing described targeting LDLR gene target sequence carries
Body；
The encoding gene of described Cas9 imports in described receptor cell by expression vector 2, and described expression vector 2 is for containing
The expression vector of the expression cassette of the encoding gene of described Cas9.
The most according to the method in claim 2 or 3, it is characterised in that: the sequence of the gRNA of described targeting ApoE gene target sequence
It is classified as and the T in sequence in sequence table 2 is replaced with the sequence that U obtains；The coding of the gRNA of described targeting ApoE gene target sequence
Gene is the DNA molecular shown in sequence 2 in sequence table；The sequence of the gRNA of described targeting LDLR gene target sequence is by sequence table
T in middle sequence 5 or sequence 6 replaces with the sequence that U obtains；The encoding gene of the gRNA of described targeting LDLR gene target sequence is
Sequence 5 or the DNA molecular shown in sequence 6 in sequence table.
5. according to described method arbitrary in claim 1-4, it is characterised in that: described receptor cell be following H1 or
H2:
H1, mammalian cell；
H2, pig cell.
The most following arbitrary product:
P1, complete RNA, by the gRNA and described targeting LDLR of described targeting ApoE gene target sequence arbitrary in claim 1-3
The gRNA composition of gene target sequence；
P2, complete gene, by encoding gene and the institute of the gRNA of described targeting ApoE gene target sequence arbitrary in claim 1-3
State the encoding gene composition of the gRNA of targeting LDLR gene target sequence；
P3, encoding gene and the described targeting of gRNA containing described targeting ApoE gene target sequence arbitrary in claim 1-3
The expression cassette of the encoding gene of the gRNA of LDLR gene target sequence；
P4, complete expression cassette, by the coding base of the gRNA containing described targeting ApoE gene target sequence arbitrary in claim 1-3
The expression cassette of cause and the expression cassette group of the encoding gene of the gRNA of arbitrary described targeting LDLR gene target sequence in claim 1-3
Become；
P5, encoding gene and the described targeting of gRNA containing described targeting ApoE gene target sequence arbitrary in claim 1-3
The recombinant vector of the encoding gene of the gRNA of LDLR gene target sequence；
P6, recombinant vector containing expression cassette described in P3；
P7, recombinant vector containing expression cassette complete described in P4；
P8, complete carrier, by the encoding gene of the gRNA containing described targeting ApoE gene target sequence arbitrary in claim 1-3
Recombinant vector and claim 1-3 in the recombinant vector of encoding gene of gRNA of arbitrary described targeting LDLR gene target sequence
Composition；
P9, complete target sequence, be made up of with described LDLR gene target sequence ApoE gene target sequence described in claim 1.
7. rite-directed mutagenesis ApoE gene and the reagent set of LDLR gene, it is characterised in that: described reagent set includes that right is wanted
Ask product described in 6 and the composition of any one in following M1-M3；
The encoding gene of M1, Cas9；
M2, the expression cassette of encoding gene containing Cas9；
M3, the expression vector of encoding gene containing Cas9.
The most following arbitrary application:
The application in rite-directed mutagenesis ApoE gene with LDLR gene of the product described in X1, claim 6；
The application in rite-directed mutagenesis ApoE gene with LDLR gene of the reagent set described in X2, claim 7.
The application in preparing ApoE gene and LDLR site-directed point mutation animal model of the product described in X3, claim 6；
The application in preparing ApoE gene and LDLR site-directed point mutation animal model of the reagent set described in X4, claim 7.
Application the most according to claim 8, it is characterised in that: described animal is mammal.
Application the most according to claim 9, it is characterised in that: described mammal is pig.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610756699.3A CN106244557B (en) | 2016-08-29 | 2016-08-29 | The method of rite-directed mutagenesis ApoE gene and LDLR gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610756699.3A CN106244557B (en) | 2016-08-29 | 2016-08-29 | The method of rite-directed mutagenesis ApoE gene and LDLR gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106244557A true CN106244557A (en) | 2016-12-21 |
| CN106244557B CN106244557B (en) | 2019-10-25 |
Family
ID=57596690
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610756699.3A Active CN106244557B (en) | 2016-08-29 | 2016-08-29 | The method of rite-directed mutagenesis ApoE gene and LDLR gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106244557B (en) |
Cited By (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106987604A (en) * | 2017-03-29 | 2017-07-28 | 北京希诺谷生物科技有限公司 | A kind of method for preparing atherosclerosis disease model dog |
| CN107937345A (en) * | 2017-11-16 | 2018-04-20 | 山东蓝思种业股份有限公司 | A kind of fibroblastic method of pig for preparing while knocking out CD163 genes and CD13 genes |
| CN110178792A (en) * | 2019-05-07 | 2019-08-30 | 哈尔滨医科大学 | A kind of construction method of atherosclerosis vulnerable plaque mouse model |
| CN112813063A (en) * | 2019-11-15 | 2021-05-18 | 中国科学院分子细胞科学卓越创新中心 | Construction of animal model for lipid metabolism disorder and repair by AAV-CRISPR/CAS9 |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| GB2572918B (en) * | 2016-12-23 | 2023-02-15 | Harvard College | Gene editing of PCSK9 |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| CN116790604A (en) * | 2023-08-18 | 2023-09-22 | 成都中科奥格生物科技有限公司 | sgRNA and CRISPR/Cas9 vector as well as construction method and application thereof |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103388006A (en) * | 2013-07-26 | 2013-11-13 | 华东师范大学 | Method for constructing gene site-directed mutation |
-
2016
- 2016-08-29 CN CN201610756699.3A patent/CN106244557B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103388006A (en) * | 2013-07-26 | 2013-11-13 | 华东师范大学 | Method for constructing gene site-directed mutation |
Non-Patent Citations (3)
| Title |
|---|
| YANG等: "Effective gene targeting in rabbits using RNA-guided Cas9 nucleases", 《JOURNAL OF MOLECULAR CELL BIOLOGY》 * |
| 房文宁等: "apoE基因对大白猪和长白猪产仔数的影响研究", 《遗传育种》 * |
| 蒋越等: "遗传与营养因素对猪LDLR 与SCD 基因表达的影响", 《上海交通大学学报》 * |
Cited By (22)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| GB2572918B (en) * | 2016-12-23 | 2023-02-15 | Harvard College | Gene editing of PCSK9 |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| CN106987604B (en) * | 2017-03-29 | 2021-05-28 | 北京希诺谷生物科技有限公司 | Method for preparing atherosclerosis disease model dog |
| CN106987604A (en) * | 2017-03-29 | 2017-07-28 | 北京希诺谷生物科技有限公司 | A kind of method for preparing atherosclerosis disease model dog |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| CN107937345B (en) * | 2017-11-16 | 2019-01-29 | 山东蓝思种业股份有限公司 | A kind of fibroblastic method of pig for preparing while knocking out CD163 gene and CD13 gene |
| CN107937345A (en) * | 2017-11-16 | 2018-04-20 | 山东蓝思种业股份有限公司 | A kind of fibroblastic method of pig for preparing while knocking out CD163 genes and CD13 genes |
| US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| CN110178792A (en) * | 2019-05-07 | 2019-08-30 | 哈尔滨医科大学 | A kind of construction method of atherosclerosis vulnerable plaque mouse model |
| CN112813063A (en) * | 2019-11-15 | 2021-05-18 | 中国科学院分子细胞科学卓越创新中心 | Construction of animal model for lipid metabolism disorder and repair by AAV-CRISPR/CAS9 |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| CN116790604A (en) * | 2023-08-18 | 2023-09-22 | 成都中科奥格生物科技有限公司 | sgRNA and CRISPR/Cas9 vector as well as construction method and application thereof |
| CN116790604B (en) * | 2023-08-18 | 2023-10-27 | 成都中科奥格生物科技有限公司 | sgRNA and CRISPR/Cas9 vector as well as construction method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106244557B (en) | 2019-10-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106244557B (en) | The method of rite-directed mutagenesis ApoE gene and LDLR gene | |
| US20230189769A1 (en) | Process for using crispr to transfect primordial germ cells in avians | |
| CN105907758B (en) | CRISPR-Cas9 guide sequence and primer thereof, transgenic expression vector and construction method thereof | |
| CN105039339B (en) | A kind of method of specific knockdown sheep FecB genes with RNA mediations and its special sgRNA | |
| CN108707629A (en) | The preparation method of zebra fish notch1b gene mutation bodies | |
| Zhou et al. | Programmable base editing of the sheep genome revealed no genome-wide off-target mutations | |
| CN106191113A (en) | A kind of preparation method of MC3R gene knock-out pig | |
| CN106414740A (en) | Method for specific knockout of swine SLA-3 gene using CRISPR-Cas9 specificity, and sgRNA used for specifically targeting sla-3 gene | |
| CN106282231B (en) | Construction method and application of mucopolysaccharide storage disease type II animal model | |
| CN108285906A (en) | A kind of construction method of site-directed integration exogenous DNA transgene pig | |
| CN106119284A (en) | A kind of product for building immunodeficient animals model and application thereof | |
| CN106282230B (en) | The method of rite-directed mutagenesis LDLR gene | |
| CN107354170A (en) | A kind of gene knockout carrier and the fibroblastic method of preparation CD163 gene knock-out pigs | |
| CN109234278B (en) | Kit and method for constructing ApoC2 gene knockout hamster model | |
| CN107365803A (en) | Exempt from the method that drug screening quickly obtains mouse Rosa26 Gene targeting foreign genes | |
| CN108949832A (en) | A kind of targeting vector and its application for knock-out pig GHR gene | |
| CN106148406B (en) | Pig ApoE gene knockout carrier and its construction method and application | |
| CN106244556B (en) | The method of rite-directed mutagenesis ApoE gene | |
| CN116790604B (en) | sgRNA and CRISPR/Cas9 vector as well as construction method and application thereof | |
| CN108018315A (en) | A kind of application of separated gene order in the blue or green Medaka albefaction strain of Japan is prepared | |
| CN109971791A (en) | A kind of candidate stem cell progress modified method of gene of patient poor over the ground | |
| WO2022012512A1 (en) | Grna for knocking out pig xenoantigen gene, and application thereof | |
| CN111088253A (en) | CRISPR (clustered regularly interspaced short palindromic repeats) single-base donor repair system for HBB-28 thalassemia gene | |
| EP4079765A1 (en) | Fusion protein that improves gene editing efficiency and application thereof | |
| CN105132426B (en) | A kind of specific knockdown FGF5 genes with RNA mediations obtain the method for gene editing sheep and its special sgRNA |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20210507 Address after: Building A8, phase I, Nanning ASEAN enterprise headquarters port, No.10, Xinji Road, high tech Zone, Nanning, Guangxi 530000 Patentee after: Nanning zhuangbo Biotechnology Co.,Ltd. Address before: 100193 No. 2 Old Summer Palace West Road, Beijing, Haidian District Patentee before: Beijing Institute of Animal Science and Veterinary Medicine, Chinese Academy of Agricultural Sciences |