CN109055379B

CN109055379B - Preparation method of transgenic chicken oviduct bioreactor

Info

Publication number: CN109055379B
Application number: CN201811054091.1A
Authority: CN
Inventors: 石铭
Original assignee: Individual
Current assignee: Shi Ming
Priority date: 2018-09-10
Filing date: 2018-09-10
Publication date: 2022-04-15
Anticipated expiration: 2038-09-10
Also published as: CN109055379A

Abstract

The invention provides a preparation method of a transgenic chicken oviduct bioreactor, which comprises the following steps: s1, designing gRNA of a targeted chicken genome DNA; s2, constructing an expression vector of the gRNA; s3, constructing a donor vector carrying the exogenous gene expression cassette: the donor vector comprises a homologous repair vector and a non-homologous repair vector; s4, introducing the vector into chicken individuals. The invention improves the accuracy of integrating exogenous genes into a genome by combining a CRISPR gene editing technology, realizes high-efficiency introduction of the exogenous genes, prepares transgenic chickens capable of expressing and secreting exogenous proteins into egg white, and realizes stable inheritance of the exogenous genes to offspring.

Description

Preparation method of transgenic chicken oviduct bioreactor

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a transgenic chicken oviduct bioreactor.

Background

A poultry oviduct bioreactor mainly refers to poultry mainly taking chicken, expresses exogenous protein with medicinal value in oviduct tissues and secretes the exogenous protein into a laid egg and then discharges the protein out of the body. The foreign protein species include various recombinant proteins that are currently on the market, such as insulin, monoclonal antibodies, and the like. The concept of poultry oviduct bioreactor and transgenic poultry gold egg program were proposed by Chinese scientist Zengjie (Zengbang philosophy) as early as 1994, and were linked with transgenic laboratories and developer enterprises in the United states, Canada, Japan, UK, etc. at the first national transgenic academic seminar in 1996, and then communication discussion cooperation research was carried out by American Avigenics corporation and Georgia university R.Ivarie and Zengjie until 1998, the American Avigenics corporation had carried out project and large-scale investment and development, and the American Avigenics corporation first published success in Nature Biotechnology in 2002 and expressed foreign protein in transgenic eggs at an expression level of only 1.34mg/L (clear solution). The Rosslen research institute, UK, also entered the field in 2003 and established a firm with the Sang support project group. Later, companies in the North American area started the related research and development of oviduct bioreactors, such as TranXenoGEN, Viragen, GeneWorks, etc., wherein the GeneWorks established in 1996 obtained 1800 ten thousand dollars of capital investment at that time, but all the research faces the problems that the expression level is low, the reactors cannot be applied, the reactors are far away from industrialization, the most central problem in the field is reflected, and the difficulty in preparing transgenic poultry oviduct bioreactors is huge.

The reproductive mode of poultry is special, after sperms enter the vagina, the oviduct funnel of the poultry is combined with eggs and fertilized, after the sperms stay for more than 2 hours, egg proteins secreted in the oviduct wrap fertilized eggs during the period, then an eggshell membrane is formed at the tubal isthmus, and the total time is up to 18 hours. The fertilized embryos explanted in vitro have developed to the late blastocyst stage, designated stage X, and have developed between 5 and 6 million cells. In which Primordial Germ Cells (PGCs) originate from the central clear area of the stage X mating disc, then enter the blood circulation system as chick embryos develop, and finally enter the gonads and form sperm and eggs. PGCs can be collected and isolated from the blood of the embryo around 11 days after the embryo development, according to the laws of migration of PGCs. PGCs isolated from the donor were injected into the 15 th stage recipient embryo, the donor PGCs successfully entered the recipient gonads and differentiated into germ cells, and the genetic genes of the donor were transmitted to the offspring (Vick L, Li Y, Simkiss K. transgenic bisrs from transformed primordial cells. Proc. R. Soc. Lond B Biol Sci,1993,251: 179. 182.).

Because of the special reproductive characteristics of poultry, single cell microinjection cannot be performed like mammals, the inheritance can only depend on random combination of virus vectors, and the randomness causes the difficulty of high-efficiency specific expression to be increased. On the other hand, studies have focused on the establishment of stem cell lines and on the individual cloning of birds by somatic cells, but the difficulty remains enormous. The two problems are not solved at home and abroad at present, and several methods used for chicken transgenosis still depend on random integration. Recent poultry egg bioreactor research has focused on improving transgene efficiency and screening individuals with high levels of expression. These problems are not solved and the poultry egg reactor cannot be realized.

The main technical bottleneck in the preparation of transgenic poultry oviduct bioreactors is the uncertainty of random integration. The invention combines the latest gene editing technology on the basis of the prior related technology, thereby greatly improving the accuracy of integration and really realizing high-efficiency heritable introduction of foreign genes.

The recent emergence and development of gene editing technology opens up a new way for overcoming the technical bottleneck of transgenic poultry bioreactors, including three types of gene editing technologies, 1, Zinc Finger Nuclease (ZFN), 2, transcription activator-like effector nuclease (TALEN), 3, regularly-spaced short palindromic repeats (CRISPR). Although the three types of gene editing techniques are different in principle and mode of action, they eventually cause Double Strand Breaks (DSBs) in target DNA, thereby activating the repair mechanism of cells. Repair of genomic DNA after fragmentation is carried out intracellularly in two ways, homologous recombination repair (HR) and non-homologous end joining repair (NHEJ). When the same sequences at two ends of the broken DNA exist in the cells, homologous recombination repair can be carried out, and after homologous sequences at two ends of the target DSB are constructed at two ends of the exogenous DNA, the homologous recombination repair can be carried out to insert genome DNA without damage; when no template of the same sequence exists in the cell, the double strand of DNA is repaired by non-homologous end joining, but as a result, the double strand after joining is mutated to a different extent. In addition, there is a microhomology arm mediated end joining (MMEJ), i.e., the length of the homology arm is shorter than the length required for the homology arm in HR.

Among the three gene editing techniques, the CRISPR system is ubiquitous in bacteria and archaea, and is associated with adaptive immunity in bacteria. The CRISPR/Cas system consists of a series of Cas proteins including Cas1, Cas2, Cas4 and effector proteins such as Cas9 and Cpf1, and in the gene cluster composition, in addition to the encoding genes for these proteins, also includes a CRISPR sequence, i.e. a leader sequence and some repeats, and a spacer sequence. When the CRISPR system functions, effector proteins need to bind to the gRNA to form a ribonucleoprotein complex, recognize DNA that complementarily pairs with the gRNA and cleave, resulting in a double-strand break. grnas are generally composed of two components, tracrRNA and crRNA. The 5 'end region of the crRNA can be complementarily matched with the target site, and the 3' end and the tracrRNA are combined with each other to form a special hairpin structure. tracrRNA and crRNA with specific recognition sequence do not exist in eukaryote, are synthesized and transcribed artificially, and form gRNA and Cas9 protein combination to form a complex after being transcribed in eukaryotic cells, the complex firstly recognizes the adjacent motif (PAM) of the original spacer sequence in the process of scanning DNA, when the sequence base at the upstream of PAM is complementarily paired with the 5' end of the gRNA, the Cas9 protein cuts the complementarily paired base pair at a specific site to form DSB, and the base sequence recognized at the upstream of PAM is the target site and is positioned on the target DNA sequence; the sequence complementary thereto is called the spacer sequence and is located in the 5' end region of the crRNA of the gRNA. In CRISPR systems, PAM sequences are important. Different species of Cas9 proteins have different PAM rules. The CRISPR systems currently in use include variants thereof. Different Cas9 proteins are selected, namely different PAM rules are adopted, the target site sequences corresponding to the upstream of PAM are different, and the 5' end base in the gRNA is matched with the target site sequences; two single-stranded DNAs of a gRNA template designed and synthesized in actual application are designed and synthesized according to a target site sequence.

Disclosure of Invention

In order to solve the technical problems, the invention provides a preparation method of a transgenic chicken oviduct bioreactor, and aims to overcome the uncertainty and low efficiency of gene random integration in the preparation process of transgenic chicken and realize exogenous gene specific expression.

The invention provides a preparation method of a transgenic chicken oviduct bioreactor, which comprises the following steps:

s1, designing gRNA of a targeted chicken genome DNA: the selected chicken genome target DNA sequence is an ovalbumin first intron, and gRNAs with homology of more than 90% are selected according to different PAM sequence rules of different Cas9 proteins;

s2, constructing an expression vector of gRNA: after a target site sequence is determined according to a PAM rule, a target site sequence positive and negative DNA single chain which meets the construction requirement of an expression vector is synthesized, the DNA single chain is connected to a CRISPR/Cas system expression vector after being annealed to form a DNA double chain, and the vector can express gRNA and Cas protein after being introduced into cells;

s3, constructing a donor vector carrying the exogenous gene expression cassette: the donor vector comprises a homologous repair vector and a non-homologous repair vector;

s31, constructing the donor vector for homologous repair: using single-stranded DNA as a homologous recombination repair template, wherein the upper and lower homologous sequences are 45bp-90 bp; or double-stranded DNA is used as a homologous recombination repair template, the upstream and downstream sequences of 100bp-1000bp respectively at the DSB position of the target DNA site are respectively connected to the 5 'end and the 3' end of the exogenous gene to be used as homologous arms, and the donor vector can exist in the form of closed-loop plasmid or PCR product or linear DNA;

s32, constructing the donor vector for non-homologous repair: the PAM sequence and the target site sequence form a cutting site frame, the reverse complementary sequence of the cutting site frame is a reverse complementary cutting site frame, one or two reverse complementary cutting site frames exist in a donor vector and exist in the form of closed-loop plasmid or linear DNA;

s4, introducing the vector into chicken individuals: uniformly mixing any gRNA/Cas9 combination prepared in the step S2 and the donor vector prepared in the step S3, injecting the mixture into the subgerminal cavity of the blastoderm in the fertilized egg at the X-stage of development of the chick embryo, and then performing electroporation on the injected chick embryo; or after uniformly mixing any gRNA/Cas9 combination prepared in the step S2 and the donor vector prepared in the step S3, mixing the plasmid mixed liquor and the nucleic acid transfection reagent in proportion, and injecting the mixture into the chicken embryo fertilized eggs in the X stage; and then hatching until hatching.

As a further refinement of the invention, the PAM types include 5'-NNN-3', 5'-NNNN-3', 5'-NNNNN-3', 5'-NNNNNNN-3', 5 '-NNNNNNNNN-3', and 5 '-NNNNNNNNN-3'.

As a further improvement of the present invention, step S2 can also be realized by the following method: constructing on the existing gRNA expression vector: a gRNA expression plasmid is independently constructed, and a promoter and a Cas9 expression plasmid or a Cas9 protein are co-transfected into a target cell by adopting Polll polymerase such as U6, T7 and the like.

As a further improvement of the present invention, the foreign gene expression cassette described in step S3 includes a first intron sequence that complements the ovalbumin gene, a signal peptide sequence that allows secretion of the protein outside the cell, a complete DNA sequence of any desired foreign protein, and a polyA sequence that protects the stability of mRNA.

As a further improvement of the invention, the first intron sequence of the complete ovalbumin gene does not contain the recognition and cutting sites of the selected gRNA any more after the completion.

As a further improvement of the invention, a section of the first intron sequence of the complete ovalbumin gene is a sequence from the cutting site of the selected gRNA to the end of the first intron or forms the complete first intron sequence of the ovalbumin gene together with the sequence at the upstream of the cutting site.

As a further improvement of the invention, the signal peptide sequence is a proto-signal peptide sequence of a target foreign protein, a chicken-derived lysozyme signal peptide, a chicken-derived ovotransferrin signal peptide, a chicken-derived ovomucoglobulin signal peptide or an artificially designed signal peptide.

As a further improvement of the present invention, any desired foreign protein of interest is human serum albumin, interleukin, human coagulation factor, interferon, tumor necrosis factor, colony stimulating factor, growth factor, chemotactic factor, recombinant antibody or other protein molecule.

As a further improvement, the polyA sequence is an original polyA sequence of the egg white protein, an additionally added BGH polyA sequence, an SV40polyA sequence or other polyA sequences.

As a further improvement of the present invention, the step S4 can also be realized by the following method: after uniformly mixing any gRNA/Cas9 combination prepared in the step S2 and the donor vector prepared in the step S3, introducing a reagent into PGC cells separated and purified from chicken embryos through electroporation or nucleic acid transfection, screening PGCs cells with exogenous genes successfully introduced into genomes through medicines, and then injecting the screened PGCs into the blood vessels of the chicken embryos at the 15 th stage.

The invention has the following beneficial effects:

1. by the method, the uncertainty and low efficiency of random gene integration in the preparation process of the chicken oviduct bioreactor are overcome, the specific expression of the exogenous gene is realized, and compared with the traditional preparation method, the method is simpler and more convenient to operate, shorter in period and higher in efficiency;

2. the invention improves the accuracy of integrating exogenous genes into a genome by combining a CRISPR gene editing technology, realizes high-efficiency introduction of the exogenous genes, prepares transgenic chickens capable of expressing and secreting exogenous proteins into egg white, and realizes stable inheritance of the exogenous genes to offspring.

Drawings

FIG. 1 is an electrophoretogram of a PCR product T7Endonuclease I after enzyme digestion in example 1 of the present invention;

FIG. 2 is a schematic structural diagram of a 1cut donor plasmid pBlue-1/cut-ALB and a 2cut donor plasmid pBlue-2/cut-ALB in example 2 of the present invention;

FIG. 3 embryonic development pattern three days after membrane sealing in example 3 of the present invention;

wherein, 1, a cutting site frame in a genome DNA sequence; 2, reverse complement cleavage site box.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention, and it is obvious that the embodiments described are only some representative embodiments of the present invention, rather than all embodiments, and all other embodiments obtained by a person skilled in the art without creative efforts belong to the protection scope of the present invention.

The invention relates to a preparation method of a transgenic chicken oviduct bioreactor, which comprises the following steps:

s1, designing gRNA of a targeted chicken genome DNA: the selected chicken genome target DNA sequence is an ovalbumin first intron, the sequence is shown as SEQ.1, and gRNA with homology of more than 90% is selected according to different PAM sequence rules of different Cas9 proteins;

5'-CTCAAAAGGTAAGCAACTCTCTGGAATTACCTTCTCTCTATATTAGCTCTTACTTGCACCTAAACTTTAAAAAATTAACAATTATTGTGTTATGTGTTGTATCTTTAAGGGTGAAGTACCTGCGTGATACCCCCTATAAAAACTTCTCACCTGTGTATGCATTCTGCACTATTTTATTATGTGTAAAAGCTTTGTGTTTGTTTTCAGGAGGCTTATTCTTTGTGCTTAAAATATGTTTTTAATTTCAGAACATCTTATCCTGTCGTTCACTATCTGATATGCTTTGCAGTTTGCCTGATTAACTTCTAGCCCTACAGAGTGCACAGAGAGCAAAATCATGGTGTTCAGTGAATTCTGGGGAGTTATTTTAATGTGAAAATTCTCTAGAAGTTTAATTCCTGCAAAGTGCAGCTGCTGATCACTACACAAGATAAAAATGTGGGGGGTGCATAAACGTATATTCTTACAATAATAGATACATGTGAACTTGTATACAGAAAAGAAAATGAGAAAAATGTGTGTGCGTATACTCACACACGTGGTCAGTAAAAACTTTTGAGGGGTTTAATACAGAAAATCCAATCCTGAGGCCCCAGCACTCAGTACGCATATAAAGGGCTGGGCTCTGAAGGACTTCTGACTTTCACAGATTATATAAATCTCAGGAAAGCAACTAGATTCATGCTGGCTCCAAAAGCTGTGCTTTATATAAGCACACTGGCTATACAATAGTTGTACAGTTCAGCTCTTTATAATAGAAACAGACAGAACAAGTATAAATCTTCTATTGGTCTATGTCATGAACAAGAATTCATTCAGTGGCTCTGTTTTATAGTAAACATTGCTATTTTATCATGTCTGCATTTCTCTTCTGTCTGAATGTCACCACTAAAATTTAACTCCACAGAAAGTTTATACTACAGTACACATGCATATCTTTGAGCAAAGCAAACCATACCTGAAAGTGCAATAGAGCAGAATATGAATTACATGCGTGTCTTTCTCCTAGACTACATGACCCCATATAAATTACATTCCTTATCTATTCTGCCATCACCAAAACAAAGGTAAAAATACTTTTGAAGATCTACTCATAGCAAGTAGTGTGCAACAAACAGATATTTCTCTACATTTATTTTTAGGGAATAAAAATAAGAAATAAAATAGTCAGCAAGCCTCTGCTTTCTCATATATCTGTCCAAACCTAAAGTTTACTGAAATTTGCTCTTTGAATTTCCAGTTTTGCAAGCCTATCAGATTGTGTTTTAATCAGAGGTACTGAAAAGTATCAATGAATTCTAGCTTTCACTGAACAAAAATATGTAGAGGCAACTGGCTTCTGGGACAGTTTGCTACCCAAAAGACAACTGAATGCAAATACATAAATAGATTTATGAATATGGTTTTGAACATGCACATGAGAGGTGGATATAGCAACAGACACATTACCACAGAATTACTTTAAAACTACTTGTTAACATTTAATTGCCTAAAAACTGCTCGTAATTTACTGTTGTAGCCTACCATAGAGTACCCTGCATGGTACTATGTACAGCATTCCATCCTTACATTTTCACTGTTCTGCTGTTTGCTCTAG-3'

SEQ.1

the CRISPR systems currently applied include variants thereof, PAM types are shown in the table.

(N＝A,T,C or G；W＝A or T；M＝A or C；R＝A or G；V＝G,C or A；Y＝C or T,D＝A,G or T；)

Example 1

When the PAM species is 5'-NNN-3', SpCas9 from Streptococcus pyogenes is commonly used, the PAM rule is 5'-NGG-3', and SpCas9 generates 65 target site sequences in the target DNA sequence, as shown in Table 1.

TABLE 1 target site sequence of SpCas9 in target DNA sequence

In the sequence TGTGCGTATACTCACACACGTGGFor example, whereinTGGIs PAM sequence, and TGTGCGTATACTCACACACG is target site sequence.

(1) The plasmid pX330-U6-Chimeric _ BB-CBh-hSpCas9 is used as a vector (Addge plasmid ID:42230, hereinafter referred to as pX330) and can simultaneously express gRNA and SpCas9 proteins, 1ug of the pX330 plasmid is cut by 1uL BbsI, and after incubation for 1 hour at 37 ℃, a cut fragment is recovered by 1% agarose electrophoresis (QIAquick Gel Extraction Kit recovery Kit), wherein the cut reaction system is as follows:

two oligonucleotides were synthesized according to the selected target site sequence TGTGCGTATACTCACACACG

The rule wherein, when the 5' end of the target site sequence is not a base G, an additional base G is required. In this example, sequences 5'-CACCGTGTGCGTATACTCACACACG-3' and 5'-AAACCGTGTGTGAGTATACGCACAC-3' were synthesized, and two oligonucleotide strands were annealed to form a short double-stranded DNA, as follows:

the reaction system is uniformly mixed in an ep tube, treated in an environment at 37 ℃ for 1 hour, heated at 75 ℃ for 5 minutes, and then placed in a room-temperature environment for cooling.

Mixing the linear pX330 plasmid digested by BbsI and purified and recovered with double-stranded short DNA product with cohesive end, and ligaFast^TMThe Ligation reaction was carried out in Rapid DNA Ligation System (Promega, Cat. No. M8221) and allowed to stand at room temperature for 1 hour in the following reaction System:

and (3) plasmid transformation: the ligation products were mixed with E.coli DH 5. alpha. competent cells (Takara No: D9057A), allowed to stand on ice for 10 minutes, then heat-shocked at 42 ℃ for 90 seconds, further allowed to stand on ice for at least 5 minutes, and then the competent cells were smeared on LB solid medium containing Ampicilin at a concentration of 100ug/ml and incubated overnight at 37 ℃. Single colonies were picked the next day in 2ml of 100ug/ml Ampicilin LB medium. After shaking culture at 250rpm and 37 ℃ for 5 hours, 40ul of the culture broth was aspirated and inoculated into 40ml of 100ug/ml Ampicilin LB medium. Culturing at 250rpm and 37 ℃ overnight with shaking (12h-16 h).

The bacterial solution was collected and centrifuged at 6000g for 5min and the supernatant was discarded. Plasmids were extracted according to the procedures described in the QIAGEN Endofree Plasmid Midi Kit instructions to obtain endotoxin-free plasmids pX 330-gRNA.

The efficiency of the enzyme digestion detection of gRNA by T7E1 is as follows: the obtained UMNSAH/DF-1 cells (ATCC) were purchased^RCRL12203^TM) Recovering, adding DMEM culture solution containing 10% fetal calf serum, and culturing at 39 deg.C under 5% CO₂Subculturing in an incubator. After subculturing for several generations, the cells were digested with 0.25% trypsin, and the cells were harvested at 1X 10⁵Plated in 6-well plates, cultured in 10% FBS DMEM, and the remaining cells were frozen in liquid nitrogen. After DF-1 cells grow to be occupiedWhen the area of the 6-well plate is 70% -90%, 2ug of endotoxin-free pX330-gRNA plasmid is taken and used in opti-MEM (Gibco)^TM31985070) to 100ul, and 5ul lipofectamin2000 (Invitrogen)^TM11668027), diluting to 100ul with opti-MEM, standing at room temperature for 5min, mixing, blowing and sucking, and standing at room temperature for 20 min. The mixed DNA was added to DF-1 cells, and after gentle shaking, the 6-well plate was returned to the 39 ℃ incubator. After 6h, the cell culture medium was changed, and the cells were continuously cultured using fresh 10% FBS DMEM medium.

48h later, removing the culture solution, adding 0.25% pancreatin to digest the cells, stopping the digestion reaction by serum, centrifuging the digestion solution, removing the supernatant and recovering the cells, resuspending the cells by PBS, extracting DF-1 cell genome DNA according to the MagExtractor genome (TOYOBO, NPK-101) instruction, and performing PCR amplification by taking the extracted cell genome DNA as a template, wherein the PCR reaction system is as follows

PCR amplification program, pre-denaturation at 95 ℃ for 1 min; denaturation at 98 ℃ for 10s, annealing at 60 ℃ for 30s, extension at 68 ℃ for 20s, extension at 72 ℃ for 2min after 35 cycles, and finally heat preservation at 4 ℃.

The PCR product was recovered from the kit NucleoSpin Gel and PCR Clean-up (MACHREY-NAGEL), 200ng of the product was digested with T7Endonuclease I (NEB) in the following system:

mixing a reaction system, adding the mixture into a PCR tube, and setting the temperature of a PCR instrument as follows:

95℃ 10min

95℃-85℃ -2℃/second

85℃-25℃ -0.1℃/second

1ul of T7Endonuclease I enzyme is added into the reaction system, and electrophoresis detection is carried out after 1 hour reaction at 37 ℃. The results are shown in FIG. 1.

The efficiency of the gRNA is 32.76% by sequencing identification.

(2) phU6-gRNA plasmid is used as a vector (Addgene plasmid ID:53188) to independently express gRNA. And (3) digesting 1ug of phU6-gRNA by BbsI restriction enzyme, recovering the digested product, mixing with the double-stranded short DNA product synthesized and annealed in the step (1), and carrying out ligation reaction. Then the ligation product is transformed, the plasmid is amplified, and the plasmid is recovered for later use.

Example 2

Human serum albumin gene is used as exogenous gene to construct donor plasmid.

1. Homologous repair donor plasmids were constructed. The exogenous gene expression frame comprises a first intron sequence for complementing the first intron sequence of the ovalbumin gene; human serum albumin ALB gene, original signal peptide is removed, and chicken lysozyme signal peptide is added. A BGH polyA sequence to protect mRNA structure.

(1) Using single-stranded DNA as a homologous recombination repair template, taking upstream 90bp at a genome fracture site as an upstream homology arm and downstream 90bp as a downstream homology arm, taking an antisense strand as a template for artificial synthesis, wherein an operation schematic diagram is shown in the figure, and a specific single-stranded DNA template sequence is shown in SEQ.2;

SEQ.2

(2) double-stranded DNA is used as a homologous recombination repair template, both a circular vector or a linearized vector or a PCR product can be used, 300bp-1000bp of upstream and downstream at a genome fracture site are used as an upstream homology arm and a downstream homology arm, the 1000bp of the upstream and downstream homology arms are selected in the embodiment, pBluescript II KS (+) is used as a vector framework, and primers are designed to be used for amplifying the upstream and downstream homology arms respectively; designing a primer to amplify human serum albumin gene, wherein the upstream primer has a chicken lysozyme signal peptide sequence, and the downstream primer has a 6 × His tag sequence; designing a first intron sequence after a primer amplification cutting site, wherein a downstream primer has a 15bp chicken lysozyme signal peptide homologous sequence; designing a BGH polyA downstream primer; the primers are shown in the following table, the 15bp homologous sequences are underlined; the italics are chicken lysozyme sequence, bolded 6 × His tag sequence. The primer sequences are as follows:

respectively amplifying the homologous upper arm and the homologous lower arm by using primers, and carrying out PCR amplification by using the extracted DF-1 cell genome DNA as a template, wherein a PCR reaction system is as follows

PCR amplification procedure: pre-denaturation at 95 ℃ for 1 min; denaturation at 98 ℃ for 10s, annealing at 60 ℃ for 30s, extension at 68 ℃ for 20s, extension at 72 ℃ for 2min after 35 cycles, and finally heat preservation at 4 ℃. And (3) recovering the homologous upper arm and the homologous lower arm of the PCR product by using a QIAquick Gel Extraction Kit, and sequencing correctly for later use.

Amplifying a first intron sequence after the cutting site by using a primer F-intron1/R-intron1, and performing PCR amplification by using the extracted DF-1 cell genome DNA as a template; the PCR amplification procedure is pre-denaturation at 95 ℃ for 1 min; denaturation at 98 ℃ for 10s, extension at 68 ℃ for 30s, extension at 72 ℃ for 2min after 35 cycles, and final heat preservation at 4 ℃. The PCR product intron1 was recovered using the QIAquick Gel Extraction Kit and sequenced correctly for use.

Amplifying human serum albumin by using a primer F-ssalB/R-ALB, and carrying out PCR amplification by using a purchased ALB plasmid pGEM-ALB (Yinqiao, Cat: HG10968-G) as a template; the PCR amplification procedure is pre-denaturation at 95 ℃ for 1 min; denaturation at 98 ℃ for 10s, annealing at 58 ℃ for 30s, extension at 68 ℃ for 20s, extension at 72 ℃ for 2min after 35 cycles, and finally heat preservation at 4 ℃. And (4) recovering the PCR product ssalB by using a QIAquick Gel Extraction Kit, and sequencing correctly for later use.

The purchased vector pcDNA^TM4/TO(Invitrogen^TMAnd the Catalog number: V102020) is cut by EcoRV enzyme, and the cutting system is as follows:

standing at 37 ℃ for 2 hours, and recovering the enzyme digestion product by using a QIAquick Gel Extraction Kit recovery Kit for later use.

The PCR product ssALB was combined with pcDNA^TM4/TO restriction purification of the product mix using LigaFast^TMThe Rapid DNA Ligation System is used for Ligation reaction, and the reaction System is placed at room temperature for 1 hour as follows:

and then carrying out Plasmid transformation and extracting plasmids, extracting the plasmids according to the operation steps in the instruction book of a QIAGEN Endofree Plasmid Midi Kit to obtain a ligation product pcDNA4-ssaLB, and carrying out enzyme digestion identification and ligation for later use.

Amplifying a human serum albumin expression frame sequence by using a primer F-ssaLB/R-BGH, and performing PCR amplification by using a self-constructed plasmid pcDNA4-ssaLB as a template; the PCR amplification procedure is pre-denaturation at 95 ℃ for 1 min; denaturation at 98 ℃ for 10s, annealing at 60 ℃ for 30s, extension at 68 ℃ for 20s, extension at 72 ℃ for 2min after 35 cycles, and finally heat preservation at 4 ℃. And (3) recovering the PCR product ssalB-BGH by using a QIAquick Gel Extraction Kit, and sequencing correctly for later use.

The vector pBluescript II KS (+) was digested with EcoRV enzyme as follows:

standing at 37 deg.C for 2 hr, and recovering enzyme digestion product with kit NucleoSpin Gel and PCR Clean-up (MACHREY-NAGEL) for use.

Mixing the homologous upper arm, the homologous lower arm and the intron sequence after the cleavage site obtained by PCR amplification and the human albumin expression frame PCR product ssALB-BGH with the enzyme digestion product of pBluescript II KS (+), and using a seamless cloning kit (

HD Cloning Kit, Clontech, code.639633).

The reaction system for homologous recombination operation is as follows:

after mixing well, the mixture was reacted at 50 ℃ for 15 minutes, and then placed on ice. Extracting plasmids according to the operation steps in the QIAGEN EndoFree Plasmid Midi Kit instruction, obtaining a ligation product pBlue-ssaLB homologous donor, and obtaining a ligation product for later use after digestion, identification and ligation.

2. Construction of non-homologous repair Donor plasmids

The PAM sequence and the target site sequence form a cutting site frame, the reverse complementary sequence of the cutting site frame is a reverse complementary cutting site frame, and one or two reverse complementary cutting site frames exist in the donor vector and exist in the form of closed-loop plasmid or linear DNA.

The reverse complementary cleavage site cassette sequence in this example is 5-CCACGTGTGTGAGTATACGCACA-3', whereinCCAThe PAM sequence in the frame of the reverse complementary cleavage site. When a reverse complement cleavage site box is present in the donor plasmid, the donor plasmid is referred to as a "1-cut donor plasmid"; when two reverse complementary cleavage site boxes are present in the donor plasmid, the donor plasmid is referred to as a "2-cut donor plasmid".

(1) When constructing 1cut donor plasmid, design primer to amplify human serum albumin expression frame, upstream 5' end has a reverse complementary cutting site frame, the sequence is shown in table, underline is reverse complementary cutting site frame.

Amplifying a human serum albumin expression frame sequence by using primers F-1/cut-ALB and R-BGH, and performing PCR amplification by using a self-constructed plasmid pBlue-ssALB homologous donor as a template; the PCR amplification procedure is pre-denaturation at 95 ℃ for 1 min; denaturation at 98 ℃ for 10s, annealing at 60 ℃ for 30s, extension at 68 ℃ for 20s, extension at 72 ℃ for 2min after 35 cycles, and finally heat preservation at 4 ℃. And (3) recovering the PCR product 1cut/ssalB-BGH by using a QIAquick Gel Extraction Kit, and sequencing correctly for later use.

The PCR product 1cut/ssALB-BGH was mixed with pBluescript II KS (+) EcoRV cleavage product using LigaFast^TMThe Rapid DNA Ligation System is used for Ligation reaction, and the reaction System is placed at room temperature for 1 hour as follows:

and then carrying out Plasmid transformation and extracting plasmids, extracting the plasmids according to the operation steps in the instruction book of a QIAGEN Endofree Plasmid Midi Kit, obtaining 1cut donor Plasmid pBlue-1cut/ssaLB, and carrying out enzyme digestion identification and connection for later use.

(2) When constructing the 2-cut donor plasmid, a downstream primer is designed to amplify a human serum albumin expression frame, a reverse complementary cutting site frame is arranged at the downstream 5' end, the sequence is shown in the table, and the underlined reverse complementary cutting site frame.

Amplifying a human serum albumin expression frame sequence by using primers F-1/cut-ALB and R-2/cut-ALB, and performing PCR amplification by using a self-constructed plasmid pBlue-ssALB homologous donor as a template; the PCR amplification procedure is pre-denaturation at 95 ℃ for 1 min; denaturation at 98 ℃ for 10s, extension at 68 ℃ for 30s, extension at 72 ℃ for 2min after 35 cycles, and final heat preservation at 4 ℃. And (3) recovering the PCR product 2cut/ssalB-BGH by using a QIAquick Gel Extraction Kit, and sequencing correctly for later use.

The PCR product 2cut/ssALB-BGH was mixed with pBluescript II KS (+) EcoRV cleavage product using LigaFast^TMThe Rapid DNA Ligation System is used for Ligation reaction, and the reaction System is placed at room temperature for 1 hour as follows:

and then carrying out Plasmid transformation and extracting plasmids, extracting the plasmids according to the operation steps in the instruction book of a QIAGEN Endofree Plasmid Midi Kit, obtaining 2cut donor plasmids pBlue-2cut/ssaLB, and carrying out enzyme digestion identification and connection for later use.

The obtained 1cut donor plasmid pBlue-1/cut-ALB and 2cut donor plasmid pBlue-2/cut-ALB. The donor plasmid is schematically shown in FIG. 2.

Example 3

Subgerminal cavity microinjection method

(1) The gRNA expression plasmid px330-gRNA obtained in example 1 was compared with the donor plasmid 1 obtained in example 2: 1, mixing, and diluting the plasmid concentration to 1ug/ul by using DMEM; the SPF fertilized egg is purchased from Japan Chuanxian corporation, the fresh fertilized egg is wiped and dried by 95 percent solution, a small end of the fertilized egg is marked by drawing a circular ring with the diameter of about 3cm by a pencil, and the plane of the circular ring is parallel to the cross section of the fertilized egg; a microinjection needle was prepared using a needle drawing machine (NARISHIGE, PC-100) with the preparation parameters of 76 ℃ for fusion, 25 ℃ for drawing, and the needle point was ground on a needle grinding machine (NARISHIGE, EG-401) to make the needle point angle 60 °. Soaking the prepared micro-injection needle in 95% alcohol solution for 24 hours, then airing, and sterilizing for 2 hours under ultraviolet lamp irradiation; the eggshell was cut along the circular ring with an electric saw (Minimo, H021) with the force controlled so that the electric saw did not enter the eggshell during the cutting process to stir the egg white. After removal of the small end egg shell, the fertilized egg and egg white were poured into a sterilized laboratory petri dish and subsequently operated under a solid microscope (Olympus, SZH10) using a microinjector 5246 to inject the mixed solution, which was successful when the middle transparent area of the blastoderm became red. Performing point perforation operation on the chicken embryo by using an electroporator (NEAP, type II), wherein the electroporation parameters are shown in the table, pouring the yolk and the egg liquid of the fertilized egg into the egg shell after the electroporation experiment operation is finished, sealing by using a ventilated membrane, and then putting into an incubator for incubation.

After 3 days of incubation, the fertilized eggs are subjected to shell changing operation, common eggs not smaller than the original eggshells are taken, 95% alcohol solution is wiped and dried, a circle mark with the diameter of about 4 cm is drawn at the big end of the eggshell by a pencil, the plane of the circle is parallel to the cross section of the fertilized eggs, the big end eggshells are removed by cutting the eggshells along the circle with an electric saw, the fertilized eggs incubated for 3 days are slowly transferred to new eggshells with the big end removed, the sealing of a preservative film is sealed after egg white liquid is supplemented properly, and the eggs are put into an incubator until hatching. Hatching conditions are that the temperature is 38.5 ℃ for 1 to 3 days, the humidity is 55 percent, and the eggs are turned once in 90 minutes; 37.2 ℃ in 4-21 days and 60 percent of humidity.

(2) The gRNA expression plasmid px330-gRNA obtained in example 1 was compared with the donor plasmid 1 obtained in example 2: 1, mixing, and diluting the plasmid concentration to 2ug/ul by using DMEM; 50ul of the plasmid mixed solution was diluted with opti-MEM to 100ul, and 50ul was collected

2000 and diluting the mixture into 100ul with opti-MEM, standing the mixture at room temperature for 5 minutes, uniformly mixing the two, and standing the mixture at room temperature for 20 minutes for later use; wiping and drying the fresh fertilized eggs by 95% alcohol solution, cutting eggshells along a circular ring by an electric saw, pouring the fertilized eggs and egg white into a sterilized experimental evaporating dish, injecting the mixed solution by using a microinjection instrument, and successfully injecting when a transparent area in the middle of a blastoderm turns red. Note thatAfter successful injection, the fertilized egg yolk and egg liquid are poured back into the egg shell, sealed by a breathable membrane seal, and then put into an incubator for incubation.

The embryonic development pattern three days after the membrane sealing is shown in figure 3.

After 3 days of incubation, the fertilized eggs are subjected to shell replacement operation, the preservative film is sealed after shell replacement, and the fertilized eggs are placed into an incubator until hatching. Hatching conditions are that the temperature is 38.5 ℃ for 1 to 3 days, the humidity is 55 percent, and the eggs are turned once in 90 minutes; 38 ℃ and 60% humidity for 4-21 days.

Example 4

PGCs mediating method

(1) Construction of a donor plasmid carrying a resistance Gene: designing a downstream primer for amplifying a Zeocin gene expression frame, wherein the sequences of the primers are shown in a table, amplifying human serum albumin expression frame and Zeocin gene expression frame sequences by using primers F-1/cut-ALB and R-Zeocin, and performing PCR amplification by using a self-constructed plasmid pcDNA4-IRES/ssALB as a template; the PCR amplification procedure is pre-denaturation at 95 ℃ for 1 min; denaturation at 98 ℃ for 10s, extension at 68 ℃ for 30s, extension at 72 ℃ for 2min after 35 cycles, and final heat preservation at 4 ℃. And (3) recovering the PCR product 1cut/IRES-ssalB-Zeocin by using a QIAquick Gel Extraction Kit, and sequencing correctly for later use.

The PCR product 1cut/IRES-ssALB-Zeocin was mixed with pBluescript II KS (+) EcoRV cleavage product using LigaFast^TMThe Rapid DNA Ligation System is used for Ligation reaction, and the reaction System is placed at room temperature for 1 hour as follows:

and then carrying out Plasmid transformation and extracting plasmids, extracting the plasmids according to the operation steps in the QIAGEN Endofree Plasmid Midi Kit instruction, obtaining 1cut donor Plasmid pBlue-1cut/IRES-ssaLB-Zeocin, and carrying out enzyme digestion identification and connection for later use.

(2) PGCs cell harvest

The SPF fertilized egg is purchased from Kangxian corporation of Japan, the fresh fertilized egg is wiped by 95% alcohol solution and dried, the small end is upwards put into an incubator for incubation, the incubation is carried out at 38.5 ℃ under the condition of 55% humidity for 48 to 50 hours, the embryo grows to 13 to 14 hours, the small end of the fertilized egg is taken out and placed upwards, a hole is chiseled on the small end by a sharp-end forceps, then the eggshell is slowly peeled by the forceps, the opening is approximately about 3cm, and the whole chick embryo can be observed. Connecting a ground and sterilized glass needle with an injector with a needle point removed, wherein the glass needle is inserted along the direction of a chick embryo blood vessel, trace blood enters the glass needle to make the needle point red at the moment of successful insertion, and then the injector slowly pumps the blood; the operation can be carried out at a plurality of positions of the blood vessel of the chick embryo, and more blood can be extracted as much as possible.

(3) PGCs cell culture

Preparing a culture medium for culturing PGCs, wherein blood cells cannot grow under the culture medium, so that impure cells are removed in the culture process, and PGCs grow independently; the medium composition is as follows, the basal medium being avian Knockout DMEM (Life Technology).

3ul of chick embryo blood was added to 1000ul of the prepared medium and added to a 24-well plate without feeder cells. One third of the medium was changed every two days to culture the cells to 2X 10⁵In time, the entire medium was replaced.

(4) Transfection of PGCs cells

The gRNA expression plasmid px330-gRNA obtained in example 1 and the donor plasmid pBlue-1cut/IRES-ssaLB-Zeocin in this example were mixed as follows: mixing at a ratio of 1. mu.l, diluting 50ul plasmid mixed solution with opti-MEM to 100ul, collecting 50ul plasmid mixed solution

2000 and 100ul of the mixture is diluted by opti-MEM, the mixture is placed at room temperature for 5 minutes, and then the two are mixed uniformly and placed at room temperature for 20 minutes for later use; adding the liposome and nucleic acid mixture to a solution containing 1 × 10⁵After incubation for 6 hours at 37 ℃ in a culture dish of PGCs, the culture medium is replaced after centrifugation, and the cells are transferred to a 6-well plate for continuous culture. Zeocin was added to the medium after 2 days to a concentration of 50 ug/ml. The culture was continued in an environment containing Zeocin for more than 2 weeks.

(5) PGCs cell re-injection

The SPF fertilized egg is purchased from Kangxian corporation of Japan, the fresh fertilized egg is wiped by 95% alcohol solution and dried, the small end is upwards put into an incubator for incubation, the incubation is carried out at 38.5 ℃ under the condition of 55% humidity for 48 to 50 hours, the embryo grows to 13 to 14 hours, the small end of the fertilized egg is taken out and placed upwards, a hole is chiseled on the small end by a sharp-end forceps, then the eggshell is slowly peeled by the forceps, the opening is approximately about 3cm, and the whole chick embryo can be observed. Connecting a ground and sterilized glass needle with an injector with a needle point removed, sucking PGCs (PGCs) separated and purified by using a fresh culture medium by using the glass needle, and inserting the glass needle along the direction of the chick embryo blood vessel, wherein the injector is slowly pushed after the glass needle is successfully inserted; the culture medium containing PGCs was pushed into the chick embryo blood vessels. After the operation is finished, the membrane is sealed, and the chick embryos are put into an incubator to be incubated under the incubation condition that the temperature is 38.5 ℃ and the humidity is 50-60% until the chick embryos are incubated and hatched.

Various modifications may be made to the above without departing from the spirit and scope of the invention as defined by the appended claims. The scope of the invention is therefore intended to be limited not by the above description, but rather by the scope of the appended claims.

Claims

1. A preparation method of a transgenic chicken oviduct bioreactor is characterized by comprising the following steps:

s1, designing gRNA of a targeted chicken genome DNA: selecting a gRNA with a sequence of TGTGCGTATACTCACACACG according to different PAM sequence rules of different Cas9 proteins, wherein the selected chicken genome target DNA sequence is an ovalbumin first intron;

s3, constructing a donor vector carrying the exogenous gene expression cassette: the donor vector comprises a homologous repair vector and a non-homologous repair vector; the exogenous gene expression frame comprises a first intron sequence of a complete ovalbumin gene, a signal peptide sequence for secreting protein out of cells, a complete DNA sequence of any target exogenous protein and a polyA sequence for protecting mRNA stability; the first intron sequence of the complete ovalbumin gene is a sequence from the cutting site of the selected gRNA to the end of the first intron;

s31, constructing the donor vector for homologous repair: using single-stranded DNA as a homologous recombination repair template, wherein the upper and lower homologous sequences are 45bp-90 bp; or double-stranded DNA is used as a homologous recombination repair template, and the upstream and downstream sequences of 100bp-1000bp respectively at the DSB position of the target DNA site are respectively connected to the 5 'end and the 3' end of the exogenous gene to be used as homologous arms, and the donor vector can exist in the form of closed-loop plasmid or linear DNA;

2. The method of claim 1, wherein the first intron sequence of the supplemented ovalbumin gene is supplemented to remove the recognition and cleavage sites of the selected gRNA.

3. The method for preparing a transgenic chicken oviduct bioreactor as claimed in claim 1, wherein the signal peptide sequence is a native signal peptide sequence of a target foreign protein, a chicken-derived lysozyme signal peptide, a chicken-derived ovotransferrin signal peptide, a chicken-derived ovomucoglobulin signal peptide or an artificially designed signal peptide.

4. The method of claim 1, wherein the target foreign protein is any one of human serum albumin, interleukin, human blood coagulation factor, interferon, tumor necrosis factor, colony stimulating factor, growth factor, chemotactic cytokine, and recombinant antibody.

5. The method for preparing a transgenic chicken oviduct bioreactor as claimed in claim 1, wherein the polyA sequence is any one of original polyA sequence of chicken ovalbumin, additional BGH polyA sequence and SV40polyA sequence.