CN106754949B - Pig flesh chalone gene editing site 864-883 and its application - Google Patents

Abstract

The invention discloses pig flesh chalone gene editing site 864-883 and its applications in pig genome, belong to bioengineering field.The present invention isolates 1 gene editing target site from pig flesh chalone gene coding region, and sequence 5 '-GGATTTTGAAGCTTTTGGATGGG-3 ' is located at 3 exon of the code area MSTN.The site, to mediate double-strand break, then can be occurred homologous recombination with targeting vector, mutated gene or selected marker etc. are integrated into the predetermined site of recipient cell genome by Cas9 endonuclease specific recognition.Statistical result shows that the site target practice efficiency is 86.7%.Pig flesh chalone gene editing provided by the invention site, effective target is provided to carry out accurate edits to the gene, new strategy is provided to develop the live pig new varieties of high lean meat percentage, also the molecular mechanism and signal path to verify flesh chalone provide reliable means and material.

Description

Pig flesh chalone gene editing site 864-883 and its application

Technical field

The invention belongs to biotechnologys and bioengineering field, and in particular to pig flesh chalone gene editing site and its answer With.

Background technique

Gene transfer technique can be divided into two major classes according to the locus specificity of exogenous origin gene integrator, and one kind is non-fixed point, The site that the foreign gene imported is integrated in target cell genome is usually random, including microinjection, electroporation, phosphorus Sour calcium precipitate, retroviral vector infection etc.: it is another kind of, it is fixed point, i.e., is integrated into after foreign gene importing target cell pre- First determining site carries out pointed decoration to intracellular target sites, and here it is the gene targetings for depending on homologous recombination. Foreign gene is precisely knocked in the genome of porcine somatic cell, always be it is extremely difficult because early stage be based only upon it is homologous heavy The gene targeting efficiency of group is extremely low, using being very restricted.Artificial endonucleases in recent years The appearance of (engineered endonuclease, EEN), just revolutionizes this status.

Zinc finger endonuclease (zinc finger endonuclease, ZFN) is first generation artificial endonucleases.Zinc Finger is a kind of protein that can combine DNA, all contains zinc fingers in many transcription factors.ZFN is by the DNA of zinc finger protein Nonspecific DNA cutting domain in structural domain and FokI endonuclease combines a kind of chimera protein to be formed, Not only there is the ability of zinc finger protein combination DNA but also there is ability (Kim the Y G, Cha of endonuclease FokI cutting DNA double-strand J,Chandrasegaran S.Hybrid restriction enzymes:zinc finger fusions to FokI cleavage domain.Proc Natl Acad Sci USA,1996,93(3):1156-1160.).It can be each using ZFN The double-strand notch of the specific position manufacture DNA of kind complex genome.Up to the present, ZFN has been successfully applied to pig, ox, big The biologies such as mouse, mouse, zebra fish, silkworm, drosophila, sea urchin, arabidopsis, tobacco, corn (Urnov F D, Rebar E J, Holmes M C,et al.Genome editing with engineered zinc finger nucleases.Nat Rev Genet,2010,11(9):636-646.).It is expensive but since ZFN preparation flow is complicated, and its technical patent quilt Several commercial companies are controlled, so promoting and applying extremely limited.

2009, the class activating transcription factor effect that scientist encodes a kind of pathogenic bacteria (Xanthamonas) of rice The base corresponding relationship of object (transcription activator-like effector, TALE) and DNA decrypt (Moscou M J,Bogdanove A J.A simple cipher governs DNA recognition by TAL effectors.Science,2009,326(5959):1501；Boch J,Scholze H,Schornack S,et al.Breaking the code of DNA binding specificity of TAL-type III Effectors.Science, 2009,326 (5959): 1509-1512.).Second generation artificial nuclease --- class transcriptional activation because Sub- effector nuclease (transcription activator-like effector nuclease, TALEN) is come into being. Similar with ZFN, TALEN is mainly formed by the DNA binding structural domain of TALE albumen and Fok I endonuclease combining enzymatic domains, TALE albumen contains the repetition peptide fragment of multiple 33-35 amino acid compositions, and each peptide fragment can identify a base. 2010, TALEN albumen application success (Li T, Huang S, Zhao X, et al.Modularly in yeast was reported for the first time assembled designer TAL effector nucleases for targeted gene knockout and gene replacement in eukaryotes.Nucleic acids Res,2011,39(14):6315-6325.).Later, TALEN obtained in the animals and plants such as plant, mouse, zebra fish, pig, ox it is rapid popularization with application (Joung J K, Sander J D.TALENs:a widely applicable technology for targeted genome editing.Nat Rev Mol Cell Biol,2013,14(1):49-55.).TALEN not only can be as ZFN to complexity Genome carry out fine modification, and its building is simpler, and specificity is also higher, therefore TALEN appearance shortly exists Largely instead of ZFN.2012, TALEN was chosen as one of ten big sciences breakthrough by " science " (Science) magazine (Breakthrough of the year.The runners-up.Science,2012,338(6114):1525-1532.)。

Either ZFN or TALEN, both artificial nucleases are all chimeras, are all by passing through engineer, sequence What the DNA binding member and nonspecific DNA cutting domain for arranging specificity were combined into.The mechanism of action of TALEN and ZFN All it is first to be cut to DNA double chain molecule target sequence, forms DNA double chain fracture (double-strand break, DSB), so The DNA damage repair mechanism of DSB active cell itself afterwards, to carry out fixed point transformation to the DNA.

At the beginning of 2013, a kind of gene site-directed editing technique clustered of third generation after ZFN and TALEN regularly interspaced short palindromic repeats(CRISPR)/CRISPR-associated (Cas) it comes on stage with glittering appearance.A kind of acquired immune system that CRISPR/Cas system is mainly based upon bacterium is transformed, bacterium benefit With this system can with specific recognition invade exogenous DNA and target dna is broken and is degraded using Cas albumen, thus Resist virus infection.The working principle of CRISPR/Cas9 gene editing system: crRNA (CRISPR-derived RNA) passes through Base pair complementarity and tracrRNA (trans-activating RNA), which are combined, forms tracrRNA/crRNA compound, this is multiple It closes object guidance nuclease Cas9 albumen and shears double-stranded DNA in the sequence target site matched with crRNA, generate DNA double chain fracture (DSB), the then DNA damage repair mechanism in DSB active cell, repairs DNA by two ways, i.e., non-homogeneous end End connection (non-homologous end joining, NHEJ) or homologous recombination repair (homology-directed Repair, HDR), to reach fixed point modifying gene group (fixed point of knockout or foreign gene including endogenous gene is knocked in) Purpose.NHEJ is a kind of non-fidelity, the repair mechanism for being easy to appear genetic mutation, the region for being sheared nucleic acid chains Gene mutation occurs, leads to the gene Knockdown or Knockout of coding.And HDR is then a kind of repair mechanism of high-fidelity, It is not easy to be mutated, correction or the target of target site is caused often through the homologous recombination between donor dna and genomic DNA To insertion foreign gene Knockin.

CRISPR/Cas9 technology possesses unique advantage not available for ZFN and TALEN: 1.CRISPR/Cas9 system only needs Synthesizing sgRNA (sequence of coding sgRNA is no more than 100bp) can be realized special sex modification to gene, so operation Get up simpler quick.2.CRISPR/Cas9 in system, sgRNA targeting sequence and genome sequence must be exactly matched, Cas9 could shear DNA, therefore its targeting accuracy is higher.3.CRISPR/Cas9 system gene modification rate is higher, More various to gene regulation mode (knock out, be inserted into, inhibit, activate etc.).The experimental period of 4.CRISPR/Cas9 system is shorter, Plenty of time and cost can be saved.6.CRISPR/Cas9 system is easier to obtain homozygous mutation body, and can be different Site introduces multiple mutation (Mussolino C, Cathomen T.RNA guides genome engineering.Nat simultaneously Biotechnol,2013,31(3):208-209；Wang,H.,et al.(2013)."One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering."Cell 153(4):910-918.)。

CRISPR/Cas9 technology since the advent of the world just has other unrivaled advantages of gene editing technology, short Within 1 year, technology is continuously improved, and develops into most popular one of the research tool of field of biology.Gene targeting is logical Homologous recombination technique is crossed by fixed point integration of foreign gene into the site of a certain determination on target cell genome, to reach pointed decoration The purpose of a certain gene on chromosome is transformed, has many advantages, such as technology maturation, modify accurate, effect stability.Gene targeting It has been widely regarded as the best approach of a kind of ideal specific modification and transformation organism inhereditary material at present, which includes A variety of different gene knockouts and the foundation for knocking in system, especially conditionity and induced gene targeting system, so as to base Because of target position modification over time and space definitely, effect it is more accurate reliable.CRISPR/Cas9 technology and gene are beaten Target is joined together, endonuclease Cas9 fixed point cutting target DNA after generate DNA fracture, recycle the homology arm of targeting vector into The accurate homologous recombination of row, the efficiency of the opposite short-movie section homologous recombination for improving the site.I am in 12 daily test May in 2016 Rope PubMed detects 1680, document with keyword " CRISPR/Cas9 " inquiry, wherein 2011 are only and deliver 1,2012 3 are delivered, delivers within 2013 78, delivers within 2014 316, delivers within 2015 718,2016 by the end of in May, 2016 564 are delivered within 12nd.With keyword " myostatin CRISPR/Cas9 " inquiry, detection document is 5, wherein only one Piece article is efficiently to be mutated (Wang, K., et al. (2015) " to pig MSTN gene using CRISPR/Cas9 system Efficient Generation of Myostatin Mutations in Pigs Using the CRISPR/Cas9 System."Sci Rep 5:16623.).This research is practiced shooting to the 3rd exon of pig MSTN, is tied according to counting after target practice Fruit shows that the site target practice efficiency is up to 86.7%, is " the biography being commonly called as with the homologous recombination technique based on embryonic stem cell (ES) The gene targeting of system " is compared, and target practice efficiency is greatly improved.

Muscle extract (myostatin, MSTN), also known as GDF-8 belong to transforming growth factor superfamily.MSTN Gene is quite conservative in mammalian evolution, and 2 intrones and 3 exons are contained in gene coding region, if only The mutation or missense mutation of dry mononucleotide.MSTN gene encodes one kind can play negative regulation, chemistry to muscle growth It is in the nature the growth factor of glycoprotein, livestock and poultry meat productivity can be influenced, improve Meat Quality, and be widely distributed in skeletal muscle.Cause This, in animal husbandry, the polymorphic molecular labeling that can be used as selection Muscle Traits and carcass trait of MSTN gene.With CRISPR/Cas9 technology is continuously improved, so that carrying out editor to pig MSTN gene becomes more simple and fast, which is answered It include: on the one hand, completeness gene knockout to be carried out to pig MSTN gene, muscular bacon hogs can be cultivated with range, To improve the economic benefit of pig breeding industry；On the other hand, gene site-directed insertion, point mutation research and humanization research are carried out. There is very great meaning to the further function of studying MSTN gene and its with connecting each other for certain diseases.Therefore, originally The purpose of invention is the efficient editing sites of identification of M STN gene, and analyzes its target practice efficiency, endogenous for building MSTN gene Property knock out or fixed point knock in foreign gene transgene pig provide new way.

Summary of the invention

The application is framework construction inserted with pig flesh chalone using pX330-U6-Chimeric_BB-CBh-hSpCas9 carrier Gene (MSTN) edits the Cas9 gRNA expression vector T21 of target site (864-883), and by its with same near target site The targeting vector dT2 of source arm transfects pig kidney PK15 cell according to certain molar ratio, thin with G418 screening monoclonal transgenosis Born of the same parents system.For convenience of screening positive clone, targeting vector dT2 design has green fluorescent protein (GFP) and red fluorescent protein (RFP) Double fluorescins, in case of accurate homologous recombination, rather than if random integration, then cell should fluoresced green.Together When, targeting vector dT2 contains neo gene, can use G418 assisting sifting.

The object of the present invention is to provide one can efficiently knock-out pig flesh chalone gene (MSTN) editing sites (864- 883).The editing sites can be used for the pig MSTN gene targeting of Cas9 mediation, by flesh chalone functionally inactive, create flesh chalone missing Transformant, operating procedure include:

(1) building is containing the Cas9 gRNA expression vector T21 for editing target site (864-883) and with double fluorescins Targeting vector dT2；

(2) above-mentioned 2 kinds of carriers are transfected into pig kidney PK15 cell according to certain mol proportion example；

(3) the monoclonal transgenic cell line of only fluoresced green is screened in G418 pressurization；

(4) PCR identifies the authenticity of homologous recombination；

(5) exact sequence on sequence verification recombination boundary.

It, can be under the mediation of endonuclease Cas9 with higher using editing sites provided by the invention (864-883) Efficiency carries out double-strand break, to improve the homologous recombination efficiency of targeting vector and target gene, will have selected marker Fixed point integration of foreign gene is in pig genome.The editing sites (864-883) are located at 3 extras of pig flesh chalone gene (MSTN) Aobvious sub-district, can efficiently knock out MSTN gene and site-directed integration has neo and EGFP selected marker.The present invention will provide a kind of side Just, efficiently strategy constructs the transgenic cell line of MSTN gene knockout, to promoting endogenous gene to knock out or foreign gene is fixed Application of the point integration technology in transgene pig is studied and produced has a very important role.

It defines unless otherwise indicated or individually, scientific and technical terms used herein have fields of the present invention Technical staff is known, identical meanings unambiguously.All published patent applications and bibliography mentioned by this paper are equal In being incorporated herein by way of completely quoting.

Detailed description of the invention

Accurate location of Fig. 1 editing sites (864-883) on pig genome

Pig flesh chalone gene M STN editing sites T2 is the known dna sequence of one section of long 23bp, sequence are as follows: GGATTTTGAAGCTTTTGGATGGG, the site are No. 15 3 extras of the code area chromosome MSTN in the accurate positionin of pig genome On aobvious son.

Cas9 gRNA expression vector schematic diagram and editing sites sequence of the Fig. 2 inserted with boot sequence.

Upper figure is Cas9 gRNA expression vector schematic diagram, with pX330-U6-Chimeric_BB-CBh-hSpCas9 carrier For skeleton, an expression vector with hSpCas9 gene, CRISPR Array and tracrRNA sequence.The following figure show volume Collect site (864-883) sequence.

Fig. 3 dT2 plasmid and the electrophoretogram of digestion.

M is 1kb DNA ladder (TaKaRa M1181/M1182), and right side is followed successively by plasmid without digestion, through Nsi I With the product after I double digestion of Xho.As it can be seen that product and expection are consistent after original plasmid and digestion.

Fig. 4 gene targeting schematic diagram.

If it is homologous recombination, neo and EGFP selected marker is integrated into the site 864-883 of MSTN.Detection is practiced shooting Integration afterwards respectively with T2-Up and MKR this to 5 ' arm of primer detection (it is expected that the length of PCR product is about 759bp), use EGFP-QF1 and T2-Down this to 3 ' arm of primer detection (it is expected that the length of PCR product is about 1.7kb).

The microphoto of clone's spot that may be positive after Fig. 5 electroporation transfection.

By possible positive PK-15 clone's spot after from left to right, being followed successively by transfection in light field (bright), green fluorescent protein (GFP) microphoto under excitation wavelength and red fluorescent protein (RFP) excitation wavelength.Visible PK-15 cell is big under light field It is small, form is normal.Visible clone's spot issues bright green fluorescence under green fluorescent protein (GFP) excitation wavelength, and red Nothing is evident that red fluorescence under color fluorescin (RFP) excitation wavelength, it was demonstrated that neo and EGFP selected marker has been integrated Into genome, and RFP is not integrated into, it is likely that positive colony required for being exactly.

The confirmation on 5 ' the homologous recombination boundary Fig. 6.

Primer transboundary is designed in 5 ' arm of integration site, expands the segment between pig genomic DNA and foreign gene neo, The insertion position of counterevidence foreign gene.No. 1 swimming lane is DL2000 DNA Ladder, and No. 2 swimming lanes and No. 3 swimming lanes are unmodified pig Genomic DNA is template, and No. 4 swimming lanes are water template, and the genomic DNA that 5-9 swimming lane is mentioned by 50ng clone's spot is template. Electrophoresis and sequencing result are shown in selected clone's spot i.e. transgenic cell line, and PCR amplification goes out the specific fragment of 759bp, And without the segment in all negative controls.Prove that the insertion position of foreign gene is consistent with theory analysis.

The confirmation on 3 ' the homologous recombination boundary Fig. 7

Primer transboundary is designed in 3 ' arm of integration site, expands the piece between pig genomic DNA and foreign gene EGFP Section, the insertion position for foreign gene of giving counterevidence.No. 1 swimming lane is DL2000 DNA Ladder, and No. 2 swimming lanes and No. 3 swimming lanes are unmodified Pig genomic DNA is template, and No. 4 swimming lanes are water template, and the genomic DNA that 5-9 swimming lane is mentioned by 50ng clone's spot is mould Plate.Electrophoresis and sequencing result are shown in selected clone's spot i.e. transgenic cell line, and PCR amplification goes out the special piece of 1701bp Section, and without the segment in all negative controls.Prove that the insertion position of foreign gene is consistent with theory analysis.

Fig. 8 target practice efficiency statistical form

Cell after G418 is screened gradually forms independent clone's spot one by one, selects the list of a fluoresced green It is cloned on 12 orifice plates and continues to cultivate, when cell quantity is enough, part is taken to mention genome for detection after being digested with pancreatin. Finally, statistics shows: the monoclonal of fluoresced green has 30, wherein there is 26 clones that homologous recombination has occurred i.e. through detection The exogenous origin gene integrator of selected marker to the expected site T2, target practice efficiency is up to 86.7%.This sufficiently shows editor's target Site T2 can efficiently knock out MSTN gene.

Specific embodiment

The present invention is to press down using pX330-U6-Chimeric_BB-CBh-hSpCas9 carrier as framework construction inserted with pig flesh Plain gene (MSTN) edits the Cas9 gRNA expression vector T21 of target site T2, and by its with homology arm near target site Targeting vector dT2 finally only selects a greening according to certain molar ratio transfection pig kidney PK15 cell with G418 assisting sifting The monoclonal of color fluorescence simultaneously carries out PCR detection and sequencing analysis to confirm whether 5 ' arm and 3 ' arm are inserted into expected target position Point.Detailed explaination is done to the present invention with attached drawing with reference to embodiments.It should be pointed out that the present embodiment is only used for explaining this Invention, rather than limitation or restriction are made to claim of the invention.

The structure of Cas9 gRNA expression vector T21 of the embodiment 1 inserted with pig flesh chalone gene (MSTN) editor target site T2 It builds

(1) main agents and material source

pX330-U6-Chimeric_BB-CBh-hSpCas9(Mammalian Expression,CRISPR Humanized S.pyogenes Cas9) carrier be purchased from Addgene, targeting vector dT2 be this laboratory designed, designed.AgeI Fermentas is purchased from EcoRI restriction enzyme.Recombinant vector is provided according to Beijing Tiangeng Biotechnology Co., Ltd The small ultrapure plasmid extraction kit specification of middle amount that mentions carries out.DNA is tapped and recovered kit purchased from Qiagen company.Sequencing commission Shenzhen Hua Da gene Co., Ltd completes.

(1) Cas9 gRNA expression vector is to be with the pX330-U6-Chimeric_BB-CBh-hSpCas9 carrier of purchase Skeleton, then according to boot sequence needed for fixed oligo design pattern insertion.Boot sequence 5 ' The AAACCCCATCCAAAAGCTTCA of CACCGGATTTTGAAGCTTTTGGATGGG 3 ' and 5 ' AAATCC 3 ' and sequencing primer Cas9-S:5 ' gagggcctatttcccatgattcc 3 ' (is located at U6 promoter upstream), is had by Shanghai English fine horse biotechnology The synthesis of limit company is dispensed in dry powder form, transports, is saved.DdH after primer sterilizing₂O is diluted to the solution of 10 μm of ol/L ,- 20 DEG C save backup.

(1) operating procedure.

Restriction enzyme A geI and EcoRI double digestion plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 are carried Body, reaction system are as follows:

Ingredient	Initial concentration	Dosage	Final concentration
				Buffer TangoTM	10×	3μl	1×
AgeI	10units/μl	1μl	0.33unit/μl
				EcoRI	10units/μl	1μl	0.33unit/μl
PX330 plasmid	1000ng/μl	3μl	100ng/μl
				Total volume		30μl

The above ingredient is sequentially added on ice, is mixed well.Digestion in 37 DEG C of water-baths is placed on to stay overnight.

Above-mentioned digestion products are recycled according to the step of Qiagen company DNA QIAquick Gel Extraction Kit.

The digestion products of recycling are connected, reaction system is as follows:

The above ingredient is sequentially added on ice, is mixed well.It is placed in 37 DEG C of water-baths and connects overnight.End is placed on On ice, for converting.

Bacillus coli DH 5 alpha is converted, transformation system is as follows:

Ingredient	Dosage
		Connection product	10μl
DH5 α competent cell	100μl
		Total volume	110μl

The above ingredient is mixed, ice bath 30min；42 DEG C of heat shock 90s；The liquid LB without containing ammonia benzyl antibiotic is added to cultivate 500 μ l of base is placed in 37 DEG C of shaking tables with the revolving speed recovery 45min of 200rpm/min；With 8000rpm/min's on desk centrifuge Revolving speed centrifugation, bacterial sediment is got off, 450 μ l LB culture mediums are then removed；Remaining 100 μ l sample is coated on.Ammonia benzyl is green On mycin LB plate, it is placed in 37 DEG C of incubators and is incubated overnight 16h.Picking bacterial colony send Shenzhen Hua Da to be sequenced.

The screening of pig transgenic cell line after 2 electroporation transfection of embodiment

(1) main agents and material source

Pig kidney PK15 cell line is purchased from ATCC.Endotoxin-free plasmid preparation is mentioned according to Beijing Tiangeng Biotechnology Co., Ltd The small ultrapure plasmid extraction kit specification of middle amount that mentions supplied carries out.G418 antibiotic is purchased from Sigma.DMEM, DPBS, tire ox blood Clearly, DMSO is purchased from Invitrogen.Electricity turns buffer runs room and voluntarily prepares.BTX2001 cell electro' asion instrument Purchased from BTX company, the U.S..

(2) operating procedure

Plating cells:

On the day before electroporation, PK15 cell pancreatin is digested for after single cell suspension, according to 0.25-1 × 10⁶Cell/ Hole is laid on 6 orifice plates, and growth is overnight.

Vitellophag:

According to cell density sum number measure suitable trypsin digestion adherent cell collecting (for PK15, general 6 orifice plates Need to be added 0.25% hole trypsin solution 0.5-1mL/, 39 DEG C of incubators are incubated for 5-10min, have observed under the microscope a small amount of Cell, which starts shedding off that the culture medium containing serum is added and terminates, to be digested), piping and druming makes attached cell completely disengage and divide repeatedly It dissipates into unicellular.

It collects, cell is resuspended:

Cell suspension is collected into the centrifuge tube of cleaning sterile, cell first is resuspended with DPBS, 2400rpm is centrifuged 3- 5min abandons supernatant, then electricity consumption turns buffer and cell is resuspended, again centrifugation (in order to ensure by the thorough washes clean of cell, can be with Electricity consumption turns buffer and washes cell twice).Abandon supernatant, appropriate electricity is added and turns buffer and plasmid, gently piping and druming make cell, plasmid and Electricity turns liquid and mixes well.

Electric shock:

Electroporation prerun is opened in advance 1-2 minutes and set voltage, the electric shock parameters such as time and number of shocks (100V, 3ms, 1pulse) draws suitable cell mixture and clean electric shock cup (electric shock cup diameter 10mm counter sample is added 50 μ L of total volume) it mixes as far as possible, bubble is avoided, then electric shock cup is put into electric shock card slot, has to make when placing electric shock cup Shock by electricity cup metal covering and card slot electrode abutting, shuts lid, shocks by electricity by Automatic start.

Culture:

After visible wait indicator light stops flashing after the completion of electric shock, electric shock cup is taken out, sample is sucked out with elongated suction nozzle and turns Enter in Nonsele ctive culture media preheated in advance.Relevant label is carried out, culture plate is put into 39 DEG C, 5%CO₂Incubator training It supports, close instrument power source and cleans electric shock cup (clear water-distillation ethanol-water-drying).After culture 24 hours, observation cell is raw Long situation counts, and counts transfection efficiency, photographs to record.

- G418 screening:

After culture for 24 hours, adherent good cell pancreatin is digested for single cell suspension, divides disk according to the density of 1:20, 10cm culture dish is reached, the additive amount of G418 is gradually adjusted according to cell death situation, lasting culture is grown up until individual cells For macroscopic clone's spot.

Clone spot separation

Monoclonal cell is separated using pancreatin point digestion method.2 μ l pancreatin are drawn on monoclonal cell, it is light after digestion 30s Light inhale is beaten, and cell is picked up, is reached in 12 orifice plates.G418 containing 100 μ g/ml in 12 orifice plate culture mediums, to maintain Dan Ke The growth of grand cell.After cell spreads entire 6 orifice plates, it can freeze, sample, be used for subsequent analysis.

Attached: electricity turns buffer formulation:

The confirmation of 3 selected marker insertion position of embodiment and target practice efficiency statistically analyze

(1) main agents and material source

TaKaRa LA Taq and its matched buffer (10 × buffer), dNTP, MgSO₄It is purchased from Japan and spins biology Science and Technology Ltd..Mammalian genome DNA extraction kit is century purchased from health.Sequencing commission Shenzhen Hua Da gene is limited Company completes.

A pair of of the specific primer for detecting 5 ' arm of positive colony is T2-Up and MKR, it is contemplated that the length of PCR product is about 759bp, a pair of of specific primer of 3 ' arm of detection are EGFP-QF1 and T2-Down, it is contemplated that the length of PCR product is about 1.7kb。

Primer is synthesized by Shanghai Ying Jun Biotechnology Co., Ltd, is dispensed, transports, is saved in dry powder form.Primer is with going out DdH after bacterium₂O is diluted to the solution of 10 μm of ol/L, and -20 DEG C save backup.

(2) operating procedure

It is that the mammalian genome DNA extraction kit specification provided in century prepares monoclonal cell system according to health Genomic DNA, its integrality of electrophoresis detection, ultraviolet specrophotometer measures concentration and purity, concentration adjusted to 20ng/ μ l。

- 5 ' arm PCR detection:

The reaction system of PCR are as follows:

The above ingredient is sequentially added on ice, is mixed well.It is put into PCR instrument and is run according to following conditions:

By PCR reaction product electrophoresis and Shenzhen Hua Da gene Co., Ltd is entrusted to be sequenced, confirms selected marker Whether correctly integrated in the 5 ' areas arm of editor's target site.

- 3 ' arm PCR detection:

The reaction system of PCR are as follows:

The above ingredient is sequentially added on ice, is mixed well.It is put into PCR instrument and is run according to following conditions:

By PCR reaction product electrophoresis and Shenzhen Hua Da gene Co., Ltd is entrusted to be sequenced, confirms selected marker Whether correctly integrated in the 3 ' areas arm of editor's target site.

Statistical target practice efficiency:

Cell after G418 is screened gradually grows up to independent clone's spot one by one, selects the list of a fluoresced green It is cloned on 12 orifice plates and continues to cultivate, when cell quantity is enough, takes part to mention genome after being digested with pancreatin and detected for PCR With remaining part cell then freezes if the positive.The monoclonal to 30 fluoresced greens is selected altogether in experiment, wherein having The homologous recombination i.e. exogenous origin gene integrator of selected marker has occurred to the expected site T2 through detection in 26 clones, then counts Target practice efficiency is 86.7%.This sufficiently shows that editor's target site T2 can efficiently knock out MSTN gene, and the selectivity of external source Marker gene can be through on editor's target site of homologous recombination site-directed integration to desired design.

SEQUENCE LISTING

<110>Animal Husbandry and Veterinary Inst., Hubei Academy of Agricultural Sciences

<120>pig flesh chalone gene editing site 864-883 and its application

<130>

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 23

<212> DNA

<213>pig

<400> 1

ggattttgaa gcttttggat ggg 23

<210> 2

<211> 27

<212> DNA

<213>artificial sequence

<400> 2

caccggattt tgaagctttt ggatggg 27

<210> 3

<211> 27

<212> DNA

<213>artificial sequence

<400> 3

aaaccccatc caaaagcttc aaaatcc 27

<210> 4

<211> 23

<212> DNA

<213>artificial sequence

<400> 4

gagggcctat ttcccatgat tcc 23

Claims (2)

1. purposes of the pig flesh chalone gene M STN editing sites as the target of editor's pig flesh chalone gene, pig flesh chalone gene MSTN editing sites 864-883 is one section of DNA sequence dna comprising 23 deoxyribonucleotides, sequence are as follows: 5 '- GGATTTTGAAGCTTTTGGATGGG-3’。

2. purposes according to claim 1, which is characterized in that GGG is contained at the end of editing sites 3 ', as Cas9 nucleic acid The PAM sequence of restriction endonuclease specific recognition, so that generation double-strand break is mediated, the DNA sequence dna of the editing sites two sides and target practice Homologous recombination occurs for the identical DNA sequence dna of sequence in carrier, and mutated gene or selected marker are integrated into site spy Positioning is set.