CN112251463A - Construction method of CD73 humanized mouse model - Google Patents

Abstract

The invention discloses a construction method of a CD73 humanized mouse model, and a CD73 humanized animal model is efficiently and successfully obtained by optimizing a targeting vector, sgRNA and verification steps used in the preparation of the model. The model of the invention has significant advantages in the screening application of the CD73 targeting drug in combination with other immune checkpoints or small molecule drugs.

Description

Construction method of CD73 humanized mouse model

Technical Field

The invention relates to the technical field of animal genetic engineering, in particular to a method for constructing a CD73 humanized mouse model.

Background

The first generation of immune checkpoint inhibitors, including PD1, PDL1, and CTLA4, etc., have become the mainstay of tumor immunotherapy. Although these immune checkpoints have met with limited success in tumor immunotherapy, only a small fraction of patients exhibit a durable response to a single immune checkpoint, and even a fraction of patients do not respond to checkpoint inhibitors currently on the market. The important aspect of overcoming the drug resistance of solid tumor treatment is the regulation and control of tumor microenvironment, and the immunosuppression in the microenvironment can obviously improve the tumor immunotherapy effect.

CD73 is an extracellular-5' -nucleotidase, a glycoprotein anchored to the plasma membrane by Glycosylphosphatidylinositol (GPI). CD73 is widely distributed on the cell surface of human tissue. The CD73 molecule is highly expressed in various tumor tissues, is not only involved in the metabolism and salvage synthesis pathways of purine nucleotides, but also is involved in the immune escape of tumors as an important immune signal negative regulation molecule by catalyzing the formation of the immunosuppressive mediator Adenosine (ADO). Targeting CD73 may have a good anti-tumor effect, and the synergistic effect shown by the combination of anti-CD 73 with certain immune molecule modulators has also been the focus of recent research. Therefore, the anti-CD 73 targeted therapy is expected to become a novel combined immunotherapy.

The study of pathogenesis of human diseases and the screening of effective therapeutic drugs require a large number of preclinical tests. Since preclinical related studies using human cells and tissues directly are ethically limited, animal models are an alternative to human biological studies. Because the mouse has small volume, easy maintenance and operation and short breeding period, the mouse is similar to the human genome, physiology and other characteristics, and has a corresponding mature gene modification technology, the mouse becomes a widely applied mammal model biological system. However, the physiological characteristics of mice are different from those of humans, and the experimental results obtained by using animal models are not suitable for human bodies. However, the humanized mouse model prepared by 'placing' human genes or cell tissues on the mouse model by using a gene modification or cell and tissue transplantation method greatly simulates the related activities of the human genes or cell tissues, thereby greatly improving the effectiveness of the mouse model for simulating certain human diseases. This is what we generally call a humanized mouse model, i.e., a mouse model with human functional genes, human cells or tissues.

The CD73 humanized mouse is obtained by replacing mouse-derived CD73 gene with human-derived gene in a mouse with a sound immune system by using a gene modification method to construct a mouse model capable of interacting with the anti-human-derived CD73 monoclonal antibody, thereby providing a more practical and easily-obtained animal evaluation system for screening the anti-human-derived CD73 monoclonal antibody before clinic. We constructed gRNA for mouse CD73 gene and vector carrying human CD73 gene fragment, and used human CD73 gene to replace mouse CD73 by CRISPR/Cas9 technology and embryo injection technology. Meanwhile, each element used in the CRISPR/Cas9 technology, including gRNA and the like, is fully optimized and adjusted, and the success rate and the accuracy rate of preparing the humanized CD73 gene animal model by adopting the technology are ensured.

Disclosure of Invention

The invention aims to provide a method for constructing a CD73 humanized mouse model, which has the advantage of efficient screening application of a CD73 targeted drug in combination with other immune check points or small molecule drugs, and solves the problems that a large number of preclinical tests are required for the pathogenesis research of human diseases and the screening of effective treatment drugs, and the preclinical related research by directly utilizing human cells and tissues is limited in ethical aspects.

In order to achieve the purpose, the invention provides the following technical scheme:

the construction method of the CD73 humanized mouse model is characterized in that a human CD73 coding amino acid sequence is inserted into the rear part of 5 'UTR of a mouse CD73 gene, a termination sequence of 3XployA is added at the tail end, so that the mouse CD73 protein cannot be expressed, and the human CD73 protein is regulated by a promoter of a mouse CD73 gene and the 5' UTR, and comprises the following steps: (1) constructing an expression vector for expressing humanized CD73 for inserting humanized CD73 gene, and specifically, connecting a plurality of fragments together by adopting a SLIC mode to construct a targeting vector; (2) determining sgRNA sequences for model preparation; (3) injecting an expression vector expressing humanized CD73 and sgRNA together with Cas9 protein into fertilized eggs, and transplanting the fertilized eggs into a pseudopregnant mouse, wherein the sequence of the humanized CD73 gene is shown as SEQ ID NO: 2, respectively.

Preferably, after a human sequence is inserted into a murine 5' UTR, the sgRNA with the lowest miss rate is selected for a target fragment, and the sequence of the sgRNA is shown as SEQ ID NO: 3, respectively.

Preferably, the targeting fragment vector is prepared by the following steps:

1) obtaining linearized pl253-DTA linearization by digesting the pl253-DTA plasmid with NOTI + SPEI;

2) amplifying CD73-5arm and CD73-3arm by using C57BL/6 genome PCR to obtain huCD73-CDS fragments and 3xployA fragments, and recycling for later use;

3) CD73-5arm, CD73-3arm, linearized pl253-DTA, huCD73-CDS and 3xployA were subjected to SLIC ligation and vector integrity was verified using PCR;

4) after the final vector is successfully constructed, a 3839bp band is recovered by using PACI/AGEI enzyme digestion, and sequencing is completed for injection.

Preferably, the primers for amplifying the CD73-5arm, CD73-3arm, huCD73-CDS and 3xployA sequences are as follows:

preferably, the method further comprises the steps of carrying out genotype identification on the pseudopregnant baby mice, screening positive mice F0 mice successfully inserted with correct humanized fragments, breeding F0 with B6 background mice to obtain F1, and carrying out gene identification on F1 mouse tails.

Preferably, the primers used for genotyping are as follows:

preferably, the method further comprises detection of CD73 protein expression, immune system validation, and/or verification of the anti-tumor efficacy of CD73 inhibitors.

Preferably, wherein the immune system validation step is: selecting thymus or spleen of main immune organs of a mouse, cutting thymus or spleen of a B6-hCD73 homozygous mouse and C57BL/6 background mouse, grinding and digesting tissues into single cells, staining extracellular protein of the histiocyte by using mouse source T \ B \ NK surface antibody, washing the cells by PBS, and then detecting the cell number of T (CD4+, CD8+) and B, NK) by flow cytometry.

Preferably, wherein the anti-tumor drug efficacy testing step of the CD73 inhibitor is as follows: b6 background PD1 and PDL1 double humanized mice and hCD73 humanized mice are bred to obtain B6-hPD1/hPDL1/hCD73 triple humanized mice, and the B6-hPD1/hPDL1/hCD73 humanized mice are adopted for drug effect evaluation; selecting a 6-7wB6-hPD1/hPDL1/hCD73 homozygous mouse, inoculating a mouse colon cancer cell MC38-hPDL1(Tg) -mPDL1(KO) -hCD73(Tg) -mCD73(KO) subcutaneously, wherein the cell line is a tumor cell which is knocked out by humanized CD73 and humanized PDL1 and simultaneously humanized murine PDL1 and CD73, and waiting for the tumor volume to be about 100 +/-50^mm3Then, the test sample is divided into 4 groups, namely a control group, a PDL1 single drug group, a PDL1 and CD73-1 antibody combination group and a PDL1 and CD73-2 antibody combination group; the dosing frequency was 2 times per week for 3 weeks, dosing end point, mice were sacrificed.

Preferably, wherein the CD73 protein is detected by a flow assay method:

(1) material taking: collecting 100ul to 1.5mL of EP tubes from peripheral blood of a mouse in an orbit, slightly shifting to avoid coagulation, transferring the blood into a 10mL centrifuge tube, adding 1mL of 1 xRBC into each tube, uniformly mixing, avoiding photorhagadia at room temperature for 10min, centrifuging at 8 ℃ for 5min, removing supernatant, performing photorhagadia for 2 times if required, washing for 1 time by using a FACS buffer, and placing on ice for later use;

(2) and (3) sealing: according to the experimental requirements, 100uL (about 10)⁶Cell) into different flow tubes, adding Fc block (CD16/32 antibody) and 1ul CD16/32 antibody (1:100 dilution) into each tube, mixing, and incubating on ice for 5 min;

(3) antibody incubation: preparing antibody mixed liquor (hPD-1, mPD-1, hCD73, mCD73 and CD3 antibodies) according to the number of sample tubes, adding 50uL of the antibody mixed liquor into each sample according to the optimal dosage of the antibodies, and uniformly mixing by vortex; adding 0.5ul antibody into each tube of the single staining tube, and uniformly mixing by vortex; incubating for 1h on ice in a dark place;

(4) cleaning: FACS buffer washing, adding FACS buffer, detecting on machine, adding Sytox blue (final concentration 1:10000 dilution) 5min before loading, and distinguishing dead and live cells.

Preferably, the method for detecting immune cells by flow is as follows:

material taking: shearing spleens of B6-hCD73 homozygous mice and C57BL/6 background mice, weighing, and placing in a C-shaped tube;

digestion: the spleen was digested with enzyme digest at 37 ℃ for 30 min. Adding 300ul of 0.1M EDTA into the digested spleen cells to stop digestion, taking 1mL of the mixture, filtering the mixture by using a filter membrane to remove undigested tissue blocks, and adding 2mLFACS buffer into each tube to neutralize the EDTA; centrifuging for 5min at 8 deg.C and 400g, removing supernatant, adding 3ml1 × RBC per tube of spleen, mixing, lysing erythrocytes for 5min at 8 deg.C and 400g in dark at room temperature, centrifuging for 5min, removing supernatant, adding 1ml LFACS buffer, resuspending, and filtering; centrifuging at 8 deg.C and 400g for 5min, removing supernatant, adding FACS buffer for resuspension, and adjusting cell concentration to 1 × 10⁷Dividing the cells into 100 uL/mL in a flow tube to prepare an incubation antibody;

(1) and (3) sealing: according to the experimental requirements, 100uL (about 10)⁶Cell) into different flow tubes, adding Fc block (CD16/32 antibody) and 1ul CD16/32 antibody (1:100 dilution) into each tube, mixing, and incubating on ice for 5 min;

(2) antibody incubation: preparing antibody mixed liquor according to the number of the sample tubes: adding CD19, CD4, CD8, CD335 and CD3 antibodies according to the optimal dosage of the antibodies, adding 50uL of antibody mixed liquor into each sample, uniformly mixing in a vortex mode, adding 0.5uL of antibody into each tube of a single staining tube, uniformly mixing in a vortex mode, and incubating for 1h on ice in a dark place;

(3) cleaning: FACS buffer washing, adding FACS buffer, detecting on machine, adding Sytox blue (final concentration 1:10000 dilution) 5min before loading, and distinguishing dead and live cells.

Compared with the prior art, the invention has the beneficial effects that:

1. the mouse CD73 protein is humanized, and a mouse model for successfully expressing humanized CD73 is obtained.

2. A mouse model of humanized CD73 and a PD1/PDL1 mouse can be bred to obtain a three-target humanized mouse model, the model can simultaneously express humanized PD1, PDL1 and CD73 proteins, perfect recognition of PD1 and PDL1 pathways is realized, and the model is a high-quality model for immune checkpoint therapy evaluation. The method can be used for single drug evaluation of PD1, PDL1 and CD73 antibodies, can be used for evaluation of the antitumor effect of the CD73 antibody combined with the PDL1 antibody, has profound guiding significance on evaluation of the effect of a clinical prodrug, fills the gap of the market in the three-target mouse model by the established B6-hPD1/hPDL1/hCD73 humanized mouse model, and provides a CD73 inhibitor evaluation platform. The method brings remarkable benefits from both economic and social perspectives.

3. The invention provides an optimized specific operation method for preparing an animal model stably expressing humanized CD73, wherein a targeting strategy, an element composition on a vector expressing humanized CD73, the best sgRNA of mouse-derived CD73 is knocked out, a primer and an enzyme digestion scheme used for identification and screening are optimized, and the high efficiency of preparing a target animal model is ensured by combining subsequent protein expression detection, immune system verification, inhibitor evaluation and the like.

Drawings

FIG. 1 is a schematic view of the targeting strategy of the present invention.

FIG. 2 shows the result of PCR amplification of the identification vector.

Fig. 3 shows the authentication strategy of generation F1.

FIG. 4 is the result of the identification of generation F1 in FIG. 1.

FIG. 5 is the result of the identification of generation F1 in FIG. 2.

FIG. 6 shows the results of flow protein assay.

FIG. 7 is a graph showing the results of the immune system assay.

FIG. 8 is a graph showing the change in body weight of mice in each group.

FIG. 9 is a graph showing the change of tumor in each group of mice.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Example 1 construction of humanized mouse model of CD73

The construction method of the CD73 humanized mouse model is completed according to the following steps:

1. determining a human source fragment replacement region and an inserted human source sequence: the human CD73 encoding gene is replaced by the mouse Cd73 encoding gene in a CRISPR Cas9 mode, so that a mouse model capable of expressing the human CD73 is constructed. The selected amino acid sequence (Aa: 1-574) coded by the human CD73 gene is the following sequence SEQ ID NO: 1 is shown in the specification; the amino acid sequence encoding human CD73 was inserted behind the 5' UTR of the murine CD73 gene, and a terminator sequence 3XployA was added to the end to disable the expression of the mouse CD73 protein, as shown below. The human CD73 protein is regulated by the promoter and 5' UTR of mouse CD73 gene, so that the human CD73 protein is expressed in the mouse sequence to maintain the similarity with the expression space and expression quantity of original mouse CD73 protein, and the original stability of mouse organism is not damaged. A schematic diagram of the targeting strategy is shown in fig. 1.

Human CD73 amino acid sequence SEQ ID NO: 1:

MCPRAARAPATLLLALGAVLWPAAGAWELTILHTNDVHSRLEQTSEDSSKCVNASRCMGGVARLFTKVQQIRRAEPNVLLLDAGDQYQGTIWFTVYKGAEVAHFMNALRYDAMALGNHEFDNGVEGLIEPLLKEAKFPILSANIKAKGPLASQISGLYLPYKVLPVGDEVVGIVGYTSKETPFLSNPGTNLVFEDEITALQPEVDKLKTLNVNKIIALGHSGFEMDKLIAQKVRGVDVVVGGHSNTFLYTGNPPSKEVPAGKYPFIVTSDDGRKVPVVQAYAFGKYLGYLKIEFDERGNVISSHGNPILLNSSIPEDPSIKADINKWRIKLDNYSTQELGKTIVYLDGSSQSCRFRECNMGNLICDAMINNNLRHTDEMFWNHVSMCILNGGGIRSPIDERNNGTITWENLAAVLPFGGTFDLVQLKGSTLKKAFEHSVHRYGQSTGEFLQVGGIHVVYDLSRKPGDRVVKLDVLCTKCRVPSYDPLKMDEVYKVILPNFLANGGDGFQMIKDELLRHDSGDQDINVVSTYISKMKVIYPAVEGRIKFSTGSHCHGSFSLIFLSLWAVIFVLYQ

selecting a human gene sequence as SEQ ID NO: 2, as shown in the figure:

atgtgtccccgagccgcgcgggcgcccgcgacgctactcctcgccctgggcgcggtgctgtggcctgcggctggcgcctgggagcttacgattttgcacaccaacgacgtgcacagccggctggagcagaccagcgaggactccagcaagtgcgtcaacgccagccgctgcatgggtggcgtggctcggctcttcaccaaggttcagcagatccgccgcgccgaacccaacgtgctgctgctggacgccggcgaccagtaccagggcactatctggttcaccgtgtacaagggcgccgaggtggcgcacttcatgaacgccctgcgctacgatgccatggcactgggaaatcatgaatttgataatggtgtggaaggactgatcgagccactcctcaaagaggccaaatttccaattctgagtgcaaacattaaagcaaaggggccactagcatctcaaatatcaggactttatttgccatataaagttcttcctgttggtgatgaagttgtgggaatcgttggatacacttccaaagaaaccccttttctctcaaatccagggacaaatttagtgtttgaagatgaaatcactgcattacaacctgaagtagataagttaaaaactctaaatgtgaacaaaattattgcactgggacattcgggttttgaaatggataaactcatcgctcagaaagtgaggggtgtggacgtcgtggtgggaggacactccaacacatttctttacacaggcaatccaccttccaaagaggtgcctgctgggaagtacccattcatagtcacttctgatgatgggcggaaggttcctgtagtccaggcctatgcttttggcaaatacctaggctatctgaagatcgagtttgatgaaagaggaaacgtcatctcttcccatggaaatcccattcttctaaacagcagcattcctgaagatccaagcataaaagcagacattaacaaatggaggataaaattggataattattctacccaggaattagggaaaacaattgtctatctggatggctcctctcaatcatgccgctttagagaatgcaacatgggcaacctgatttgtgatgcaatgattaacaacaacctgagacacacggatgaaatgttctggaaccacgtatccatgtgcattttaaatggaggtggtatccggtcgcccattgatgaacgcaacaatggcacaattacctgggagaacctggctgctgtattgccctttggaggcacatttgacctagtccagttaaaaggttccaccctgaagaaggcctttgagcatagcgtgcaccgctacggccagtccactggagagttcctgcaggtgggcggaatccatgtggtgtatgatctttcccgaaaacctggagacagagtagtcaaattagatgttctttgcaccaagtgtcgagtgcccagttatgaccctctcaaaatggacgaggtatataaggtgatcctcccaaacttcctggccaatggtggagatgggttccagatgataaaagatgaattattaagacatgactctggtgaccaagatatcaacgtggtttctacatatatctccaaaatgaaagtaatttatccagcagttgaaggtcggatcaagttttccacaggaagtcactgccatggaagcttttctttaatatttctttcactttgggcagtgatctttgttttataccaatag

2. determination of sgRNA sequences for model preparation: determining the approximate region of the sgRNA according to the replaced fragment, in order to ensure that the mouse sequence is not expressed in S2, selecting a human sequence to be inserted into a mouse source 5' UTR, using sgRNA evaluation software, selecting the target fragment with the lowest off-target rate, and preparing the sgRNA by transcription: PCR was performed using Primer Star or Primer Star Max system, sgRNA-F, sgRNA-R as primers, the correctly sequenced puc57-sgRNA plasmid (1: 30 dilution) as template, PCR product was purified, and sgRNA transcription preparation template was prepared. Transcription of sgRNA was performed using T7-ShortScript in vitro transcription kit (AM 1354); the sgRNA sequence used was as follows, and the targeting efficiency of this sgRNA was as high as 88%.

3. Construction of the vector and the transplant product: and (3) connecting a plurality of fragments together by adopting a SLIC mode to construct a targeting fragment vector, wherein the required fragments comprise a pl253-DTA framework, huCD73-CDS, 3 stop, CD73-5arm and CD73-3arm, and the targeting fragment vector is prepared by the following steps:

(1) linearized pl253-DTA linearization was obtained by digesting the pl253-DTA plasmid with NOTI + SPEI.

(2) The method comprises the steps of carrying out PCR amplification on CD73-5arm (sgRNA5 'end homology arm) and CD73-3arm (sgRNA 3' end homology arm) by using a C57BL/6 genome to obtain a 3xployA sequence, synthesizing a huCD73-CDS fragment through a sequence, obtaining a fragment with a required dosage by a PCR amplification mode, carrying out electrophoresis gel running and using kit gel for recovery and standby application. The primers for amplifying the CD73-5arm, CD73-3arm, huCD73-CDS and 3xployA sequences are shown in Table 1 below.

TABLE 1 primers for amplification of CD73-5arm, CD73-3arm, huCD73-CDS and 3xployA sequences

(3) CD73-5arm, CD73-3arm, pl253-DTA (linearized), huCD73-CDS and 3xployA were subjected to SLIC ligation and vector integrity was verified using PCR. The vectors were amplified using the primers shown in Table 2.

TABLE 2 primers used for PCR amplification identification vectors

The results of the identification are shown in FIG. 2.

(4) After the final vector was successfully constructed, the PACI/AGEI enzyme digestion (6451bp,3839bp) was used to recover the 3839bp band, the correct vector was sequenced, and the linearized vector was used for injection. The sequencing protocol is shown in table 4.

TABLE 4 vector sequencing protocol

4. Positive mice were obtained by transplantation injection: injecting the transplanted product, the target sgRNA and the cas9 protein into fertilized eggs, transplanting the fertilized eggs into pseudopregnant mice, carrying out genotype identification on the pseudopregnant mice, screening positive mice successfully inserted with correct humanized fragments F0 mice, breeding F0 and B6 background mice to obtain F1, carrying out gene identification on F1 rat tails, wherein the identification strategy is shown in figure 3, and the primers are shown in table 5. See fig. 3 for 3 PCR reactions, where wild type: a positive strip is not obtained in the PCR reaction; thirdly, single 206bp bands can be obtained by PCR reaction; heterozygote: the PCR reaction can obtain positive strips; thirdly, single 206bp bands can be obtained by PCR reaction; a homozygote: the PCR reaction can obtain positive strips; ③ the PCR reaction does not obtain a single 206bp band. The PCR experiment results of F1 mouse are shown in FIG. 4 and FIG. 5, and in FIG. 4-5, the negative control is B6 genomic DNA; n is blank control, no template control; the TRANS 2K PLUS II band is 8000bp \5000bp \3000bp \2000bp \1000bp \750bp \500bp \250bp \100 bp. It can be seen that mouse tail DNA of F1 positive mouse can be amplified by PCR to obtain corresponding bands, wherein the 5-end band shows 2135bp, and the 3-end band shows 2074 bp. And performing second-generation sequencing on the PCR positive products, wherein sequencing primers are shown in a table 7, and the mouse with correct sequencing is a positive mouse. Positive mice were numbered as follows: 7#, 12#, 13#, F1 were bred and matched to obtain CD73 humanized pure mouse, B6-hCD 73.

TABLE 5 genotype identification primers

TABLE 6 genotype identification conditions

TABLE 7 genotype sequencing primers

5. Protein expression detection: the selected CD73 is rich in expression, peripheral blood is selected in the experiment to detect the expression of CD73 protein in blood, and the CD73 protein flow detection method comprises the following steps:

(1) material taking: collecting peripheral blood of a mouse from 100ul to 1.5mL of LEP tubes (EDTA.2K is added in advance for anticoagulation), slightly shifting to avoid coagulation, transferring the blood into a 10mL centrifuge tube, adding 1mL1 × RBC (10 × stock solution is diluted by distilled water) into each tube, uniformly mixing, avoiding photodisruption at room temperature for 10min, 8 ℃,400g, centrifuging for 5min, removing supernatant, performing photodisruption for 2 times if needed, washing for 1 time by a FACSBuffer, and placing on ice for later use;

(2) and (3) sealing: according to the experimental requirements, 100uL (about 10)⁶Cell) into different flow tubes, adding Fc block (CD16/32 antibody) and 1ul CD16/32 antibody (1:100 dilution) into each tube, mixing, and incubating on ice for 5 min;

(3) antibody incubation: preparing antibody mixed liquor (hPD-1, mPD-1, hCD73, mCD73 and CD3 antibodies) according to the number of sample tubes, adding 50uL of the antibody mixed liquor into each sample according to the optimal dosage of the antibodies, and uniformly mixing by vortex; adding 0.5ul antibody into each tube of the single staining tube, and uniformly mixing by vortex; incubating for 1h on ice in a dark place;

(4) cleaning: washing with FACS buffer, adding FACS buffer, detecting on a machine, adding Sytox blue (final concentration 1:10000 dilution) 5min before loading, and distinguishing dead and live cells;

the results of protein expression detection by flow assay are shown in fig. 6, human CD73 could be successfully detected in naive mice, and no expression could be detected in murine CD 73.

6. And (3) immune system verification: selecting main immune organs of mice, namely thymus or spleen, cutting B6-hCD73 homozygous mice and C57BL/6 background mice, grinding and digesting tissues into single cells, staining histiocyte extracellular protein by mouse source T \ B \ NK surface antibody, washing cells by PBS, and then carrying out flow cytometry to detect the quantity of T (CD4+, CD8+), B, NK cells, wherein the immune cell flow detection method comprises the following steps:

(1) material taking: shearing spleens of B6-hCD73 homozygous mice and C57BL/6 background mice, weighing, and placing in a C-shaped tube;

(2) digestion: the spleen was digested with enzyme digest (PBS containing Ca, Mg + 2% CS +10mM HEPES +30ug DNase +1.75Mg collagenase D) at 37 ℃ for 30 min. Digestion was stopped by adding 300ul0.1M EDTA to the digested spleen cells, 1mL was filtered through a filter to remove the undigested tissue mass, and 2mL FACS buffer was added to each tube to neutralize the EDTA. Centrifuging for 5min at 8 deg.C and 400g, removing supernatant, adding 3ml1 × RBC per tube of spleen, mixing, lysing erythrocytes for 5min at 8 deg.C and 400g in dark at room temperature, centrifuging for 5min, removing supernatant, adding 1ml LFACS buffer, resuspending, and filtering; centrifuging at 8 deg.C and 400g for 5min, removing supernatant, adding FACS buffer for resuspension, and adjusting cell concentration to 1 × 10⁷mL, split into 100uL in flow tube, ready to incubate antibody;

(3) and (3) sealing: according to the experimental requirements, 100uL (about 10)⁶Individual) cells were divided into different flow tubes, added with Fc block (CD16/32 antibody) and 1ul of CD16/32 antibody (1:100 dilution) per tube, mixed well, and incubated on ice for 5 min.

(4) Antibody incubation: preparing antibody mixed liquor (CD19, CD4, CD8, CD335 and CD3 antibodies) according to the number of sample tubes, adding 50uL of antibody mixed liquor into each sample according to the optimal dosage of the antibodies, uniformly mixing by vortex, adding 0.5uL of antibody into each tube of a single-staining tube, uniformly mixing by vortex, and incubating for 1h on ice in a dark place;

(5) cleaning: washing with FACS buffer, adding FACS buffer, detecting on a machine, adding Sytox blue (final concentration 1:10000 dilution) 5min before loading, and distinguishing dead and live cells;

the results of immune system validation are shown in FIG. 7, and the relative proportions of T cells, B cells, CD4+ T cells, CD8+ T cells and NK cells in the naive mice were substantially similar to those in naive mice. It is shown that the immune system is normal in humanized CD73 mice and that the modeling of the mice was successful.

7. Humanized mice PD1, PDL1 and CD73 evaluated the CD73 inhibitor antitumor efficacy test: in vitro data prove that a CD73 humanized mouse can normally express a CD73 protein, the immune response of the protein in the mouse is normal, but whether the mouse can be used for evaluating the actual curative effect of a CD73 anti-cancer drug is still to be verified, in order to adapt to the clinical existing CD73 medication scheme, a combined administration scheme of PD1/PDL1 and CD73 is adopted, a B6 background PD1 and PDL1 double humanized mouse are matched with an hCD73 humanized mouse to obtain a B6-hPD1/hPDL1/hCD73 triple humanized mouse, and the drug effect evaluation is carried out by adopting the B6-hPD1/hPDL1/hCD73 humanized mouse;

evaluation of CD73 inhibitors B6-hPD1/hPDL1/hCD73 tumor-bearing mouse model: selecting a 6-7w B6-hPD1/hPDL1/hCD73 homozygous mouse, inoculating a mouse colon cancer cell MC38-hPDL1(Tg) -mPDL1(KO) -hCD73(Tg) -mCD73(KO) subcutaneously, wherein the cell line is a tumor cell which is humanized by CD73 and humanized by PDL1 and knocked out by murine PDL1 and CD73, and the tumor volume is about 100 +/-50^mm3Then, the test sample is divided into 4 groups, namely a control group, a PDL1 single drug group, a PDL1 and CD73-1 antibody combination group and a PDL1 and CD73-2 antibody combination group; the dosing frequency was 2 times per week for 3 weeks, dosing end point, mice were sacrificed. The dosing schedule is shown in the following table:

as a result: the body weight changes of the mice in each group are shown in fig. 8. The tumor growth curves for each group are shown in fig. 9.

The results show that: compared with a control group, the anti-hPDL1 antibody has obvious cancer inhibition effect (TGI is 48.02%) in a single administration group, and the tumor inhibition effect is improved after the anti-hPDL1 antibody is combined with a CD73 antibody, wherein the TGI reaches 63.97% and 61%. The results show that the B6-hPD1/hPDL1/hCD73 mice can be used for the combined administration evaluation of PDL1 human antibody and CD73 human antibody, and the B6-hPD1/hPDL1/hCD73 mice inoculated with PDL1 and CD73 humanized cell lines are the preferable model for the combined administration of PD1/PDL1 and CD73 inhibitor.

It will be evident to those skilled in the art that the invention is not limited to the details of the foregoing illustrative embodiments, and that the present invention may be embodied in other specific forms without departing from the spirit or essential attributes thereof. The present embodiments are therefore to be considered in all respects as illustrative and not restrictive, the scope of the invention being indicated by the appended claims rather than by the foregoing description, and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein. Any reference sign in a claim should not be construed as limiting the claim concerned.

Sequence listing

<110> Guangdong Yakang Biotech Co., Ltd

<120> construction method of CD73 humanized mouse model

<160> 17

<170> SIPOSequenceListing 1.0

<210> 1

<211> 574

<212> PRT

<213> homo sapiens

<400> 1

Met Cys Pro Arg Ala Ala Arg Ala Pro Ala Thr Leu Leu Leu Ala Leu

1 5 10 15

Gly Ala Val Leu Trp Pro Ala Ala Gly Ala Trp Glu Leu Thr Ile Leu

20 25 30

His Thr Asn Asp Val His Ser Arg Leu Glu Gln Thr Ser Glu Asp Ser

35 40 45

Ser Lys Cys Val Asn Ala Ser Arg Cys Met Gly Gly Val Ala Arg Leu

50 55 60

Phe Thr Lys Val Gln Gln Ile Arg Arg Ala Glu Pro Asn Val Leu Leu

65 70 75 80

Leu Asp Ala Gly Asp Gln Tyr Gln Gly Thr Ile Trp Phe Thr Val Tyr

85 90 95

Lys Gly Ala Glu Val Ala His Phe Met Asn Ala Leu Arg Tyr Asp Ala

100 105 110

Met Ala Leu Gly Asn His Glu Phe Asp Asn Gly Val Glu Gly Leu Ile

115 120 125

Glu Pro Leu Leu Lys Glu Ala Lys Phe Pro Ile Leu Ser Ala Asn Ile

130 135 140

Lys Ala Lys Gly Pro Leu Ala Ser Gln Ile Ser Gly Leu Tyr Leu Pro

145 150 155 160

Tyr Lys Val Leu Pro Val Gly Asp Glu Val Val Gly Ile Val Gly Tyr

165 170 175

Thr Ser Lys Glu Thr Pro Phe Leu Ser Asn Pro Gly Thr Asn Leu Val

180 185 190

Phe Glu Asp Glu Ile Thr Ala Leu Gln Pro Glu Val Asp Lys Leu Lys

195 200 205

Thr Leu Asn Val Asn Lys Ile Ile Ala Leu Gly His Ser Gly Phe Glu

210 215 220

Met Asp Lys Leu Ile Ala Gln Lys Val Arg Gly Val Asp Val Val Val

225 230 235 240

Gly Gly His Ser Asn Thr Phe Leu Tyr Thr Gly Asn Pro Pro Ser Lys

245 250 255

Glu Val Pro Ala Gly Lys Tyr Pro Phe Ile Val Thr Ser Asp Asp Gly

260 265 270

Arg Lys Val Pro Val Val Gln Ala Tyr Ala Phe Gly Lys Tyr Leu Gly

275 280 285

Tyr Leu Lys Ile Glu Phe Asp Glu Arg Gly Asn Val Ile Ser Ser His

290 295 300

Gly Asn Pro Ile Leu Leu Asn Ser Ser Ile Pro Glu Asp Pro Ser Ile

305 310 315 320

Lys Ala Asp Ile Asn Lys Trp Arg Ile Lys Leu Asp Asn Tyr Ser Thr

325 330 335

Gln Glu Leu Gly Lys Thr Ile Val Tyr Leu Asp Gly Ser Ser Gln Ser

340 345 350

Cys Arg Phe Arg Glu Cys Asn Met Gly Asn Leu Ile Cys Asp Ala Met

355 360 365

Ile Asn Asn Asn Leu Arg His Thr Asp Glu Met Phe Trp Asn His Val

370 375 380

Ser Met Cys Ile Leu Asn Gly Gly Gly Ile Arg Ser Pro Ile Asp Glu

385 390 395 400

Arg Asn Asn Gly Thr Ile Thr Trp Glu Asn Leu Ala Ala Val Leu Pro

405 410 415

Phe Gly Gly Thr Phe Asp Leu Val Gln Leu Lys Gly Ser Thr Leu Lys

420 425 430

Lys Ala Phe Glu His Ser Val His Arg Tyr Gly Gln Ser Thr Gly Glu

435 440 445

Phe Leu Gln Val Gly Gly Ile His Val Val Tyr Asp Leu Ser Arg Lys

450 455 460

Pro Gly Asp Arg Val Val Lys Leu Asp Val Leu Cys Thr Lys Cys Arg

465 470 475 480

Val Pro Ser Tyr Asp Pro Leu Lys Met Asp Glu Val Tyr Lys Val Ile

485 490 495

Leu Pro Asn Phe Leu Ala Asn Gly Gly Asp Gly Phe Gln Met Ile Lys

500 505 510

Asp Glu Leu Leu Arg His Asp Ser Gly Asp Gln Asp Ile Asn Val Val

515 520 525

Ser Thr Tyr Ile Ser Lys Met Lys Val Ile Tyr Pro Ala Val Glu Gly

530 535 540

Arg Ile Lys Phe Ser Thr Gly Ser His Cys His Gly Ser Phe Ser Leu

545 550 555 560

Ile Phe Leu Ser Leu Trp Ala Val Ile Phe Val Leu Tyr Gln

565 570

<210> 2

<211> 1725

<212> DNA

<213> homo sapiens

<400> 2

atgtgtcccc gagccgcgcg ggcgcccgcg acgctactcc tcgccctggg cgcggtgctg 60

tggcctgcgg ctggcgcctg ggagcttacg attttgcaca ccaacgacgt gcacagccgg 120

ctggagcaga ccagcgagga ctccagcaag tgcgtcaacg ccagccgctg catgggtggc 180

gtggctcggc tcttcaccaa ggttcagcag atccgccgcg ccgaacccaa cgtgctgctg 240

ctggacgccg gcgaccagta ccagggcact atctggttca ccgtgtacaa gggcgccgag 300

gtggcgcact tcatgaacgc cctgcgctac gatgccatgg cactgggaaa tcatgaattt 360

gataatggtg tggaaggact gatcgagcca ctcctcaaag aggccaaatt tccaattctg 420

agtgcaaaca ttaaagcaaa ggggccacta gcatctcaaa tatcaggact ttatttgcca 480

tataaagttc ttcctgttgg tgatgaagtt gtgggaatcg ttggatacac ttccaaagaa 540

accccttttc tctcaaatcc agggacaaat ttagtgtttg aagatgaaat cactgcatta 600

caacctgaag tagataagtt aaaaactcta aatgtgaaca aaattattgc actgggacat 660

tcgggttttg aaatggataa actcatcgct cagaaagtga ggggtgtgga cgtcgtggtg 720

ggaggacact ccaacacatt tctttacaca ggcaatccac cttccaaaga ggtgcctgct 780

gggaagtacc cattcatagt cacttctgat gatgggcgga aggttcctgt agtccaggcc 840

tatgcttttg gcaaatacct aggctatctg aagatcgagt ttgatgaaag aggaaacgtc 900

atctcttccc atggaaatcc cattcttcta aacagcagca ttcctgaaga tccaagcata 960

aaagcagaca ttaacaaatg gaggataaaa ttggataatt attctaccca ggaattaggg 1020

aaaacaattg tctatctgga tggctcctct caatcatgcc gctttagaga atgcaacatg 1080

ggcaacctga tttgtgatgc aatgattaac aacaacctga gacacacgga tgaaatgttc 1140

tggaaccacg tatccatgtg cattttaaat ggaggtggta tccggtcgcc cattgatgaa 1200

cgcaacaatg gcacaattac ctgggagaac ctggctgctg tattgccctt tggaggcaca 1260

tttgacctag tccagttaaa aggttccacc ctgaagaagg cctttgagca tagcgtgcac 1320

cgctacggcc agtccactgg agagttcctg caggtgggcg gaatccatgt ggtgtatgat 1380

ctttcccgaa aacctggaga cagagtagtc aaattagatg ttctttgcac caagtgtcga 1440

gtgcccagtt atgaccctct caaaatggac gaggtatata aggtgatcct cccaaacttc 1500

ctggccaatg gtggagatgg gttccagatg ataaaagatg aattattaag acatgactct 1560

ggtgaccaag atatcaacgt ggtttctaca tatatctcca aaatgaaagt aatttatcca 1620

gcagttgaag gtcggatcaa gttttccaca ggaagtcact gccatggaag cttttcttta 1680

atatttcttt cactttgggc agtgatcttt gttttatacc aatag 1725

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gcggccgcgg gacgcatggc 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gcggccgcgg gacgcatggc 20

<210> 5

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ggggacacat ggctggctag agcgcgttga 30

<210> 6

<211> 56

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ctagccagcc atgtgtcccc gagccgcgcg ggcgcccgcg acgctactcc tcgccc 56

<210> 7

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tattcatcgc gctattggta taaaacaaag atcactgccc aaagtg 46

<210> 8

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

taccaatagc gcgatgaata aatgaaagct tgc 33

<210> 9

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gccgcgggac gggttccgga tcagcttgat g 31

<210> 10

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tccggaaccc gtcccgcggc cgctaaggta cccaag 36

<210> 11

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ggaccggttt aattaaagag gtggaggaga ctgggatg 38

<210> 12

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tagctgtcag gtttacccgc tag 23

<210> 13

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ataactgggc actcgacact tg 22

<210> 14

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ttggaggcac atttgaccta gtc 23

<210> 15

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

tcattgtgct cggacttcag ag 22

<210> 16

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

tcctctactc cgcagtttag tagag 25

<210> 17

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

acgtcgtttg tgtgcaggat c 21

Claims (11)

1. A method for constructing a CD73 humanized mouse model is characterized in that a human CD73 coding amino acid sequence is inserted behind the 5 'UTR of a mouse CD73 gene, a termination sequence of 3XployA is added at the tail end, so that the mouse CD73 protein cannot be expressed, and the human CD73 protein is regulated by the promoter of the mouse CD73 gene and the 5' UTR, and comprises the following steps: (1) constructing an expression vector for expressing humanized CD73 for inserting humanized CD73 gene, and specifically, connecting a plurality of fragments together by adopting a SLIC mode to construct a targeting vector; (2) determining sgRNA sequences for model preparation; (3) injecting an expression vector expressing humanized CD73 and sgRNA together with Cas9 protein into fertilized eggs, and transplanting the fertilized eggs into a pseudopregnant mouse, wherein the sequence of the humanized CD73 gene is shown as SEQ ID NO: 2, respectively.

2. The method of claim 1, wherein: after a human sequence is inserted into a mouse source 5' UTR, sgRNA with the lowest miss rate is selected for a target fragment, and the sequence of the sgRNA is shown as SEQ ID NO: 3, respectively.

3. The method of claim 1, wherein: the preparation steps of the targeting fragment vector are as follows:

1) obtaining linearized pl253-DTA linearization by digesting the pl253-DTA plasmid with NOTI + SPEI;

2) amplifying CD73-5arm and CD73-3arm by using C57BL/6 genome PCR to obtain huCD73-CDS fragments and 3xployA sequences connected behind the CDS fragments, and recovering for later use;

3) CD73-5arm, CD73-3arm, linearized pl253-DTA, huCD73-CDS and 3xployA were subjected to SLIC ligation and vector integrity was verified using PCR;

4) after the final vector is successfully constructed, a 3839bp band is recovered by using PACI/AGEI enzyme digestion, and sequencing is completed for injection.

4. The method of claim 3, wherein the primers that amplify the CD73-5arm, CD73-3arm, huCD73-CDS, and 3xployA sequences are as follows:

5. the method according to any one of claims 1 to 4, wherein: the method also comprises the steps of carrying out genotype identification on the pseudopregnant baby mice, screening positive mice F0 mice successfully inserted with correct humanized fragments, breeding F0 and B6 background mice to obtain F1, and carrying out gene identification on F1 mouse tails.

6. The method of claim 5, wherein the primers used to identify the genotype are as follows:

7. the method according to any one of claims 1 to 4, wherein: also included are detection of CD73 protein expression, validation of the immune system, and/or validation of antitumor agents with CD73 inhibitors.

8. The method of claim 7, wherein the immune system validation step is: selecting thymus or spleen of main immune organs of a mouse, cutting thymus or spleen of a B6-hCD73 homozygous mouse and C57BL/6 background mouse, grinding and digesting tissues into single cells, staining extracellular protein of the histiocyte by using mouse source T \ B \ NK surface antibody, washing the cells by PBS, and then detecting the cell number of T (CD4+, CD8+) and B, NK) by flow cytometry.

9. The method of claim 7, wherein the CD73 inhibitor anti-tumor agent validation step is: b6 background PD1 and PDL1 double humanized mice and hCD73 humanized mice are bred to obtain B6-hPD1/hPDL1/hCD73 triple humanized mice, and the B6-hPD1/hPDL1/hCD73 humanized mice are adopted for drug effect evaluation; selecting a 6-7w B6-hPD1/hPDL1/hCD73 homozygous mouse, inoculating a mouse colon cancer cell MC38-hPDL1(Tg) -mPDL1(KO) -hCD73(Tg) -mCD73(KO) subcutaneously, wherein the cell line is a tumor cell which is humanized by CD73 and humanized by PDL1 and knocked out by murine PDL1 and CD73, and the tumor volume is about 100 +/-50^mm3Then, the test sample is divided into 4 groups, namely a control group, a PDL1 single drug group, a PDL1 and CD73-1 antibody combination group and a PDL1 and CD73-2 antibody combination group; the dosing frequency was 2 times per week for 3 weeks, dosing end point, mice were sacrificed.

10. The method of claim 7, wherein the CD73 protein is detected by a flow assay method:

(1) material taking: collecting 100ul to 1.5mL of EP tubes from peripheral blood of a mouse in an orbit, slightly shifting to avoid coagulation, transferring the blood into a 10mL centrifuge tube, adding 1mL of 1 xRBC into each tube, uniformly mixing, avoiding photorhagadia at room temperature for 10min, centrifuging at 8 ℃ for 5min, removing supernatant, performing photorhagadia for 2 times if required, washing for 1 time by using a FACS buffer, and placing on ice for later use;

(2) and (3) sealing: dividing 100uL cells into different flow tubes according to the experiment requirement, adding Fc block (CD16/32 antibody) and 1uL CD16/32 antibody (diluted 1: 100) into each tube, mixing uniformly, and incubating on ice for 5 min;

(3) antibody incubation: preparing antibody mixed liquor (hPD-1, mPD-1, hCD73, mCD73 and CD3 antibodies) according to the number of sample tubes, adding 50uL of the antibody mixed liquor into each sample according to the optimal dosage of the antibodies, and uniformly mixing by vortex; adding 0.5ul antibody into each tube of the single staining tube, and uniformly mixing by vortex; incubating for 1h on ice in a dark place;

(4) cleaning: FACS buffer washing, adding FACS buffer, detecting on machine, adding Sytox blue (final concentration 1:10000 dilution) 5min before loading, and distinguishing dead and live cells.

11. The method for constructing a humanized mouse model of CD73 according to claim 7 or 8, wherein: the immune cell flow detection method comprises the following steps:

material taking: shearing spleens of B6-hCD73 homozygous mice and C57BL/6 background mice, weighing, and placing in a C-shaped tube;

digestion: the spleen was digested with enzyme digest at 37 ℃ for 30 min. Adding 300ul0.1M EDTA into the digested spleen cells to stop digestion, filtering 1mL with a filter membrane to remove undigested tissue blocks, and adding 2mLFACS buffer per tube to neutralize the EDTA; centrifuging for 5min at 8 deg.C and 400g, removing supernatant, adding 1 × RBC 3ml per tube of spleen, mixing, lysing erythrocytes for 5min at 8 deg.C and 400g in dark at room temperature, centrifuging for 5min, removing supernatant, adding 1ml LFACS buffer, resuspending, and filtering; centrifuging at 8 deg.C and 400g for 5min, removing supernatant, adding FACS buffer for resuspension, and adjusting cell concentration to 1 × 10⁷Per mL, min100uL in a flow tube, preparing to incubate the antibody;

(1) and (3) sealing: dividing 100uL cells into different flow tubes according to experiment requirements, adding Fc block (CD16/32 antibody) and 1uL CD16/32 antibody (diluted 1: 100) into each tube, mixing uniformly, and incubating on ice for 5 min;

(2) antibody incubation: preparing antibody mixed liquor according to the number of the sample tubes: adding CD19, CD4, CD8, CD335 and CD3 antibodies according to the optimal dosage of the antibodies, adding 50uL of antibody mixed liquor into each sample, uniformly mixing in a vortex mode, adding 0.5uL of antibody into each tube of a single staining tube, uniformly mixing in a vortex mode, and incubating for 1h on ice in a dark place;

(3) cleaning: FACS buffer washing, adding FACS buffer, detecting on machine, adding Sytox blue (final concentration 1:10000 dilution) 5min before loading, and distinguishing dead and live cells.

Images