CN110904046B

CN110904046B - Application of ISLR gene in preparation of medicine for treating obesity and improving insulin resistance

Info

Publication number: CN110904046B
Application number: CN201811088692.4A
Authority: CN
Inventors: 孟庆勇; 张玉英
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2018-09-18
Filing date: 2018-09-18
Publication date: 2021-10-08
Anticipated expiration: 2038-09-18
Also published as: CN110904046A

Abstract

The invention provides an application of an ISLR gene in preparing a medicament for treating obesity and improving insulin resistance. The invention discloses the molecular mechanism of ISLR gene participating in regulating insulin receptor level, influencing insulin signal pathway activation and participating in obesity-induced insulin resistance for the first time and the application in treating obesity and improving insulin resistance. The invention provides a new thought and target for effectively treating human obesity-induced diabetes and metabolic syndrome.

Description

Application of ISLR gene in preparation of medicine for treating obesity and improving insulin resistance

Technical Field

The invention belongs to the technical field of biology, and particularly relates to an application of an ISLR gene in preparation of a medicament for treating obesity and improving insulin resistance.

Background

At present, metabolic syndrome and diabetes have become global disorders that severely affect human health and quality of life. An increasing number of researchers have conducted intensive research into metabolic syndrome and the pathogenesis and treatment strategies of diabetes. Insulin is a hormone important in regulating the glycolipid metabolism of the body. Insulin resistance is a major feature of metabolic syndrome and diabetes, and is also the most critical pathogenesis. The metabolic syndrome and the incidence of diabetes of obese people are obviously increased, and insulin resistance is more likely to occur in consistent obese constitution.

Insulin is combined with an insulin receptor alpha subunit, and a signal is transmitted to an insulin receptor beta subunit, so that the insulin receptor beta subunit is phosphorylated to activate a downstream PI3K-AKT signal path, glucose uptake is finally regulated, glycogen synthesis and protein and lipid synthesis are promoted, lipid decomposition is inhibited, and the material energy metabolism balance of the whole body is regulated. Muscle, adipose tissue and liver are important metabolic tissues of the body, all regulated by the insulin signaling pathway. In obese subjects, insulin receptor levels in tissues affected by insulin are significantly lower than in normal subjects. The reduction of insulin receptor content is one of the molecular mechanisms by which insulin resistance occurs. Obesity is the result of excessive adipocyte hypertrophy. Adipose tissue plays a very important role in the metabolic balance of the whole body as an important tissue for energy storage, supply and secretion. Metabolic disorders of fat cells caused by excessive hypertrophy, abnormal secretion of fat factors and even cell necrosis occur, so that the metabolic balance of the whole body is affected. Insulin regulates the development and function of adipocytes, and insulin resistance affects the function of adipocytes. Therefore, the molecular mechanism of obesity-induced insulin resistance is urgently under intensive study.

In 1997, the Immunoglobulin Superfamily (ISLR) Rich in Leucine repeats was first discovered. Early studies found that the protein encoded by this functional gene is well conserved in mammals and contains two domains: the LRR domain and Ig like domains are also evolutionarily well conserved, and are predicted to play important roles in protein-protein interactions and cell-to-cell relationships. At present, no report on the treatment of obesity and the improvement of insulin resistance by ISLR is found.

Disclosure of Invention

The invention aims to provide application of an ISLR gene in preparing a medicament for treating obesity and improving insulin resistance.

Another objective of the invention is to provide a molecular mechanism of gene ISLR for regulating insulin receptor level, influencing insulin signal pathway activation and participating in obesity-induced insulin resistance, and an application in obesity and insulin resistance treatment.

In order to achieve the object of the present invention, in a first aspect, the present invention provides an ISLR gene targeting vector, which is a targeting vector developed based on ZFN, TALEN or CRISPR/Cas9 technology for knocking out an ISLR gene.

In a specific embodiment of the invention, the targeting vector is a targeting vector developed based on CRISPR/Cas9 technology and used for knocking out ISLR gene, and the nucleotide sequence of gRNA of the targeting ISLR gene in the targeting vector is 5'-GATCTCCACCGTGCCGCCCG-3' (SEQ ID NO: 1). Optionally, the nucleotide sequence of gRNA targeting ISLR gene in the targeting vector is 5'-ACACAATGAGATCCGCTCGG-3' (SEQ ID NO:2) or 5'-GGCTGCTAAAGGCGTCCCGA-3' (SEQ ID NO: 3).

In the present invention, the nucleotide sequence of the ISLR gene is shown in GenBank: NC _ 000075.6. (SEQ ID NO:5)

In a second aspect, the invention provides an application of the targeting vector in preparation of an ISLR gene knockout cell line.

In the present invention, the cell line does not include human embryonic stem cells. Alternatively, the cell line comprises mouse embryonic fibroblasts C3H10T 1/2.

In a third aspect, the invention provides an ISLR gene knockout cell line, and the preparation method of the cell line comprises the steps of transforming the cell line with the targeting vector to obtain a target-positive cell clone, namely the ISLR gene knockout cell line.

In a fourth aspect, the invention provides the targeting vector and application of the ISLR gene knockout cell line in preparing ISLR gene knockout transgenic animals.

In a fifth aspect, the invention provides a method for preparing an ISLR gene knockout transgenic mouse, which is to obtain the ISLR gene knockout transgenic mouse by using a Cre-loxp system, and comprises the following specific steps:

1)ISLR-loxp^+/+construction of transgenic mice: first, a targeting vector for the Islr gene was constructed, and a sequence (SEQ ID NO:6) shown in FIG. 19A was synthesized by Shanghai's Square model Biotechnology development Co., Ltd and ligated between HindIII and BamHI cleavage sites of a plasmid of vector pB-R322-MK (vector pB-R322-MK supplied from Shanghai's Square model Bioresearch center), to obtain a recombinant plasmid pB-R322-MK-loxp (targeting plasmid) shown in FIG. 19B, which was transfected into mouse ES cells, and successfully targeted ES cells were obtained by screening. And (3) carrying out microinjection and blastocyst transplantation by using the ES cells successfully targeted to obtain a chimeric mouse, and carrying out subsequent passage to obtain an Islr-flox transgenic mouse. In this mouse, a flox site was inserted downstream of the first intron and 3' UTR of the Islr gene, respectively;

2) adipoq-cre transgenic mice and ISLR-loxp^+/+Transgenic mice were mated, and the resulting offspring mice were genotyped, and ISLR knock-out mice were detected (Adipoq-cre: ISLR)^fl+/fl+) And (5) obtaining the product.

Preferably, the primers used in the genotyping of step 2) are as follows:

ISLRKO-F：5'-GAGGAAGCTAGGGGTGTGTT-3'

ISLRKO-R：5'-TCCCCAACCTTCCTTCAGTC-3'

in a sixth aspect, the present invention provides the use of an ISLR gene in the manufacture of a medicament or composition for treating obesity and improving insulin resistance.

Designing and synthesizing a suppressor targeting the ISLR gene, which is a substance capable of suppressing the expression of the ISLR gene at the transcriptional or translational level, based on the ISLR gene sequence, and then using the suppressor as an effective ingredient in a drug or a composition for treating obesity and improving insulin resistance.

In a seventh aspect, the present invention provides a suppressor for targeting an ISLR gene, wherein the suppressor is a substance capable of suppressing the expression of the ISLR gene at a transcriptional or translational level, and the substance is at least one selected from the group consisting of shRNA, siRNA, dsRNA, miRNA, cDNA, antisense RNA/DNA, low molecular weight compounds, peptides, and antibodies.

In a specific embodiment of the invention, the inhibitor is siRNA, the nucleotide sequence of which is 5'-UGCUGGCACUCCACUGUGA-3' (SEQ ID NO: 4).

In an eighth aspect, the present invention provides a medicament or composition for treating obesity and improving insulin resistance, wherein the inhibitor is an active ingredient.

In a ninth aspect, the present invention provides any one of the following uses of the ISLR gene:

1) the use in modulating insulin receptor levels;

2) use in affecting the activation of an insulin signaling pathway (e.g., the PI3K-AKT signaling pathway);

3) use in a molecular mechanism involved in obesity-induced insulin resistance;

4) use in the treatment of obesity and insulin resistance.

In a tenth aspect, the present invention provides a method for treating obesity and improving insulin resistance, comprising performing site-directed mutagenesis on an ISLR gene by genetic engineering means to delete or weaken the function of the ISLR gene; or

The ISLR gene is silenced by introducing a suppressor into an obese or diabetic individual.

The invention utilizes C3H10T1/2 cell line with ISLR gene knockout and C3H10T1/2 cell line with over-expression ISLR gene to carry out adipogenic induction and differentiation. Insulin treatment of differentiated mature adipocytes was performed to detect activation of insulin signals, including Insr α, Insr β, p-Insr β, Akt, p-Akt expression levels. ISLR knockdown increased p-Akt and p-Insr β levels. At the same time, ISLR knock-out increases the protein expression level of Insr α without altering Insr mRNA levels. After ISLR overexpression, the p-Insr beta level is reduced, and the protein expression content of Insr alpha and Insr beta is reduced. High fat feeding is carried out on the gene in an adipose tissue specific knockout mouse to induce obesity, and the Adipoq-cre ISLR is observed after three months^fl+/fl+The body type of the mouse is obviously smaller than ISLR^fl+/fl+Mice (ISLR gene over-expressed mice) called Adipoq-cre: ISLR^fl+/fl+The weight of the mice is obviously lower than that of ISLR^fl+/fl+A mouse. Glucose tolerance experiments were performed, Adipoq-cre: ISLR^fl+/fl+Blood glucose levels were significantly lower in mice than in control mice. Simultaneously taking 0min and 15min serum to detect the insulin level, Adipoq-cre: ISLR^fl+/fl+The level of insulin in the serum of the mice was significantly lower than that of the control mice. Allco-cre ISLR for high fat feeding^fl+/fl+And ISLR^fl+/fl+After the mice are hungry overnight, the mice are treated with insulin, white adipose tissues, muscle tissues and liver tissues are taken, and the p-Akt level Adipoq-cre: ISLR is detected^fl+/fl+Significantly higher than control mice. In addition, ISLR-siRNA is injected into wild obese mice induced by high fat feeding at a fixed point in intra-abdominal adipose tissue, the weight of the mice injected with the ISLR-siRNA is measured to be less than that of control mice by about 10g, and the weight of the mice injected with the ISLR-siRNA is also lower than that of the control mice by adipose tissue and liver tissue. After overnight starvation, insulin treatment was performed, and the blood glucose levels of the mice injected with ISLR-siRNA were lower than those of the control group.

By the technical scheme, the invention at least has the following advantages and beneficial effects:

the invention discloses the molecular mechanism of ISLR gene participating in regulating insulin receptor level, influencing insulin signal pathway activation and participating in obesity-induced insulin resistance for the first time and the application in treating obesity and improving insulin resistance. The invention provides a new thought and target for effectively treating human obesity-induced diabetes and metabolic syndrome.

Drawings

FIG. 1 shows the effectiveness of the T7E1 enzyme digestion verification of targeting ISLR of the CRISPR-cas9system in example 1 of the present invention, and 1-5 represent five targets of ISLR; 4/5ck is wild type control targeted at target No. 4 and No. 5; 1/2/3ck are wild-type controls targeted at target Nos. 1, 2 and 3.

FIG. 2 shows the sequencing alignment of two monoclonal cell lines KO1(A) and KO2(B) obtained by targeting ISLR target No. 4 using CRISPR-cas9system in example 1 of the present invention against the targeted types.

FIG. 3 shows the detection of ISLR protein expression levels in two ISLR knockout cells by Western blot in example 1 of the present invention. G, indicating that the cells are in the growth phase; g +2 d: cells were indicated to be under contact inhibition for two days.

FIG. 4 shows the detection of ISLR protein expression level in ISLR overexpressing cells by Western blot in example 1 of the present invention.

FIG. 5 shows the genotype of ISLR knockout mice obtained by PCR assay using Cre/loxp system in example 1 of the present invention.

FIG. 6 shows the PCR detection of ISLR knockout mouse ISLR gene knockout type obtained by Cre/loxp system in example 1 of the present invention.

FIG. 7 shows the detection of ISLR expression level in white adipose tissue of ISLR knockout mice by Western blot in example 1 of the present invention.

FIG. 8 shows the level of phosphorylation of Akt (A) and Insr β (B) after treatment with insulin in ISLR knock-out cells detected by Western blot in example 2 of the present invention.

FIG. 9 shows the expression level of Insr alpha in ISLR knock-out cells detected by Western blot (A) and the expression level of insulin receptor detected by RT-qPCR (B) in example 2 of the present invention.

FIG. 10 shows the level of phosphorylation of Insr β and the level of expression of Insr α after insulin treatment in ISLR overexpressing cells measured by Western blot in example 2 of the present invention.

FIG. 11 shows the Adipoq-cre: ISLR in example 2 of the present invention^fl+/fl+And ISLR^fl+/fl+Mice were given a high fat three month post-feeding body shape.

FIG. 12 shows the Adipoq-cre: ISLR in example 2 of the present invention^fl+/fl+And ISLR^fl+/fl+Mice were given high fat body weights three months after feeding.

FIG. 13 shows the Adipoq-cre: ISLR in example 2 of the present invention^fl+/fl+And ISLR^fl+/fl+Mice were given high fat feeding for three months and then were given blood glucose levels at the times noted after i.p. glucose injection.

FIG. 14 shows the Adipoq-cre: ISLR in example 2 of the present invention^fl+/fl+And ISLR^fl+/fl+Mice were given high fat feeding for three months and then were given insulin levels at the times noted after i.p. glucose injection.

FIG. 15 shows Westernblot detection of Adipoq-cre: ISLR in example 2 of the present invention^fl+/fl+And ISLR^fl+/fl+Phosphorylation levels of Akt in white adipose tissue (a), skeletal muscle (B) and liver (C) after three months of intraperitoneal injection of insulin for 30min with high fat feeding in mice.

FIG. 16 is the body weight of wild-type obese mice fed high fat for four months injected with ISLR-siRNA and NC according to example 3 of the present invention.

FIG. 17 is the blood glucose levels at the times noted after intraperitoneal injection of insulin after four months of injection of ISLR-siRNA and NC8 weeks in wild-type obese mice fed high fat in example 3 of the invention.

FIG. 18 is the body weight and triglyceride content in tissues after four weeks of ISLR-siRNA and NC8 injection in wild type obese mice fed with high fat for four months in example 3 of the present invention.

FIG. 19 is a schematic structural diagram of an Islr gene targeting vector constructed in example 1 of the present invention. Wherein, A is a targeting segment inserted into a vector, and B is a targeting plasmid pB-R322-MK-loxp map.

Detailed Description

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Unless otherwise indicated, the examples follow conventional experimental conditions, such as the Molecular Cloning handbook, Sambrook et al (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual,2001), or the conditions as recommended by the manufacturer's instructions.

In the invention, the Adipoq-cre mouse is offered by professor Zhu sea of the institute of basic medicine of Chinese academy of medical sciences. Adipoq-cre mice are available from Jackson Lab under the trade name B6; FVB-Tg (Adipoq-cre)1Evdr/J, No. 010803.

Example 1 ISLR Gene knock-out and overexpression cell lines and preparation of knock-out mice

1. The CRISPR-Cas9system is used for realizing the knockout of ISLR genes in C3H10T1/2 cells.

Firstly, a targeting plasmid of an ISLR gene is constructed, and the base sequence of an sgRNA action site is as follows (5 '-3'):

Crispr-islr-1：ACACAATGAGATCCGCTCGG(Target1)

Crispr-islr-2：GGCTGCTAAAGGCGTCCCGA(Target2)

Crispr-islr-3：CCGCCTGCACGCGTTGGCCG(Target3)

Crispr-islr-4：GATCTCCACCGTGCCGCCCG(Target4)

Crispr-islr-5：TCCGGACCGGAAGACAACGTC(Target5)

the plasmid pX 330-U6-chiral _ BB-CBh-hSpCas9 (refer to Feng Zhang et al Genome engineering using the CRISPR-Cas9system protocols, VOL.8NO.11, 2013) is subjected to single enzyme digestion by BbsI, and gel is recovered to obtain the purified linear empty vector. And (3) annealing to synthesize guide RNA, wherein the system is as follows:

Crispr-islr-F-1 caccGACACAATGAGATCCGCTCGG

Crispr-islr-R-1 aaacCCGAGCGGATCTCATTGTGTC

Crispr-islr-F-2 caccGGCTGCTAAAGGCGTCCCGA

Crispr-islr-R-2 aaacTCGGGACGCCTTTAGCAGCC

Crispr-islr-F-3 caccGCCGCCTGCACGCGTTGGCCG

Crispr-islr-R-3 aaacCGGCCAACGCGTGCAGGCGGC

Crispr-islr-F-4 caccGATCTCCACCGTGCCGCCCG

Crispr-islr-R-4 aaacCGGGCGGCACGGTGGAGATC

Crispr-islr-F-5 caccGACGTTGTCTTCCGGTCCGGA

Crispr-islr-R-5 aaacTCCGGACCGGAAGACAACGTC

Target-F:22.5μl

Target-R:22.5μl

LA buffer:5μl

reaction conditions are as follows:

99℃ 5min，25℃ 10min，4℃ ∞。

the ligation system after cleavage was as follows (10. mu.l):

pX330 empty vector: 2 μ l

T4 ligase: 1 μ l

T4buffer：1μl

Linker: 6 μ l (Linker is the product of annealing synthesis of guide RNA)

Reaction conditions are as follows: 16 ℃ overnight.

The ligated product was transformed into DH 5. alpha. E.coli competent cells. And obtaining transformants for sequencing comparison, and successfully constructing pX330-ISLR-taget plasmid.

C3H10T1/2 cells were transfected by lipo2000 liposome-mediated method using the successfully constructed pX330-ISLR-tag plasmid. Cells were harvested 36 hours after transfection to extract genomic DNA. The targeting efficiency is verified by using T7E1 enzyme digestion, and the PCR amplification primer sequences are as follows:

ISLR-Target1/2/3-F:5'-TTTGTTGGGCTGTTCTCCTG-3'

ISLR-Target1/2/3-R:5'-CATCTTGGCTGGGCTGGTA-3'

ISLR-Target4/5-F:5'-GCCTCAGCGGTGTCTATTCC-3'

ISLR-Target4/5-R:5'-TTCCAGACCTCGTGGTGTTAA-3'

PCR reaction (50. mu.l):

2×Q5mix：25μl

and (3) primer F: 2.5. mu.l

And (3) primer R: 2.5. mu.l

Genomic DNA: 100ng

ddH₂O: to 50. mu.l

And (3) PCR reaction conditions: 1min at 98 ℃; 10s at 98 ℃,20 s at 58 ℃ and 1min at 72 ℃ for 35 cycles; 72 ℃ for 2min, 4 ℃ infinity.

The PCR product was run on agarose gel electrophoresis for gel recovery. And (3) carrying out denaturation treatment on the purified PCR product, wherein the reaction system is as follows:

PCR products: 1 μ g

LA buffer：1μl

ddH₂O: to 10. mu.l

Reaction procedure:

95℃ 10min

95℃-85℃ 2c/s

85℃ 1min

85℃-75℃ 0.3c/s

75℃ 1min

75℃-65℃ 0.3c/s

65℃ 1min

65℃-55℃ 0.3c/s

55℃ 1min

55℃-45℃ 0.3c/s

45℃ 1min

45℃-35℃ 0.3c/s

35℃ 1min

35℃-25℃ 0.3c/s

25℃ 1min

4℃ ∞

T7E1 digestion system (20. mu.l):

PCR products after denaturation: 10 μ l

NEB buffer 2：2μl

T7E1：1μl

ddH₂O：7μl

Reaction conditions are as follows: 1h at 37 ℃.

The agarose gel electrophoresis results are shown in FIG. 1, and the targets No.1, No. 2 and No. 4 successfully achieve targeting.

And screening by using a target point sequence No. 4 to obtain a monoclonal cell targeted by C3H10T 1/2. Mutation type verification was performed on 2 monoclonal cells (KO1, KO2), and the sequencing results are shown in fig. 2(A, B): ISLR whole knockdown cells were successfully obtained. Western blot verification protein expression level is shown in figure 3, and the results show that the complete knockout of ISLR gene is realized.

2. The C3H10T1/2 cell line with the gene over-expressed is obtained by using pcDNA3.1-ISLR vector

Construction of pcDNA3.1-ISLR vector: the sequence of the Islr CDS region is obtained by PCR amplification, and the fragment is inserted into the backbone of the pcDNA3.1(+) vector by double digestion with BamH I and EcoRI to obtain the pcDNA3.1-ISLR vector plasmid.

Cell transfection system (six well plate):

optimizing a culture medium: 250 μ l/well

Lipo2000：10μl

pcDNA3.1-ISLR plasmid: 2 ug of

When the cells were grown to 60-70% confluence, transfection was performed and the cells were subjected to limiting dilution after 36 hours to obtain monoclonal cells (OE). Western blot verification protein expression level is shown in figure 4, and the results show that ISLR gene overexpression is realized.

3. Mouse for obtaining ISLR gene in adipose tissue specific knockout by Cre-loxp system

ISLR-loxp^+/+Construction of transgenic mice: first, a targeting vector for the Islr gene was constructed, and a sequence (SEQ ID NO:6) shown in FIG. 19A was synthesized by Shanghai's Square model Biotechnology development Co., Ltd and ligated between HindIII and BamHI cleavage sites of a plasmid for vector pB-R322-MK (vector pB-R322-MK constructed by Shanghai's Square model Bioresearch center), to obtain a recombinant plasmid pB-R322-MK-loxp (targeting plasmid) shown in FIG. 19B, which was transfected into mouse ES cells, and successfully targeted ES cells were obtained by screening. And (3) carrying out microinjection and blastocyst transplantation by using the ES cells successfully targeted to obtain a chimeric mouse, and carrying out subsequent passage to obtain an Islr-flox transgenic mouse. In this mouse, a flox site was inserted downstream of the first intron and 3' UTR of the Islr gene, respectively;

combining an Adipoq-cre mouse with ISLR-loxp^+/+Mice are hybridized, and mouse tail genome is used for genotype identification, wherein the primer sequences are as follows:

Cre-F：5'-GCCTGCATTACCGGTCGATGC-3'

Cre-R：5'-CAGGGTGTTATAAGCAATCCC-3'

Flox-F：5'-GCGAGCAATCCAGTCCTTA-3'

Flox-R：5'-CCTGTTCTGTTCAAACTATCCC-3'

PCR amplification

PCR reaction System (15. mu.l)

2×Taq Mix：7.5μl

Upstream primer (10 μ M): 0.5. mu.l

Downstream primer (10 μ M): 0.5. mu.l

ddH₂O：11.2μl

Genome: 0.3. mu.L

And (3) PCR reaction conditions:

94 ℃ for 5min, 94 ℃ for 30s, 60 ℃ for 30s, 72 ℃ for 40s, 2-4: 30 cycles, 5min at 72 ℃ and infinity at 4 ℃

The results of agarose gel electrophoresis are shown in FIG. 5.

Obtaining Adipoq-cre ISLR^fl+/fl+Progeny mice. Determining whether ISLR knockout is realized or not by using an ISLR deletion detection primer, wherein a genome is derived from a mature adipocyte, and the primer sequence is as follows:

ISLRKO-F：5'GAGGAAGCTAGGGGTGTGTT 3'

ISLRKO-R：5'TCCCCAACCTTCCTTCAGTC 3'

and (3) PCR amplification:

and (3) PCR reaction system:

2×Taq Mix：7.5μl

upstream primer (10 μ M): 0.5. mu.l

Downstream primer (10 μ M): 0.5. mu.l

ddH₂O：11.2μl

Genome: 0.3. mu.L

And (3) PCR reaction conditions:

5min at 94 ℃; 30s at 94 ℃, 30s at 60 ℃, 2min at 72 ℃ and 35 cycles; 5min at 72 ℃ and infinity at 4 ℃

The results of agarose gel electrophoresis are shown in FIG. 6. Western blot verification protein expression level is shown in figure 7, and the results show that complete ISLR gene knockout is realized.

Example 2 ISLR Gene knock-out increases insulin signaling pathway activation and overexpression decreases insulin signaling pathway activation

1. Adipogenic differentiation of ISLR knockout and over-expressed C3H10T1/2 cell lines

The ISLR knockout C3H10T1/2 cell line (prepared in example 1) and control cells were screened in the same batch to obtain non-targeted cells, and cultured in DMEM containing 10% FBS and 1% double antibody, and the DMEM containing 10% FBS and 1% double antibody was replaced after 2 days of contact inhibition, and 10. mu.g/ml insulin, 1. mu.M dexamethasone, and 0.5mM IBMX were added. After 2 days of induced differentiation, DMEM culture medium containing 10% FBS and 1% double antibody was replaced, and 10. mu.g/ml insulin was added, followed by two-day culture. Then cultured in 10% FBS and 1% double antibody DMEM medium until complete differentiation into adipocytes.

2. Insulin treatment of differentiated mature adipocytes

Mature adipocytes cultured in six-well plates were treated with 3% BSA solution containing 10. mu.g/ml insulin for 4 hours, and cells were collected and total protein was extracted using RIPA lysate for insulin signal activation detection. Results As shown in FIG. 8(A, B), ISLR knockdown increased p-Akt and p-Insr β levels. Also as shown in fig. 9(A, B), the ISLR knockout increased the protein expression level of instr α without altering the mRNA levels of instr. The results are shown in FIG. 10, where ISLR after overexpression reduced the p-Insr β level, while reducing the protein expression levels of Insr α and Insr β.

3. For Adipoq-cre: ISLR^fl+/fl+And ISLR^fl+/fl+Detection of insulin Signal activation levels following high fat feeding in mice

Two-month-old Adipoq-cre ISLR using high fat diet containing 60% fat, 20% carbohydrate and 20% protein^fl+/fl+Example 1 preparation and ISLR^fl+/fl+Mice (mice with over-expressed ISLR genes) were subjected to obesity induction. Three months later, the Adipoq-cre ISLR is observed^fl+/fl+The body type of the mouse is obviously smaller than ISLR^fl+/fl+Mice, as shown in figure 11. Adipoq-cre: ISLR^fl+/fl+The weight of the mice is obviously lower than that of ISLR^fl+/fl+Mice (fig. 12).

Allco-cre ISLR for high fat feeding^fl+/fl+And ISLR^fl+/fl+The mice were subjected to glucose tolerance test by first starving overnight, measuring the blood glucose level after starvation, and then performing 2g/kg intraperitoneal injection of glucose for blood glucose measurement at 15, 30, 60, 90, and 120min, respectively, as shown in FIG. 13, and the results are Adipoq-cre: ISLR^fl+/fl+Blood glucose levels were significantly lower in mice than in control mice. The results of simultaneously taking 0 and 15min sera to measure insulin levels are shown in FIG. 14, and the Adipoq-cre: ISLR^fl+/fl+Mouse serumInsulin levels were significantly lower than in control mice.

Allco-cre ISLR for high fat feeding^fl+/fl+And ISLR^fl+/fl+After the mice were starved overnight and then treated with 0.75U/kg of insulin for 30min, white adipose tissue, muscle tissue and liver tissue were collected, and the p-Akt level was measured, as shown in FIG. 15(A, B and C), Adipoq-cre: ISLR^fl+/fl+Significantly higher than control mice.

Example 3 ISLR knockdown is effective in treating obesity

In wild obese mice fed high fat for four months, site-directed injection of ISLR-siRNA and NC (siRNA that does not target any gene, purchased from leber biotechnology limited, guangzhou, No. Q0510) into intra-abdominal adipose tissue was performed, and target DNA sequences for the action of ISLR-siRNA were as follows: ggcttcgtgctggcactccactgtgacgt are provided. The nucleotide sequence of the ISLR-siRNA is 5'-UGCUGGCACUCCACUGUGA-3' (SEQ ID NO: 4).

After 8 weeks of treatment, body weights were measured as shown in FIG. 16, and mice injected with ISLR-siRNA weighed approximately 10g less. After subsequent starvation overnight and insulin treatment at 0.75U/kg, the blood glucose levels of the ISLR-siRNA injected mice were lower than those of the control group (FIG. 17). Adipose and liver tissue weights were also determined, and the ISLR-siRNA-injected mice were lower than those of the control group (fig. 18).

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> university of agriculture in China

Application of <120> ISLR gene in preparation of medicine for treating obesity and improving insulin resistance

<130> KHP181115631.7

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

acacaatgag atccgctcgg 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ggctgctaaa ggcgtcccga 20

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gatctccacc gtgccgcccg 20

<210> 4

<211> 19

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ugcuggcacu ccacuguga 19

<210> 5

<211> 2991

<212> DNA

<213> little mouse (Mus musculus)

<400> 5

gcctctttcc ctgtccagtt tctagtgtca gctatgaagc agagtccctg ttgctgaaac 60

tcagtttcat tttgttgaaa ggagtctagc agcacagagc cttcccccgc agccctgctt 120

agagctgtcc cgtgcaccct gagccgggtg tgcaaaccag ccagacccct cctccagcag 180

tcctggtcct gtggacttgc gagcaatcca gtccttagat gctttggttc catcttaaaa 240

gctgttaagc ttgacttcag aagaacagtt tggaggtaag tcaggaaaga aggggccccc 300

gtggctggga gcgaggaagc taggggtgtg tttttagcac atccctctgg gtttgaggga 360

cttggaacag gctcctgctc agagcatctg cttggacaat ctcaacccca gaatttccag 420

ctgcatttga gctgagcctc tggcccccct gccttagctg agaggtccta gctggtttat 480

ttaggcagct gcctgggata gtttgaacag aacaggccac agagtgggag gggtggaggg 540

tgtgtgtgtg cattgcacaa ggggccttgt ctggaccagg gaagcaaaac atacctatgg 600

ggggctctag tgggaggagc tgtagccagg atgtgggagg gcagaaggga ggttctgtgc 660

agtgcggggg gaagggggtg gctggaaaac agatttcaag tcataaagtc agctaggaac 720

aggccaaggc agaaagagct gtgtgcaaag gagaagctgg ggtccacttc catcttgtct 780

tcatcctgac tgactgcaca cacgaccttg gcaagtccca gccctcctct gggcctcggt 840

ttcttctcct gttggggtga gggtggtggg ttaggtggta ttggattctg gctgggttat 900

gtggaacagg gccttctaac ggggagagtt tgggcaggga tctgaggagg gacaactcct 960

ttctatgaat cctaggctca cccgggtggc atgcccttcc ccgtaggacg taccatgcgg 1020

gcactgtgcc tgctttgttg ggctgttctc ctgaacctgg tgcgagcttg tccagagccc 1080

tgtgactgtg gggagaagta tggcttccag attgcagact gtgcctatcg tgacctagag 1140

ggtgtgccac cgggcttccc ggccaatgtg accacactga gcctgtcagc caacaggctg 1200

ccaggcctgc cggagggagc cttcagggaa gtgcccctat tgcagtcgct gtggctggca 1260

cacaatgaga tccgctcggt ggctattggt gctctggccc ctctgagcca tctcaagagt 1320

ctggacctca gccacaacct cctctctgag tttgcctgga gcgacctgca caacctcagc 1380

gctctgcagc tgctcaagat ggacagcaac gagttagcct tcatccctcg ggacgccttt 1440

agcagcctca gcgccctgcg ttccctgcag ctcaaccaca accgcctgca cgcgttggcc 1500

gagggcacct tcgcaccgct caccgcgctg tcccacttgc agatcaatga caaccctttc 1560

gactgcacct gtggcatcgt gtggttcaag acatgggccc tggcctcagc ggtgtctatt 1620

ccagaacagg acaacattgc ctgtactaca ccccacgtcc tgaagggtat cccactaggc 1680

cgcctgccac ccctgccctg ctcagctccc tcagtgcaac taagctacca gcccagccaa 1740

gatggagcag agctacggcc tggcttcgtg ctggcactcc actgtgacgt ggatggacag 1800

ccagtccccc agctccattg gcacattcac accccgggcg gcacggtgga gatcgccagt 1860

cctaatgtag gcactgatgg acgtgccctg cctggtgccc ttgcaaccag tgggcagcca 1920

cgcttccagg cctttgccaa tggcagcctg cttatccctg actttggcaa gctggaggag 1980

ggcacctata gctgcctggc caccaatgag ctaggcagtg ccgaaagctc tgtaaatgtg 2040

gcattggcca ccccaggtga ggggggagag gatgctgtgg ggcacaagtt ccatggcaaa 2100

gcagtggagg gcaagggctg ctatacggtt gacaacgagg tacagccatc cggaccggaa 2160

gacaacgtgg ttatcattta cctcagccgt gctgggcccc cagaagctgc aatagcagca 2220

gacgggaggc ctgcgcagca gttctctggc atacttctgc taggccaaag cctgcttgtt 2280

ctctcctttt tctacttcta actacaccct gccctggttg gctagagcag ctccagggcc 2340

ttcctaactc cccctgatca cgttcctgcc aatgttccgt cttaacacca cgaggtctgg 2400

aattggtgag gcctgaggtt agcctgggga cttcacattt tcctatcacc ttttctaagc 2460

tcatccaggc cgctcattac tccaatttgc agatctgctc agaactagca gctaggatag 2520

aactatatcc caaaactcat catctctagt gctagttgct gctaacagca ttgcctgtgc 2580

tcctagcagg ggcagcctgc taacagggca acaacaatgt cttaacctga cctactttga 2640

gagttctagc catggaggta aagagcttgt ggaggccatc caggtgggca ctggggctgg 2700

gctagaaggg ggtctggagt ggccagtaca ggatctggaa aggaggtacc acgggccatg 2760

gctgggcagg ctaaaagctt tcctgttttt agatgctctc tgatgagata tggaaatcat 2820

ccctcactgg gcctttctct cctctcaccc caagccccac agcatgtgcc tgcctcttga 2880

gacacttact ccccctcctc ctctgaagag gctagccagt ctgggtagca gaaaaataaa 2940

taaataaata aataaataaa taaacaaaca gcatttctga tgctctgctt t 2991

<210> 6

<211> 8764

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tgatgccctc ttgtgtctct gaagacagct acagtgtact tacataaaat aataaataaa 60

tctttaaaaa aaaaaaaagc tttgctggta gggaatgagg aggtcaggcc tgctgttcct 120

gggacagcta gtgaggccct cccatccacg aaaaatttgg ctccctggca ttgaacacaa 180

acttccctga aatgtcctca ttgtaaggaa ctttccttgg gcacatccct cctcccatct 240

ggcctagagt cctcatttgg gccacaggga ggagaacaga tgaaccctaa aatactcctt 300

tatggcacct gatgacccaa caactcattc atacaccaaa ggacttctgg gttcaacagc 360

agcctataag acaaggcatc tatctagcca tggaagaaca aatggctgca ggtcagagca 420

agagtgggaa aggaaaggct gggcaagcag tgagatcaac agagaggaga ccaaccccag 480

acttagggac ctcagaaggc tggaggatga ggtggttttt attttcttct tctctcttct 540

ctcttctctc ttctctcttc tctcttctct cttctctctt ctctcttctc tcttctctct 600

tctctcttct ctcttctctc ttctctcttc tctcttctct cttctctctc ctctcctctc 660

ctcacctcac ctctcctctc ctctcctctc ctctcctctc ctctcctctc ctctcctctc 720

ctctctcttc ttccttcctt ccttccttcc ttccttcctt ccttcttctt ttcctcctcc 780

ttctcctcct cctctccctt ctcttcctcc tccttttagt tttagtttct gtttttgttt 840

ttgagacaga atctctctac acagccctgg ctgtcctgga actctgtaga ccaggctgat 900

ctggagctcc cagaggtctg cctgcctctg cctcccaagt gccaagaata aaggtgtgcg 960

ccacttggtt ggtatcatct gtgccagaag gaaacagtca cagcagaagg ggtagggact 1020

gaggctgatc tgtccttggg tgaactttag agaagtaggg gagagtgggg actttgagct 1080

ccttggaggg cccttcaggt agggctgatg gtatgggctt tgtgtagtga gtgagtgtgt 1140

gtgtctgtgt tctgagaaac ctagtgaggc cctagtcaca agtgagttgc ccctgacaaa 1200

ccctggggtc agatcccccc tgctttgttg aatctgaatg tgtgtaagcc tccaggctct 1260

gcttatccaa actctcccac acagtaagca aggtagaaga aaaggcttcc tggggcagga 1320

gaggcaagaa gggcacacct aaaggaatct ataataactt ccctagcttc agacttggtg 1380

tctgcaagca acactctggg gtcttcaaca gcttcatgac aagcagggga ggtaaggaac 1440

cgtggtgggg ctcctcatac acttctcacc gatgacaata cccacttccc cttggcttca 1500

ccgagagggc aagcagagtc tatcaggtta gcagacaaga agaggaagca tgggcgaggg 1560

caaggagggg ggagacagac aggtatagtc tgtggagggc agaggggtcc atgctaggag 1620

gtgtctttca gttctcctcc agctcctttg acttgaacct tttcctcgat ccattcctac 1680

ccatggtcct ttatgcttga gagaaaggtc tcacatccgc cccacaggat gtagctgccc 1740

ctttcacata gtgtgggatg gtagattcca gaagtagcaa cgctcaccat actgtctagc 1800

atgttacagg acttcaacac caaggggact gagccacagg gactgttcct gagatgaggc 1860

cccgaagcct tgctctgagt gctgggtcct ggaccgtgga acctctttgt ctgcaagcca 1920

gggtgttcag aatccccagc cagtgacacc tctgccaagg ctgatttctg ctctctgtca 1980

ggcatgctgt catctctgtc atcttgcctg cacatacagc ccactcagtg tggggctggg 2040

ctgctgcctt gggagctccc tgcccaacag cctcagactt caggatatat ttacttaaaa 2100

aaaaaaaaaa aaaagcttaa cactttggct tctcgaccag gggttagagc ttggtggcta 2160

ttccctacac tttggtcctt acagttttcc aacaagaagc cccagcacac acacacacac 2220

acacagagag agagagagag agagacagac agacagacag acagacagac agacagacag 2280

acattaagag agacacacag gaatacatac tcacgaaaag actaattcat gtccaaatac 2340

aaaccaccat cacacagtcc cacacagaca cacacatctc ctactgcata tctctaatat 2400

acagacttat ccacacacag tgacatccat ccactcccca ctaccaccaa gcccacagtg 2460

cacacacaac agcacacaca aacaccaaca cagccaggca ggaagaaggg gctgcttttt 2520

tttttttttc ttgttggaag cgaggttaga aatttcccac tttccatgaa atccagtttc 2580

tcacccttcc cctatttaaa aaaaaagcca aaaaaacaaa aacaacccaa ctttctggcc 2640

tcatcttttc ttgggtccta cacagatagt gctgtgactt taagaagttg gaacttcaga 2700

gatgagggag agagagagag agagagagag agggagagag agagagagag agagaacaca 2760

tgaacaaccc caaatttggc ctctttccct gtccagtttc tagtgtcagc tatgaagcag 2820

agtccctgtt gctgaaactc agtttcattt tgttgaaagg agtctagcag cacagagcct 2880

tcccccgcag ccctgcttag agctgtcccg tgcaccctga gccgggtgtg caaaccagcc 2940

agacccctcc tccagcagtc ctggtcctgt ggacttgcga gcaatccagt ccttagatgc 3000

tttggttcca tcttaaaagc tgttaagctt gacttcagaa gaacagtttg gaggtaagtc 3060

aggaaagaag gggcccccgt ggctgggagc gaggaagcta ggggtgtgtt tttagcacat 3120

ccctctgggt ttgagggact tggaacaggc tcctgctcag aattccgaag ttcctattct 3180

ctagaaagta taggaacttc aggtctgaag aggagtttac gtccagccaa gctagcttgg 3240

ctgcaggtcg tcgaaattct accgggtagg ggaggcgctt ttcccaaggc agtctggagc 3300

atgcgcttta gcagccccgc tgggcacttg gcgctacaca agtggcctct ggcctcgcac 3360

acattccaca tccaccggta ggcgccaacc ggctccgttc tttggtggcc ccttcgcgcc 3420

accttctact cctcccctag tcaggaagtt cccccccgcc ccgcagctcg cgtcgtgcag 3480

gacgtgacaa atggaagtag cacgtctcac tagtctcgtg cagatggaca gcaccgctga 3540

gcaatggaag cgggtaggcc tttggggcag cggccaatag cagctttgct ccttcgcttt 3600

ctgggctcag aggctgggaa ggggtgggtc cgggggcggg ctcaggggcg ggctcagggg 3660

cggggcgggc gcccgaaggt cctccggagg cccggcattc tgcacgcttc aaaagcgcac 3720

gtctgccgcg ctgttctcct cttcctcatc tccgggcctt tcgacctgca gcctgttgac 3780

aattaatcat cggcatagta tatcggcata gtataatacg acaaggtgag gaactaaacc 3840

atgggatcgg ccattgaaca agatggattg cacgcaggtt ctccggccgc ttgggtggag 3900

aggctattcg gctatgactg ggcacaacag acaatcggct gctctgatgc cgccgtgttc 3960

cggctgtcag cgcaggggcg cccggttctt tttgtcaaga ccgacctgtc cggtgccctg 4020

aatgaactgc aggacgaggc agcgcggcta tcgtggctgg ccacgacggg cgttccttgc 4080

gcagctgtgc tcgacgttgt cactgaagcg ggaagggact ggctgctatt gggcgaagtg 4140

ccggggcagg atctcctgtc atctcacctt gctcctgccg agaaagtatc catcatggct 4200

gatgcaatgc ggcggctgca tacgcttgat ccggctacct gcccattcga ccaccaagcg 4260

aaacatcgca tcgagcgagc acgtactcgg atggaagccg gtcttgtcga tcaggatgat 4320

ctggacgaag agcatcaggg gctcgcgcca gccgaactgt tcgccaggct caaggcgcgc 4380

atgcccgacg gcgatgatct cgtcgtgacc catggcgatg cctgcttgcc gaatatcatg 4440

gtggaaaatg gccgcttttc tggattcatc gactgtggcc ggctgggtgt ggcggaccgc 4500

tatcaggaca tagcgttggc tacccgtgat attgctgaag agcttggcgg cgaatgggct 4560

gaccgcttcc tcgtgcttta cggtatcgcc gctcccgatt cgcagcgcat cgccttctat 4620

cgccttcttg acgagttctt ctgaggggat caattctcta gagctcgctg atcagcctcg 4680

actgtgcctt ctagttgcca gccatctgtt gtttgcccct cccccgtgcc ttccttgacc 4740

ctggaaggtg ccactcccac tgtcctttcc taataaaatg aggaaattgc atcgcattgt 4800

ctgagtaggt gtcattctat tctggggggt ggggtggggc aggacagcaa gggggaggat 4860

tgggaagaca atagcaggca tgctggggat gcggtgggct ctatggcttc tgaggcggaa 4920

agaaccagct ggggctcgac tagagcttgc ggaacccttc gaagttccta ttctctagaa 4980

agtataggaa cttcatcagt caggtacata atataacttc gtataatgta tgctatacga 5040

agttattagg tggatccgag catctgcttg gacaatctca accccagaat ttccagctgc 5100

atttgagctg agcctctggc ccccctgcct tagctgagag gtcctagctg gtttatttag 5160

gcagctgcct gggatagttt gaacagaaca ggccacagag tgggaggggt ggagggtgtg 5220

tgtgtgcatt gcacaagggg ccttgtctgg accagggaag caaaacatac ctatgggggg 5280

ctctagtggg aggagctgta gccaggatgt gggagggcag aagggaggtt ctgtgcagtg 5340

cggggggaag ggggtggctg gaaaacagat ttcaagtcat aaagtcagct aggaacaggc 5400

caaggcagaa agagctgtgt gcaaaggaga agctggggtc cacttccatc ttgtcttcat 5460

cctgactgac tgcacacacg accttggcaa gtcccagccc tcctctgggc ctcggtttct 5520

tctcctgttg gggtgagggt ggtgggttag gtggtattgg attctggctg ggttatgtgg 5580

aacagggcct tctaacgggg agagtttggg cagggatctg aggagggaca actcctttct 5640

atgaatccta ggctcacccg ggtggcatgc ccttccccgt aggacgtacc atgcgggcac 5700

tgtgcctgct ttgttgggct gttctcctga acctggtgcg agcttgtcca gagccctgtg 5760

actgtgggga gaagtatggc ttccagattg cagactgtgc ctatcgtgac ctagagggtg 5820

tgccaccggg cttcccggcc aatgtgacca cactgagcct gtcagccaac aggctgccag 5880

gcctgccgga gggagccttc agggaagtgc ccctattgca gtcgctgtgg ctggcacaca 5940

atgagatccg ctcggtggct attggtgctc tggcccctct gagccatctc aagagtctgg 6000

acctcagcca caacctcctc tctgagtttg cctggagcga cctgcacaac ctcagcgctc 6060

tgcagctgct caagatggac agcaacgagt tagccttcat ccctcgggac gcctttagca 6120

gcctcagcgc cctgcgttcc ctgcagctca accacaaccg cctgcacgcg ttggccgagg 6180

gcaccttcgc accgctcacc gcgctgtccc acttgcagat caatgacaac cctttcgact 6240

gcacctgtgg catcgtgtgg ttcaagacat gggccctggc ctcagcggtg tctattccag 6300

aacaggacaa cattgcctgt actacacccc acgtcctgaa gggtatccca ctaggccgcc 6360

tgccacccct gccctgctca gctccctcag tgcaactaag ctaccagccc agccaagatg 6420

gagcagagct acggcctggc ttcgtgctgg cactccactg tgacgtggat ggacagccag 6480

tcccccagct ccattggcac attcacaccc cgggcggcac ggtggagatc gccagtccta 6540

atgtaggcac tgatggacgt gccctgcctg gtgcccttgc aaccagtggg cagccacgct 6600

tccaggcctt tgccaatggc agcctgctta tccctgactt tggcaagctg gaggagggca 6660

cctatagctg cctggccacc aatgagctag gcagtgccga aagctctgta aatgtggcat 6720

tggccacccc aggtgagggg ggagaggatg ctgtggggca caagttccat ggcaaagcag 6780

tggagggcaa gggctgctat acggttgaca acgaggtaca gccatccgga ccggaagaca 6840

acgtggttat catttacctc agccgtgctg ggcccccaga agctgcaata gcagcagacg 6900

ggaggcctgc gcagcagttc tctggcatac ttctgctagg ccaaagcctg cttgttctct 6960

cctttttcta cttctaacta caccctgccc tggttggcta gagcagctcc agggccttcc 7020

taactccccc tgatcacgtt cctgccaatg ttccgtctta acaccacgag gtctggaatt 7080

ggtgaggcct gaggttagcc tggggacttc acattttcct atcacctttt ctaagctcat 7140

ccaggccgct cattactcca atttgcagat ctgctcagaa ctagcagcta ggatagaact 7200

atatcccaaa actcatcatc tctagtgcta gttgctgcta acagcattgc ctgtgctcct 7260

agcaggggca gcctgctaac agggcaacaa caatgtctta acctgaccta ctttgagagt 7320

tctagccatg gaggtaaaga gcttgtggag gccatccagg tgggcactgg ggctgggcta 7380

gaagggggtc tggagtggcc agtacaggat ctggaaagga ggtaccacgg gccatggctg 7440

ggcaggctaa aagctttcct gtttttagat gctctctgat gagatatgga aatcatccct 7500

cactgggcct ttctctcctc tcaccccaag ccccacagca tgtgcctgcc tcttgagaca 7560

cttactcccc ctcctcctct gaagaggcta gccagtctgg gtagcagaaa aataaataaa 7620

taaataaata aataaataaa caaacagcat ttctgatgct ctgctttcat ctgcttagaa 7680

ttctgttggg atcaaagact ctttatcaga gggtgggatg gccatatgtg agagttgtgc 7740

caacacagga caagaaccag aggacatatg tggcatggaa ggggagccca gactcattac 7800

taagccttaa catgtaccaa gctgcagatt tactgtcttc aaactagccc atgggatgag 7860

ggagacagaa gtcgacctgc agccaagcta tcgaattcct gcagcccaat tccgatcata 7920

ttcaataacc cttaatataa cttcgtataa tgtatgctat acgaagttat taggtccctc 7980

gaggggatcc acttaaccat tgctttctgc attttgtaaa gggtttgtaa ggtggtggga 8040

aggcctgggc tgtagcccta agaagagtgt caggaataga gatgtatatg gttggggcca 8100

gatcgggcaa gaggaaggaa ggagactgaa ggaaggttgg ggaagcaggg gacagaacac 8160

aaggaagaaa ctgaagacag gaggaaggag acaggaaaac acagtgcacc caggctctct 8220

cttcagatac ctgaggtagg actgagagtt ggaggttagt catagcagcg aggatgtaaa 8280

tagttctgcc agcagagatg ctgcagaact ccttgtctgt gctaggtcag aggggtctcc 8340

ctactcccca cctttaaaga ctggatgtat gctcataggg gtgaagacct tcaggggaag 8400

gcctggcctc gttccagagc cctaggactg ctgagctcag cagactgaag gcaagagatt 8460

gagtctgagt agcagctgtg agtttggcag ctggccagcc cctctcccat agtagtgtcc 8520

acatgtgggg cctcctttct ccctcatgct cctccaactt gcagctcatg tccagtcctt 8580

gtcagcatca accagccagg gccaagaatg tcttcacgtc tgagagaaag caccaggatg 8640

gagccaggtt ccatatgctg tgtccctggg gtaagttact gcccatctct gggtttcaag 8700

tgtgtcagaa ctcaaatgac aaagggcagg ccaggaatgt aactgtgttg tcagagtgct 8760

tgcc 8764

Claims

The application of an ISLR gene inhibitor in preparing a medicine or a composition for treating obesity and improving insulin resistance is characterized in that an ISLR gene targeted inhibitor siRNA is designed and synthesized according to an ISLR gene sequence, the inhibitor siRNA is a substance capable of inhibiting ISLR gene expression from a transcription or translation level, and then the inhibitor siRNA is used as an effective component in the medicine or the composition for treating obesity and improving insulin resistance;

the nucleotide sequence of the inhibitor siRNA is 5'-UGCUGGCACUCCACUGUGA-3', and the target DNA sequence of the inhibitor siRNA is as follows: ggcttcgtgctggcactccactgtgacgt are provided.