CN103834662A - Pig fat metabolism related gene ISLR and application thereof - Google Patents

Abstract

The invention relates to a pig fat metabolism related gene ISLR and application thereof. The pig fat metabolism related gene ISLR has a nucleotide sequence shown in the SEQ ID NO.1 or a nucleotide sequence with the same function, obtained by substitution, deletion or addition of one or more nucleotides on the SEQ ID NO.1 and derived from SEQ ID NO.1. The invention for the first time uses gene chip to screen an EST sequence, which is stimulated by clenbuterol hydrochloride to induce up-regulation of expression. The gene has adjusting effect in the metabolism of pig fat, and provides the basis for the research on metabolism and development of pig fat.

Description

A kind of pork fat metabolism related gene ISLR and application thereof

Technical field

The present invention relates to biological technical field, particularly relate to a kind of pork fat metabolism related gene ISLR and application thereof.

Background technology

Immunoglobulin Superfamily Containing Leucine-Rich Repeat(ISLR, be rich in the immunoglobulin-like albumen of leucine tumor-necrosis factor glycoproteins) be within 1997, from human retina subtracted library, to be researched and analysed the new albumen of the one obtaining by people such as Nagasawa, belong to immunoglobulin superfamily member.This new albumen comprises two main structural region LRR and Tg sample region.LRR is the structural unit of a repetition, is made up of several aminoacid sequences that repeat copy.Infer that the albumen that comprises this structure is at protein work and cell adhesion important role mutually.These protein comprise at least one even multiple LRR structural unit follows the sequence of N-terminal or C-terminal uniqueness.Ig superfamily is one group of protein families that comprises even multiple conservative Ig samples region.Although the diverse in function of this proteinoid, the albumen of all these classes all relates to be done mutually with the adhesion of other albumen or is present in cell surface.The albumen that contains LRR structural domain and Ig region when known report is little, and the function of ISLR albumen needs further to be found.

The over-deposit of human obesity and body fat is focus and the difficult point that foreign scholar pays close attention to for many years.China is maximum in the world Swine Production state, but China's pig industry also exists serious deficiency in evolution, such as the improved seeds of shortage oneself, live pig quality (be hereditary predisposition, comprise average lean ratio, the average carcass weight of livestock on hand pig etc. of the rate of animals delivered to the slaughter-house, slaughter pig) is not high, and feedstuff-meat ratio is far above the developed country of raising pigs.Hot issue about the growth of pig and the research of meat shape always.China's Native Pig kind deposits the very competent of fat, and the average lean ratio of slaughter pig only has more than 50%, and this has affected the economic worth of pig greatly.Drug salts Clenbuterol is a kind of beta 2 adrenoreceptor agonists, is commonly called as " clenbuterol hydrochloride ".Large quantity research shows that clenbuterol can strengthen steatolysis and suppress fatty deposits, improves growth of animals or poultry speed, reduces feedstuff-meat ratio.But it in vivo the residence time long, toxicity is large, may to consumption animal products people cause secondary pollution.Traditional hybridization technique can be brought the improvement that pig flesh characters aspect is certain, but makes slow progress, and is difficult to meet the growing material requisite of people.Therefore replace clenbuterol in the effect aspect raising carcass lean meat percentage in the urgent need to a kind of new method or the little medicine of toxic side effect.

EST is the cDNA partial sequence at cDNA clone two ends, generally shorter.Only measure the partial sequence of gene because EST checks order, also do not need the sequence to clone, thereby there is economic and efficient feature.Obtaining by methods such as the demonstration of mRNA difference, representative variance analyses after the cDNA partial sequence of unknown gene, investigator urgently wishes to be cloned into its full length cDNA sequence, to the function of this gene is studied.

Summary of the invention

The object of the invention is to provide a kind of pork fat metabolism related gene ISLR, or with the nucleotide sequence of the nucleotide coding same protein shown in SEQID NO.1.

Another object of the present invention is to provide the carrier that contains said gene.

Another object of the present invention is to provide the host cell that contains said gene or carrier.

Still a further object of the present invention is to provide said gene in the application regulating in pork fat growth and metabolism.

The present invention utilizes gene chip to carry out gene expression spectrum analysis to the fragrant Adipose Tissue of the drug salts Clenbuterol of feeding, obtain some difference expression genes, its expressed sequence tag (ESTs) sequence is compared less than homologous sequence in state-run biotechnology information center of the U.S. (NCBI), obtain pork fat metabolism related gene ISLR of the present invention, and verified in pig individual level.

The nucleotide sequence of pork fat metabolism related gene ISLR of the present invention as shown in SEQ IDNO.1, this gene cDNA total length 2443bp, coding region is 1287bp, 428 amino acid of encoding are up to more than 86%, more close with people with the kinship of people and mouse.

In addition, consider the degeneracy of codon, for example, can, in its coding region, not change under the condition of aminoacid sequence, or in its non-coding region not affecting under the condition of protein expression, the gene order of the above-mentioned albumen of encoding is modified.Therefore, the present invention also comprises replacement, the interpolation that the gene order of the above-mentioned albumen of encoding is carried out and/or lacks one or more Nucleotide, has the nucleotide sequence with above-mentioned encoding gene with identical function.The present invention also comprises just sequence or the antisense sequences based on described gene, comprises cloning vector or the expression vector, the host cell that contains described carrier etc. that contain described nucleotide sequence or its fragment.

Specifically, the fatty tissue of the fragrant pig that the present invention feeds and do not feed drug salts Clenbuterol carries out cDNA chip hybridization, has the ESTs of 45 differential expressions, comparison NCBI, wherein 9 comparisons, less than any homologous sequence, belong to the also gene of unknown function of middle unknown nucleotide sequence of pig.Electronics extends the EST(rpig-3584 of differential expression), comparison is to people's Islr gene.And extraction RNA carries out the technological line of RT-PCR, obtain its complete encoding sequence.Recycling 5 ' RACE and 3 ' RACE obtain the cDNA sequence of the 2443bp of total length, and its nucleotide sequence, as shown in SEQ ID NO.1, is compared and found that it and Human genome ISLR have high homology with people's sequence.

Utilize the expression amount of fluorescence quantitative PCR detection rpig_3584 in the fragrant Adipose Tissue of experimental group and control group.Find that rpig_3584 presents up-regulated expression in experimental group, and significant difference.

According to technique scheme, beneficial effect of the present invention is:

The present invention utilizes gene chip to screen to be subject to hydrochloric acid Ke Lunteluo to stimulate the est sequence that causes up-regulated first, utilize this primers, obtain the expression level of ISLR gene in experimental group and control group pig body by quantitative pcr amplification, thereby determine the effect of this gene in pork fat metabolism.This is the basic fundamental of ISLR Function Identification and analysis, comprises the detection to this genetic expression position, expression time, expression level many aspects; Also comprised this gene is being carried out to human intervention simultaneously, as crossed after expression or siRNA interference, the qualification evaluation criteria of the important indicator to adipose tissue development and metabolic effect.

Brief description of the drawings

Fig. 1 is detection of expression result in the fatty tissue of ISLR before and after Clenbuterol hydrochloride is processed; The non-CLB that P1, P3 were illustrated respectively in for three monthly ages processes and CLB processing pig, and the non-CLB that P2, P4 are illustrated respectively in age in April processes and CLB processing pig.

Embodiment

Following examples are used for illustrating the present invention, but are not used for limiting the scope of the invention.Without departing from the spirit and substance of the case in the present invention, the amendment that the inventive method, step or condition are done or replacement, all belong to scope of the present invention.

If do not specialize, the conventional means that in embodiment, technique means used is well known to those skilled in the art.

The molecular cloning of embodiment 1 ISLR gene

1, the fatty tissue of the fragrant pig of drug salts Clenbuterol being fed and not fed carries out cDNA chip hybridization, there is the ESTs of 45 differential expressions, comparison NCBI, wherein 9 comparisons, less than any homologous sequence, belong to the also gene of unknown function of middle unknown nucleotide sequence of pig.The EST(rpig-3584 of differential expression) nucleotide sequence as follows:

CCCGGGCTGCAGGAATTCGGCACGA gTTTGGCCGGAAGG aGGGAGTTTACGGGCTGCCTGGGCTCCCTTCCTGCAGCCTCCT cTCTGCAGACCTTCTCAGGCACCCTGTCCCGGGACGAAAAGG gCACCCAGGCTTGCAG(underscore mark part there is part in cDNA for est sequence).

2, electronics extends the EST(rpig-3584 of differential expression), obtain the extension sequence with complete open reading frame, and comparison is to people's Islr gene.According to extension sequence design Auele Specific Primer.Upstream and downstream primer is respectively:

Upstream primer: 5 '-TGTTGTTTTGGGTTCCGTCT-3 ';

Downstream primer: 5 '-GATGCATACCTGGAGGGAAA-3 '.

3, utilize the Auele Specific Primer of design to extract RNA to fragrant Adipose Tissue, carry out RT-PCR amplification, obtain the object band of pig ISLR gene.The PCR product of the ISLR gene that recovery is obtained is connected with pGM-T, adopt the pGM-T clone test kit clone object fragment of TIANGEN Biotech (Beijing) Co., Ltd., connecting product adopts heat shock conversion method to proceed to bacillus coli DH 5 alpha competent cell (purchased from Tian Gen biochemical technology company limited), and screening positive clone, through Shanghai biotechnology company limited order-checking, institute check order be listed as consistent with expected results.ISLR gene ORF sequence is shown in the long 1287bp of SEQ ID NO.1().

4, taking pig ISLR gene ORF sequence as basis, utilize the cDNA sequence of the 2443bp of 5 ' RACE and 3 ' RACE acquisition total length,

5 ' RACE primer: 5 '-ACGGAACCCAAAACAACAAA-3 '

3 ' RACE primer: 5 '-ATGAGGTGATGCCCTAACCA-3 '

The nucleotide sequence of the pig ISLR full length gene cDNA sequence obtaining is as shown in SEQ IDNO.1.

Embodiment 2 functional analyses of ISLR gene in Adipose Tissue

1, the est sequence of the fragrant Adipose Tissue differential expression of experimental group and control group is carried out to RNA extraction, also again verify gene chip result simultaneously.Experimental group is 3 monthly age pigs (P3) and the 4 monthly age pigs (P4) that drug salts Clenbuterol is fed, control group is 3 monthly age pigs (P1) and the 4 monthly age pigs (P2) of not feeding, and uses the RNA of TIANGEN Biotech (Beijing) Co., Ltd. to extract test kit extraction.

2, reverse transcription RNA

1) in PCR pipe, add successively

2) in 70 DEG C of sex change 5min, be placed in rapidly on ice, leave standstill 1min.

3) in PCR pipe, add successively

4) after mixing, centrifugal a little.

5) 42 DEG C, reaction 50min.

6) 72 DEG C, effect 15min.

7) product is directly used in PCR or is placed in-20 DEG C of preservations.

3, primer is synthetic

The primer of implementation sequence, comprises

Upstream primer: 5 '-TGTTGCTGCAGAGAAGCAGT-3 ' and

Downstream primer: 5 '-ACGGAACCCAAAACAACAAA-3 '.

4, amplification rpig_3584 carries out fluorescent quantitation, operates with reference to the quantitative PCR Mix of American AB I company test kit specification sheets.

1) formulation of typical curve

Using GAPDH as internal standard gene drawing standard curve.

2) according to following reaction system application of sample on 96 orifice plates

3) adopt ABI7900HT fluorescence real-time quantitative PCR instrument, react by following condition: 55 DEG C of 5min; 95 DEG C of 10min; 95 DEG C of 15s, 60 DEG C of 1min, 40 circulations.

4) last 95 DEG C of 15s on ABI7900HT fluorescence real-time quantitative PCR instrument, 60 DEG C of 15s, 95 DEG C of 15s make melting curve again, and each sample, negative control (taking water as template) and typical curve respectively do 3 repetitions.

From Fig. 1 quantitative result, EST (rpig_3584) presents up-regulated expression in experimental group, and significant difference, consistent with the result of chip.

Although above the present invention is described in detail with a general description of the specific embodiments, on basis of the present invention, can make some modifications or improvements it, this will be apparent to those skilled in the art.Therefore, these modifications or improvements without departing from theon the basis of the spirit of the present invention, all belong to the scope of protection of present invention.

Claims (4)

1. a pork fat metabolism related gene ISLR, it is:

1) nucleotide sequence shown in SEQ ID NO.1;

2) this sequence through replace, lack or add one or several Nucleotide and have same function by the derivative nucleotide sequence of SEQ ID NO.1.

2. contain the carrier of gene described in claim 2.

3. contain the host cell of carrier described in gene described in claim 1 or claim 2.

4. the application of gene in the growth of adjusting pork fat and metabolism described in claim 1.

Images