AU2017101108A4

AU2017101108A4 - Construction method of animal model of mucopolysaccharidosis type II and use thereof

Info

Publication number: AU2017101108A4
Application number: AU2017101108A
Authority: AU
Inventors: En GAO; Zengmiao Hou; Min Li; Xiaoying Li; Xiaolin Yang; Jinli Zhao
Original assignee: Shaanxi HuiKang Bio Tech Co Ltd
Current assignee: Shaanxi HuiKang Bio Tech Co Ltd
Priority date: 2016-09-06
Filing date: 2017-08-15
Publication date: 2017-09-14
Anticipated expiration: 2025-08-15
Also published as: CN106282231B; CN106282231A; WO2018045727A1

Abstract

The present invention provides a construction method of an animal model of mucopolysaccharidosis type II, comprising steps of: designing target sites for IDS gene of mice, synthesizing a oligonucleotide chain, annealing the synthesized oligonucleotide chain followed by being ligated with pUC57-T7-sgRNA plasmid to generate sgRNA expression vectors; generating fertilized eggs of the mice; mixing uniformly transcribed Cas9 mRNA and sgRNA to obtain a RNA mixture, microinjecting the RNA mixture into the cytoplasm of the fertilized eggs, then implanting the surviving fertilized eggs into female mice for propagation to generate FO generation mice; extracting genomic DNA of the FO generation mice as a template to perform a PCR reaction with a primer comprising target sites of sgRNA, digesting the reaction products, and selecting mutated mice so as to determine Founder mice; and generating F1 generation mice by mating the Founder mice with wild-type male mice. The present invention also provides an animal model constructed by the method and the use of the model in the study on mucopolysaccharidosis type II.

Description

CONSTRUCTION METHOD OF ANIMAL MODEL OF MUCOPOLYSACCHARIDOSIS TYPE II AND USE THEREOF 2017101108 15 Aug 2017

Technical Field

The present invention belongs to the technical field of medical biology, and in particular, the present invention relates to a construction method of an animal model.

Background of the Invention

Mice models play a key role in the study on the pathogenesis of human diseases and drug screening, and especially have significant value in evaluating treatment effects of drugs and selecting treatment methods.

Gene knockout is a new molecular biology technology developed since the late 80’s and is a technology that inactivates or deletes a specific gene of a body through a certain route. In general, gene knockout means that a target gene fragment is replaced with a designed homologous fragment by mainly using the principle of homologous recombination of DNA, so as to achieve the purpose of gene knockout. This is a complex molecular biology technology, and also known as “gene targeting” technology. So far, thousands of mutated mice models have been constructed by using this technology. However, this traditional gene knockout method is complex, time-consuming and costly. In recent years, people have been looking for a new method which is faster and more economical and has better application.

Mucopolysaccharidosis type II (MPS II, MIM309900), also known as Hunter syndrome, is an X-linked recessive hereditary disease. Gene mutation leads to deficiency of lysosomal enzyme iduronate-2-sulfatase (IDS), so that a large amount of mucopolysaccharides (MPS) are deposited in the body, and a large amount of dermatin sulfate B (DS) and heparitin sulfate (HS) are excreted into urinary. Patients with MPS II are generally normal at birth, but with more and more mucopolysaccharides deposited in the body, the MPS II course is progressive increasingly and typical in symptoms, and has poor prognosis. IDS gene is located in Xq27.3-Xq28, and MPS II is highly related to IDS gene mutation. MPS II is also known as “orphan disease” due to the very low incidence. At present, it is still difficult to research and treat this disease around the world. 1 2017101108 15 Aug 2017

Disclosure of the Invention

In order to overcome the defects of complex process, harsh conditions, and high cost when constructing an animal model currently, as well as the problems that current studies on mucopolysaccharidosis type II lack a researchable animal model, the present invention provides a construction method of an animal model of mucopolysaccharidosis type II, the animal model of mucopolysaccharidosis type II, and the use of the animal model in the study on mucopolysaccharidosis type II.

In the first aspect of the present invention, there is provided a construction method of an animal model of mucopolysaccharidosis type II, which comprises steps of: (1) designing target sites for IDS gene of mice, synthesizing a oligonucleotide chain, annealing the synthesized oligonucleotide chain followed by being ligated with pUC57-T7-sgRNA plasmid to generate sgRNA expression vectors; (2) generating fertilized eggs of the mice; (3) mixing uniformly transcribed Cas9 mRNA and sgRNA to obtain a RNA mixture, micro injecting the RNA mixture into the cytoplasm of the fertilized eggs, then implanting surviving fertilized eggs into female mice for propagation to generate F0 generation mice; (4) extracting genomic DNA of the F0 generation mice as a template to perform a PCR reaction with a primer comprising target sites of sgRNA, digesting the reaction products, and selecting mutated mice so as to determine Founder mice; and (5) generating FI generation mice by mating the Founder mice with wild-type male mice.

The aforementioned construction method, in step (1), the following two pairs of oligonucleotide chains are synthesized: ms Ids E5-l-sgRNAl: T AGG AC A A AGC AGATTGGCG, and AAACCGCC AATCTGCTTTGT; ms Ids E5-2-sgRNA2: TAGGATGTGGCAGATGTGCCTGA, and AAACTCAGGCACATCTGCCACAT. 2 2017101108 15 Aug 2017

The aforementioned construction method, in step (2), 4 to 5 weeks old female mice, which are used as donors, are intraperitoneally injected with PMSG and hCG for superovulation, then mated with male mice to obtain fertilized eggs of the mice on the next day.

The aforementioned construction method, in step (4), the primers comprising target sites of sgRNA are: ms Ids E5 C9 forward primer: AGTT CT GGT CT GGAG AC AC AATT; and ms Ids E5 C9 reverse primer: AGGCATCCTGGTAGGTAGGTTAT.

The aforementioned construction method, in step (4), the volume of the PCR reaction system is 50 pL, and the conditions of the PCR reaction are shown as follows: initial denaturation at 95 “C for 5 min; followed by 30 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 30 s; and finally extension at 72 °C for 10 min.

The aforementioned construction method, in step (4), the digestion is performed with T7 endonuclease.

The aforementioned construction method, in step (4), after the mutated mice are selected, the mutations are firstly detected and determined by TA cloning and sequencing, then Founder mice are determined.

The aforementioned construction method, the construction method further comprises genotype identification of the animal model of mucopolysaccharidosis type II, which comprises steps of: extracting genomic DNA of the FI generation mice, designing primers comprising target sites of sgRNA , performing a PCR reaction by using the extracted genomic DNA of the FI generation mice as templates, and sequencing the product of the PCR reaction.

The aforementioned construction method, the primers comprising the target sites of sgRNA are: ms Ids E5 C9 forward primer: AGTTCTGGTCTGGAGACACAATT; and ms Ids E5 C9 reverse primer: AGGCATCCTGGTAGGTAGGTTAT. 3 2017101108 15 Aug 2017

The aforementioned construction method, the volume of the PCR reaction system is 50 μι, and the conditions of the PCR reaction are shown as follows: initial denaturation at 95 C for 5 min; followed by 30 cycles of denaturation at 95 C for 30 s, annealing at 55 C for 30 s, and extension at 72 °C for 30 s; and finally extension at 72 C for 10 min.

The aforementioned construction method, the construction method further comprises phenotype analysis of the animal model of mucopolysaccharidosis type II, which comprises steps of: extracting tissues from hearts, livers, spleens and kidneys of the FI generation mice and the male wild type mice, respectively, to make tissue sections; staining the tissue sections with Alcian blue; and comparing the tissue sections of the FI generation mice with those of the male wild type mice.

In the second aspect of the present invention, there is provided an animal model of mucopolysaccharidosis type II constructed by the construction method of the first aspect.

The aforementioned mucopolysaccharidosis type II animal model, nucleotide acid 18956-18975bp is deleted from idose-2-sulfatase gene in X chromosome, and the sequence of the nucleotide acid 18956-18975bp is AACTCCACGCCAATCTGCTT.

In the third aspect of the present invention, there is provided the use of the animal model of mucopolysaccharidosis type II constructed by the construction method of the first aspect or the animal model of mucopolysaccharidosis type II of second aspect in the study on mucopolysaccharidosis type II.

Compared with prior art, the construction method of an animal model of mucopolysaccharidosis type II provided by the present invention at least has the following advantages: (1) The mice model of mucopolysaccharidosis type II constructed in the present invention based on the CRISPR/Cas9 gene knockout technology provides an extremely important animal model for a further study on the pathogenesis of mucopolysaccharidosis type II and evaluation of therapeutic effect. 4 (2) It takes a short period, only 2 months, to obtain the mice model of mucopolysaccharidosis type II by using the method according to the present invention. 2017101108 15 Aug 2017 (3) The IDS gene knockout model mice obtained in the present invention, which have a genotype labeled as X'ldsXlds, are mice with normal phenotypes, and may be normally cultivated in the laboratory. The present inventor successfully established an IDS gene knockout model mice strain in which the gene can be stably inherited, through mating the IDS gene knockout model mice with wild-type C57BL/6 male mice (genotype XldsY), the gene of model mice can be stably inherited. The IDS gene knockout model mice strain are mated with wild-type C57BL/6 male mice (genotype XldsY) to generate FI generation mice. Of the FI generation mice, theoretically, 25% have the genotype X'ldsY, namely the animal model of mucopolysaccharidosis type II mice (genotype XldsY), while theoretically 25% have the genotype X‘ldsXlds, namely IDS gene knockout model mice (genotype XldsY). In this case, once the IDS gene knockout model mice (genotype X"ldsXlds) are generated, the animal model of mucopolysaccharidosis type II mice (genotype XldsY) could be generated by a simple natural mating process in the laboratory, without the need for a complex experiment for gene knockout. Thus, IDS gene knockout model mice and IDS gene knockout model mice of the animal model of mucopolysaccharidosis type II mice can be generated simultaneously through the method according to the present invention, which is the most ingenious point in the technical solutions of the present invention.

Brief Description of the Drawings

Figure 1 is a schematic diagram illustrating the mechanism of RNA-mediated Cas9 system targeting genome modification;

Figure 2 illustrates the modification of CRISPR/Cas9-mediated IDS gene;

Figure 3 illustrates the structure of DNA sequence at the target site;

Figures 4(A) and 4(B) illustrate the sequencing results of identifying the genotype of the animal model of mucopolysaccharidosis type II mice; and

Figure 5 illustrates the results of staining the tissue sections of the animal model of 5 mucopolysaccharidosis type II mice with Alcian blue. 2017101108 15 Aug 2017

Specific Mode for Carrying out the Present Invention

In order to fully understand the purposes, characteristics and effects of the present invention, the present invention will be described in detail with reference to the following detailed description. However, it will be appreciated that the present invention is not limited to that. Unless otherwise specified, the experimental methods and the conditions, which are not defined in the following specific embodiments, are performed in accordance with conventional methods and conditions, or in accordance with the product specification. The substances involved in the following specific embodiments are commercially available.

The CRISPR/Cas9 gene knockout technology according to the present invention is the newest method for the site-directed construction of gene knockout mice after the techniques such as zinc finger nuclease and TALEN, and exhibits great potential for the site-directed modification of genes. The present invention provides an animal model of mucopolysaccharidosis type II mice based on CRISPR/Cas9 gene knockout technology and a construction method thereof, which provides an extremely important animal model for the further study on the pathogenesis of mucopolysaccharidosis type II and evaluation of therapeutic effect. I. Construction of the animal model of mucopolysaccharidosis type II mice 1. Construction of CRISPR-targeting modified gene vector

The present inventors designed two target sites for IDS gene (targeting 18963-1898 lbp nucleotide region and 18985-19005bp nucleotide region of exon 5 (nucleotide 18934-19134bp) of Mouse BAC-146N21 Chromosome X contains iduronate-2-sulfatase gene (Accession; AC002315), wherein ms Ids E5-l-sgRNAl targets 18963-1898lbp nucleotide region, and ms Ids E5-2-sgRNA2 targets 18985-19005bp nucleotide region), and synthesized two pairs of oligonucleotide chains (ms Ids E5-l-sgRNAl: TAGGACAAAGCAGATTGGCG and AAACCGCCAATCTGCTTTGT; and ms Ids E5-2-sgRNA2: TAGG AT GT GGC AG AT GT GC CTG A and AAACTC AGGC AC ATCTGCC AC AT) for the preparation of sgRNA. The mechanisms are shown in Figure 1. The synthesized 6 oligonucleotides were annealed (at 95 "C for 5 min, then naturally cooled to room temperature), and ligated into pUC57-T7-sgRNA expression vector (Addgene, N0.51132) digested with Bsal to construct sgRNA expression vector. Whether or not the ligated fragment is correct is determined by sequencing so as to select the correct clones. After expanding culture, the plasmids were extracted for preparing in vitro transcription templates. 2017101108 15 Aug 2017

Cas9 (D10A) expression plasmid (Pstl374-NLS-Cas9-ZF) was digested by Agel to be linearized, purified by phenol-chloroform extraction, and then dissolved in nuclease-free water as a template for in vitro transcription. The synthesis of Cas9 mRNA was performed by using the T7 Ultra Kit (Ambion, AM 1345) and utilizing T7 RNA polymerase in vitro. The sgRNA expression vector was digested by Dral to be linearized, purified by phenol-chloroform extraction, and then dissolved in nuclease-free water as a template for in vitro transcription. The in vitro synthesis of sgRNA was performed by using the MEGAshortscript Kit (Ambion, AM1354) and utilizing T7 RNA polymerase in vitro. 2. Superovulation of embryonic donor mice

The female mice donors were administered with PMSG (serum gonadotropin), and 46 hours later injected with hCG (human chorionic gonadotropin), then mated with male mice. The fertilized eggs were taken the next day for microinjection. 3. Micro injection and embryo transplantation

The transcribed Cas9 mRNA and sgRNA were mixed and adjusted to concentrations of 20 ng/μΐ and 12.5 ng/μΐ of each sgRNA. The RNA mixture was injected into the cytoplasm of the mice fertilized eggs through microinjection. 143 surviving fertilized eggs were transplanted into five pseudopregnant C57BL/6 female mice, with each pseudopregnant female mouse being transplanted 28 fertilized eggs. About 3 weeks later, a total of 19 F0 generation mice were born in which 17 were survived. 4. Identification of Founder mice

Embryo-transplanted mice were bom on about the 19th day after surgery. 20 days after the mice were bom, DNA was extracted by cutting-tail method and identified by PCR. A pair of 7 primers (ms Ids E5 C9 For: AGTTCTGGTCTGGAGACACAATT, and ms Ids E5 C9 Rev: AGGCATCCTGGTAGGTAGGTTAT) comprising sgRNA target sites was designed by Sangon Biotech (Shanghai) Co., Ltd. The volume of PCR reaction system was 50pL (the reagents used in PCR reaction were purchased from Tiangen Biotech (Beijing) Co., Ltd.), and the reaction conditions were shown as follows: 95 °C for 5 min; (95 °C for 30s, 55 °C for 30s, and 72 °C for 30s), 30 cycles; 72 °C for lOmin; then saved at 4 °C. The amplified fragment had a length of 466bp. The PCR product was purified by a PCR purification kit (Tiangen Biotech (Beijing) Co., Ltd.). 100 ng of the purified PCR product was denatured and renatured in NEB Buffer 2 and subsequently incubated with T7 endonuclease (NEB, M0302L) at 37 °C for 40 min, then separated by 1.5% agarose gel electrophoresis. T7 endonuclease is capable of recognizing and cleaving incomplete pairing double-stranded DNA. If CRISPR/Cas9 causes a mutation to the target site, it could be recognized by the enzyme and the double-stranded DNA is cleaved. Thus, if there is a band except the PCR product band in agarose gel electrophoresis, the annealed product could be identified and cleaved by the T7 endonuclease, indicating that there may be mutation in the sequence of the target DNA (Figure 2). In order to further verify the presence of mutation, as well as the specific cases of mutation, TA-cloning and sequencing were performed for further detection of mutations (Figure 3). 2017101108 15 Aug 2017 5. FI generation mice generated by mating Founder mice and wild-type mice 4 weeks old female Founder mice were mated with wild-type male mice, and mice were identified by PCR 20 days after birth. If a positive mouse was bom, it means that a transgenic gene has been integrated into germ cell and the strain was established successfully. The IDS gene knockout mice with the genotype labeled as X ldsXlds were obtained. FI generation mice were obtained by mating F0 generation No. 23-1 female mice ( X"'dsX'ds) with wild-type C57BL/6 male mice (XldsY). II. Genotype identification of the animal model of mucopolysaccharidosis type II mice 20 days after the birth of FI generation mice, the FI generation male mice and wild-type C57BL/6 male mice were extracted genomic DNA by cutting-tail method, then the target gene was amplified. A pair of primers (ms Ids E5 C9 For: AGTTCTGGTCTGGAGACACAATT, and ms Ids E5 C9 Rev: 8 AGGCATCCTGGTAGGTAGGTTAT) comprising sgRNA target site was designed by Sangon Biotech (Shanghai) Co., Ltd. The volume of PCR reaction system was 50pL (the reagents used in PCR reaction were purchased from Tiangen Biotech (Beijing) Co., Ltd.), and the reaction conditions were shown as follows: 95 °C for 5 min; (95 °C for 30s, 55 °C for 30s, and 72 °C for 30s), 30 cycles; 72 °C for lOmin; then saved at 4 °C. The amplified fragment had a length of 466bp. The PCR product was purified by a PCR purification kit (Tiangen Biotech (Beijing) Co., Ltd.). The purified PCR product was directly sequenced, and the sequencing results were shown in Figures 4(A) and 4(B). It can be seen that an animal model of mucopolysaccharidosis type II mice with genotype X'ldsY was obtained. It was also shown that 20 bases of nucleotide 18956-18975bp were deleted in Mouse BAC-146N21 Chromosome X containing iduronate-2-sulfatase gene (Accession: AC002315), and the base sequence was AACTCCACGCCAATCTGCTT. The results were consistent with the expected, that is, the genotype of the animal model of mucopolysaccharidosis type II mice (genotype X'ldsY) was identified to be correct. 2017101108 15 Aug 2017

Ill, Phenotypic analysis of the animal model of mucopolysaccharidosis type II mice

The mice were sacrificed through cervical dislocation. Four tissues of heart, liver, spleen and kidney of the animal model of mucopolysaccharidosis type II mice (genotype X'ldsY) and wild-type male mice were extracted respectively, to prepare tissue paraffin sections. Upon the sections were prepared, the sections were stained with Alcian blue. Alcian blue is a cationic dye, and is most specific for showing acidic mucus substances. Compared with the tissues sections of wild-type mice which were stained with Alcian blue (Figure 5), a clear phenomenon of mucopolysaccharide aggregation was found in the tissue sections of heart, liver, spleen, and kidney of the animal model of mucopolysaccharidosis type II mice, which demonstrated that an animal model of mucopolysaccharidosis type II mice was successfully constructed.

Finally, it is to be noted that the foregoing is merely illustrative of specific embodiments of the present invention, and that modifications and variations of the present invention may be made by those skilled in the art. If such modifications and variations are within the scope of the appended claims and their equivalents, they shall be deemed to be within the scope of protection of the present invention. 9

Claims

What is claimed is:

1. A construction method of an animal model of mucopolysaccharidosis type II, characterized in that, the method comprises steps of: (1) designing target sites for IDS gene of mice, synthesizing a oligonucleotide chain, annealing the synthesized oligonucleotide chain followed by being ligated with pUC57-T7-sgRNA plasmid to generate sgRNA expression vectors; (2) generating fertilized eggs of the mice; (3) mixing uniformly transcribed Cas9 mRNA and sgRNA to obtain a RNA mixture, micro injecting the RNA mixture into the cytoplasm of the fertilized eggs, then implanting surviving fertilized eggs into female mice for propagation to generate FO generation mice; (4) extracting genomic DNA of the FO generation mice as a template to perform a PCR reaction with a primer comprising target sites of sgRNA, digesting the reaction products, and selecting mutated mice so as to determine Founder mice; and (5) generating FI generation mice by mating the Founder mice with wild-type male mice.
2. The construction method of claim 1, characterized in that, in step (1), the following two pairs of oligonucleotide chains are synthesized: ms Ids E5-l-sgRNAl: TAGGACAAAGCAGATTGGCG, and AAACCGCCAATCTGCTTTGT; ms Ids E5-2-sgRNA2: TAGGATGTGGCAGATGTGCCTGA, and AAACTCAGGCACATCTGCCACAT.
3. The construction method of claim 1, characterized in that, in step (2), 4 to 5 weeks old female mice, which are used as donors, are intraperitoneally injected with PMSG and hCG for superovulation, then mated with male mice to obtain fertilized eggs of the mice on the next day.
4. The construction method of claim 1, characterized in that, in step (4), the primers comprising target sites of sgRNA are: ms Ids E5 C9 forward primer: AGTTCTGGTCTGGAGACACAATT; and ms Ids E5 C9 reverse primer: AGGCATCCTGGTAGGTAGGTTAT.
5. The construction method of claim 1, characterized in that, in step (4), the volume of the PCR reaction system is 50 liL, and the conditions of the PCR reaction are shown as follows: initial denaturation at 95 °C for 5 min; followed by 30 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 30 s; and finally extension at 72 "C for 10 min.
6. The construction method of claim 1, characterized in that, in step (4), the digestion is performed with T7 endonuclease.
7. The construction method of claim 1, characterized in that, in step (4), after the mutated mice are selected, the mutations are firstly detected and determined by TA cloning and sequencing, then Founder mice are determined.
8. The construction method of any one of claims 1-7, characterized in that, the construction method further comprises genotype identification of the animal model of mucopolysaccharidosis type II, which comprises steps of: extracting genomic DNA of the FI generation mice, designing primers comprising target sites of sgRNA, performing a PCR reaction by using the extracted genomic DNA of the FI generation mice as templates, and sequencing the product of the PCR reaction.
9. The construction method of claim 8, characterized in that, the primers comprising the target sites of sgRNA are: ms Ids E5 C9 forward primer: AGTTCTGGTCTGGAGACACAATT; and ms Ids E5 C9 reverse primer: AGGC ATCCTGGTAGGTAGGTTAT.
10. The construction method of claim 8, characterized in that, the volume of the PCR reaction system is 50 iiL, and the conditions of the PCR reaction are shown as follows: initial denaturation at 95 °C for 5 min; followed by 30 cycles of denaturation at 95 °C for 30 s, annealing at 55 G for 30 s, and extension at 72 °C for 30 s; and finally extension at 72 °C for 10 min.
11. The construction method of any one of claims 1-7, characterized in that, the construction method further comprises phenotype analysis of the animal model of mucopolysaccharidosis type II, which comprises steps of: extracting tissues from hearts, livers, spleens and kidneys of the FI generation mice and the male wild type mice, respectively, to make tissue sections; staining the tissue sections with Alcian blue; and comparing the tissue sections of the FI generation mice with those of the male wild type mice.
12. An animal model of mucopolysaccharidosis type II, constructed by the construction method of any one of claims 1-11.
13. The animal model of mucopolysaccharidosis type II of claim 12, characterized in that, nucleotide acid 18956-18975bp is deleted from idose-2-sulfatase gene in X chromosome, and the sequence of the nucleotide acid 18956-18975bp is AACTCCACGCCAATCTGCTT.
14. Use of the animal model of mucopolysaccharidosis type II constructed by the construction method of any one of claims 1-11 or the animal model of mucopolysaccharidosis type II of claim 12 or 13 in the study on mucopolysaccharidosis type II.