CN110468156A - Correct the gene editing system and its application of the point mutation of ob/ob mouse Leptin - Google Patents
Correct the gene editing system and its application of the point mutation of ob/ob mouse Leptin Download PDFInfo
- Publication number
- CN110468156A CN110468156A CN201910752482.9A CN201910752482A CN110468156A CN 110468156 A CN110468156 A CN 110468156A CN 201910752482 A CN201910752482 A CN 201910752482A CN 110468156 A CN110468156 A CN 110468156A
- Authority
- CN
- China
- Prior art keywords
- crispr
- cas9 system
- sequence
- cas9
- sgrna2
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
- A61K48/0066—Manipulation of the nucleic acid to modify its expression pattern, e.g. enhance its duration of expression, achieved by the presence of particular introns in the delivered nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Cell Biology (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a kind of CRISPR-Cas9 system, including sgRNA1 expression cassette, sgRNA2 expression cassette and Cas9 expression cassette, and the donor sequence for repairing point mutation, sgRNA1 and sgRNA2 are targeted respectively to be had and DNA sequence downstream on site to be edited.The present invention includes that the CRISPR-Cas9 system of double sgRNA substantially increases the efficiency of cutting double-stranded DNA；Additionally provide non-therapeutic application of the CRISPR-Cas9 system in gene editing；It additionally provides the CRISPR-Cas9 system and is preparing the application in the drug for treating hereditary disease caused by single gene mutation.Cutting efficiency may be up to 75%, and two sgRNA and undershooting-effect be not detected.According to the position sgRNA, donor sequence has carried out codon optimization according to Codon degeneracy, and donor is avoided to be cut by crispr-cas9 system.
Description
Technical field
The present invention relates to biomedicine fields.More specifically it relates to which one kind can be used for correcting ob/ob murine preadipocyte cell
The CRISPR-Cas9 system of leptin gene point mutation and its application.
Background technique
Obesity is a kind of chronic metabolic disease as caused by many factors such as h and E, with eating habit and life
Mode is closely related.In recent years, incidence of obesity increases at an amazing speed, becomes global public health problem.Data
Show that the population of global one third faces overweight and fat crisis, global adult obese disease incidence is highest be Egypt about
Be 35%, it be the U.S. is about 13% that Adolescent Obesity rate is highest, the Overweight-obesity size of population it is most be China, surpassed
Cross 300,000,000 people.
It has now found that with fat related gene up to more than 600 kinds.Studying more have FTO gene, leptin (Leptin), increases
Appetite plain gene (OrexinA, B), peptide tyrosine tyrosine (PYY), SECL6B, Melanocortin 4 receptor (Mc4R), neuropeptide tyrosine base
Because of (NPY2R), gamma ammonia butyric acid 2 (GAD2) etc..
The homozygous mutation of leptin gene causes congenital leptin to lack, people or other mammals occur satiety missing,
Bulimia nerovsa and extreme early onset are fat, with symptoms such as a variety of metabolism, hormone and dysimmunities.Its optimal treatment method
It is that the mutated gene is made to be modified to normal leptin gene by way of gene editing.
Gene editing (gene editing) is based on specific artificial endonucleases' technology, to target gene group DNA sequence
Column are specifically lacked, are inserted into or modified, to change the specific hereditary information in biomaterial.
Currently used gene editing technology is based on II type CRISPR-Cas9 system.The system include Cas9 albumen and
sgRNA.Wherein, Cas9 albumen is containing there are two the endonucleases of nuclease domain RuvC and HNH.The cutting of RuvC structural domain
Incomplementarity DNA chain, and HNH structural domain cuts complementary dna chain.SgRNA is by trans-activation crRNA (trans-activating
CrRNA, tracrRNA) and CRISPR RNA (crRNA) composition.CrRNA is by the protospacer 20-nt element and and tracrRNA
Complementary additional sequences composition.CrRNA be usually engineered to containing there are two critical section single-stranded sgRNA: the end 3' with
The duplex-RNA constructs that Cas9 is combined and the boot sequence in the end 5' in conjunction with target DNA sequence.
However, existing CRISPR-Cas9 system Shortcomings in off-target rate and cutting efficiency always.
Summary of the invention
In order to solve the above problem, the present invention provides a kind of CRISPR-Cas9 systems comprising sgRNA1 expression cassette,
SgRNA2 expression cassette and Cas9 expression cassette, the sgRNA1 and sgRNA2 are respectively provided with different go-ahead sequences and target position to be edited
Point.
In a specific embodiment, the sgRNA1 expression cassette, sgRNA2 expression cassette and Cas9 expression cassette are located respectively
In different operons.
In a preferred embodiment, the go-ahead sequence of the sgRNA1 is located at the side in site to be edited, and institute
The go-ahead sequence for stating sgRNA2 is located at the other side in site to be edited.
In a specific embodiment, the CRISPR-Cas9 system further includes and mutational site and its neighbouring sequence
The expression cassette of homologous donor segment.For example, in one embodiment, donor sequence can be for for correcting leptin gene
The homologous recombination sequence of point mutation.
In a preferred embodiment, the donor segment with sgRNA1 go-ahead sequence and/or guide's sgRNA2 sequence
It arranges corresponding position and has carried out part or all of base mutation.
In a specific embodiment, the go-ahead sequence of sgRNA1 is as shown in SEQ ID NO:1, and sgRNA2 to
Sequence is led as shown in SEQ ID NO:3.
In a specific embodiment, the sequence of the donor segment is as shown in SEQ ID NO:4.
The present invention also provides non-therapeutic application of the above-mentioned CRISPR-Cas9 system in gene editing.
The present invention also provides above-mentioned CRISPR-Cas9 system in preparation for treating hereditary disease caused by single gene mutation
Drug in application.
In a specific embodiment, the hereditary disease is that congenital leptin caused by Leptin gene mutation lacks
Disease.For example, the mutation for correcting C to T in 105 arginine residues codons of ob/ob mouse Leptin gene,
CRISPR-Cas9 system comprising double sgRNA of the invention substantially increases the efficiency of cutting double-stranded DNA.Cutting
Efficiency may be up to 75%, and two sgRNA and undershooting-effect is not detected.According to the position sgRNA, donor sequence is according to close
Numeral degeneracy has carried out codon optimization, and donor is avoided to be cut by crispr-cas9 system.
Detailed description of the invention
Fig. 1 is Y6712, the relative position schematic diagram of Y6713, Y6714 in Leptin gene with mutational site；
Fig. 2 is the fluorescent microscopy images after the ob/ob mouse primary PECTORAL LIMB SKELETON of three kinds of Cas9-sgRNA transfection；
Fig. 3 is the structural schematic diagram of Cas9-sgRNAs；
Fig. 4 is the T7E1 of the target fragment of the primary PECTORAL LIMB SKELETON genomic DNA amplification of AdvCas9-sgRNAs transfection
The agarose electrophoresis figure of enzyme product；
Fig. 5 is that the fluorescence of the ob/ob mouse primary PECTORAL LIMB SKELETON of AdvCas9-sgRNAs and AdvDonor cotransfection is aobvious
Micro mirror photo；
Fig. 6 is the Leptin of the ob/ob mouse primary PECTORAL LIMB SKELETON of AdvCas9-sgRNAs and AdvDonor cotransfection
Peak figure is sequenced in gene Sanger；
Fig. 7 is 9 site T7E1 restriction enzyme digestion and electrophoresis figures that miss the target of sgRNA1；
Fig. 8 is 10 site T7E1 restriction enzyme digestion and electrophoresis figures that miss the target of sgRNA2
Fig. 9 is leptin content statistical chart (### and the ob that primary PECTORAL LIMB SKELETON induces differentiation into ripe rear cell supernatant
+ Adv control group is compared, p < 0.001)；
Figure 10 is that primary PECTORAL LIMB SKELETON induces differentiation into ripe rear Immuncytochemical detection leptin protein, in which: A/D:
Leptin protein immunocytochemistry after the induction differentiation of c57 mouse primary PECTORAL LIMB SKELETON；B/E:ob+Adv control group is primary
Leptin protein immunocytochemistry after PECTORAL LIMB SKELETON induction differentiation；C/F:ob+Adv (Cas9+T/C) organizes PECTORAL LIMB SKELETON induction
Leptin protein immunocytochemistry after differentiation.
Specific embodiment
1.ob/ob mouse
Ob/ob mouse is obesity syndrome model caused by Leptin point mutation, helps to more fully understand the mankind
Fat associated metabolic variation, probes into influence and mechanism of action of the drug to obesity syndrome.The Leptin gene of ob/ob mouse
There are the point mutation of a C > T (g.10797 C > T, c.372 C > T, p.R105X), and 105 arginine of leptin protein are residual
Base (Arginine, Arg, R) sports terminator codon, and the leptin protein of original 167 amino acid has lacked 63 amino acid, no
Appetite-suppressing can be played and increase the biological function of energy consumption, lead to systemic and cellularity high heat obese state.ob/
Ob mouse shows above-mentioned obesity syndrome in 3-4 week old, and situation runs down with age, shows as progressive body
Increase, hyperglycemia, hyperinsulinemia, hypertriglyceridemia and the dissolution of early stage cellular fat again, including bone sclerotin are reduced
With chronic osteoporosis.Have in studies have shown that mankind's single-gene obesity Leptin gene mutation type and exists and ob/ob mouse phase
Same point mutation.
2. targeting the sgRNA design and vector construction of ob/ob mouse Leptin gene mutation site
The go-ahead sequence for designing three sgRNA, is respectively designated as Y6712-Y6714, in the position of Leptin gene such as Fig. 1
Shown, sequence is as follows:
Y6712:AGTCGGTATCCGCCAAGCAGAGG (SEQ ID NO:1)；
Y6713:AGCCTCACTCTACTCCACAGAGG (SEQ ID NO:2)；
Y6714:GCAGGCCACTGGTCTGAGGCAGG (SEQ ID NO:3).
Above-mentioned 3 sgRNA go-ahead sequences are inserted respectively into plasmid vector pAdeno-U6-spgRNA-CMV-sfGFP-
It in P2A-3Flag-spCas9, respectively obtains: plasmid pAdeno-U6-spgRNA (Y6712)-CMV-sfGFP-P2A-3Flag-
SpCas9 (abbreviation Cas9-sgRNA (Y6712)), plasmid pAdeno-U6-spgRNA (Y6713)-CMV-sfGFP-P2A-
3Flag-spCas9 (abbreviation Cas9-sgRNA (Y6713)) and plasmid pAdeno-U6-spgRNA (Y6714)-CMV-sfGFP-
P2A-3Flag-spCas9 (abbreviation Cas9-sgRNA (Y6714)).
By above-mentioned three kinds of Cas9-sgRNA plasmid transfection mouse vehicles cells B16F10, the cell transfected is trained
It supports.As shown in Fig. 2, having green fluorescence after transfection cell culture 48h, cellular morphology, which has no, to be substantially change, it is seen that three kinds of plasmids
The dye efficiency turned is higher, and plasmid normal expression in cell, can be used for testing in next step.
Transfection cell is collected, genomic DNA is extracted.Segment of the design primer using Chao Shi PCR amplification comprising mutational site,
And it is sequenced.The results show that set peak occurs in the corresponding segment Sanger sequencing of transfection cellular genome, start set peak occur
Position at the upstream the PAM third base of sgRNA, show that three sgRNA can correctly identify Leptin gene, and
Cas9 albumen has cleavage activity.
The building of 3.AdvCas9-sgRNA plasmid
We devise a kind of new sgRNA+Cas9 system, which includes two sgRNA sequences, are improved and are cut with expectation
Cut the efficiency of double-stranded DNA.In the present embodiment, we construct plasmid, In using two go-ahead sequences of Y6712 and Y6714
Two sgRNA expression cassettes (Fig. 3) are constructed in pAdeno-U6-spgRNA-CMV-sfGFP-P2A-3Flag-spCas9, make its point
Not Biao Da two sgRNA, the go-ahead sequence of one of sgRNA is Y6712, another is Y6714, is named as Cas9-
SgRNAs is packaged into adenovirus, is named as Adv Cas9-sgRNAs, is pair with the adenovirus that the plasmid without sgRNA is packed
According to.
PECTORAL LIMB SKELETON is transfected with AdvCas9-sgRNAs, collects cell extraction genome after culture transfection cell 48h
DNA expands target fragment.The validity of AdvCas9-sgRNAs is detected using T7E1 endonuclease.T7E1 endonuclease
Enzyme identifies and cuts the DNA of Incomplete matching, cross DNA structure, Holliday structure or DNA bifurcation and heterodimeric
Body DNA can also cut the double-stranded DNA with cleavage site.
As a result as shown in figure 4, since control virus has no sgRNA, only Cas9, and under normal circumstances, double-stranded DNA is
Pairing completely, and there is no the structures such as hair fastener, cross DNA, therefore, have transfected the primary PECTORAL LIMB SKELETON of control virus
(Control) DNA carries out PCR amplification, and product is not in that (3 multiple holes of Control group are list to miscellaneous band after T7E1 digestion
One band).And 2 exon of sgRNA energy specific recognition Leptin gene of AdvCas9-sgRNAs, Cas9 play cutting function
Can, DNA double chain is cut open, and under NHEJ mechanism, radom insertion or missing base cause to be mutated, and such DNA carries out PCR,
PCR product is in Gradient annealing, since template is different, forms heterodimer DNA, and T7E1 is identified and cut, and generates length
Short different DNA fragmentation.PCR product length is 892bp in this experiment, and due to the presence of two sgRNA, PCR product is passed through
The DNA fragmentation of 300bp, 500bp and 650bp or so size length can be formed after T7E1 digestion.Show AdvCas9-sgRNAs
Adenovirus can correctly identify 2 exon of Leptin gene and can be in corresponding site cutting double-stranded DNA.AdvCas9-sgRNAs gland
Virus is in the committed step that target site cutting genomic DNA is that point mutation is corrected in this research in Leptin gene, T7E1 digestion
AdvCas9-sgRNAs adenovirus cuts primary PECTORAL LIMB SKELETON Leptin gene efficiency and is up to 74.8 ± 5.3% as the result is shown,
Premise is provided for homologous recombination.
4. homologous recombination experiments
Donor sequence is designed according to target sequence, it is prominent two positions sgRNA to avoid cutting of the sgRNA to donor
Become number of base, avoids sgRNA from cutting the free donor for existing and being integrated into genome, effect is knocked in raising
Rate.The good donor sequence of compounding design (SEQ ID NO:4), is building up to carrier pAdeno-MCMV-mcherry-P2A-Neo-
On HA, plasmid pAdeno-lep donor-MCMV-mcherry-P2A-Neo-HA is formed, is packaged into adenovirus, named
For AdvDonor.
By AdvCas9-sgRNAs and the primary PECTORAL LIMB SKELETON of AdvDonor cotransfection.Replacement contains 20 μm of ol/ after 12h
The complete medium of LScr7 is taken pictures under confocal fluorescent microscopic after 48h.As a result as shown in figure 5, adenovirus infection efficiency
Height shows AdvCas9-sgRNAs and AdvDonor on cell state without influence, green fluorescence and the basic common location of red fluorescence
The similar efficiency of the primary PECTORAL LIMB SKELETON of adenovirus infection.
The ob/ob mouse primary PECTORAL LIMB SKELETON for transfecting AdvCas9-sgRNAs and AdvDonor adenovirus is labeled as ob+
Adv (Cas9+T/C) group, the PECTORAL LIMB SKELETON of transfection control virus are labeled as ob+Adv control group, after virus transfection 48h,
0.5mg/mL G418 screening is added, after ob+Adv control group complete cell death, extracts ob+Adv (Cas9+T/C) group
Cell DNA carries out Sanger sequencing.As a result as shown in fig. 6, ob+Adv (Cas9+T/C) organizes primary PECTORAL LIMB SKELETON DNA
The point mutation of C > T existing for Sanger sequencing discovery Leptin gene script is repaired (arrow instruction).Because fat is thin before primary
Born of the same parents' passage number is limited, and monoclonal forming ability is poor, we do not obtain its monoclonal strain, and sequencing DNA is mixing clone DNA, because
There is set peak in this Sanger sequencing.But in mutational site, we remain to the base C of discovery higher proportion, show for Leptin base
Because the CRISPR-Cas9 system of point mutation can play a role in primary PECTORAL LIMB SKELETON, and it can be carried out knocking in for single base.
The efficiency analysis of the homologous recombination of 5.CRISPR-Cas9 System-mediated
1) homologous recombination proportion grading
To mix cloned genomic dna as template, DNA fragmentation near PCR amplification Leptin gene target sequence, PCR is produced
Object carries out agarose gel electrophoresis and recycles respective segments, carries out TA cloning and sequencing using TA Cloning Kit.The 109 of picking in total
A clone, the results are shown in Table 1.
1 sequencing analysis result of table
2) T7E1 endonuclease reaction detection sgRNA misses the target
9 sites of missing the target (Fig. 7) of sgRNA1 and preceding 10 sites of missing the target (figure of sgRNA2 are had detected with T7E1 enzyme cutting method
8), number is 1 to be grouped into the primary PECTORAL LIMB SKELETON transfection control adenovirus of ob/ob (ob+Adv control), and No. 2 be ob/
The primary PECTORAL LIMB SKELETON experimental group of ob (ob+Adv (Cas9+T/C)).The results show that it is all miss the target site PCR product size with
Predict that primer size is identical, have do not observed in site of missing the target No. 2 samples occur in addition to No. 1 sample strip band other are miscellaneous
Band.Although the amplified production in six sites of missing the target Wdr7, Cdc14a, Sun1, Cnksr3, Tekt3, Sult5al is through T7EI digestion
After there is visible small band, with ob+Adv control group amplified production after comparison, it was found that, after above-mentioned 6 site digestions of missing the target
The band of appearance also has in control group, shows that the appearance of small band is caused by T7EI Non-specific cleavage.These results suggest that
Undershooting-effect does not occur for the CRISPR-Cas9 system that we construct.
6. the leptin protein in transformant detects
Primary PECTORAL LIMB SKELETON after G418 resistance screening induce differentiation into it is ripe after, collect cell culture supernatant, ultrafiltration
(control group is identical with experimental group cell supernatant cycles of concentration) is concentrated in pipe, and Leptin-Elisa kit detects leptin protein afterwards.
As a result as shown in figure 9, leptin protein is nearly no detectable in cellular control unit supernatant, after experimental group cell supernatant is concentrated
Measuring leptin protein concentration is 573.4 ± 51.3pg/mL.Show that ob/ob mouse primary PECTORAL LIMB SKELETON Leptin gene point is prominent
After change is repaired, mature fat cell can generate leptin protein and secrete into cell culture supernatant.
The verifying of further progress immunocytochemistry.Choose the leptin of identification mouse Leptin protein 10 1-154 amino acids
Polyclonal antibody carries out immunostaining to the fat cell of differentiation and maturation.The results are shown in Figure 10, ob+Adv control and ob+
Adv (Cas9+T/C) group cell induce differentiation into it is ripe after, the visible fat drips that differ in size in endochylema, cell becomes larger, irregular.
C57 mouse primary PECTORAL LIMB SKELETON induce differentiation into it is ripe after, brown yellow granule shape substance in endochylema, prompt leptin protein expression it is rich
It is rich.Do not occur brown yellow granule shape substance, no leptin protein expression in ob+Adv control group cell cytosol.ob+Adv
(Cas9+T/C) it organizes and occurs brown yellow granule in cell cytosol, cell is prompted to express normal leptin protein.But also there is part cell
Brown yellow granule is had no in endochylema, shows that the adenovirus mediated Leptin gene point of AdvCas9-sgRNAs+ and AdvDonor is prominent
Become and not occur in all cells, only the point mutation that homologous recombination introduces T > C, this and primary lactation occur for part cell
Zooblast homologous recombination efficiency is related.
The foregoing is merely presently preferred embodiments of the present invention, is not intended to limit the invention, it is all in spirit of the invention and
Within principle, any modification, equivalent replacement, improvement and so on be should all be included in the protection scope of the present invention.
Sequence table
<110>Liyuan Hospital Attached to Tongji Medical College, Huazhong Science and Technol
<120>the gene editing system and its application of the point mutation of ob/ob mouse Leptin are corrected
<141> 2019-08-14
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213> Artificial Sequence
<400> 1
agtcggtatc cgccaagcag agg 23
<210> 2
<211> 23
<212> DNA
<213> Artificial Sequence
<400> 2
agcctcactc tactccacag agg 23
<210> 3
<211> 23
<212> DNA
<213> Artificial Sequence
<400> 3
gcaggccact ggtctgaggc agg 23
<210> 4
<211> 1042
<212> DNA
<213> Artificial Sequence
<400> 4
ggagaaccac agaagagtat gactaggagg gagagatctg ataagggcag gaggctagag 60
agaatataag gaataaagag ctatggctgg ttcttcacgg atatcattgg agaaaggaat 120
tactcaagac taatcagaag tgaagggtgg agtggctcgg aatgaacaga aagtccggga 180
gaccagctcc gtggctccca gtcagctgat gacaggaagt aagggcctgg accaggaagg 240
tgagaaggaa ggaggtagcc caggttcaca gatgtaatga agggctctgg agaccgatct 300
ccctgccact tgctaaagca cctcttgttc ttcttcctcc tgcatagcag tcggtatccg 360
ccaagcaaag agtcactggc ttggacttca ttcctgggct tcaccccatt ctgagtttgt 420
ccaagatgga ccagactctg gcagtctatc aacaggtcct caccagcctg ccttcccaaa 480
atgtgctgca gatagccaat gacctggaga atctccgaga cctcctccat ctgctggcct 540
tctccaagag ctgctctctg ccacagacca gtggcctgca gaagccagag agcctggatg 600
gcgtcctgga agcctcactc tactccacag aggtggtggc tttgagcagg ctgcagggct 660
ctctgcagga cattcttcaa cagttggatg ttagccctga atgctgaagt ttcaaaggcc 720
accaggctcc caagaatcat gtagagggaa gaaaccttgg cttccagggg tcttcaggag 780
aagagagcca tgtgcacaca tccatcattc atttctctcc ctcctgtaga ccacccatcc 840
aaaggcatga ctccacaatg cttgactcaa gttatccaca caacttcatg agcacaagga 900
ggggccagcc tgcagagggg actctcacct agttcttcag caagtagaga taagagccat 960
cccatcccct ccatgtccca cctgctccgg gtacatgttc ctccgtgggt acacgcttcg 1020
ctgcggccca ggagaggtga gg 1042
Claims (10)
1. a kind of CRISPR-Cas9 system, which is characterized in that expressed including sgRNA1 expression cassette, sgRNA2 expression cassette and Cas9
Frame, the sgRNA1 and sgRNA2 are respectively provided with the DNA sequence dna that different go-ahead sequences target location proximate to be edited.
2. CRISPR-Cas9 system according to claim 1, which is characterized in that the sgRNA1 expression cassette, sgRNA2 table
It is respectively in different operons up to frame and Cas9 expression cassette.
3. CRISPR-Cas9 system according to claim 1, which is characterized in that the go-ahead sequence of the sgRNA1 targets
The side in site to be edited, and the go-ahead sequence of the sgRNA2 targets the other side in site to be edited.
4. CRISPR-Cas9 system according to claim 1, which is characterized in that further include with mutational site and its near
The expression cassette of the donor segment of sequence homology.
5. CRISPR-Cas9 system according to claim 4, which is characterized in that the donor segment with sgRNA1 to
It leads sequence and/or the corresponding position of sgRNA2 go-ahead sequence has carried out number of base mutation.
6. CRISPR-Cas9 system according to claim 4, which is characterized in that the go-ahead sequence of sgRNA1 such as SEQ ID
Shown in NO:1, and the go-ahead sequence of sgRNA2 is as shown in SEQ ID NO:3.
7. CRISPR-Cas9 system according to claim 6, which is characterized in that the sequence such as SEQ of the donor segment
Shown in ID NO:4.
8. non-therapeutic application of the CRISPR-Cas9 system of any of claims 1-7 in gene editing.
9. CRISPR-Cas9 system of any of claims 1-7 is in preparation for treating caused by single gene mutation
Application in the drug of hereditary disease.
10. application according to claim 9, which is characterized in that the hereditary disease is first caused by Leptin gene mutation
Nature leptin deficiency disease.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910752482.9A CN110468156A (en) | 2019-08-15 | 2019-08-15 | Correct the gene editing system and its application of the point mutation of ob/ob mouse Leptin |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910752482.9A CN110468156A (en) | 2019-08-15 | 2019-08-15 | Correct the gene editing system and its application of the point mutation of ob/ob mouse Leptin |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110468156A true CN110468156A (en) | 2019-11-19 |
Family
ID=68511747
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910752482.9A Pending CN110468156A (en) | 2019-08-15 | 2019-08-15 | Correct the gene editing system and its application of the point mutation of ob/ob mouse Leptin |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110468156A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114369600A (en) * | 2022-01-28 | 2022-04-19 | 复旦大学附属眼耳鼻喉科医院 | For repairing Klhl18lowfCRISPR/Cas9 gene editing system of mutant gene and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105567735A (en) * | 2016-01-05 | 2016-05-11 | 华东师范大学 | Site specific repairing carrier system and method of blood coagulation factor genetic mutation |
| CN109517845A (en) * | 2018-10-30 | 2019-03-26 | 中山大学附属第医院 | A kind of CRISPR single base repair system and its application |
-
2019
- 2019-08-15 CN CN201910752482.9A patent/CN110468156A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105567735A (en) * | 2016-01-05 | 2016-05-11 | 华东师范大学 | Site specific repairing carrier system and method of blood coagulation factor genetic mutation |
| CN109517845A (en) * | 2018-10-30 | 2019-03-26 | 中山大学附属第医院 | A kind of CRISPR single base repair system and its application |
Non-Patent Citations (3)
| Title |
|---|
| JAE-IL ROH等: "CRISPR-Cas9-mediated generation of obese and diabetic mouse models", 《EXP.ANIM》 * |
| ZUPENG WANG等: "Optimized paired-sgRNA/Cas9 cloning and expression cassette triggers high-efficiency multiplex genome editing in kiwifruit", 《PLANT BIOTECHNOLOGY JOURNAL》 * |
| 李继洋等: "基于优化 sgRNA 系统提高海岛棉 CRISPR/Cas9 基因组编辑功效的研究", 《作物学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114369600A (en) * | 2022-01-28 | 2022-04-19 | 复旦大学附属眼耳鼻喉科医院 | For repairing Klhl18lowfCRISPR/Cas9 gene editing system of mutant gene and application |
| CN114369600B (en) * | 2022-01-28 | 2024-02-13 | 复旦大学附属眼耳鼻喉科医院 | For repairing Klhl18 lowf CRISPR/Cas9 gene editing system of mutant gene and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106244557B (en) | The method of rite-directed mutagenesis ApoE gene and LDLR gene | |
| CN105316327B (en) | Wheat TaAGO4a gene C RISPR/Cas9 carrier and its application | |
| Botchan et al. | Studies on simian virus 40 excision from cellular chromosomes | |
| CN105492608B (en) | Method for specifically knocking out pig PDX1 gene by CRISPR-Cas9 and sgRNA for specifically targeting PDX1 gene | |
| CN108342480A (en) | A kind of genetic mutation detection Quality Control object and preparation method thereof | |
| CN107828738A (en) | A kind of dnmt rna deficiency Chinese hamster ovary celI system and preparation method and application | |
| CN105518134A (en) | Method for pig SLA-2 gene specific knockout through CRISPR-Cas9 and sgRNA for specially targeting SLA-2 gene | |
| CN106414740A (en) | Method for specific knockout of swine SLA-3 gene using CRISPR-Cas9 specificity, and sgRNA used for specifically targeting sla-3 gene | |
| CN105518135A (en) | Method for pig CMAH gene specific knockout through CRISPR-Cas9 and sgRNA for specially targeting CMAH gene | |
| JP2005522225A (en) | Enhanced gene expression system | |
| WO2019086007A1 (en) | Sgrna for targeting and guiding cas9 protein to efficiently cleave tcr and b2m gene loci | |
| WO2019227640A1 (en) | Reagent and method for repairing fbn1t7498c mutation using base editing | |
| WO2019020007A1 (en) | Method for modulating rna splicing by inducing base mutation at splice site or base substitution in polypyrimidine region | |
| CN108424930A (en) | A kind of construction method and purposes of HBeAg transgene mouse models | |
| Hirsch et al. | Replication of duck hepatitis B virus in two differentiated human hepatoma cell lines after transfection with cloned viral DNA | |
| Andrew et al. | Sp1 and Sp3 transactivate the RET proto-oncogene promoter | |
| CN109486814A (en) | A kind of gRNA for repairing HBB1 point mutation, gene editing system, expression vector and gene editing kit | |
| CN111484994B (en) | Method for specifically knocking out pig Fah and Rag2 double genes by CRISPR-Cas9 | |
| CN110468156A (en) | Correct the gene editing system and its application of the point mutation of ob/ob mouse Leptin | |
| CN106148406A (en) | Pig ApoE gene knockout carrier and construction method thereof and application | |
| Dara et al. | Using CRISPR/Cas9 system to knock out exon 48 in DMD gene | |
| TWI225517B (en) | Genomic sequences for protein production and delivery | |
| CN108118057A (en) | A kind of gene editing system and its preparation method and application | |
| CN109706122A (en) | It constructs FSCN1 gene and stablizes knockout cell system, method and plasmid or plasmid combinations and application | |
| CN114990093B (en) | Protein sequence MINI RFX-CAS13D with small amino acid sequence |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |