CN105567735A

CN105567735A - Site specific repairing carrier system and method of blood coagulation factor genetic mutation

Info

Publication number: CN105567735A
Application number: CN201610005683.9A
Authority: CN
Inventors: 李大力; 关玉婷; 王立人; 刘明耀
Original assignee: East China Normal University
Current assignee: East China Normal University
Priority date: 2016-01-05
Filing date: 2016-01-05
Publication date: 2016-05-11

Abstract

The invention discloses a method for carrying out in-situ repairing on blood coagulation factor F8/F9. The method comprises the following steps: in a target genome sequence, selecting the mutation sites of blood coagulation factor as the gene sites for in-situ repairing; designing the binding sites of nuclease of sgRNA sequence of a CRISPR/Cas system; designing a homologous recombinant repairing donor sequence for in-situ repairing; delivering nuclease protein and/or sgRNA and the nucleotide sequence of the homologous recombinant repairing donor to the gene sites of in-situ repairing by a delivering carrier; generating damages to the genome DNA by the nuclease on the gene in-situ repairing sites; and rting the homologous recombinant repairing donor sequence into the gene in-situ repairing sites so as to repair the gene or supplement the expression of gene. The in-situ repairing of mutation sites of blood coagulation factor can be applied to the clinic, and the method has the advantages of precise induction, safer and controllable process, and definite target.

Description

A kind of fixed point repair vector system and method for coagulation factor gene sudden change

Technical field

The present invention relates to coagulation factor gene editing technique field, be specifically related to in-situ remediation method of a kind of thrombin and uses thereof.

Background technology

The coagulation process of the mankind is the cascade reactions participated in by various thrombin (as factor I, II, VIII, IX, X, XI) etc., the any one factor in this reaction is undergone mutation and cascade reaction all may be caused to carry out, coagulation process cannot complete, and just shows as blood coagulation disorders clinically, hematostaxis (especially occurs in joint, muscle and soft tissue.) etc. haemophiliachemophiliac symptom.And most hemophilia is because the gene of expression blood coagulation factor VIII (FVIII or the F8 factor) or IX (FIX or the F9 factor) is undergone mutation caused.Wherein because VIII blood coagulation disorders that transgenation causes is called haemophilia A.VIII genes encoding blood coagulation factor VIII, the latter is the glycoprotein in a kind of blood plasma.Combine with the vonWilebrand factor (vWF) under normal physiological conditions, present quiescent condition.Once there is wounds streamed blood in body, just the coagulation cascade reacting activation VIII factor can be passed through, make the VIII factor depart from vWF, and then is combined with the IX factor together cut X factor precursor become maturation Xa the latter the most at last conversion of fibrinogen be that scleroproein causes blood coagulation.At present, the haemophilia A of 50 ~ 60% due to the gene of encoding factor VIII to there is wrong meaning in protein-active region, stopping mutation causes, and all the other morbidities of 40 ~ 50% are caused by the rearrangement of VIII gene internal and inversion.Haemophilia A patient accounts for 70 ~ 80% of hemophilia morbidity sum.The cause of disease of haemophilia B (plasma thromboplastin component deficiency disease) is that the gene (Xq27.1) owing to expressing plasma thromboplastin component in above-mentioned reaction is undergone mutation, cause plasma thromboplastin component express by premature termination or its protein function lose a kind of sex-linked recessive inheritance disease of causing, its sickness rate accounts for 25% of haemophiliac's total number of persons.Blood coagulation factor VIII and IX are positioned on mankind's X chromosome, and because female human has two X chromosomes and the male sex only with an X chromosome, so A/B type hemophilia is mainly fallen ill in the male sex, the sickness rate of male sex's haemophilia A is about 1/5000 ~ 1/10000; Type B is about 1/20000 ~ 1/30000.Women mostly then is the carrier of VIII gene or IX transgenation on an X chromosome.In addition, in the case not having family history, the case of nearly 1/3 is had to fall ill due to genes involved spontaneous mutation.

Its state of an illness is divided clinically according to the content of thrombin corresponding in haemophiliac's blood.Content is patients with mild at 0.05-0.40IU/mL, and its morbidity performance is mainly significant wound or Post operation is bled in a large number, and spontaneity is bled comparatively rare; Content is moderate patient at 0.01-0.05IU/mL, and after its morbidity is mainly Minimally Invasive Surgery, persistence is bled or bled with spontaneity once in a while; What content was less than 0.01IU/mL is then severe patient, and the spontaneity of visible joint or muscle is bled.

Between 30 years, the gene order of each thrombin of the mankind, protein structure are thoroughly resolved in the past.But it is but comparatively slow for haemophiliachemophiliac treatment means progress.Clinical treatment means main at present are still the alternative medicine of recombinate the VIII factor or the IX factor.Though this method energy respite state of an illness, cannot repair the genome suddenlyd change, radical cure hemophilia.Recombinant factor in vivo can because the transformation period be gradually by metabolism, so patient often needs the injection carrying out recombinant factor all the life, overall expenses is very expensive.And in gene therapy, mainly utilize reverse transcription or adeno-associated virus as carrier, the gene of expressing blood coagulation factor VIII or IX is transported in patient body.Existing clinical data shows to utilize a kind of novel gland relevant viral vector it can be made to recover basic living quality for light-duty heavy haemophiliac's alleviation in the IX factor of patient's expression in vivo q.s.But this methods for the treatment of also also exists some drawbacks.Though first adeno-associated virus in most of the cases just foreign gene is inserted into the mankind safe site (AAVS1) if native gene generation random fracture, can not get rid of the possibility that viral exogenous sequences is inserted into random fracture DNA place, this virogene random integration is in vivo the major hidden danger of various cancer.Secondly; although AAV can stably express in AAVS1 site by partial exogenous gene; but after expressing for a long time, the promotor of foreign gene may be caused curative effect to decline by the protection mechanism silence of body, and integration rate is very low, usually can not reach result for the treatment of.Adeno-associated virus carries out copying and the IX factor expressing people although can enter liver cell, but the genome overwhelming majority due to virus is episome group, will lose after liver cell division growth and lose the expression of foreign gene and lose curative effect, and because virus-mediated gene therapy can produce the antibody for virus, make the virus of same serotype can not can only carry out Retreatment same use once with it, therefore the stably express of coagulation factor gene is very crucial.Therefore directly external source coagulation factor gene is imported to human body by virus carry out gene therapy and be difficult to reach permanently effective, this is a difficult problem for current relevant clinical research.In addition, in natural situation, the common regulation and control being subject to native gene promotor, enhanser etc. expressed by the thrombin of human body, thus stimulate (as wounds streamed blood) to make response to external world.Then not by the regulation and control of the upstream and downstream sequences such as endogenous FVIII/FIX gene promoter, enhanser, there is potential pathogenic risk in the thrombin being positioned at AAVS1 site ectopic expression.

Along with the emergence of gene editing technology, people bring into use the gene editing of the technology such as ZFN, TALEN, CRISPR/Cas to thrombin to study.Wherein ZFN technology by a kind of can target specific dna sequence zinc finger protein combine and TypeIIS endonuclease (as FokI) merge the artificial recombination albumen formed.Generally FokI is transformed into needs to be played a role by dimer, so need the ZFN of a pair target particular sequence, FokI can cut DNA.By DNA or the corresponding mRNA of the ZFN that encodes in the microinjection of zygote stage, realize rat, mouse, the gene knockout of zebra fish isotype biology.Although ZFN technology has made gene editing simplify to a great extent, but himself also exists the defect that some can not be ignored.Such as different target sequences is needed to build different ZFN expression vectors, slow down speed of experiment, and zinc refers to that the specificity for DNA can be subject to the impact of upstream and downstream zinc fingers, researchist is had to the zinc fingering row specificity screening built, thus again make test become loaded down with trivial details and time-consuming.

TALEN technology and ZFN technology type seemingly, are that the nuclease such as class transcriptional activation response element and FokI, meganuclease that can be combined with specific dna sequence merges and forms artificial nuclease.The DNA binding domain of TALEN and ZFN similar be also be made up of multiple element (TALE), each TALE module is made up of wherein the 12nd 34 amino acid, 13 amino acids are responsible for identifying special DNA base.Compare ZFN, the advantage of TALEN is that the DNA base of each TALE Module recognition is separate and one to one, so TALEN is higher than ZFN on specificity and efficiency.But its shortcoming is also similar with ZFN: need to rebuild corresponding TALEN sequence for new target spot, and the activity of cutting DNA is not high enough.

The CRISPR/Cas technology occurred in recent years is because it is efficient and handiness is just more and more used in the research of gene editing and treatment.CRISPR/Cas derives from a kind of acquired immunity mechanism resisting the invasion of the exogenous dna fragment such as plasmid, phage of archeobacteria: after external source phage invasion bacterium, the DNA that Cas albumen in CRISPR/Cas system can catch external source phage DNA is integrated in the genome as self, and is transcribed into tracr:CrRNA complex RNA.Cas9 guides on external source phage DNA by this complex RNA can tie merga pass RNA and DNA base complementrity with the nuclease Cas9 in CRISPR/Cas system, if the 3 ' end now meeting RNA:DNA complementary strand immediately following PAM sequence (be NGG for PAM sequence s.pyCas9) so Cas9 nuclease just combined double-stranded DNA can be cut off.As the core component of CRISPR/Cas system, Cas9 comprises the PAM binding domain of three RuvC nuclease structural domains, a HNH nuclease structural domain and a hydroxyl terminal.Research finds that PAM binding domain is lived for the combination of Cas9 and DNA and the enzyme of Cas9 and serves vital effect.Two chains of three RuvC structural domains and HNH structural domain then cutting double-stranded DNA respectively.Through confirming, the 10th aspartic acid (D) in sudden change nitrogen end RuvCI structural domain is L-Ala (A), or in sudden change HNH structural domain, the Histidine (H) of the 840th can both make Cas9 become a nickase of cutting single-chain DNA for L-Ala (A).In order to make CRISPR/Cas system more convenient apply in the middle of gene editing, researchist has transformed tracr:CrRNA and has made originally independently tracRNA and CrRNA amalgamation and expression become new strand to guide RNA (sgRNA).Thus, in CRISPR/Cas system, the different DNA sequence dna of target only needs to synthesize new sgRNA, this quite flexible that CRISPR/Cas technology is become in gene editing, eliminates the tedious steps needing to rebuild carrier before CRISPR/Cas system occurs in TALEN and ZFN system.

Nathwani, A. people (Adenovirus-associatedvirusvector-mediatedgenetransferinh emophiliaB.NewEnglandJournalofMedicine is waited, 365 (25), 2357 – 2365) report a kind of clinically for the gene therapy method of haemophilia B, comprise the AAV8 virus expressing mankind FIX factor complete encoding sequence to 6 patient's intravenous injections.Immunosuppression class medicine is not used in therapeutic process.Treating after 16 months, in all participation blood samples of patients, all detect the FIX factor, all there is remission to a certain degree or alleviates in all patients.But this report is also pointed out thisly to utilize AAV8 virus directly integrated transgene, and its shortcoming is that integration efficiency is lower and the gene integrated is likely again reticent by body, therefore requires further improvement.

Park, the people such as C.-Y (FunctionalCorrectionofLargeFactorVIIIGeneChromosomalInve rsionsinHemophiliaAPatient-DerivediPSCsUsingCRISPR-Cas9. CellStemCell, 2015) report and a kind of CRISPR/Cas system are transferred to the intracellular research method of the IPS induced by haemophilia A patient.With the same above, Park, the people such as C (Targetedinversionandreversionofthebloodcoagulationfactor 8geneinhumaniPScellsusingTALENs.ProceedingsoftheNational AcademyofSciencesoftheUnitedStatesofAmerica, 111 (25), 9253 – 9258.) also report a kind of research method based on iPS cell, namely TALEN is utilized to cause DSB in iPS cell, the sequence of FVIII gene upper span 140kbp is put upside down, cause the pattern cell of an artificial hemophilia A, then profit uses the same method and the sequence of this 140kbp is again put upside down in iPS cell.But, these methods utilize the method for CRISPR/Cas or TALEN to be all the simple trial in iPS cell model, and iPS has the risk of random mutation so it is not finally also broken for clinical defect due to it.

In sum, the above research of the gene editing for thrombin is all the method adopting gene substitution or gene integration at present, exactly the expression cassette of a complete extrinsic soagulation factor is imported in deficient cells by expression vector (such as expression plasmid), thus play a role with the gene of replace defective.Such as, be utilize the characteristic site-directed integration of adeno-associated virus to enter safe site AAVS1.Then this genetic method needs complete foreign gene to import in deficient cells, and the genic system imported crosses efficiency and the accuracy that senior general affects channel genes.In addition, this technology itself does not obtain repairing this dcc gene, therefore needs constantly to carry out continuing to import, thus has influence on the research effect of gene editing.

In theory, be in-situ immobilization for the optimal research strategy of thrombin mutator gene, namely directly make gene repair complete by gene complementation technology in position dcc gene, thus provide reference frame for next step gene therapy of whether carrying out.Therefore develop a kind of research method of carrying out in-situ immobilization for thrombin mutational site, these research and development for further clinical treatment are particularly important.

Chinese patent application 201510053175.3, denomination of invention " in-situ immobilization plasmid, test kit and method that human blood coagulation factor VII I gene No. 22 intron inversion types suddenly change " disclose and utilize TALENs system to add the encoding sequence of F8 factor 23-26 exon and polyA signal the intersection of 22 exons and intron thereof to by the mode of homologous recombination, thus by the genetic information completion of the F8 gene of No. 22 intron inversion types sudden changes.Although the method can repair thrombin F8 to a certain extent by the mode of in-situ immobilization, but, the method needs to import multiple complete genome (i.e. 23-26 exon), it still needs too huge TALENs system, and and be not suitable for other genetic flaw, such as deletion mutantion, repeat sudden change, dystopy sudden change etc.In addition, due to the difference of the main Types that thrombin F9 and F8 undergos mutation, the F8 transgenation of 40-50% is approximately only had to be the inversion that No. 22 dyeing are inscribed under its natural environment, the point mutation of the sudden change of F9 then mainly single or multiple single base composition, therefore the method be not suitable for in-situ immobilization thrombin F9.

Therefore, need at present to utilize the CRISPR/Cas system improved, a kind of research method of carrying out in-situ immobilization for thrombin mutational site is provided.

Summary of the invention

The principle of the invention is, for single base or the deletion mutantion of polybase base of thrombin F8 or F9, or the situation of whole deletion mutant, utilize the CRISPR/Cas system improved, by the base of disappearance or gene in-situ immobilization, thus repair the cell of producer defect.Further, present invention focuses on the CRISPR/Cas system that Sustainable use improves, thrombin F9 is carried out to the method for in-situ immobilization.

The present invention's first object is to provide a kind of method that the CRISPR/Cas of utilization system carries out in-situ immobilization to thrombin F8/F9, comprises the following steps:

(1) in target gene group sequence, the mutational site of selected coagulation factor gene is the gene locus of in-situ immobilization;

(2) according to selected gene in-situ immobilization site, the binding site of the nuclease of the sgRNA sequence of design CRISPR/Cas system;

(3) the homologous recombination repair donor sequences of in-situ immobilization is designed for;

(4) in the middle of the gene locus nucleotide sequence of nuclease protein and/or sgRNA, described homologous recombination repair donor being delivered to in-situ immobilization by delivery vector or safe locus, wherein nuclease protein is CRISPR/Cas9 albumen, or produces nuclease and the combination thereof of DNA single chain or double-strand break with the specific site that can cause that above-mentioned albumen has a homology;

(5) genomic dna is caused to damage by nuclease in described gene in-situ immobilization site;

(6) described homologous recombination donor sequences is inserted in described gene in-situ immobilization site, the expression of revision points or supplementary gene.

Wherein, in described step (1), by finding the N near mutational site on positive-sense strand ₂₀nGG (i.e. NNNNNNNNNNNNNNNNNNNN-NGG site), or on antisense strand, find the CCNN near mutational site ₂₀(i.e. CCN-NNNNNNNNNNNNNNNNNNNN site), determines the target spot of CRISPR/Cas gene editing system institute in-situ immobilization.Wherein front 20 bases are the complementary pairing sequence of sgRNA and target spot in CRISPR/Cas system.The PAM sequence that last NGG (on antisense strand CCN) identifies for s.pyCas9.Described mutational site refers to and causes thrombin to lose function or the active mutational site reducing or lack.In one embodiment, the gene locus of step (1) described in-situ immobilization comprises, near described blood coagulation factor VIII or IX gene mutation site or in any appropriate site of coagulation factor gene group or have putative safe locus (safeharbor, as AAVS1 site etc.) in the gene non-coding region of high expression level activity or human genome in liver cell.Wherein, contrasted by gene order-checking and normal people's genome, obtain the mutational site of haemophiliac's body intravascular coagulation Factor IX, IX gene.This mutational site may be positioned on the exon sequence of coding VIII/IX gene, also may be arranged in intension; Mutational site may only have one, and multiple mutational site also may be had to exist; In a specific embodiment, the sgRNA sequence corresponding to F9 mutational site is selected from one or more sgRNA sequence in SEQIDNO.1-241.In another embodiment, the position of target spot also can be positioned at safe locus (safeharbor) and includes but not limited to AAVS1, CCR5, Albumin etc.

Wherein, in step (2), transgenation entrained by haemophiliac can design homologous recombination repair donor DNA sequences, in one embodiment, described transgenation is selected from single base or many base deletions, in a specific embodiment, described many base deletions are gene fragment disappearance or full genome disappearance.

Described in step (3), homologous recombination repair donor sequences is homologous recombination repair sequence, it comprises the partial sequence of the encoding blood coagulation factors CDS for in-situ immobilization single-base deletion mutation, the sequence for the encoding blood coagulation factors of in-situ immobilization polybase base deletion mutantion, and the sequence of encoding blood coagulation factors full genome CDS for the deletion mutantion of in-situ immobilization full genome, in a specific embodiment, after the introduction site of the sequence of encoding blood coagulation factors full genome is selected from safe locus, FIX promotor, or after Albumin promotor.The form of described homologous recombination repair donor sequences can be any one or multiple combination of double-stranded DNA (dsDNA), single stranded oligonucleotide (ssODN), single stranded RNA.Described homologous recombination repair donor sequences is with the homology arm with described gene editing site sequence or its upstream and downstream sequence very high homology.Described homologous recombination repair donor sequences comprise for repair merger sudden change that thrombin is wild-type or introduce there is blood coagulation activity stronger than wildtype factor new sudden change as FIXR338L.In a specific embodiment, described reparation donor sequences comprises or is made up of the sequence in SEQIDNO:242.

In described step (4), the DNA sequence dna of express nucleic acid enzyme can be connected in one or more virus vector including but not limited to slow virus, adenovirus, adeno-associated virus by molecular cloning means.By in advance virus vector being proceeded to host cell as increased in HEK293T cell or HEK293 or HEK239A or HEK293FT cell, concentrating related viral vectors.Donor repairing sequence can connect in the middle of identical carrier with nucleotide sequence, also can be connected in the middle of different virus delivery vector.Virus vector can enter in patient body by intravenous method, also can by the liver cell, IPS cell etc. of the method infected patient of incubated in vitro.In addition, the linear DNA of express nucleic acid enzyme and donor sequences, annular DNA also directly can be sent in patient body or in its cell and realize gene in-situ immobilization under the help of transfection reagent, nano particle.In another embodiment, also can Cas9 recombinant protein be imported in patient body by nano material, transfection reagent etc., also by the method for in-vitro transfection, Cas9 recombinant protein can be imported the liver cell, IPS cell etc. of patient, entering of foreign aid's nucleic acid can be reduced further like this, thus reduce the probability that foreign aid DNA random integration enters genomic dna.And the speed that Cas9 recombinant protein plays a role after entering cell is faster, degradation rate is also faster, the Cas9 nucleic acid continued less can be expressed caused potential effect of missing the target in vivo like this.

In one embodiment, described Cas9 dietary protein origin in archeobacteria II type (CRISPR)-CRISPR-associatedprotein (Cas) system, or there is with it homology can by the nuclease in the specific DNA site of RNA target editor.

Also in another embodiment, described delivery vector comprises slow virus, adenovirus, adeno-associated virus (comprising AAV1 ~ AAV10), single stranded oligonucleotide, linear DNA, annular DNA, is imported any one or the multiple combination of DNA or RNA of associated materials parcel by nano material or DNA.In a specific embodiment, in body, the method for passing virus vector is carried to comprise vein or intra-arterial injection.In another embodiment, or miniCircleDNA can be utilized to come in body or Intracellular delivery is linear, annular DNA, single stranded oligonucleotide by chemical reagent or nano material.

Wherein, described genomic dna damage causes double-strand DNA cleavage or single stranded DNA breach in described gene editing site.Described homologous recombination repair repairing sequence enters genome by the mode of the end link that homologous recombination or non-homogeneous restructuring are received.

In described step (5), described homologous recombination repair donor sequences is inserted into the expression coming revision points or supplementary gene in described gene editing site.Wherein, enter in body or intracellular donor repairing sequence can replace the mutational site of patient VIII, IX gene by homologous recombination, make corresponding thrombin restore funcitons or expression.Also complete wild-type VIII/IX gene can be inserted in the safe gene locuss such as intension of patient VIII, IX gene, exon, the gene non-coding region of high expression level activity or AAVS1 thus to replace originally losing the IX gene of function or loss.

Wherein, the described safe locus of step (6) is can carry out to it gene locus that gene in-situ immobilization can't threaten to health through checking.

The present invention's second object is the preparation method providing a kind of adenovirus carrier, this carrier can be used for the in-situ immobilization of coagulation factor gene or improves the expression of thrombin, and it contains DNA sequence dna and/or the sgRNA sequence contained in CRISPR/Cas system of nuclease Cas9 and/or contains the partial or complete encoding sequence that homologous recombination repair sequence is blood coagulation factor VIII, IX gene.Further, its contain for repair merger sudden change that thrombin is wild-type or introduce there is blood coagulation activity stronger than wildtype factor new sudden change as FIXR338L.Further, present invention focuses on the CRISPR/Cas system that Sustainable use improves, thrombin F9 is carried out to the method for in-situ immobilization.

In one embodiment, the preparation process of this adenovirus carrier is as follows:

(5) by the DNA encoding sequence of the method amplification Cas9 of PCR or external synthesis;

(6) homologous recombination sequence needed for sudden change of blood coagulation factor VIII, IX gene or the complete DNA sequences encoding of encoding blood coagulation factors VIII, IX gene is repaired by the method amplification of PCR or external synthesis;

(7) by the method for molecular cloning, the repairing sequence in the Cas9 in step (1) and step (2) is connected in same or different adenovirus carriers;

(8) adenovirus transfection is entered by the adenovirus transfected and host cell strain of expression adenoviral gene E1 and E3 that comes as in HEK293, HEK293A, HEK293T or HEK293FT.In carry out increasing and concentrating, obtain object adenovirus carrier.

In one embodiment, described adenovirus carrier is the carrier for the haemophiliachemophiliac coagulation factor gene in-situ immobilization of mouse, and host cell is HEK293, HEK293A, HEK293T or HEK293FT cell, the described adenovirus carrier with sgRNA and homologous recombination repair sequence is H271pAdeno-sgmf9-fix1 carrier.In a specific embodiment, the adenovirus carrier of described expression Cas9 nuclease is H271pAdeno-Cas9 carrier.Also in a specific embodiment, described thrombin is F8 or F9.

In another embodiment, described adenovirus carrier is the carrier for the haemophiliachemophiliac coagulation factor gene in-situ immobilization of people, and host cell is HEK293, HEK293A, HEK293T or HEK293FT cell, the described adenovirus carrier with sgRNA and homologous recombination repair sequence is H271Adeno-sghFIX-hFIX carrier.In a specific embodiment, the adenovirus carrier of described expression Cas9 nuclease is H271Adeno-hCas9 carrier.Also in a specific embodiment, described thrombin is F8 or F9.Also in other specific embodiments, the sgRNA sequence corresponding to F9 mutational site is selected from one or more sgRNA sequence in SEQIDNO.1-241.In another embodiment, the position of target spot also can be positioned at safe locus (safeharbor) and includes but not limited to AAVS1, CCR5, Albumin etc.

The present invention's the 3rd object is to provide a kind of adenovirus carrier prepared by aforesaid method.

In one embodiment, in the middle of the gene locus that described adenovirus carrier comprises nuclease protein and/or sgRNA, the nucleotide sequence of described homologous recombination repair donor is delivered to in-situ immobilization by carrier or safe locus, wherein nuclease protein is CRISPR/Cas9 albumen, or TALEN albumen, or produce nuclease and the combination thereof of DNA single chain or double-strand break with the specific site that can cause that above-mentioned albumen has a homology.In a specific embodiment, described reparation donor sequences comprises or is selected from the sequence in SEQIDNO:242.

In one embodiment, described adenovirus carrier is the carrier for the haemophiliachemophiliac coagulation factor gene in-situ immobilization of mouse, and the described adenovirus carrier with sgRNA and homologous recombination repair sequence is H271pAdeno-sgFIX-FIX1 carrier.In another embodiment, the adenovirus carrier of described expression Cas9 nuclease is H271pAdeno-Cas9 carrier.

In another embodiment, described adenovirus carrier is the carrier for the haemophiliachemophiliac coagulation factor gene in-situ immobilization of people, H271Adeno-sghFIX-hFIX carrier.In a specific embodiment, the adenovirus carrier of described expression Cas9 nuclease is H271Adeno-hCas9 carrier.

The present invention's the 4th object is to provide a kind of described adenovirus carrier and treats hemophilia in preparation or treat the application in the pharmaceutical composition of the disease that thrombin F8/F9 transgenation causes.

In one embodiment, described adenovirus carrier is by the adenovirus carrier prepared by aforesaid method.

In another embodiment, in the middle of the gene locus that described adenovirus carrier comprises nuclease protein and/or sgRNA, the nucleotide sequence of described homologous recombination repair donor is delivered to in-situ immobilization by carrier or safe locus, wherein nuclease protein is CRISPR/Cas9 albumen, or produces nuclease and the combination thereof of DNA single chain or double-strand break with the specific site that can cause that above-mentioned albumen has a homology.

Also in another embodiment, this mutational site may be positioned on the exon sequence of coding VIII/IX gene, also may be arranged in intension; Mutational site may only have one, and multiple mutational site also may be had to exist; In a specific embodiment, the sgRNA sequence corresponding to F9 mutational site is selected from one or more sgRNA sequence in SEQIDNO.1-241.In another embodiment, the position of target spot also can be positioned at safe locus (safeharbor) and includes but not limited to AAVS1, CCR5, Albumin etc.In a specific embodiment, described reparation donor sequences comprises or is selected from the sequence of SEQIDNO:242.

The present invention's the 5th object is to provide a kind of base deletion by in-situ immobilization coagulation factor gene F8 or F9 and suddenlys change the pharmaceutical composition of the disease caused, and comprising:

Nuclease protein and/or sgRNA, wherein nuclease protein is CRISPR/Cas9 albumen, or produces nuclease and the combination thereof of DNA single chain or double-strand break with the specific site that can cause that above-mentioned albumen has a homology;

Delivery vector;

For the nucleotide sequence of the homologous recombination repair donor of in-situ immobilization genetic flaw.

In one embodiment, described delivery vector is adenovirus carrier as above.In a specific embodiment, described adenovirus carrier is one or more adenovirus carriers, or one or more gland relevant viral vector (comprising AAV1-10).In another embodiment, the adenovirus carrier of described expression Cas9 nuclease is H271Adeno-sghFIX-hFIX carrier.Also in other specific embodiments, the sgRNA sequence corresponding to F9 mutational site is selected from one or more sgRNA sequence in SEQIDNO.1-241.In another embodiment, the position of target spot also can be positioned at safe locus (safeharbor) and includes but not limited to AAVS1, CCR5, Albumin etc.In another embodiment, sgRNA can combine with Cas9 albumen in CRISPR/Cas system and guide the sequence in its target gene group in-situ immobilization site.

In another embodiment, the nucleotide sequence of homologous recombination repair it comprise the partial sequence of the encoding blood coagulation factors CDS for in-situ immobilization single-base deletion mutation, the sequence for the encoding blood coagulation factors of in-situ immobilization polybase base deletion mutantion, and the sequence of encoding blood coagulation factors full genome for the deletion mutantion of in-situ immobilization full genome, in a specific embodiment, after the introduction site of the sequence of encoding blood coagulation factors full genome is selected from safe locus, FIX promotor, or after Albumin promotor.The form of described homologous recombination repair donor sequences can be any one or multiple combination of double-stranded DNA (dsDNA), single stranded oligonucleotide (ssODN), single stranded RNA.Described homologous recombination repair donor sequences is with the homology arm with described gene in-situ immobilization site sequence or its upstream and downstream sequence very high homology.Described homologous recombination repair donor sequences comprise for repair merger sudden change that thrombin is wild-type or introduce there is blood coagulation activity stronger than wildtype factor new sudden change as FIXR338L.In a specific embodiment, described reparation donor sequences comprises or is selected from the sequence in SEQIDNO:242.

Wherein, transgenation entrained by haemophiliac can design homologous recombination repair donor DNA sequences, in one embodiment, described transgenation is selected from single base or many base deletions, in a specific embodiment, described many base deletions are genetically deficient.

Wherein, described homologous recombination repair donor sequences is homologous recombination repair sequence, it comprises the partial sequence of the encoding blood coagulation factors CDS for in-situ immobilization single-base deletion mutation, the sequence for the encoding blood coagulation factors of in-situ immobilization polybase base deletion mutantion, and the sequence of encoding blood coagulation factors full genome for the deletion mutantion of in-situ immobilization full genome, in a specific embodiment, after the introduction site of the sequence of encoding blood coagulation factors full genome is selected from safe locus, FIX promotor, or after Albumin promotor.The form of described homologous recombination repair donor sequences can be any one or multiple combination of double-stranded DNA (dsDNA), single stranded oligonucleotide (ssODN), single stranded RNA.Described homologous recombination repair donor sequences is with the homology arm with described gene in-situ immobilization site sequence or its upstream and downstream sequence very high homology.Described homologous recombination repair donor sequences comprise for repair merger sudden change that thrombin is wild-type or introduce there is blood coagulation activity stronger than wildtype factor new sudden change as FIXR338L.

Wherein, the DNA sequence dna of express nucleic acid enzyme can be connected in one or more virus vector including but not limited to slow virus, adenovirus, adeno-associated virus by molecular cloning means.By in advance virus vector being proceeded to host cell as increased in HEK293T cell, concentrating related viral vectors.Donor repairing sequence can connect in the middle of identical carrier with nucleotide sequence, also can be connected in the middle of different virus delivery vector.Virus vector can enter in patient body by intravenous method, also can by the liver cell, IPS cell etc. of the method infected patient of incubated in vitro.In addition, the linear DNA of express nucleic acid enzyme and donor sequences, annular DNA also directly can be sent in patient body or in its cell and realize gene in-situ immobilization under the help of transfection reagent, nano particle.In another embodiment, also can Cas9 recombinant protein be imported in patient body by nano material, transfection reagent etc., also by the method for in-vitro transfection, Cas9 recombinant protein can be imported the liver cell, IPS cell etc. of patient, entering of foreign aid's nucleic acid can be reduced further like this, thus reduce the probability that foreign aid DNA random integration enters genomic dna.And the speed that Cas9 recombinant protein plays a role after entering cell is faster, degradation rate is also faster, the Cas9 nucleic acid continued less can be expressed caused potential effect of missing the target in vivo like this.

In one embodiment, described Cas9 dietary protein origin in archeobacteria II type (CRISPR)-CRISPR-associatedprotein (Cas) system, or there is with it homology can by the nuclease in the specific DNA site of RNA target in-situ immobilization.

Wherein, described genomic dna damage causes double-strand DNA cleavage or single stranded DNA breach in described gene in-situ immobilization site.Described homologous recombination repair repairing sequence enters genome by the mode of the end link that homologous recombination or non-homogeneous restructuring are received.

Wherein, described homologous recombination repair donor sequences is inserted into the expression coming revision points or supplementary gene in described gene in-situ immobilization site.Wherein, enter in body or intracellular donor repairing sequence can replace the mutational site of patient VIII, IX gene by homologous recombination, make corresponding thrombin restore funcitons or expression.Also complete wild-type VIII/IX gene can be inserted in the safe gene locuss such as intension of patient VIII, IX gene, exon, the gene non-coding region of high expression level activity or AAVS1 thus to replace originally losing the IX gene of function or loss.In a specific embodiment, described reparation donor sequences comprises or is made up of the sequence in SEQIDNO:242.

Wherein, described safe locus is can carry out to it gene locus that gene in-situ immobilization can't threaten to health through checking.

Term and definition

Term " blood coagulation factor VIII, IX ", also known as FVIII or the F8 factor, or FIX or the F9 factor.

Term " in-situ immobilization ", refers at gene locus to be repaired, by gene recombination or replacement, single base of this site deletion or polybase base are able to supplementary complete, thus recover the original function of this gene, or strengthen the original function of this gene, also known as original position gene editing.It should be pointed out that the method only for suffering from haemophiliachemophiliac patient (as Mammals, or the mankind) repair the gene having genetically deficient in the F8/F9 factor.Although method can in-situ immobilization dcc gene, but haemophiliac is subject to the correct conveying of transmitting carrier, can gene (only have the cellular genome of 7% to be repaired back wild-type in such as embodiment 3 Fig. 7 by normal expression, the gene repaired completely in Fig. 9 only has 1.72%, 12.5%, 6.4%), barrier in body, the expression lag-effect in in-situ immobilization site, therefore the method can only be used for the gene of the deletion mutantion in the in-situ immobilization F8/F9 factor, directly can not be used for the treatment of hemophilia, namely the invention belongs to the basic research in early stage of methods for the treatment of, not clinical treatment.

Term " CRISPR/Cas system ", it comprises the tumor-necrosis factor glycoproteins (CRISPR site) of short high conservative and is positioned at the double-stranded DNA nuclease (Cas albumen) of this location proximate, this nuclease can cut target site under guide RNA (guidanceRNA, i.e. gRNA) guides.In the present invention, described CRISPR site comprises the N near mutational site ₂₀nGG, or the CCNN on antisense strand near mutational site ₂₀.Described gRNA is then 18 N sites (i.e. PAM sequence) of repeating in CRISPR site.

Term " TALEN system ", please supplements as above.If the present invention will not protect, then need not supplement

Term " Hemophilia A ", refers to the hemophilia type because F8 transgenation causes.

Term " Hemophilia B ", refers to the hemophilia type because F9 transgenation causes.

Term " ssODN template ", refers to the DNA sequence dna that single stranded oligonucleotide forms, and it is with the DNA sequence dna with hemophilia mutational site upstream and downstream DNA sequence dna very high homology, just hemophilia mutating alkali yl is changed into the corresponding DNA sequence of encoding wild type FIX albumen.After there is homologous recombination, ssODN template can replace the sequence of former mutational site and its upstream and downstream.

Term " annexs sudden change ", and protein amino acid sequence coded after DNA sequence dna (codon) changes is constant, also known as same sense mutation.Simultaneously its reason to encode same amino acid whose phenomenon because there is multiple DNA codon.Annex sudden change some DNA sequence dnas changed on repairing sequence to make it different from wild-type (being generally the sequence corresponding to target spot), but the albumen of coding is identical, the Cas9 imported like this, can not cut the sequence of having repaired.Random owing to annexing gene comparision, same amino acid can have multiple DNA codon combinations so cannot provide the DNA combination determined.

Term " gene damage ", refers to double chain DNA sequence generation double-strand break, or wherein the phenomenon of fracture occurs any strand.

Term " homologous recombination donor sequences ", refers to the DNA sequence dna with hemophilia mutational site upstream and downstream DNA sequence dna very high homology, and it can change into the corresponding amino acid whose DNA sequence dna of encoding wild type FIX albumen by causing haemophiliachemophiliac sudden change.After homologous recombination occurs, homologous recombination donor sequences can replace the sequence of former mutational site and its upstream and downstream, so may be used for repairing mutant nucleotide sequence.

Term " pharmaceutical composition "; refer to except comprising with except the main component of the present invention composition that is main active ingredient; it also can comprise other auxiliary material do not limited or assistant carriers, such as solvent, nano particle or nano-carrier, stablizer, damping fluid, auxiliary material, transfection reagent etc.Because this pharmaceutical composition is prepared by existing known routine techniques, the pharmaceutical composition of such as adenovirus carrier, even if the present invention is without the need to limiting the preparation method of this pharmaceutical composition, but those skilled in the art also can prepare pharmaceutical composition of the present invention according to currently known methods.

Technique effect

Beneficial effect of the present invention comprises:

(1) by the edit methods of gene in-situ immobilization of the present invention, the sudden change of its inactivation or loss can be caused at the in-situ immobilization in the VIII factor or IX factor gene mutational site.Gene in theory after in-situ immobilization is identical with wild type gene, and the cell only need repairing a patient body part makes the expression amount of patient's normal coagulation factor the reach state of an illness that the general population's 2% just can alleviate patient greatly, make it live as normal people.And the cell after repairing can express normal thrombin for a long time, eliminates the misery of repeatedly injecting recombinant blood coagulation factor.Therefore, by the method for gene in-situ immobilization of the present invention, provide reference frame for researching and developing haemophiliachemophiliac gene therapy further.

(2) native Factor is subject to upstream and downstream genome sequence as the comprehensive regulation of the factors such as promotor, 3 ' UTR, enhanser non-coding RNA, Chromosome, thus realizes the feedback stimulating (as wounds streamed blood) to external world.The thrombin sequence of external source is integrated in AAVS1 site by traditional AAV viral integrase therapy, depart from the upstream and downstream gene of wildtype factor, so its expression may not be subject to or not exclusively be subject to the impact of wildtype factor gene regulatory network, potential health risk may be caused.Utilize gene in-situ remediation method of the present invention, in the original position of gene locus of curing the disease, DNA is repaired, also the gene of undergoing mutation is substituted after complete thrombin sequence can being inserted into the corresponding thrombin promotor of patient, to improve the expression amount of thrombin.The gene location residing for thrombin sequence after utilizing the present invention to repair is close with wild-type or identical, and suffered upstream and downstream gene regulating is also more close, not easily reticent by body, also safer.

(3) traditional adeno-associated virus therapy utilizes the integration ability of its virus to enter in the middle of AAVS1 site by the gene integration of expressing thrombin, its inefficiency, effect not lasting (gene being integrated into AAVS1 site is easily silenced), and patient also easily produces the antibody to virus, so the virus of same serotype possibly cannot carry out Retreatment to patient.And adopt the gene of gene in-situ immobilization of the present invention can not be caused Relapse rate by body silence, and the homologous recombination efficiency utilizing nuclease Cas9 or TALEN to cause is in theory also higher than the integration efficiency (being about 0.1%) of wild type AAV virus.

(4) entire coding strand of the VIII factor has exceeded traditional AAV virus packaging upper limit, the present invention can according to the pathogenic mutation site design homologous recombination sequence of haemophilia A patient, or pour short chain ssODN into and repair, avoid the inferior position in traditional AAV virus packaging.

(5) the inventive method is simpler compared to carrier construction step TALEN method (such as Chinese patent application 201510053175.3), and design target spot is more flexible.Due to for different genes site, the TALEN of different DNA binding domain, efficiency is different, and the loaded down with trivial details construction step of TALEN makes tester be difficult to test multiple target spot simultaneously, and be difficult to import multiple TALEN system at same cell due to the too huge gene for the simultaneous mutation of multiple sites of TALEN carrier.But the sgRNA in the inventive method then well solves this problem.For the gene of difference sudden change, or even when multiple site simultaneous mutation, also can test the efficiency of multiple sgRNA simultaneously, and repair simultaneously.

(6) in addition, described TALEN method repairs F8 gene in the mode of transfection IPS cell, is only " sub-experiment in vivo ".Directly adopt the mode of adenovirus (adeno-associated virus) by delivering in mouse (patient) body at the bottom of pharmaceutical agent combinations in the pharmaceutical agent combinations of the inventive method, comparatively speaking more close to clinical application.

(7) the present invention proposes the research method of the in-situ immobilization of the deletion mutant for F8/F9, and demonstrate this research method by the cas system improved.The present invention proposes the method for the in-situ immobilization for deletion mutantion in the world first, and have fixed point and accurately import, safety is controlled more, and target spot is clear and definite, belongs to domestic correlative study and leads world level first, and specify R&D direction.

Accompanying drawing explanation

Fig. 1 for carrying out gene in-situ immobilization and utilizing ssODN to repair FIX gene locus schematic diagram in HEK293T cell.

Fig. 2 is the gene in-situ immobilization carrier pX458-sghF9 for human cell

Fig. 3 is that T7E1 to detect in HEK293T cell whether producer in-situ immobilization.

Fig. 4 is the sequencing result of producer in-situ immobilization in HEK293T cell.

Fig. 5 is the gene in-situ immobilization carrier pX458-sgmf9 for mouse

Fig. 6 expresses the sgRNA of target mouse fix gene and the adenovirus carrier H271pAdeno-sgmf9-fix1 of donor repairing sequence.

Fig. 7 is circular plasmids recovery template peasy-fix1.

Fig. 8 is the adenovirus carrier H271pAdeno-Cas9 expressing Cas9 nuclease

Fig. 9 is the overall T7E1 detection case of injection adenovirus group mouse liver vivo gene in-situ immobilization.

Figure 10 is injection adenovirus group mouse liver vivo gene reparation average case distribution plan.

Figure 11 is that 3 individual mice liver vivo genes of injection high titer adenovirus poison group repair situation distribution plan.

Figure 12 is injection adenovirus group mouse liver gene in-situ immobilization situation sequencing result.

Figure 13 is that injection pX458-sgmf9 plasmid and ssODN donor group mouse liver vivo gene repair situation distribution plan.

Figure 14 is injection pX458-sgmf9 plasmid and ssODN donor group mouse vivo gene in-situ immobilization cloning and sequencing result.

Figure 15 repairs donor group mouse liver vivo gene in-situ immobilization situation for injection pX458-sgmf9 plasmid and peasy-fix1 plasmid and distributes.

Figure 16 be injection pX458-sgFIX plasmid and peasy-fix1 plasmid repair donor group 3 mouse separately in liver gene in-situ immobilization situation distribute.

Figure 17 is injection pX458-sgFIX plasmid and peasy-fix1 plasmid donor group mouse vivo gene in-situ immobilization cloning and sequencing result.

Figure 18 is injection pX458-sgFIX plasmid and peasy-fix1 plasmid donor group mouse clotting ability aPTT detected result.

Embodiment

In conjunction with following specific embodiments and the drawings, the present invention is described in further detail, and protection content of the present invention is not limited to following examples.Under the spirit and scope not deviating from inventive concept, the change that those skilled in the art can expect and advantage are all included in the present invention, and are protection domain with appending claims.Implement process of the present invention, condition, reagent, experimental technique etc., except the following content mentioned specially, be universal knowledege and the common practise of this area, the present invention is not particularly limited content.As according to people such as Sambrook, molecular cloning, the described people of laboratory manual (NewYork:ColdSpringHarborLaboratoryPress, 1989), or according to the suggestion condition of manufacturer.

The present invention proposes a kind of gene in-situ remediation method and pharmaceutical composition and its application in treatment hemophilia (comprising A, Type B).In the present invention, disclose and a kind ofly repair pathogenic mutation site in haemophilia B body or complete normal FIX factor gene is inserted in safe site in patient body method.The method comprises: the site determining gene in-situ immobilization, and introducing nuclease carries out cutting as CRISPR/Ca system to editing sites DNA and causes DNA damage, provides recovery template fragment simultaneously.Further, utilize the inventive method, utilize DNA repair mechanism in body repair mutational site or introduce complete FIX gene.Wherein, repair mode comprises: the reparation of (a) non-homologous end joining.Non-homologous end joining reparation causes transgenation (base insertion, disappearance) to be introduced in goal gene group sequence.(b) homologous recombination repair.Homologous recombination repair makes donor exogenous DNA array be incorporated in target gene group DNA sequence dna, causes the change of endogenous targets gene order.

Embodiment 1 carries out in-situ immobilization to the number of base of clotting factor IX gene seat in mankind HEK293T cell

1, the structure of the carrier pX458-sghF9 of targeted human plasma thromboplastin component

The schematic diagram of gene in-situ immobilization is carried out as shown in Figure 1 in human cell FIX site by CRISPR/Cas system.The DNA sequence dna of Human factor IX is obtained, the CDS region of clotting factor IX gene the 8th exon that search sequence is behaved in this example from NCBI.5 ' N is found in the positive-sense strand or antisense strand of this CDS sequence ₂₀nGG3 ' or 5 ' CCNN ₂₀the sequence of 3 '.Wherein front 20 base N are the base that sgRNA and target complement sequence match.And PAM (proto-spacer-ajacent-motif) sequence that last three base NGG (CCN) identify for s.pyCas9 is not counted in sgRNA sequence.Be U6 promotor so add one " G " to ensure the transcriptional expression of sgRNA at 5 ' end of sgRNA sequence due to the promotor driving sgRNA to transcribe in pX458 carrier.In the present embodiment the sgRNA sequence selected be that SEQIDNO.555 ' TGTGCTGGCTTCCATGAAGG3 ' adds caccg at the 5 ' end of sgRNA, add aaac to form sticky end at 5 ' end of sgRNA reverse complemental chain.Two chains of external synthesis sgRNA annealing are formed with the double-strand sgRNA of sticky end.Synthesized double-stranded sequence is sghF9-For5 ' CACCGTGTGCTGGCTTCCATGAAGG3 ', sghF9-Rev5 ' AAACCCTTCATGGAAGCCAGCACAC3 '.Utilize restriction enzyme BbSI linearizing pX458 carrier (Addgene plasmid #48138), be connected into by T4 ligase enzyme the structure that sgRNA completes gene in-situ immobilization carrier pX458-sghF9.

As shown in Figure 2, the essentially consist of gene in-situ immobilization carrier pX458-sghF9 comprises: Cas9 fragment-sghF9 fragment.

2, carrier pX458-sghF9 is proceeded in Human embryo kidney cells system HEK293T realize FIX gene in-situ immobilization

In transfection before 24 hours, with the trysinization HEK293T cell of 0.25%, cell is accessed in 24 orifice plates, the about 5 × 10^4 of each a hole access cell.About 24 as a child carried out transfection when cell density reaches about 80-90%.Transfection procedure is as follows: get about 500ngpX458-sghF9 plasmid or 500ngpX458-sghF9 and 0.5nM with the ssODN template hfix:tcttcgatctacaaagttcaccatctataacaacatgttctgtgctggctt ccaCgCaggaTgtagagattcatgtcaaggagatagtgggggaccccatgttactg aagtggaagggac annexing sudden change, add in 50 μ l plasma-free DMEM medium.Separately get 50 μ l substratum and add lip2000 (invitrogen) transfection reagent (also can enter PEI with other suitable transfection reagent, calcium phosphate etc. replace lip2000).After leaving standstill 5min, transfection reagent is mixed with plasmid, continue static 20min.Finally mixed 100 μ l substratum are added in HEK293T cell that (this step is the amount in the single hole of operation 24 orifice plate.)。

3, HEK293T extracting genome DNA

Transfection utilizes selected by flow cytometry apoptosis to go out cell (i.e. the successful cell of transfection) with green fluorescence after 24 hours.Continue to cultivate about 48 hours.The protease K digesting liquid of 500 μ l20ng/ml (final concentration) is utilized to digest about 30min to the cell in each hole afterwards in 55 DEG C of water-baths.Utilize the genomic dna in phenol chloroform extraction method extraction cell.

4, identified gene editor damage that FIX gene locus is caused and gene in-situ immobilization

The sgRNA target spot upstream design PCR primer P1 selected, downstream design PCR primer P2.Wherein, P1 primer sequence: cagctacgttacacctatttgcP2 primer sequence: ccttaatccagttgacataccg.Utilize P1, P2 as primer, with the HEK293T cellular genome of extracting in step 3 for template carries out pcr amplification.PCR reaction terminates the rear utilization sky common DNA Product Purification Kit of root and carries out single step purification to product.High-temperature denatured and slow annealing is carried out to the PCR primer after purifying.T7EndonucleaseI (T7E1) is added in product after annealing.About 1h is cut at 37 DEG C of enzymes.TBE-acrylamide gel is utilized to carry out electrophoresis to digestion products.

Fig. 3 is T7E1 restriction enzyme digestion and electrophoresis figure.As shown in Figure 3, constructed plasmid can be edited the FIX genomic locus in mankind HEK293T cell.PCR primer after purifying is directly connected into pEASYblunt (transgene) carrier, choose 10 clones and check order, then choose 50 check order for proceeding to ssODN group.The result of the DNA damage that Fig. 4 causes FIX gene locus in HEK293T for gene in-situ immobilization plasmid and gene in-situ immobilization.As shown in Figure 4, wherein underscore part is target sequence, and agg is PAM sequence afterwards, and each section of sequence has marked situation "-" the expression disappearance base of clone through DNA damage, and "+" represents the base inserted.Square frame is depicted as HDR and introduces merger sudden change.

Embodiment 2, repairs the FIX gene fragment of hemophilia mouse model disappearance in vivo by gene in-situ immobilization.

1, haemophilia B mouse information

In the present embodiment haemophilia B mouse on FIX gene with the pure and mild sudden change of Y381D.

2, the selection of sgRNA target spot

System of selection is with the selection of sgRNA in embodiment 1.Being chosen as of sgRNA in the present embodiment:

sgmf9-forcaccggAACTCTAAGGTCCTGAAGAA,

sgmf9-RevaaacTTCTTCAGGACCTTAGAGTTcc,

3, the structure of pX458-sgFIX gene in-situ immobilization carrier

Annealed for sgFIX-For and sgFIX-RevDNA in step 2 connecting in pX458 is respectively built into pX458-sgmf9, as shown in Figure 5.

4, the structure of adenoviral gene in-situ immobilization carrier

Connect into annealed for sgmf9-For and sgmf9-Rev in step 2 in H271pAdeno carrier.Design homologous recombination repair sequence according to FIX element mutation position (Y381D) point in haemophilia B Mice Body and build adenovirus carrier.The present embodiment repairing sequence is chosen as the DNA with mouse FIX gene DNA sequence very high homology.Be wild-type by the sudden change reparation of mouse Y381D in repairing sequence, in repairing sequence, introduce the genome annexing sudden change and prevent from having repaired with the cutting of sour enzyme simultaneously.Repairing sequence fix1 is double-stranded DNA, and it comprises the homology arm of Y381D mutational site and a left and right 800bp.Fix1 is connected in the H271pAdeno carrier with sgRNA, built the adenovirus carrier H271pAdeno-sgmf9-fix1 with sgRNA and homologous recombination repair sequence, as shown in Figure 6.

5, the structure of homologous recombination plasmid donor

Fix1 is connected into (transgene) in peasy-blunt carrier be built into only have donor sequences carrier peasy-FIX1 as shown in Figure 7, as plasmid donor.

6, the design of ssODN donor sequences

External synthesis is with the single stranded oligonucleotide ssODN:fix2TGTCAGTGGCTGGGGAAAAGTCTTCAACAAAGGGAGACAGGCTTCC ATTCTTCAGTACCTTAGAGTTCCACTGGTGGATAGAGCCACATGCCTTAGGTCCAC AACATTCACTATCTATAA with mouse FIX gene very high homology.

7, the structure of Cas9 adenovirus carrier

Nuclease in the present embodiment is selected and is come from, the Cas9 nuclease of archeobacteria II type (CRISPR)-CRISPR-associatedprotein (Cas) system.The adenovirus carrier H271pAdeno-Cas9 being built into as shown in Figure 8 and expressing Cas9 nuclease will be connected in H271pAdeno carrier after Cas9 sequence amplification by PCR.

8, the amplification of viral delivery vector and concentrated and purified

By Cas9 adenovirus infection HEK293A cell amplification, be concentrated into about 10 by CsCl density gradient centrifugation ¹²pfu is with for subsequent use.Equally H271pAdeno-sgmf9-fix1 is packaged into adenovirus, is concentrated into about 10 by CsCl density gradient centrifugation ¹²pfu is with for subsequent use.

9, mouse FIX gene is repaired in vivo by the method for injection DNA plasmid

Injection is expressed the plasmid of CRISPR/Cas system and is provided the plasmid of DNA plerosis sequence: adjustment volume after 120 μ gpX458-sgmf9 carriers and the mixing of 120 μ gpeasy-fix1 donor dna carriers is 1ml by first group, is injected in mouse tail vein within 7-10 second.Second group 120 μ gpX458-sgFIX carriers are mixed with 120 μ g single stranded oligonucleotide fix2 after to adjust volume be 1ml, be injected in mouse tail vein within 7-10 second.

10, murine genes is repaired in vivo by the method for injection adenovirus delivery vector

Injection is divided into high density group HighAdv: by 10 ¹¹pfuH271pAdeno-Cas9 adenovirus and 5 × 10 ¹¹after the mixing of pfuH271pAdeno-sgmf9-fix1 adenovirus, adjustment volume is entered in Mice Body by tail vein injection after 200 μ l.Low concentration group lowAdv: by 10 ¹⁰pfuH271pAdeno-Cas9 adenovirus and 10 ¹⁰after the mixing of pfuH271pAdeno-sgmf9-fix1 adenovirus, adjustment volume is entered in Mice Body by tail vein injection after 200 μ l.

11, inject adenovirus group mouse liver vivo gene situation of repairing to detect

Tail vein injection is after about 4 weeks, by mouse euthanasia.Get mouse liver grinding, extract hepatic gene group DNA.At target spot upstream design PCR primer P3, at target spot downstream design PCR primer P4.

Wherein: P3 primer sequence is tcgaactatccctcatcaccag

P4 primer sequence is gtctgtaaagggcatcacccat

With the hepatic gene group DNA extracted for template, P3, P4 are that primer carries out pcr amplification.Gained PCR primer utilizes kits (sky root).PCR primer after purifying is added T7E1 enzyme cut, detect the efficiency of CRISPR/Cas system in-situ immobilization gene in Mice Body, result enters the adenovirus of injection shown in Fig. 9 group about has the liver cell of 19% to there occurs gene original position editor.PCR primer is linked into pEASYblunt carrier to choose 360 clones and check order, clone's quantity of overall producer original position editor accounts for 18%, the hepatic gene of 10% is had to there occurs disappearance or inserting edition, the hepatic gene group of 8% is had to there occurs HDR gene in-situ immobilization, the liver cell genome of 7% is wherein had to be repaired back wild-type, as shown in Figure 10.Figure 11 shows that the mouse vivo gene separately of 3 high titer adenovirus poison of injection repairs situation, mutator gene in three Mice Bodies has being repaired in various degree (to repair the reparation of 1.72%, 12.5%, 6.4%, G to T pathogenic mutation completely: 4.31%, 10.83%, 4%).Figure 12 shows that the concrete sequencing analysis situation that mouse liver genome is repaired, its mid point are disappearance base, underscore, for inserting base, is the base of generation HDR replacement in square frame.

12, inject plasmid group mouse liver vivo gene in-situ immobilization situation to detect

Same genome analysis is carried out to the mouse liver of injection pX458-sgmf9 and peasy-fix1 plasmid or single stranded oligonucleotide (ssODN) fix2 group.As Figure 13, inject fix2 group picking 177 clones, about have the clone of 1.12% to there occurs gene original position editor.The clone of 0.56% is about had to there occurs the base reparation of G to T.As the gene in-situ immobilization situation that Figure 14 is gained after 177 cloning and sequencing analyses of injection fix2 group picking.

To injecting peasy-fix1 plasmid group picking 394 clones, wherein have the clone of 6.6% to there occurs gene in-situ immobilization, what the reparation of G to T base occurred has 6.35% (Figure 15).Be injection peasy-FIX1 group 3 murine genes in-situ immobilization situations as shown in figure 16.The sequencing analysis result of 394 clones as shown in figure 17.

The mouse blood getting injection pX458-sgFIX and peasy-FIX1 plasmid or ssODN group carries out apTT detection.As shown in figure 18, no matter be repair mouse FIX gene with peasy-FIX1 plasmid or with ssODN as donor, the clotting time of mouse all significantly shortens than without treatment group or placebo, on average have dropped about 25-30%.

Claims

1. thrombin F8/F9 is carried out to a method for in-situ immobilization, it is characterized in that, step comprises:

(6) described homologous recombination donor sequences is inserted in described gene in-situ immobilization site, the expression of revision points or supplementary gene;

Wherein,

In described step (1), by finding the N near mutational site on positive-sense strand ₂₀nGG, or on antisense strand, find the CCNN near mutational site ₂₀, determine the target spot of CRISPR/Cas gene editing system institute in-situ immobilization, wherein said mutational site refers to and causes thrombin to lose function or the active mutational site reducing or lack;

In step (2), the transgenation entrained by haemophiliac can design homologous recombination repair donor DNA sequences, wherein said transgenation is selected from single base or many base deletions;

In step (3), described homologous recombination repair donor sequences is homologous recombination repair sequence, it comprises the partial sequence of the encoding blood coagulation factors CDS for in-situ immobilization single-base deletion mutation, the sequence for the encoding blood coagulation factors of in-situ immobilization polybase base deletion mutantion, and the sequence of encoding blood coagulation factors full genome CDS for the deletion mutantion of in-situ immobilization full genome;

In step (4), delivery vector is selected from slow virus, adenovirus, adeno-associated virus, single stranded oligonucleotide, linear DNA, annular DNA, is imported any one or the multiple combination of DNA or RNA of associated materials parcel by nano material or DNA;

In step (5), described homologous recombination repair donor sequences is inserted into the expression coming revision points or supplementary gene in described gene editing site;

In step (6), described safe locus is can carry out to it gene locus that gene in-situ immobilization can't threaten to health through checking.

2. the method for claim 1, it is characterized in that, sgRNA sequence corresponding to F9 mutational site is selected from one or more sgRNA sequence in SEQIDNO.1-241, and the position of target spot is positioned at safe locus (safeharbor) and includes but not limited to AAVS1, CCR5, Albumin etc.

3. as the method for claim 1 or 2, it is characterized in that, described many base deletions are gene fragment disappearance or full genome disappearance, described reparation donor sequences comprises or is made up of the sequence in SEQIDNO:242, and described homologous recombination repair donor sequences comprise for repair merger sudden change that thrombin is wild-type or introduce there is blood coagulation activity stronger than wildtype factor new sudden change as FIXR338L.

4. method as claimed in claim 1 or 2, is characterized in that, can increase in advance, concentrates related viral vectors in step (4) in HEK293T cell or HEK293 or HEK239A or HEK293FT cell.

5. method as claimed in claim 1 or 2, it is characterized in that, step does not pass through delivery vector in (4), direct Cas9 recombinant protein leads host cell by nano material, transfection reagent etc., or directly by the method for in-vitro transfection, Cas9 recombinant protein is imported host cell, to reduce entering of foreign aid's nucleic acid, reduce the probability that foreign aid DNA random integration enters genomic dna.

6. for the preparation of the method for the adenovirus carrier in claim 1 or 2, it is characterized in that, step is as follows:

(1) by the DNA encoding sequence of the method amplification Cas9 of PCR or external synthesis;

(2) homologous recombination sequence needed for sudden change of blood coagulation factor VIII, IX gene or the complete DNA sequences encoding of encoding blood coagulation factors VIII, IX gene is repaired by the method amplification of PCR or external synthesis;

(3) by the method for molecular cloning, the repairing sequence in the Cas9 in step (1) and step (2) is connected in same or different adenovirus carriers;

(4) adenovirus transfection being entered by carrying out increasing and concentrating in the host cell strain of adenovirus transfected and next expression adenoviral gene E1 and E3, obtaining object adenovirus carrier;

Wherein,

Described adenovirus carrier is the carrier for the haemophiliachemophiliac coagulation factor gene in-situ immobilization of mouse, and host cell strain is HEK293, HEK293A, HEK293T or HEK293FT cell;

Or,

Described adenovirus carrier is the carrier for the haemophiliachemophiliac coagulation factor gene in-situ immobilization of people, and the thin strain born of the same parents of host are HEK293, HEK293A, HEK293T or HEK293FT cells.

7. method as claimed in claim 6, it is characterized in that, the described carrier for the haemophiliachemophiliac coagulation factor gene in-situ immobilization of mouse, be the adenovirus carrier H271pAdeno-sgmf9-fix1 carrier with sgRNA and homologous recombination repair sequence, and the adenovirus carrier of described expression Cas9 nuclease is H271pAdeno-Cas9 carrier;

Or,

The described carrier for the haemophiliachemophiliac coagulation factor gene in-situ immobilization of people, be be H271Adeno-sghFIX-hFIX carrier with the adenovirus carrier of sgRNA and homologous recombination repair sequence, and the adenovirus carrier of described expression Cas9 nuclease is H271Adeno-hCas9 carrier.

8. method as claimed in claims 6 or 7, it is characterized in that, sgRNA sequence corresponding to F9 mutational site is selected from one or more sgRNA sequence in SEQIDNO.1-241, and the position of target spot also can be positioned at safe locus (safeharbor) includes but not limited to AAVS1, CCR5, Albumin etc.

9. by the adenovirus carrier prepared by method according to claim 8.

10. adenovirus carrier as claimed in claim 9, it is characterized in that, comprise nuclease protein and/or sgRNA, in the middle of gene locus that the nucleotide sequence of described homologous recombination repair donor is delivered to in-situ immobilization by carrier or safe locus, wherein nuclease protein is CRISPR/Cas9 albumen, or produce nuclease and the combination thereof of DNA single chain or double-strand break with the specific site that can cause that above-mentioned albumen has a homology, and described reparation donor sequences comprises or is selected from the sequence of SEQIDNO:242.

11. adenovirus carriers as claimed in claim 10, it is characterized in that, described adenovirus carrier is the carrier H271pAdeno-sgFIX-FIX1 carrier for the haemophiliachemophiliac coagulation factor gene in-situ immobilization of mouse, and the adenovirus carrier of described expression Cas9 nuclease is H271pAdeno-Cas9 carrier;

Or

Said adenovirus carrier is the carrier H271Adeno-sghFIX-hFIX carrier for the haemophiliachemophiliac coagulation factor gene in-situ immobilization of people, and the adenovirus carrier of described expression Cas9 nuclease is H271Adeno-hCas9 carrier.

12. the adenovirus carrier as described in any one of claim 9-11 treats the application in the pharmaceutical composition of the disease that thrombin F8/F9 transgenation causes in preparation.

13. 1 kinds of base deletions by in-situ immobilization coagulation factor gene F8 or F9 suddenly change thus treat haemophiliachemophiliac pharmaceutical composition, it is characterized in that, comprising:

Adenovirus carrier described in any one of claim 9-11;

14. pharmaceutical compositions as claimed in claim 13, it is characterized in that, the adenovirus carrier of described expression Cas9 nuclease is H271Adeno-sghFIX-hFIX carrier, and the sgRNA sequence corresponding to F9 mutational site is selected from one or more sgRNA sequence in SEQIDNO.1-241, and the nucleotide sequence of described reparation donor comprises or is selected from the sequence in SEQIDNO:242.