CN105518134A - Method for pig SLA-2 gene specific knockout through CRISPR-Cas9 and sgRNA for specially targeting SLA-2 gene - Google Patents
Method for pig SLA-2 gene specific knockout through CRISPR-Cas9 and sgRNA for specially targeting SLA-2 gene Download PDFInfo
- Publication number
- CN105518134A CN105518134A CN201580000473.4A CN201580000473A CN105518134A CN 105518134 A CN105518134 A CN 105518134A CN 201580000473 A CN201580000473 A CN 201580000473A CN 105518134 A CN105518134 A CN 105518134A
- Authority
- CN
- China
- Prior art keywords
- sla
- gene
- sequence
- sgrna
- target sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Virology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for pig SLA-2 gene specific knockout through CRISPR-Cas9 and sgRNA for specially targeting an SLA-2 gene. A target sequence of the sgRNA for specially targeting the SLA-2 gene on the SLA-2 gene meets a 5'-N(20)NGG-3' sequence arrangement rule, wherein the N(20) represents 20 continuous bases, and each N represents A, T, C or G; the target sequence on the SLA-2 gene locates at a 5-exon coding area or a junction position of adjacent introns of an N end of the SLA-2 gene; and the target sequence on the SLA-2 gene is unique. The sgRNA is used in a method for pig SLA-2 gene specific knockout through the CRISPR-Cas9, the pig SLA-2 gene can be rapidly, accurately, efficiently and specifically knocked out, and the problems of the long period and high cost of construction of an SLA-2 gene knockout pig are effectively solved.
Description
Technical field
The present invention relates to gene engineering technology field, particularly relate to gene Knockout field, be specifically related to the method for CRISPR-Cas9 specific knockdown pig SLA-2 gene and the sgRNA for selectively targeted SLA-2 gene.
Background technology
Organ transplantation is the most effective treatment means for the treatment of organs debilitating diseases.Up to now, the patient in the whole world existing nearly 1,000,000 continues life by organ transplantation.Along with the progress of aging population and medical skill, need the patient carrying out organ transfer operation to get more and more, but the shortage of donor organ seriously constrain carrying out of organ transfer operation.For renal transplantation, China needs the patient carrying out renal transplantation to reach 300,000 every year, and the donation kidney that can be used for transplanting is no more than 10,000 examples, and most of patient dies from renal failure.Rely on after death organ donation can not meet the needs of organ transplantation.By other species genetic engineering modified, to provide the organ being appropriate to human implantation, become the main path solving non-human donor's organ shortage problem.
At present, evaluate according to biological safety, physiological function index, economy and rare species conservation etc. are many-sided, pig becomes ideal Xenogeneic organ source.But there is huge difference between pig and people, directly the organ transplantation of pig can be produced strong immunological rejection to people.Therefore, by genetically engineered, pig is transformed, to produce the organ being suitable for human implantation, become heteroplastic ultimate aim.
Swine leukocyte antigen (swineleukocyteantigen, SLA) I quasi-molecule is the critical function gene representing gene molecule hereditary feature.Be called SLA-1 (PD1), SLA-2 (PD14) and SLA-3 (PD7), be also called SLA-C, SLA-B and SLA-A.The classical main high expression level of SLA gene is in immunity system and Digestive tract, and especially in immunity system, the tissue such as spleen, thymus gland, bronchial lymph nodes is rich in immunocyte.People's cd4 t cell by the heterologous antigen of indirectly antigen presentation approach identification pig, and is mainly SLAI quasi-molecule and identifies.Therefore, need the SLAI quasi-molecule eliminating pig cell surface to reduce the immunogenicity of xenogeneic organ.And the knock-out pig SLA-2 gene of precise and high efficiency, be the committed step eliminating the immunological rejection that SLAI quasi-molecule causes.
At present, common gene Knockout comprises homologous recombination (HomologusRecombination, HR) technology, class transcriptional activation effector nuclease (TranscriptionActivator-LikeEffectorNuclease, TALEN) technology, Zinc finger nuclease (Zinc-FingerNuclease, ZFN) the short palindrome in the rule cluster interval of technology and latest developments repeats (ClusteredRegularlyInterspacedShortPalindromicRepeat, CRISPR) technology.Because recombination efficiency is low, (efficiency approximately only has 10 to HR technology
-6), to the screening operation of mutant, very consuming time and poor efficiency, is substituted gradually.The cutting efficiency of TALEN technology and ZFN technology generally can reach 20%, but all needs to build the protein module that can identify particular sequence, and previous work is loaded down with trivial details time-consuming.The modular design of ZFN technology is comparatively complicated and have higher miss rate, and its application is limited.
CRISPR is that one comes from procaryotic acquired immune system, and the mixture that this system performs interference function is made up of protein C as and CRISPR-RNA (crRNA).This system finds that there is three types at present, and wherein Equations of The Second Kind Cas9 system composition is simple, is actively applied to genetically engineered field.Cas9 target cutting DNA is by two kinds of tiny RNA---crRNA (CRISPRRNA) and tracrRNA (trans-activatingcrRNA) realizes with the principle of target complement sequence identification.Two kinds of tiny RNA are fused into a RNA chain now, are called for short sgRNA (singleguideRNA), specific gene order can be identified, guide Cas9 albumen to cut.In eukaryote, there is non-homogeneous restructuring end after DNA is cut-off and connect, cause phase shift mutation, finally cause gene function to knock out.
Compared to above-mentioned 3 kinds of technology, CRISPR technological operation is simple, screening efficiency is high, can realize the cutting of accurate target.Therefore, knock out by CRISPR technology the screening efficiency that SLA-2 gene greatly can improve Neu5Gc deletion cells and genetically engineered pig.But the gordian technique difficult problem in this path designs and prepares the sgRNA of accurate target, because the target tolerance range height of gene depends on sgRNA target sequence, the sgRNA that success designs accurate target becomes the key technical problem knocking out goal gene, the invention is intended to solve this technical problem thus provides solid basis for knocking out SLA-2 gene.
Summary of the invention
The object of the present invention is to provide the method for CRISPR-Cas9 specific knockdown pig SLA-2 gene and the sgRNA for selectively targeted SLA-2 gene.
According to a first aspect of the invention, the invention provides the sgRNA for selectively targeted SLA-2 gene in CRISPR-Cas9 specific knockdown pig SLA-2 gene, this sgRNA has following characteristics:
(1) target sequence of this sgRNA on SLA-2 gene meets the series arrangement rule of 5 '-N (20) NGG-3 ', wherein N (20) represents 20 continuous print bases, wherein each N represents A or T or C or G, and legal target sequence can be positioned at positive-sense strand or antisense strand;
(2) target sequence of this sgRNA on SLA-2 gene is positioned at 5 exons coding districts of the N end of SLA-2 gene, or the major portion of sequence is positioned at 5 exons of the N end of SLA-2 gene, rest part crosses over the boundary with adjacent intron, is positioned at adjacent intron;
(3) target sequence of this sgRNA on SLA-2 gene is unique.
As preferred version of the present invention, above-mentioned target sequence is the sequence shown in arbitrary sequence in SEQ ID NO:1 ~ 174.
As preferred version of the present invention, above-mentioned target sequence is SEQ ID NO:2, the sequence shown in 3 or 8.
According to a second aspect of the invention, the invention provides the method for CRISPR-Cas9 specific knockdown pig SLA-2 gene, the method comprises the steps:
(1) 5 '-end of the target sequence of the sgRNA described in first aspect adds the sequence for the formation of sticky end, and synthesis obtains forward oligonucleotide sequence; The two ends of the complementary sequence that the target sequence of the sgRNA described in first aspect is corresponding add the suitable sequence for the formation of sticky end, and synthesis obtains reverse oligonucleotide sequence; By the forward oligonucleotide sequence of synthesis and reverse oligonucleotide sequence anneals, renaturation, form the double stranded oligonucleotide with sticky end;
(2) above-mentioned double stranded oligonucleotide is connected into the linearizing expression vector carrying Cas9 gene, obtain carrying the expression vector of sgRNA oligonucleotide containing respective target sequence and Cas9 gene, transform competent bacteria, Screening and Identification goes out correct positive colony, and positive colony is shaken to bacterium, extracts plasmid;
(3) the false type slow virus of sgRNA and Cas9 simultaneously carrying target SLA-2 gene is packed out with the expression vector of the above-mentioned sgRNA of carrying oligonucleotide and Cas9 gene, packaging plasmid and package cell line;
(4) use above-mentioned false type slow virus infection object cell, and cultivate further; Then collect infected object cell, with the gene fragment of its genomic dna above-mentioned target sequence for template amplification comprises, cut through sex change, renaturation and enzyme, that determines SLA-2 gene knocks out situation.
As preferred version of the present invention, above-mentioned expression vector is the carrier of sequence shown in SEQ ID NO:175.
As preferred version of the present invention, aforesaid method comprises the steps:
(1) 5 '-end of the target sequence of the sgRNA described in first aspect adds CACCG sequence, and synthesis obtains forward oligonucleotide sequence; 5 '-end of the complementary sequence that the target sequence of the sgRNA described in first aspect is corresponding adds AAAC sequence, 3 '-end adds C, and synthesis obtains reverse oligonucleotide sequence; By the forward oligonucleotide sequence of synthesis and reverse oligonucleotide sequence anneals, renaturation, form the double stranded oligonucleotide with sticky end;
(2) linearized vector that the expression vector lentiCRISPRv2 above-mentioned double stranded oligonucleotide being connected into sequence as shown in SEQ ID NO:175 obtains through BsmBI digestion with restriction enzyme, obtain the recombinant expression vector lentiCRISPRv2-SLA-2 carrying sgRNA oligonucleotide, transform competent bacteria, Screening and Identification goes out correct positive colony, and positive colony is shaken to bacterium, extracts plasmid;
(3) the false type slow virus of sgRNA and Cas9 simultaneously carrying target SLA-2 gene is packed out with above-mentioned expression vector lentiCRISPRv2-SLA-2, packaging plasmid and package cell line;
(4) use above-mentioned CRISPR false type slow virus infection object cell, and cultivate further; Then collect infected object cell, with the gene fragment of its genomic dna above-mentioned target sequence for template amplification comprises, cut through sex change, renaturation and enzyme, that determines SLA-2 gene knocks out situation.
As preferred version of the present invention, above-mentioned packaging plasmid is plasmid pLP1, plasmid pLP2 and plasmid pLP/VSVG; Above-mentioned packing cell is HEK293T cell.
As preferred version of the present invention, above-mentioned purpose cell is pig PIEC cell.
As preferred version of the present invention, above-mentioned with the gene fragment of its genomic dna above-mentioned target sequence for template amplification comprises, cut through sex change, renaturation and enzyme, that determines SLA-2 gene knocks out situation, is specially:
A () is to infect the genomic dna of the object cell of virus for template, the SLA-2 gene fragment of the target sequence of above-mentioned sgRNA is comprised, simultaneously with the genomic dna of the wild-type cell of same primers amplification uninfecting virus with the upstream and downstream primer amplification of SLA-2 gene;
B SLA-2 gene fragment that the above-mentioned amplification of () purifying is arrived, then in the future the SLA-2 gene fragment of the object cell of self-infection virus and the SLA-2 gene fragment balanced mix from wild-type cell, heat denatured, renaturation, form hybrid DNA molecule;
C () cuts the hybrid DNA molecule after renaturation with Cruiser enzyme;
D () electrophoresis detection digestion products, detects the SLA-2 gene knockout effect of target sequence mediation.
According to a third aspect of the invention we, the invention provides the recombinant expression vector lentiCRISPRv2-SLA-2 used in the method for CRISPR-Cas9 specific knockdown pig SLA-2 gene, the sequence of the skeleton carrier of this recombinant expression vector is as shown in SEQ ID NO:175; Entrained target sequence as the target sequence of the sgRNA of first aspect, SEQIDNO:2, the target sequence shown in 3 or 8 in preferred sequence table.
According to a forth aspect of the invention, the invention provides sgRNA as described in relation to the first aspect or the purposes of recombinant expression vector lentiCRISPRv2-SLA-2 in the method for CRISPR-Cas9 specific knockdown pig SLA-2 gene described in the third aspect.
Of the present invention for CRISPR-Cas9 specific knockdown pig SLA-2 gene, successfully find the sgRNA of selectively targeted SLA-2 gene, sgRNA of the present invention is used in the method for CRISPR-Cas9 specific knockdown pig SLA-2 gene, can fast, accurately, efficiently, knock-out pig SLA-2 gene specifically, effectively solve and build the technical problem that the SLA-2 gene knock-out pig cycle is long and cost is high.
Accompanying drawing explanation
Fig. 1 is the plasmid map of the vector plasmid lentiCRISPRv2 used in the embodiment of the present invention;
Fig. 2 is the plasmid map of the packaging plasmid pLP1 used in the embodiment of the present invention;
Fig. 3 is the plasmid map of the packaging plasmid pLP2 used in the embodiment of the present invention;
Fig. 4 is the plasmid map of the packaging plasmid pLP/VSVG used in the embodiment of the present invention;
Fig. 5 is the electrophoresis detection result figure of the gene knockout effect of digestion verification target sequence in the embodiment of the present invention, wherein M represents DNAMarker, 2,3 and 8 to represent in table 1 that No. 2, No. 3 and No. 8 target sequence are to the target cutting effect of SLA-2 gene respectively, WT represents that the PCR primer Cruiser enzyme of the wild-type cell cut without virus infection and Cas9 cuts detected result, and arrow place represents the small segment obtained through the cutting of Cruiser enzyme.
Embodiment
Below in conjunction with the drawings and specific embodiments, technical scheme of the present invention is described further.These the drawings and specific embodiments are not used for limiting the scope of the invention.If do not specialize, the conventional means that technique means used in embodiment is well known to those skilled in the art, is raw materials usedly commercial goods.
The test materials related in following examples and reagent: lentiCRISPRv2 plasmid is purchased from Addgene company, packaging plasmid pLP1, pLP2 and pLP/VSVG are purchased from Invitrogen company, package cell line HEK293T cell purchased from American Type culture collection warehousing (ATCC), PIEC cell is purchased from Chinese Academy of Sciences's cell bank, DMEM substratum, Opti-MEM substratum and foetal calf serum FBS are purchased from Gibco company, and Lipofectamine2000 is purchased from Invitrogen company.
Do not make the experimental methods of molecular biology illustrated in following examples, all carry out with reference to the concrete grammar described in " Molecular Cloning: A Laboratory guide " (third edition) J. Pehanorm Brooker one book, or carry out according to test kit and product description.
Recapitulative technical scheme of the present invention comprises following five parts:
One, the Choice and design of Susscrofa (pig) SLA-2 gene sgRNA target sequence
The sgRNA target sequence of 1.SLA-2 gene is selected:
Suitable 20bp oligonucleotide sequence is found as target sequence in SLA-2 gene extron subarea.
The sgRNA target sequence design of 2.SLA-2 gene:
Above-mentioned target sequence and complementary sequence are added joint respectively, forms forward oligonucleotide sequence and reverse oligonucleotide sequence.
Two, the CRISPR carrier of SLA-2 gene is built
1. synthesize above-mentioned forward oligonucleotide sequence and reverse oligonucleotide sequence, renaturation forms the double chain DNA fragment (i.e. double stranded target sequence oligonucleotide) with sticky end.
2. build CRISPR-sgRNA expression vector:
Above-mentioned double chain DNA fragment is built up to destination carrier (as lentiCRISPRv2, its plasmid map as shown in Figure 1), form the slow virus CRISPR carrier as lentiCRISPRv2-SLA-2.
Three, the false type slow virus of expressing SLA-2sgRNA is obtained
The false type slow virus of the CRISPR utilizing packaging plasmid, package cell line and slow virus CRISPR carrier to produce to express SLA-2sgRNA.
Four, infect object cell and detect SLA-2 gene knockout effect
1. slow virus infection object cell:
The false type slow virus of such as lentiCRISPRv2-SLA-2 is added object cell culture medium carry out infection and cultivate further.
2. detect SLA-2 gene knockout effect:
Collect object cell, take genomic dna as the gene fragment that template amplification comprises target sequence, cut through sex change, renaturation and enzyme, that determines SLA-2 gene knocks out situation.
Five, SLA-2 gene knockout is monoclonal selects and identifies
1., for there being the object cell mass determining to knock out effect, by dilution and Colony Culture, isolate the cell strain of some single cell source.
2. identify that monoclonal SLA-2 knocks out situation.
Describe technical scheme of the present invention and beneficial effect thereof by the following examples in detail.
The Choice and design of embodiment one, Susscrofa (pig) SLA-2 gene sgRNA target sequence
Target sequence determines the targeting specific of sgRNA and the efficiency of induction Cas9 cutting goal gene.Therefore, efficiently special target sequence Choice and design is the prerequisite building sgRNA expression vector.
1.SLA-2 the sgRNA target sequence of gene is selected
For SLA-2 gene, following principle should be followed on target sequence is selected:
(1) target sequence meeting 5 '-N (20) NGG-3 ' rule is found in SLA-2 gene extron coding region, wherein N (20) represents 20 continuous print bases, wherein each N represents A or T or C or G, and legal target sequence can be positioned at positive-sense strand or antisense strand;
(2) select 5 exons coding region sequences near N end, the cutting of such coding region sequence can cause the function of SLA-2 gene to knock out, and the sequence of residual brachymemma can not be formed with the albumen of function;
(3) if there is multiple spliced body, then select in common exon coding region, 5 the exons coding region sequences held near N for SLA-2 gene Selection can meet this condition;
(4) utilize online sequence analysis tools (http://crispr.mit.edu/) to analyze the homology situation of above target sequence in pig genome, give up the target sequence that there is remarkable homologous sequence, select further according to scoring,
The target sequence selected is unique on SLA-2 gene.
Based on above principle, select the target sequence set shown in table 1.
The set of table 1 target sequence
The sgRNA target sequence design of 2.SLA-2 gene:
(1) using lentiCRISPRv2 plasmid as expression vector, according to the feature of lentiCRISPRv2 plasmid, add CACCG sequence at 5 '-end of above-mentioned N (20) target sequence, form forward oligonucleotide sequence:
5’-CACCGNNNNNNNNNNNNNNNNNNNN-3’；
(2) add sequence at the two ends of the reverse complementary sequence of above-mentioned N (20) target sequence, form reverse oligonucleotide sequence:
5’-AAACNNNNNNNNNNNNNNNNNNNNC-3’；
Forward oligonucleotide sequence and reverse oligonucleotide sequence complementaryly can form the double chain DNA fragment with sticky end:
5’-CACCGNNNNNNNNNNNNNNNNNNNN-3’
3’-CNNNNNNNNNNNNNNNNNNNNCAAA-5’。
The sgRNA expression vector of embodiment two, structure SLA-2 gene
1. synthetic DNA Insert Fragment
(1) forward and the reverse oligonucleotide sequence of above-mentioned design is synthesized
Oligonucleotide sequence specifically can be synthesized according to the sequence provided by business-like company (as Invitrogen company).The present embodiment and following examples to have studied in table 1 listed No. 2, No. 3 and No. 8 target sequence shown in sequence and knock out effect to SLA-2 gene.
The forward oligonucleotide sequence that No. 2 target sequence is corresponding and reverse oligonucleotide sequence as follows:
5’-CACCGCGCGGCTCCTCCCTCGGATT-3’(SEQIDNO：176)；
5’-AAACAATCCGAGGGAGGAGCCGCGC-3’(SEQIDNO：177)。
The forward oligonucleotide sequence that No. 3 target sequence is corresponding and reverse oligonucleotide sequence as follows:
5’-CACCGCGGCTCCTCCCTCGGATTCG-3’(SEQIDNO：178)；
5’-AAACCGAATCCGAGGGAGGAGCCGC-3’(SEQIDNO：179)。
The forward oligonucleotide sequence that No. 8 target sequence is corresponding and reverse oligonucleotide sequence as follows:
5’-CACCGGCGGCTCCTCCCTCGGATTC-3’(SEQIDNO：180)；
5’-AAACGAATCCGAGGGAGGAGCCGCC-3’(SEQIDNO：181)。
By the forward of correspondence and reverse oligonucleotide sequence anneals, renaturation, form the double chain DNA fragment with sticky end.
Reaction system (20 μ L) is as follows:
Forward oligonucleotide (10 μMs): 1 μ L
Reverse oligonucleotide (10 μMs): 1 μ L
10×PCRbuffer：2μL
ddH
2O：16μL
Above-mentioned reaction system is put into PCR instrument, and reacts by following program.
Response procedures:
95℃,5min；
80℃,5min；
70℃,5min；
60℃,5min；
50℃,5min；
Naturally room temperature is down to.
2. build sgRNA expression vector
(1) BsmBI digestion with restriction enzyme destination carrier lentiCRISPRv2 plasmid (its sequence is as shown in SEQ ID NO:175) is utilized.
Prepare according to following reaction system:
LentiCRISPRv2 plasmid: 1 μ g
10 × enzyme cuts buffer:2 μ L
BsmBI restriction enzyme: 2 μ L
Supplement ddH
2o to cumulative volume 20 μ L
Endonuclease reaction system is placed in 37 DEG C of reaction 4h.
(2) electrophoretic separation cmy vector fragment
After enzyme cuts end, enzyme is cut mixture and is separated by agarose gel electrophoresis, select carrier segments (about 12kb) to cut, and reclaimed by DNA gel recovery post.
(3) double chain DNA fragment of synthesis and carrier main leaf section are carried out being connected also transformation of E. coli
The carrier segments that double chain DNA fragment renaturation obtained obtains with recovery carries out ligation, prepares according to following reaction system:
LentiCRISPRv2 carrier segments: 100ng
Double chain DNA fragment: 200ng
T4 ligase enzyme: 1 μ L
T4 ligation buffer:1 μ L
Supplement ddH
2o to cumulative volume 10 μ L
Connection mixture is placed in 25 DEG C of reaction 2h.
Mixture transformation of E. coli DH5 α bacterial strain will be connected: in connection mixture, add 100 μ L bacillus coli DH 5 alpha competent cells, hatch 30min on ice after reaction terminates; Mixture is put into 42 DEG C of water-baths, after heat shock 90s, put into cooled on ice; Add 100 μ LLB substratum to mixture, 20min cultivated by 37 DEG C of shaking tables; Mixture is coated with AmpLB flat board, cultivates 14h for 37 DEG C.
(4) correct transformed clone is identified
Select some bacterium colonies from AmpLB flat board and carry out enlarged culturing, extraction plasmid carries out enzyme and cuts qualification.Select and may check order by correct clone, whether checking insertion sequence is correct.Conservation is carried out for correct lentiCRISPRv2-SLA-2 carrier cloning.
Embodiment three, acquisition express the false type slow virus of SLA-2sgRNA
1. material prepares
Amplification is extracting packaging plasmid pLP1, pLP2 and pLP/VSVG (purchased from Invitrogen, its collection of illustrative plates respectively as shown in Figure 2, Figure 3 and Figure 4) also; Amplification is extracting vector plasmid lentiCRISPRv2-SLA-2 also; Cultivate package cell line HEK293T cell (purchased from ATCC); DMEM substratum, Opti-MEM substratum and foetal calf serum FBS (purchased from Gibco); Lipofectamine2000 (purchased from Invitrogen); HEK293T cell cultures is in containing 5%CO
237 DEG C of culture environment in, substratum is the DMEM substratum containing 10%FBS.
2. transfection and virus packaging
First day: package cell line HEK293T is passaged to 10cmdish, about 30% degrees of fusion;
Second day: carry out transfection when HEK293T reaches 80% degrees of fusion according to following formula:
Preparating mixture 1, comprises:
lentiCRISPRv2-SLA-2：6μg
pLP1：6μg
pLP2：6μg
pLP/VSVG：3μg
Opti-MEM：500μL。
Preparating mixture 2, comprises:
Lipofectamine2000：30μL
Opti-MEM：500μL。
After leaving standstill 5min, mixture 1 and mixture 2 are mixed into transfection mixture, leave standstill 20min.
HEK293T substratum is changed to plasma-free DMEM medium, adds transfection mixture, be changed to the DMEM substratum of 20%FBS after 37 DEG C of cultivation 8h, continue to cultivate.
3. collection virus and preservation
3rd day: collect the HEK293T substratum supernatant containing virus after transfection 48h, after filtering with 0.45 μm of filter, packing, placed-80 DEG C of preservations.
Embodiment four, infect object cell and detect target sequence knock out effect
1. material prepares
Cultivate object clone pig hip arterial endothelium cells PIEC (purchased from Chinese Academy of Sciences's cell bank); DMEM substratum and foetal calf serum FBS (purchased from Gibco); The false type slow virus of lentiCRISPRv2-SLA-2 of different target sequence (sequence 2 and sequence 4); PIEC cell cultures is in containing 5%CO
237 DEG C of culture environment in, substratum is the DMEM substratum containing 10%FBS.
2. slow virus infection object cell
First day: by object passage to 6 orifice plate, about 20% merges density.Each virus needs 6 holes, needs efficiency to contrast 6 holes simultaneously.
Second day: when object cell about 40% fusion density, add the false type slow virus supernatant of 1mLlentiCRISPRv2-SLA-2 and 1mLDMEM substratum.Efficiency contrast does not need to add slow virus.
3rd day: remove containing virus culture base after infecting 24h, change normal incubation medium into, add tetracycline to final concentration 2 μ g/mL, the efficiency control sample not infecting virus also adds tetracycline in contrast simultaneously, cultivates 48h.
3. cell infection Efficiency testing and cultivation
5th day: the efficiency compared with control cells do not infected should whole apoptosis (>95%) under the effect of tetracycline.Judge the efficiency of infection of cell according to the apoptosis situation infecting slow virus cell, usually can reach the efficiency of infection (apoptosis rate <10%) of more than 90%.Carry out infecting to reach suitable efficiency of infection after viral supernatants can being carried out concentrated or gradient dilution if desired.
After tetracycline screening, the apoptosis do not infected.Object cell is gone down to posterity again and is changed to ordinary culture medium and cultivate 48h.
4. detect SLA-2 gene knockout effect
(1) design upstream and downstream primer with the SLA-2 gene fragment that increases, wherein upstream and downstream primer sequence is as follows:
ACTTGCTTCCTGACCCTCTG(SEQIDNO：182)
TGTTCAGGTTCACTCGGTAA(SEQIDNO：183)。
Object amplified fragments comprises sgRNA target sequence, and size is 406bp.Target sequence is no less than 100bp to the position at fragment two ends.
(2) collection unit divides object cell, uses promega genomic DNA kit extracting genomic dna.The genomic dna of the wild-type of extracting simultaneously object cell.
(3) take genomic dna as the SLA-2 gene fragment (comprising mutagenic samples and the wild-type samples of infection) that template amplification comprises target sequence.
Amplification reaction system (20 μ L) is as follows:
Upstream primer (10 μMs): 1 μ L
Downstream primer (10 μMs): 1 μ L
2×PCRMix：10μL
Genomic dna: 100ng
Prepare with above-mentioned reaction system, put into PCR instrument, and react by follow procedure.
Response procedures:
95℃,3min
95℃,30s
58℃,20s
72℃,20s
72℃,3min；
Wherein second step to the 4th step repeats 35 circulations.
(4) electrophoresis detection PCR primer reclaim purifying
(5) by heat denatured, the renaturation respectively of the DNA fragmentation after purifying, hybrid DNA molecule (comprising mutagenic samples and wild-type samples) is formed.
Reaction system is as follows:
Genomic PCR fragment: 200ng
5 × reaction buffer:2 μ L
Reaction system is totally 9 μ L
Prepare with above-mentioned reaction system, put into PCR instrument, and react by follow procedure.
Response procedures:
95℃,5min；
80℃,5min；
70℃,5min；
60℃,5min；
50℃,5min；
Naturally room temperature is down to.
(6) add 1 μ LCruiser enzyme with the hybrid dna (comprising mutagenic samples and wild-type samples) after Cruiser enzyme cutting renaturation to the reaction mixture through sex change, renaturation, hatch 20min for 45 DEG C.
(7) electrophoresis detection digestion products, detects the SLA-2 gene knockout effect of target sequence mediation.
By the DNA fragmentation cut through enzyme with 2% sepharose carry out electrophoretic analysis, 100V, 25min.Determine the cutting situation of object fragment, judge the gene knockout effect of target sequence.
To the cutting identification of mutant DNA based on following principle: the cell through infecting can express sgRNA and Cas9.If genomic dna is cut by the Cas9 targeting proteins that sgRNA mediates, sudden change (wild-type becomes saltant type) can be introduced near cleavage site after repairing.Because wild-type and mutant sequences do not mate in this position, the wild-type DNA gone out as template amplification and mutant DNA just can produce annular (loop) structure of local through the hybrid molecule that refolding strategy is formed.And the latter can be cut off by the identification of Cruiser enzyme, causes hybrid DNA molecule to be cut into small segment.
As shown in Figure 5, the PCR primer without the wild-type cell of virus infection does not detect small segment to result; And sequence 2, sequence 3 and sequence 8 can produce cutting by efficient targeting SLA-2 gene, the existence of small segment therefore detected, show that sequence 2, sequence 3 and sequence 8 can as the target sequences of CRISPR-Cas9 specific knockdown pig SLA-2 gene.
Embodiment five, SLA-2 gene knockout are monoclonal to be selected and identifies
1. monoclonally to select (target sequence based on sequence 2, sequence 3 and sequence 8)
(1) the object cell mass that part infects is gone down to posterity, get 100 unicellular 10cmdish that are transferred to and cultivate.
(2) cultivate after about 10 days, have a considerable amount of mono-clonal to grow into macroscopic level.
(3) independently clone by pipettor head scraping, cell is transferred in 24 orifice plates and cultivates, the corresponding clone in each hole.
(4) again after the cultivation of about a week, there is part to clone and grow to enough quantity, go to further qualification.
2. identify that monoclonal SLA-2 knocks out situation
(1) mono-clonal to be checked and wild-type cell is collected, respectively extracting genomic dna.
(2) according to preceding method, the SLA-2 gene fragment of increase respectively mono-clonal and wild-type cell, the gene fragment increased comprises sgRNA target sequence.
(3) the mono-clonal PCR fragment of equivalent is mixed with wild-type PCR fragment, heat denatured, renaturation, form hybrid DNA molecule.
(4) with the hybrid dna after Cruiser enzyme cutting annealing, 20min is hatched for 45 DEG C.
(5) whether electrophoresis detection digestion products, according to having cutting fragment determination mono-clonal whether effective sudden change occurs.
Result shows, based on the lentiCRISPRv2-SLA-2 false type slow virus infection object cell of the target sequence shown in sequence 2, detect from 20 mono-clonals of 100 unicellular middle random chooses through Cruiser enzyme restriction enzyme digestion and electrophoresis, wherein there are 17 mono-clonals cutting small segment can be detected, show that gene knockout occurs, gene knockout efficiency can reach more than 85%, illustrates that the target sequence shown in sequence 2 has the effect that very high target knocks out SLA-2 gene.Based on the lentiCRISPRv2-SLA-2 false type slow virus infection object cell of the target sequence shown in sequence 3, detect from 20 mono-clonals of 100 unicellular middle random chooses through Cruiser enzyme restriction enzyme digestion and electrophoresis, wherein there are 19 mono-clonals cutting small segment can be detected, show that gene knockout occurs, gene knockout efficiency can reach more than 95%, illustrates that the target sequence shown in sequence 3 has the effect that very high target knocks out SLA-2 gene.Based on the lentiCRISPRv2-SLA-2 false type slow virus infection object cell of the target sequence shown in sequence 8, detect from 20 mono-clonals of 100 unicellular middle random chooses through Cruiser enzyme restriction enzyme digestion and electrophoresis, wherein there are 18 mono-clonals cutting small segment can be detected, show that gene knockout occurs, gene knockout efficiency can reach more than 90%, illustrates that the target sequence shown in sequence 8 has the effect that very high target knocks out SLA-2 gene.
Above content is in conjunction with concrete embodiment further description made for the present invention, can not assert that specific embodiment of the invention is confined to these explanations.For general technical staff of the technical field of the invention, without departing from the inventive concept of the premise, some simple deduction or replace can also be made.
Claims (10)
1. in CRISPR-Cas9 specific knockdown pig SLA-2 gene for the sgRNA of selectively targeted SLA-2 gene, it is characterized in that:
(1) target sequence of described sgRNA on SLA-2 gene meets the series arrangement rule of 5 '-N (20) NGG-3 ', wherein N (20) represents 20 continuous print bases, wherein each N represents A or T or C or G, and legal target sequence can be positioned at positive-sense strand or antisense strand;
(2) target sequence of described sgRNA on SLA-2 gene is positioned at 5 exons coding districts of the N end of SLA-2 gene, or the major portion of sequence is positioned at 5 exons of the N end of SLA-2 gene, rest part crosses over the boundary with adjacent intron, is positioned at adjacent intron;
(3) target sequence of described sgRNA on SLA-2 gene is unique.
2. the sgRNA for selectively targeted SLA-2 gene according to claim 1, is characterized in that, described target sequence is the sequence shown in arbitrary sequence in SEQ ID NO:1 ~ 174.
3. the sgRNA for selectively targeted SLA-2 gene according to claim 1, is characterized in that, described target sequence is SEQ ID NO:2, the sequence shown in 3 or 8.
The method of 4.CRISPR-Cas9 specific knockdown pig SLA-2 gene, it is characterized in that, described method comprises the steps:
(1) 5 '-end of the target sequence of the sgRNA described in any one of claim 1-3 adds the sequence for the formation of sticky end, and synthesis obtains forward oligonucleotide sequence; The two ends of the complementary sequence that the target sequence of the sgRNA described in any one of claim 1-3 is corresponding add the suitable sequence for the formation of sticky end, and synthesis obtains reverse oligonucleotide sequence; By the described forward oligonucleotide sequence of synthesis and reverse oligonucleotide sequence anneals, renaturation, form the double stranded oligonucleotide with sticky end;
(2) described double stranded oligonucleotide is connected into the linearizing expression vector carrying Cas9 gene, obtain carrying the expression vector of sgRNA oligonucleotide containing respective target sequence and Cas9 gene, transform competent bacteria, Screening and Identification goes out correct positive colony, and described positive colony is shaken to bacterium, extracts plasmid;
(3) the false type slow virus that the expression vector of sgRNA oligonucleotide and Cas9 gene, packaging plasmid and package cell line pack out sgRNA and Cas9 simultaneously carrying target SLA-2 gene is carried described in use;
(4) use described false type slow virus infection object cell, and cultivate further; Then collect infected object cell, with the gene fragment of its genomic dna described target sequence for template amplification comprises, cut through sex change, renaturation and enzyme, that determines SLA-2 gene knocks out situation.
5. the method for CRISPR-Cas9 specific knockdown pig SLA-2 gene according to claim 4, it is characterized in that, described expression vector is the carrier of sequence shown in SEQ ID NO:175.
6. the method for the CRISPR-Cas9 specific knockdown pig SLA-2 gene according to claim 4 or 5, it is characterized in that, described method comprises the steps:
(1) 5 '-end of the target sequence of the sgRNA described in any one of claim 1-3 adds CACCG sequence, and synthesis obtains forward oligonucleotide sequence; 5 '-end of the complementary sequence that the target sequence of the sgRNA described in any one of claim 1-3 is corresponding adds AAAC sequence, 3 '-end adds C, and synthesis obtains reverse oligonucleotide sequence; By the described forward oligonucleotide sequence of synthesis and reverse oligonucleotide sequence anneals, renaturation, form the double stranded oligonucleotide with sticky end;
(2) linearized vector that the expression vector lentiCRISPRv2 described double stranded oligonucleotide being connected into sequence as shown in SEQ ID NO:175 obtains through BsmBI digestion with restriction enzyme, obtain the recombinant expression vector lentiCRISPRv2-SLA-2 carrying sgRNA oligonucleotide, transform competent bacteria, Screening and Identification goes out correct positive colony, and described positive colony is shaken to bacterium, extracts plasmid;
(3) the false type slow virus of sgRNA and Cas9 simultaneously carrying target SLA-2 gene is packed out with described expression vector lentiCRISPRv2-SLA-2, packaging plasmid and package cell line;
(4) use described false type slow virus infection object cell, and cultivate further; Then collect infected object cell, with the gene fragment of its genomic dna described target sequence for template amplification comprises, cut through sex change, renaturation and enzyme, that determines SLA-2 gene knocks out situation.
7. the method for CRISPR-Cas9 specific knockdown pig SLA-2 gene according to claim 6, it is characterized in that, described packaging plasmid is plasmid pLP1, plasmid pLP2 and plasmid pLP/VSVG; Described packing cell is HEK293T cell.
8. the method for CRISPR-Cas9 specific knockdown pig SLA-2 gene according to claim 6, it is characterized in that, described object cell is pig PIEC cell;
Described with the gene fragment of its genomic dna described target sequence for template amplification comprises, cut through sex change, renaturation and enzyme, that determines SLA-2 gene knocks out situation, is specially:
A () is to infect the genomic dna of the object cell of virus for template, the SLA-2 gene fragment of the target sequence of described sgRNA is comprised, simultaneously with the genomic dna of the wild-type cell of same primers amplification uninfecting virus with the upstream and downstream primer amplification of SLA-2 gene;
B SLA-2 gene fragment that the above-mentioned amplification of () purifying is arrived, then in the future the SLA-2 gene fragment of the object cell of self-infection virus and SLA-2 gene fragment balanced mix, heat denatured, the renaturation from wild-type cell, form hybrid DNA molecule;
C () cuts the hybrid DNA molecule after renaturation with Cruiser enzyme;
D () electrophoresis detection digestion products, detects the SLA-2 gene knockout effect of target sequence mediation.
9. the recombinant expression vector lentiCRISPRv2-SLA-2 used in the method for CRISPR-Cas9 specific knockdown pig SLA-2 gene, it is characterized in that, the sequence of the skeleton carrier of described recombinant expression vector is as shown in SEQ ID NO:175; The target sequence of the entrained sgRNA of target sequence as described in any one of claim 1-3, SEQIDNO:2, the target sequence shown in 3 or 8 in preferred sequence table.
10. the purposes of the sgRNA as described in any one of claim 1-3 or recombinant expression vector lentiCRISPRv2-SLA-2 according to claim 9 in the method for CRISPR-Cas9 specific knockdown pig SLA-2 gene.
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/CN2015/081228 WO2016197356A1 (en) | 2015-06-11 | 2015-06-11 | Method for knockout of swine sla-2 gene using crispr-cas9 specificity, and sgrna used for specifically targeting sla-2 gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105518134A true CN105518134A (en) | 2016-04-20 |
Family
ID=55724972
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201580000473.4A Pending CN105518134A (en) | 2015-06-11 | 2015-06-11 | Method for pig SLA-2 gene specific knockout through CRISPR-Cas9 and sgRNA for specially targeting SLA-2 gene |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN105518134A (en) |
| WO (1) | WO2016197356A1 (en) |
Cited By (24)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9526784B2 (en) | 2013-09-06 | 2016-12-27 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US9840699B2 (en) | 2013-12-12 | 2017-12-12 | President And Fellows Of Harvard College | Methods for nucleic acid editing |
| US10077453B2 (en) | 2014-07-30 | 2018-09-18 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US10227581B2 (en) | 2013-08-22 | 2019-03-12 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| CN110438128A (en) * | 2019-08-20 | 2019-11-12 | 山西农业大学 | Utilize the method for CRISPR/Cas9 system knock-out pig CCAR1 gene |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101984058A (en) * | 2010-11-16 | 2011-03-09 | 大连大学 | Pouch pig SLA-2 genes and application thereof |
| US20140186843A1 (en) * | 2012-12-12 | 2014-07-03 | Massachusetts Institute Of Technology | Methods, systems, and apparatus for identifying target sequences for cas enzymes or crispr-cas systems for target sequences and conveying results thereof |
| WO2014165573A1 (en) * | 2013-04-02 | 2014-10-09 | University Of Connecticut | Regulating transplant rejection of donor and embryonic stem cell-derived tissues and organs |
-
2015
- 2015-06-11 CN CN201580000473.4A patent/CN105518134A/en active Pending
- 2015-06-11 WO PCT/CN2015/081228 patent/WO2016197356A1/en active Application Filing
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101984058A (en) * | 2010-11-16 | 2011-03-09 | 大连大学 | Pouch pig SLA-2 genes and application thereof |
| US20140186843A1 (en) * | 2012-12-12 | 2014-07-03 | Massachusetts Institute Of Technology | Methods, systems, and apparatus for identifying target sequences for cas enzymes or crispr-cas systems for target sequences and conveying results thereof |
| WO2014165573A1 (en) * | 2013-04-02 | 2014-10-09 | University Of Connecticut | Regulating transplant rejection of donor and embryonic stem cell-derived tissues and organs |
Non-Patent Citations (1)
| Title |
|---|
| REYES LM等: "Creating Class I MHC Null Pigs Using gRNA and the Cas9 Endonuclease", 《J IMMUNOL》 * |
Cited By (47)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12006520B2 (en) | 2011-07-22 | 2024-06-11 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US10954548B2 (en) | 2013-08-09 | 2021-03-23 | President And Fellows Of Harvard College | Nuclease profiling system |
| US11920181B2 (en) | 2013-08-09 | 2024-03-05 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10227581B2 (en) | 2013-08-22 | 2019-03-12 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US9999671B2 (en) | 2013-09-06 | 2018-06-19 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US9526784B2 (en) | 2013-09-06 | 2016-12-27 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US11299755B2 (en) | 2013-09-06 | 2022-04-12 | President And Fellows Of Harvard College | Switchable CAS9 nucleases and uses thereof |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US9737604B2 (en) | 2013-09-06 | 2017-08-22 | President And Fellows Of Harvard College | Use of cationic lipids to deliver CAS9 |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US10912833B2 (en) | 2013-09-06 | 2021-02-09 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US11124782B2 (en) | 2013-12-12 | 2021-09-21 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US9840699B2 (en) | 2013-12-12 | 2017-12-12 | President And Fellows Of Harvard College | Methods for nucleic acid editing |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11053481B2 (en) | 2013-12-12 | 2021-07-06 | President And Fellows Of Harvard College | Fusions of Cas9 domains and nucleic acid-editing domains |
| US10077453B2 (en) | 2014-07-30 | 2018-09-18 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US11578343B2 (en) | 2014-07-30 | 2023-02-14 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11999947B2 (en) | 2016-08-03 | 2024-06-04 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| CN110438128B (en) * | 2019-08-20 | 2023-04-25 | 山西农业大学 | Method for knocking out pig CCAR1 gene by using CRISPR/Cas9 system |
| CN110438128A (en) * | 2019-08-20 | 2019-11-12 | 山西农业大学 | Utilize the method for CRISPR/Cas9 system knock-out pig CCAR1 gene |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2016197356A1 (en) | 2016-12-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105518134A (en) | Method for pig SLA-2 gene specific knockout through CRISPR-Cas9 and sgRNA for specially targeting SLA-2 gene | |
| CN105518135A (en) | Method for pig CMAH gene specific knockout through CRISPR-Cas9 and sgRNA for specially targeting CMAH gene | |
| CN105492609A (en) | Method for CRISPR-Cas9 specific knockout of pig GGTA1 gene and sgRNA for specific targeted GGTA1 gene | |
| CN105518139A (en) | Method for knocking out pig FGL2 genes with CRISPR-Cas9 specificity and sgRNA for specificity targeting FGL2 genes | |
| CN105518137A (en) | Method for specifically removing pig SALL1 gene by CRISPR-Cas9 and sgRNA used for specific targeting SALL1 gene | |
| CN105518138A (en) | Method knocking out pig GFRA1 genes with CRISPR-Cas9 specificity and sgRNA for specificity targeting GFRA1 genes | |
| CN105492608A (en) | Method using CRISPR-Cas9 to specifically knock off pig PDX1 gene and sgRNA of PDX1 gene for specific targeting | |
| CN105518140A (en) | Method for pig vWF gene specific knockout through CRISPR-Cas9 and sgRNA for specially targeting vWF gene | |
| CN106414740A (en) | Method for specific knockout of swine SLA-3 gene using CRISPR-Cas9 specificity, and sgRNA used for specifically targeting sla-3 gene | |
| CN105593367A (en) | CRISPR-Cas9 specificity pig SLA-1 gene knockout method and sgRNA used for specific targeting SLA-1 gene | |
| CN105907758B (en) | CRISPR-Cas9 guide sequence and primer thereof, transgenic expression vector and construction method thereof | |
| CN106244557B (en) | The method of rite-directed mutagenesis ApoE gene and LDLR gene | |
| CN107630018B (en) | A kind of kit for editing or repairing HBB gene | |
| WO2016187904A1 (en) | Method for pig cmah gene specific knockout by means of crispr-cas9 and sgrna for specially targeting cmah gene | |
| CN108795902A (en) | A kind of safe and efficient CRISPR/Cas9 gene editings technology | |
| RU2003131342A (en) | WAYS OF CULTIVATION OF CIRCUS VIRUSES | |
| CN106987560B (en) | Construction method of RK-13 cell HBB gene knockout stable strain | |
| CN111979243B (en) | Method for constructing TAP gene-deleted pig T2 cells by using CRISPR/Cas9 system | |
| CN107034238A (en) | One kind immortalizes special network cell line and its construction method | |
| CN107365803A (en) | Exempt from the method that drug screening quickly obtains mouse Rosa26 Gene targeting foreign genes | |
| CN107267532A (en) | The construction method of JS2008 plants of full-length infectious CDNAs of PEDV and application | |
| CN111484994A (en) | Method for specifically knocking out pig Fah and Rag2 double genes by CRISPR-Cas9 | |
| CN114058619A (en) | Construction of RIPLET knockout cell line and application of RIPLET knockout cell line as production cell line of picornaviridae virus vaccine | |
| CN106282230A (en) | The method of rite-directed mutagenesis LDLR gene | |
| CN106244556B (en) | The method of rite-directed mutagenesis ApoE gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160420 |
|
| RJ01 | Rejection of invention patent application after publication |