CN105518138A - Method knocking out pig GFRA1 genes with CRISPR-Cas9 specificity and sgRNA for specificity targeting GFRA1 genes - Google Patents

Method knocking out pig GFRA1 genes with CRISPR-Cas9 specificity and sgRNA for specificity targeting GFRA1 genes Download PDF

Info

Publication number
CN105518138A
CN105518138A CN201580000470.0A CN201580000470A CN105518138A CN 105518138 A CN105518138 A CN 105518138A CN 201580000470 A CN201580000470 A CN 201580000470A CN 105518138 A CN105518138 A CN 105518138A
Authority
CN
China
Prior art keywords
gfra1
sequence
sgrna
target sequence
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201580000470.0A
Other languages
Chinese (zh)
Other versions
CN105518138B (en
Inventor
蔡志明
牟丽莎
谢崇伟
刘璐
陈鹏飞
张军方
陆赢
高汉超
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shenzhen Second Peoples Hospital
Original Assignee
Shenzhen Second Peoples Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shenzhen Second Peoples Hospital filed Critical Shenzhen Second Peoples Hospital
Publication of CN105518138A publication Critical patent/CN105518138A/en
Application granted granted Critical
Publication of CN105518138B publication Critical patent/CN105518138B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a method knocking out pig GFRA1 genes with CRISPR-Cas9 specificity and sgRNA for specificity targeting GFRA1 genes. The target sequence of the sgRNA of the specificity targeting GFRA1 genes on the GFRA1 genes meets a sequence arrangement rule of 5'- N(20) NGG- 3'; N(20) represents 20 continous basic groups; each N indicates A, T, C or G; the target sequence on the GFRA1 is placed in a junction part between 5 exon encoding areas of the N end of the GFRA1 or adjacent introns; and the target sequence on the GFRA1 genes is unique. In the method knocking out pig GFRA1 genes with CRISPR-Cas9 specificity, GFRA1 genes of the pigs can be quickly, accurately and high-efficiently knocked out in a specific way; and problems of long term and high cost during gene knockout of the GFRA1 genes can be solved.

Description

The method of CRISPR-Cas9 specific knockdown pig GFRA1 gene and the sgRNA for selectively targeted GFRA1 gene
Technical field
The present invention relates to gene engineering technology field, particularly relate to gene Knockout field, be specifically related to the method for CRISPR-Cas9 specific knockdown pig GFRA1 gene and the sgRNA for selectively targeted GFRA1 gene.
Background technology
Organ transplantation is the most effective treatment means for the treatment of organs debilitating diseases.Up to now, the patient in the whole world existing nearly 1,000,000 continues life by organ transplantation.Along with the progress of aging population and medical skill, need the patient carrying out organ transfer operation to get more and more, but the shortage of donor organ seriously constrain carrying out of organ transfer operation.For renal transplantation, China needs the patient carrying out renal transplantation to reach 300,000 every year, and the donation kidney that can be used for transplanting is no more than 10,000 examples, and most of patient dies from renal failure.Rely on after death organ donation can not meet the needs of organ transplantation.By other species genetic engineering modified, to provide the organ being appropriate to human implantation, become the main path solving non-human donor's organ shortage problem.
At present, evaluate according to biological safety, physiological function index, economy and rare species conservation etc. are many-sided, pig becomes ideal Xenogeneic organ source.But there is huge difference between pig and people, directly the organ transplantation of pig can be produced strong immunological rejection to people.Therefore, by genetically engineered, pig is transformed, to produce the organ being suitable for human implantation, become heteroplastic ultimate aim.
Traditional technological line is by reducing the immunity difference of pig and people to obtain the strain that can be used for the pig transplanted.In recent years, utilize allelotaxis's defective type pig to produce as culture environment the organ be made up of human cell and become new thinking.By the gene of effective self allelotaxis of Interference Control pig of genetically engineered, make pig certain organ disappearance in growth course, thus provide crucial culture environment for the growth of human archeocyte organ.
Current known GFRA1 gene is the indispensable gene in kidney development.GFRA1 full name GDNF family receptors alpha1, high conservative in evolution.GFRA1 participates in the transmission of GDNF signal as acceptor, and the signal feedback between mediation ureter epithelium and rear renal interstitial, it is required for entering stroma for ureteric bud.Disappearance GFRA1 gene can cause Kidney of Newborn underdevelopment or disappearance.Utilize GFRA1 gene Knockout that pig can be made in growth course not produce kidney, for human cell source's kidney provides good developing environment.And the GFRA1 gene of the knock-out pig of precise and high efficiency, be first step.
At present, common gene Knockout comprises homologous recombination (HomologusRecombination, HR) technology, class transcriptional activation effector nuclease (TranscriptionActivator-LikeEffectorNuclease, TALEN) technology, Zinc finger nuclease (Zinc-FingerNuclease, ZFN) the short palindrome in the rule cluster interval of technology and latest developments repeats (ClusteredRegularlyInterspacedShortPalindromicRepeat, CRISPR) technology.Because recombination efficiency is low, (efficiency approximately only has 10 to HR technology -6), to the screening operation of mutant, very consuming time and poor efficiency, is substituted gradually.The cutting efficiency of TALEN technology and ZFN technology generally can reach 20%, but all needs to build the protein module that can identify particular sequence, and previous work is loaded down with trivial details time-consuming.The modular design of ZFN technology is comparatively complicated and have higher miss rate, and its application is limited.
CRISPR is that one comes from procaryotic acquired immune system, and the mixture that this system performs interference function is made up of protein C as and CRISPR-RNA (crRNA).This system finds that there is three types at present, and wherein Equations of The Second Kind Cas9 system composition is simple, is actively applied to genetically engineered field.Cas9 target cutting DNA is by two kinds of tiny RNA---crRNA (CRISPRRNA) and tracrRNA (trans-activatingcrRNA) realizes with the principle of target complement sequence identification.Two kinds of tiny RNA are fused into a RNA chain now, are called for short sgRNA (singleguideRNA), specific gene order can be identified, guide Cas9 albumen to cut.In eukaryote, there is non-homogeneous restructuring end after DNA is cut-off and connect, cause phase shift mutation, finally cause gene function to knock out.
Compared to above-mentioned 3 kinds of technology, CRISPR technological operation is simple, screening efficiency is high, can realize the cutting of accurate target.Therefore, knock out by CRISPR technology the screening efficiency that GFRA1 gene greatly can improve GFRA1 deletion cells and kidney growth missing gene engineering pig.But the gordian technique difficult problem in this path designs and prepares the sgRNA of accurate target, because the target tolerance range height of gene depends on sgRNA target sequence, the sgRNA that success designs accurate target becomes the key technical problem knocking out goal gene, the invention is intended to solve this technical problem thus provides solid basis for knocking out GFRA1 gene.
Summary of the invention
The object of the present invention is to provide the method for CRISPR-Cas9 specific knockdown pig GFRA1 gene and the sgRNA for selectively targeted GFRA1 gene.
According to a first aspect of the invention, the invention provides the sgRNA for selectively targeted GFRA1 gene in CRISPR-Cas9 specific knockdown pig GFRA1 gene, this sgRNA has following characteristics:
(1) target sequence of this sgRNA on GFRA1 gene meets the series arrangement rule of 5 '-N (20) NGG-3 ', wherein N (20) represents 20 continuous print bases, wherein each N represents A or T or C or G, and the target sequence meeting above-mentioned rule is positioned at positive-sense strand or antisense strand;
(2) target sequence of this sgRNA on GFRA1 gene is positioned at 5 exons coding districts of the N end of GFRA1 gene, or a part for target sequence is positioned at 5 exons of the N end of GFRA1 gene, rest part crosses over the boundary with adjacent intron, is positioned at adjacent intron;
(3) target sequence of this sgRNA on GFRA1 gene is unique.
As preferred version of the present invention, above-mentioned target sequence is the sequence shown in arbitrary sequence in SEQ ID NO:1 ~ 50.
As preferred version of the present invention, above-mentioned target sequence is the sequence shown in SEQ ID NO:1 or 4.
According to a second aspect of the invention, the invention provides the method using CRISPR-Cas9 specific knockdown pig GFRA1 gene, the method comprises the steps:
(1) 5 '-end of the target sequence of the sgRNA described in first aspect adds the sequence for the formation of sticky end, and synthesis obtains forward oligonucleotide sequence; The two ends of the complementary sequence that the target sequence of the sgRNA described in first aspect is corresponding add the suitable sequence for the formation of sticky end, and synthesis obtains reverse oligonucleotide sequence; By the forward oligonucleotide sequence of synthesis and reverse oligonucleotide sequence anneals, renaturation, form the double stranded oligonucleotide with sticky end;
(2) above-mentioned double stranded oligonucleotide is connected into the linearizing expression vector carrying Cas9 gene, obtain carrying the expression vector of sgRNA oligonucleotide containing respective target sequence and Cas9 gene, transform competent bacteria, Screening and Identification goes out correct positive colony, and positive colony is shaken to bacterium, extracts plasmid;
(3) the false type slow virus of sgRNA and Cas9 simultaneously carrying target GFRA1 gene is packed out with the expression vector of the above-mentioned sgRNA of carrying oligonucleotide and Cas9 gene, packaging plasmid and package cell line;
(4) use above-mentioned false type slow virus infection object cell, and cultivate further; Then collect infected object cell, with the gene fragment of its genomic dna above-mentioned target sequence for template amplification comprises, cut through sex change, renaturation and enzyme, that determines GFRA1 gene knocks out situation.
As preferred version of the present invention, above-mentioned expression vector is the carrier of sequence shown in SEQ ID NO:51.
As preferred version of the present invention, aforesaid method comprises the steps:
(1) 5 '-end of the target sequence of the sgRNA described in first aspect adds CACCG sequence, and synthesis obtains forward oligonucleotide sequence; 5 '-end of the complementary sequence that the target sequence of the sgRNA described in first aspect is corresponding adds AAAC sequence, 3 '-end adds C, and synthesis obtains reverse oligonucleotide sequence; By the forward oligonucleotide sequence of synthesis and reverse oligonucleotide sequence anneals, renaturation, form the double stranded oligonucleotide with sticky end;
(2) linearized vector that the expression vector lentiCRISPRv2 above-mentioned double stranded oligonucleotide being connected into sequence as shown in SEQ ID NO:51 obtains through BsmBI digestion with restriction enzyme, obtain the recombinant expression vector lentiCRISPRv2-GFRA1 carrying sgRNA oligonucleotide, transform competent bacteria, Screening and Identification goes out correct positive colony, and positive colony is shaken to bacterium, extracts plasmid;
(3) the false type slow virus of sgRNA and Cas9 simultaneously carrying target GFRA1 gene is packed out with above-mentioned expression vector lentiCRISPRv2-GFRA1, packaging plasmid and package cell line;
(4) use above-mentioned CRISPR false type slow virus infection object cell, and cultivate further; Then collect infected object cell, with the gene fragment of its genomic dna above-mentioned target sequence for template amplification comprises, cut through sex change, renaturation and enzyme, that determines GFRA1 gene knocks out situation.
As preferred version of the present invention, above-mentioned packaging plasmid is plasmid pLP1, plasmid pLP2 and plasmid pLP/VSVG; Above-mentioned packing cell is HEK293T cell.
As preferred version of the present invention, above-mentioned purpose cell is pig PIEC cell.
As preferred version of the present invention, above-mentioned with the gene fragment of its genomic dna above-mentioned target sequence for template amplification comprises, cut through sex change, renaturation and enzyme, that determines GFRA1 gene knocks out situation, is specially:
A () is to infect the genomic dna of the object cell of virus for template, the GFRA1 gene fragment of the target sequence of above-mentioned sgRNA is comprised, simultaneously with the genomic dna of the wild-type cell of same primers amplification uninfecting virus with the upstream and downstream primer amplification of GFRA1 gene;
B GFRA1 gene fragment that the above-mentioned amplification of () purifying is arrived, then in the future the GFRA1 gene fragment of the object cell of self-infection virus and GFRA1 gene fragment heat denatured, the renaturation respectively from wild-type cell, form hybrid DNA molecule;
C () cuts the hybrid DNA molecule after renaturation with Cruiser enzyme;
D () electrophoresis detection digestion products, detects the GFRA1 gene knockout effect of target sequence mediation.
According to a third aspect of the invention we, the invention provides the recombinant expression vector lentiCRISPRv2-GFRA1 used in the method for CRISPR-Cas9 specific knockdown pig GFRA1 gene, the sequence of the skeleton carrier of this recombinant expression vector is as shown in SEQ ID NO:51; Entrained target sequence as the target sequence of the sgRNA of first aspect, the target sequence shown in SEQIDNO:1 or 4 in preferred sequence table.
According to a forth aspect of the invention, the invention provides sgRNA as described in relation to the first aspect or the purposes of recombinant expression vector lentiCRISPRv2-GFRA1 in the method for CRISPR-Cas9 specific knockdown pig GFRA1 gene described in the third aspect.
Of the present invention for CRISPR-Cas9 specific knockdown pig GFRA1 gene, successfully find the sgRNA of selectively targeted GFRA1 gene, sgRNA of the present invention is used in the method for CRISPR-Cas9 specific knockdown pig GFRA1 gene, can fast, accurately, efficiently, knock-out pig GFRA1 gene specifically, effectively solve and build the technical problem that the GFRA1 gene knock-out pig cycle is long and cost is high.
Accompanying drawing explanation
Fig. 1 is the plasmid map of the vector plasmid lentiCRISPRv2 used in the embodiment of the present invention;
Fig. 2 is the plasmid map of the packaging plasmid pLP1 used in the embodiment of the present invention;
Fig. 3 is the plasmid map of the packaging plasmid pLP2 used in the embodiment of the present invention;
Fig. 4 is the plasmid map of the packaging plasmid pLP/VSVG used in the embodiment of the present invention;
Fig. 5 is the electrophoresis detection result figure of the gene knockout effect of digestion verification target sequence in the embodiment of the present invention, wherein M represents DNAMarker, WT represents that the PCR primer Cruiser enzyme of the wild-type cell cut without virus infection and Cas9 cuts detected result, 1 and 4 to represent in table 1 that No. 1 and No. 4 target sequence are to the target cutting effect of GFRA1 gene respectively, and arrow place represents the small segment obtained through the cutting of Cruiser enzyme.
Embodiment
Below in conjunction with the drawings and specific embodiments, technical scheme of the present invention is described further.These the drawings and specific embodiments are not used for limiting the scope of the invention.If do not specialize, the conventional means that technique means used in embodiment is well known to those skilled in the art, is raw materials usedly commercial goods.
The test materials related in following examples and reagent: lentiCRISPRv2 plasmid is purchased from Addgene company, packaging plasmid pLP1, pLP2 and pLP/VSVG are purchased from Invitrogen company, package cell line HEK293T cell purchased from American Type culture collection warehousing (ATCC), PIEC cell is purchased from Chinese Academy of Sciences's cell bank, DMEM substratum, Opti-MEM substratum and foetal calf serum FBS are purchased from Gibco company, and Lipofectamine2000 is purchased from Invitrogen company.
Do not make the experimental methods of molecular biology illustrated in following examples, all carry out with reference to the concrete grammar described in " Molecular Cloning: A Laboratory guide " (third edition) J. Pehanorm Brooker one book, or carry out according to test kit and product description.
Recapitulative technical scheme of the present invention comprises following five parts:
One, the Choice and design of Susscrofa (pig) GFRA1 gene sgRNA target sequence
The sgRNA target sequence of 1.GFRA1 gene is selected:
Suitable 20bp oligonucleotide sequence is found as target sequence in GFRA1 gene extron subarea.
The sgRNA target sequence design of 2.GFRA1 gene:
Above-mentioned target sequence and complementary sequence are added joint respectively, forms forward oligonucleotide sequence and reverse oligonucleotide sequence.
Two, the CRISPR carrier of GFRA1 gene is built
1. synthesize above-mentioned forward oligonucleotide sequence and reverse oligonucleotide sequence, renaturation forms the double chain DNA fragment (i.e. double stranded target sequence oligonucleotide, also can be called double stranded oligonucleotide) with sticky end.
2. build CRISPR-sgRNA expression vector:
Above-mentioned double chain DNA fragment is built up to destination carrier (as lentiCRISPRv2, its plasmid map as shown in Figure 1), form the slow virus CRISPR carrier as lentiCRISPRv2-GFRA1.
Three, the false type slow virus of expressing GFRA1sgRNA is obtained
The false type slow virus of the CRISPR utilizing packaging plasmid, package cell line and slow virus CRISPR carrier to produce to express GFRA1sgRNA.
Four, infect object cell and detect GFRA1 gene knockout effect
1. slow virus infection object cell:
The false type slow virus of such as lentiCRISPRv2-GFRA1 is added object cell culture medium carry out infection and cultivate further.
2. detect GFRA1 gene knockout effect:
Collect object cell, take genomic dna as the gene fragment that template amplification comprises target sequence, cut through sex change, renaturation and enzyme, that determines GFRA1 gene knocks out situation.
Five, GFRA1 gene knockout is monoclonal selects and identifies
1., for there being the object cell mass determining to knock out effect, by dilution and Colony Culture, isolate the cell strain of some single cell source.
2. identify that monoclonal GFRA1 knocks out situation.
Describe technical scheme of the present invention and beneficial effect thereof by the following examples in detail.
The Choice and design of embodiment one, Susscrofa (pig) GFRA1 gene sgRNA target sequence
Target sequence determines the targeting specific of sgRNA and the efficiency of induction Cas9 cutting goal gene.Therefore, efficiently special target sequence Choice and design is the prerequisite building sgRNA expression vector.
1.GFRA1 the sgRNA target sequence of gene is selected
For GFRA1 gene, following principle should be followed on target sequence is selected:
(1) target sequence meeting 5 '-N (20) NGG-3 ' rule is found in GFRA1 gene extron coding region, wherein N (20) represents 20 continuous print bases, wherein each N represents A or T or C or G, and the target sequence meeting above-mentioned rule is positioned at positive-sense strand or antisense strand;
(2) coding region sequence of 5 exons near N end is selected, target sequence can be positioned at the coding region of 5 exons of the N end of GFRA1 gene, or a part for target sequence is positioned at 5 exons of the N end of GFRA1 gene, rest part crosses over the boundary with adjacent intron, is positioned at adjacent intron; The cutting of such coding region sequence can cause the function of GFRA1 gene to knock out, and the sequence of residual brachymemma can not be formed with the albumen of function;
(3) if there is multiple spliced body, then select in common exon coding region, 5 the exons coding region sequences held near N for GFRA1 gene Selection can meet this condition;
(4) online sequence analysis tools (http://crispr.mit.edu/) is utilized to analyze the homology situation of above target sequence in pig genome, give up the target sequence that there is remarkable homologous sequence, select further according to scoring, the target sequence selected is unique on GFRA1 gene.
Based on above principle, select the target sequence set shown in table 1.
The set of table 1 target sequence
Numbering Sequence
1 GTACTTCGCACTGCCGCTTC
2 GAAGCGGCAGTGCGAAGTAC
3 TACTTCGCACTGCCGCTTCT
4 GTGCGAAGTACAGGGTCGCC
5 AAGCGGCAGTGCGAAGTACA
6 GTACAGGGTCGCCAGGAACA
7 GCACCAAGTACCGCACGCTG
8 CTCCTTTAGGCACTGATCGC
9 CTGCCTCAGCGTGCGGTACT
10 CGAGTGCCGCAGCGCCATGG
11 GGCGCTGCGGCACTCGTCCT
12 GGCCAGCGATCAGTGCCTAA
13 GGACGAGTGCCGCAGCGCCA
14 CCGCACGCTGAGGCAGTGCG
15 CTGTCGGCCGAGGTGAGCGG
16 CCACGCACTGCCTCAGCGTG
17 CGCTGGCCTTCACACAGTCC
18 CACGCTGAGGCAGTGCGTGG
19 CTTCAGCTTGACCTCGGGCC
20 GCCCGAGGTCAAGCTGAAGT
21 ACGCTGAGGCAGTGCGTGGC
22 GACCAACTTCAGCTTGACCT
23 GGACCGCCTGGACTGTGTGA
24 CGCCGCTCACCTCGGCCGAC
25 TGTCGGCCGAGGTGAGCGGC
26 GCGGTCCCCGCCGCTCACCT
27 ACCAACTTCAGCTTGACCTC
28 CTCCTGTCGGCCGAGGTGAG
29 GGTGAGCGGCGGGGACCGCC
30 CAGCTTGACCTCGGGCCTGG
31 GAGGCAGTGCGTGGCGGGCA
32 ACATGCTCCAGTAGATTCGC
33 AGAACTGCCTGCGAATCTAC
34 TTACAACTGCCGCTGCAAGC
35 TTTACAACTGCCGCTGCAAG
36 TGAGGGCCTCCATGGCGCTG
37 GTAAAGCGACTTCTGTTTGA
38 GAGCATGTACCAGAGCCTGC
39 CTGCAAGCGGGGTATGAAGA
40 TGTAAAGCGACTTCTGTTTG
41 AGCATGTACCAGAGCCTGCA
42 CGGGTGGTCCCATTCATACC
43 ATTGTCTGATATTTTCCGGG
44 GCTGTTAACTGGCTCATATG
45 CTGCTGTTAACTGGCTCATA
46 TGCTGTTAACTGGCTCATAT
47 TCAGACAATCTGCTGTTAAC
48 CAGATTGTCTGATATTTTCC
49 GCAGATTGTCTGATATTTTC
50 CTGGCAGACGTTTTCCAGCA
The sgRNA target sequence design of 2.GFRA1 gene:
(1) using lentiCRISPRv2 plasmid as expression vector, according to the feature of lentiCRISPRv2 plasmid, add CACCG sequence at 5 '-end of above-mentioned N (20) target sequence, form forward oligonucleotide sequence:
5’-CACCGNNNNNNNNNNNNNNNNNNNN-3’；
(2) add sequence at the two ends of the reverse complementary sequence of above-mentioned N (20) target sequence, form reverse oligonucleotide sequence:
5’-AAACNNNNNNNNNNNNNNNNNNNNC-3’；
Forward oligonucleotide sequence and reverse oligonucleotide sequence complementaryly can form the double chain DNA fragment with sticky end:
5’-CACCGNNNNNNNNNNNNNNNNNNNN-3’
3’-CNNNNNNNNNNNNNNNNNNNNCAAA-5’。
The sgRNA expression vector of embodiment two, structure GFRA1 gene
1. synthetic DNA Insert Fragment
(1) forward and the reverse oligonucleotide sequence of above-mentioned design is synthesized
Oligonucleotide sequence specifically can be synthesized according to the sequence provided by business-like company (as Invitrogen company).The present embodiment and following examples to have studied in table 1 listed No. 1 and No. 4 target sequence shown in sequence and knock out effect to GFRA1 gene.
The forward oligonucleotide sequence that No. 1 target sequence is corresponding and reverse oligonucleotide sequence as follows:
CACCGGTACTTCGCACTGCCGCTTC(SEQIDNO：52)；
AAACGAAGCGGCAGTGCGAAGTACC(SEQIDNO：53)。
The forward oligonucleotide sequence that No. 4 target sequence is corresponding and reverse oligonucleotide sequence as follows:
CACCGGTGCGAAGTACAGGGTCGCC(SEQIDNO：54)；
AAACGGCGACCCTGTACTTCGCACC(SEQIDNO：55)。
By the forward of correspondence and reverse oligonucleotide sequence anneals, renaturation, form the double chain DNA fragment with sticky end.
Reaction system (20 μ L) is as follows:
Forward oligonucleotide (10 μMs): 1 μ L
Reverse oligonucleotide (10 μMs): 1 μ L
10×PCRbuffer：2μL
ddH 2O：16μL
Above-mentioned reaction system is put into PCR instrument, and reacts by following program.
Response procedures:
95℃,5min；
80℃,5min；
70℃,5min；
60℃,5min；
50℃,5min；
Naturally room temperature is down to.
2. build sgRNA expression vector
(1) BsmBI digestion with restriction enzyme destination carrier lentiCRISPRv2 plasmid (its sequence is as shown in SEQ ID NO:51) is utilized.
Prepare according to following reaction system:
LentiCRISPRv2 plasmid: 1 μ g
10 × enzyme cuts buffer:2 μ L
BsmBI restriction enzyme: 2 μ L
Supplement ddH 2o to cumulative volume 20 μ L
Endonuclease reaction system is placed in 37 DEG C of reaction 4h.
(2) electrophoretic separation cmy vector fragment
After enzyme cuts end, enzyme is cut mixture and is separated by agarose gel electrophoresis, select carrier segments (about 12kb) to cut, and reclaimed by DNA gel recovery post.
(3) double chain DNA fragment of synthesis and carrier main leaf section are carried out being connected also transformation of E. coli
The carrier segments that double chain DNA fragment renaturation obtained obtains with recovery carries out ligation, prepares according to following reaction system:
LentiCRISPRv2 carrier segments: 100ng
Double chain DNA fragment: 200ng
T4 ligase enzyme: 1 μ L
T4 ligation buffer:1 μ L
Supplement ddH 2o to cumulative volume 10 μ L
Connection mixture is placed in 25 DEG C of reaction 2h.
Mixture transformation of E. coli DH5 α bacterial strain will be connected: in connection mixture, add 100 μ L bacillus coli DH 5 alpha competent cells, hatch 30min on ice after reaction terminates; Mixture is put into 42 DEG C of water-baths, after heat shock 90s, put into cooled on ice; Add 100 μ LLB substratum to mixture, 20min cultivated by 37 DEG C of shaking tables; Mixture is coated with AmpLB flat board, cultivates 14h for 37 DEG C.
(4) correct transformed clone is identified
Select some bacterium colonies from AmpLB flat board and carry out enlarged culturing, extraction plasmid carries out enzyme and cuts qualification.Select and may check order by correct clone, whether checking insertion sequence is correct.Conservation is carried out for correct lentiCRISPRv2-GFRA1 carrier cloning.
Embodiment three, acquisition express the false type slow virus of GFRA1sgRNA
1. material prepares
Amplification is extracting packaging plasmid pLP1, pLP2 and pLP/VSVG (purchased from Invitrogen, its collection of illustrative plates respectively as shown in Figure 2, Figure 3 and Figure 4) also; Amplification is extracting vector plasmid lentiCRISPRv2-GFRA1 also; Cultivate package cell line HEK293T cell (purchased from ATCC); DMEM substratum, Opti-MEM substratum and foetal calf serum FBS (purchased from Gibco); Lipofectamine2000 (purchased from Invitrogen); HEK293T cell cultures is in containing 5%CO 237 DEG C of culture environment in, substratum is the DMEM substratum containing 10%FBS.
2. transfection and virus packaging
First day: package cell line HEK293T is passaged to 10cmdish, about 30% degrees of fusion;
Second day: carry out transfection when HEK293T reaches 80% degrees of fusion according to following formula:
Preparating mixture 1, comprises:
lentiCRISPRv2-GFRA1：6μg
pLP1：6μg
pLP2：6μg
pLP/VSVG：3μg
Opti-MEM：500μL。
Preparating mixture 2, comprises:
Lipofectamine2000：30μL
Opti-MEM：500μL。
After leaving standstill 5min, mixture 1 and mixture 2 are mixed into transfection mixture, leave standstill 20min.
HEK293T substratum is changed to plasma-free DMEM medium, adds transfection mixture, be changed to the DMEM substratum of 20%FBS after 37 DEG C of cultivation 8h, continue to cultivate.
3. collection virus and preservation
3rd day: collect the HEK293T substratum supernatant containing virus after transfection 48h, after filtering with 0.45 μm of filter, packing, placed-80 DEG C of preservations.
Embodiment four, infect object cell and detect target sequence knock out effect
1. material prepares
Cultivate object clone pig hip arterial endothelium cells PIEC (purchased from Chinese Academy of Sciences's cell bank); DMEM substratum and foetal calf serum FBS (purchased from Gibco); The false type slow virus of lentiCRISPRv2-GFRA1 of different target sequence (sequence 1 and sequence 4); PIEC cell cultures is in containing 5%CO 237 DEG C of culture environment in, substratum is the DMEM substratum containing 10%FBS.
2. slow virus infection object cell
First day: by object passage to 6 orifice plate, about 20% merges density.Each virus needs 6 holes, needs efficiency to contrast 6 holes simultaneously.
Second day: when object cell about 40% fusion density, add the false type slow virus supernatant of 1mLlentiCRISPRv2-GFRA1 and 1mLDMEM substratum.Efficiency contrast does not need to add slow virus.
3rd day: remove containing virus culture base after infecting 24h, change normal incubation medium into, add tetracycline to final concentration 2 μ g/mL, the efficiency control sample not infecting virus also adds tetracycline in contrast simultaneously, cultivates 48h.
3. cell infection Efficiency testing and cultivation
5th day: the efficiency compared with control cells do not infected should whole apoptosis (>95%) under the effect of tetracycline.Judge the efficiency of infection of cell according to the apoptosis situation infecting slow virus cell, usually can reach the efficiency of infection (apoptosis rate <10%) of more than 90%.Carry out infecting to reach suitable efficiency of infection after viral supernatants can being carried out concentrated or gradient dilution if desired.
After tetracycline screening, the apoptosis do not infected.Object cell is gone down to posterity again and is changed to ordinary culture medium and cultivate 48h.
4. detect GFRA1 gene knockout effect
(1) design upstream and downstream primer with the GFRA1 gene fragment that increases, wherein upstream and downstream primer sequence is as follows:
CTCTCACTGGATGGAGCTGAACTTTG(SEQIDNO：56)
GCTCAGACCCTATAATTTCCTGCCAG(SEQIDNO：57)。
Object amplified fragments comprises sgRNA target sequence, and size is 465bp.Target sequence is no less than 100bp to the position at fragment two ends.
(2) collection unit divides object cell, uses promega genomic DNA kit extracting genomic dna.The genomic dna of the wild-type of extracting simultaneously object cell.
(3) take genomic dna as the GFRA1 gene fragment (comprising mutagenic samples and the wild-type samples of infection) that template amplification comprises target sequence.
Amplification reaction system (20 μ L) is as follows:
Upstream primer (10 μMs): 1 μ L
Downstream primer (10 μMs): 1 μ L
2×PCRMix：10μL
Genomic dna: 100ng
Prepare with above-mentioned reaction system, put into PCR instrument, and react by follow procedure.
Response procedures:
95℃,3min
95℃,30s
58℃,20s
72℃,20s
72℃,3min；
Wherein second step to the 4th step repeats 35 circulations.
(4) electrophoresis detection PCR primer reclaim purifying
(5) by heat denatured, the renaturation respectively of the DNA fragmentation after purifying, hybrid DNA molecule (comprising mutagenic samples and wild-type samples) is formed.
Reaction system is as follows:
Genomic PCR fragment: 200ng
5 × reaction buffer:2 μ L
Reaction system is totally 9 μ L
Prepare with above-mentioned reaction system, put into PCR instrument, and react by follow procedure.
Response procedures:
95℃,5min；
80℃,5min；
70℃,5min；
60℃,5min；
50℃,5min；
Naturally room temperature is down to.
(6) with the hybrid dna (comprising mutagenic samples and wild-type samples) after Cruiser enzyme cutting renaturation
Add 1 μ LCruiser enzyme to the reaction mixture through sex change, renaturation, hatch 20min for 45 DEG C.
(7) electrophoresis detection digestion products, detects the GFRA1 gene knockout effect of target sequence mediation.
By the DNA fragmentation cut through enzyme with 2% sepharose carry out electrophoretic analysis, 100V, 25min.Determine the cutting situation of object fragment, judge the gene knockout effect of target sequence.
To the cutting identification of mutant DNA based on following principle: the cell through infecting can express sgRNA and Cas9.If genomic dna is cut by the Cas9 targeting proteins that sgRNA mediates, sudden change (wild-type becomes saltant type) can be introduced near cleavage site after repairing.Because wild-type and mutant sequences do not mate in this position, the wild-type DNA gone out as template amplification and mutant DNA just can produce annular (loop) structure of local through the hybrid molecule that refolding strategy is formed.And the latter can be cut off by the identification of Cruiser enzyme, causes hybrid DNA molecule to be cut into small segment.Due to containing Part Wild type DNA composition in mutagenic samples, the hybrid molecule containing part annular structure thus after refolding strategy, can be formed.
As shown in Figure 5, the wild-type cell without virus infection does not produce cutting to result, therefore small segment do not detected; And sequence 1 and sequence 4 can produce cutting by efficient targeting GFRA1 gene, the existence of small segment therefore detected, show that sequence 1 and sequence 4 can as the target sequences of CRISPR-Cas9 specific knockdown pig GFRA1 gene.
Embodiment five, GFRA1 gene knockout are monoclonal to be selected and identifies
1. monoclonally to select (target sequence based on sequence 1 and sequence 4)
(1) the object cell mass that part infects is gone down to posterity, get 100 unicellular 10cmdish that are transferred to and cultivate.
(2) cultivate after about 10 days, have a considerable amount of mono-clonal to grow into macroscopic level.
(3) independently clone by pipettor head scraping, cell is transferred in 24 orifice plates and cultivates, the corresponding clone in each hole.
(4) again after the cultivation of about a week, there is part to clone and grow to enough quantity, go to further qualification.
2. identify that monoclonal GFRA1 knocks out situation
(1) mono-clonal to be checked and wild-type cell is collected, respectively extracting genomic dna.
(2) according to preceding method, the GFRA1 gene fragment of increase respectively mono-clonal and wild-type cell, the gene fragment increased comprises sgRNA target sequence.
(3) the mono-clonal PCR fragment of equivalent is mixed with wild-type PCR fragment, heat denatured, renaturation, form hybrid DNA molecule.
(4) with the hybrid dna after Cruiser enzyme cutting annealing, 20min is hatched for 45 DEG C.
(5) whether electrophoresis detection digestion products, according to having cutting fragment determination mono-clonal whether effective sudden change occurs.
Result shows, based on the lentiCRISPRv2-GFRA1 false type slow virus infection object cell of the target sequence shown in sequence 1, detect from 6 mono-clonals of 100 unicellular middle random chooses through Cruiser enzyme restriction enzyme digestion and electrophoresis, wherein there are 5 mono-clonals cutting small segment can be detected, show that gene knockout occurs, gene knockout efficiency can reach more than 83%, illustrates that the target sequence shown in sequence 1 has the effect that very high target knocks out GFRA1 gene.Based on the lentiCRISPRv2-GFRA1 false type slow virus infection object cell of the target sequence shown in sequence 4, detect from 4 mono-clonals of 100 unicellular middle random chooses through Cruiser enzyme restriction enzyme digestion and electrophoresis, wherein there are 4 mono-clonals cutting small segment can be detected, show that gene knockout occurs, gene knockout efficiency can reach 100%, illustrates that the target sequence shown in sequence 4 has the effect that very high target knocks out GFRA1 gene.
Above content is in conjunction with concrete embodiment further description made for the present invention, can not assert that specific embodiment of the invention is confined to these explanations.For general technical staff of the technical field of the invention, without departing from the inventive concept of the premise, some simple deduction or replace can also be made.

Claims (10)

1. using the sgRNA for selectively targeted GFRA1 gene in CRISPR-Cas9 specific knockdown pig GFRA1 gene, it is characterized in that:
(1) target sequence of described sgRNA on GFRA1 gene meets the series arrangement rule of 5 '-N (20) NGG-3 ', wherein N (20) represents 20 continuous print bases, wherein each N represents A or T or C or G, and the target sequence meeting described rule is positioned at positive-sense strand or antisense strand;
(2) target sequence of described sgRNA on GFRA1 gene is positioned at 5 exons coding districts of the N end of GFRA1 gene, or a part for target sequence is positioned at 5 exons of the N end of GFRA1 gene, rest part crosses over the boundary with adjacent intron, is positioned at adjacent intron;
(3) target sequence of described sgRNA on GFRA1 gene is unique.
2. the sgRNA for selectively targeted GFRA1 gene according to claim 1, is characterized in that, described target sequence is the sequence shown in arbitrary sequence in SEQ ID NO:1 ~ 50.
3. the sgRNA for selectively targeted GFRA1 gene according to claim 1, is characterized in that, described target sequence is the sequence shown in SEQ ID NO:1 or 4.
4. use the method for CRISPR-Cas9 specific knockdown pig GFRA1 gene, it is characterized in that, described method comprises the steps:
(1) 5 '-end of the target sequence of the sgRNA described in any one of claim 1-3 adds the sequence for the formation of sticky end, and synthesis obtains forward oligonucleotide sequence; The two ends of the complementary sequence that the target sequence of the sgRNA described in any one of claim 1-3 is corresponding add the suitable sequence for the formation of sticky end, and synthesis obtains reverse oligonucleotide sequence; By the described forward oligonucleotide sequence of synthesis and reverse oligonucleotide sequence anneals, renaturation, form the double stranded oligonucleotide with sticky end;
(2) described double stranded oligonucleotide is connected into the linearizing expression vector carrying Cas9 gene, obtain carrying the expression vector of sgRNA oligonucleotide containing respective target sequence and Cas9 gene, transform competent bacteria, Screening and Identification goes out correct positive colony, and described positive colony is shaken to bacterium, extracts plasmid;
(3) the false type slow virus that the expression vector of sgRNA oligonucleotide and Cas9 gene, packaging plasmid and package cell line pack out sgRNA and Cas9 simultaneously carrying target GFRA1 gene is carried described in use;
(4) use described false type slow virus infection object cell, and cultivate further; Then collect infected object cell, with the gene fragment of its genomic dna described target sequence for template amplification comprises, cut through sex change, renaturation and enzyme, that determines GFRA1 gene knocks out situation.
5. the method for CRISPR-Cas9 specific knockdown pig GFRA1 gene according to claim 4, it is characterized in that, described expression vector is the carrier of sequence shown in SEQ ID NO:51.
6. the method for the CRISPR-Cas9 specific knockdown pig GFRA1 gene according to claim 4 or 5, it is characterized in that, described method comprises the steps:
(1) 5 '-end of the target sequence of the sgRNA described in any one of claim 1-3 adds CACCG sequence, and synthesis obtains forward oligonucleotide sequence; 5 '-end of the complementary sequence that the target sequence of the sgRNA described in any one of claim 1-3 is corresponding adds AAAC sequence, 3 '-end adds C, and synthesis obtains reverse oligonucleotide sequence; By the described forward oligonucleotide sequence of synthesis and reverse oligonucleotide sequence anneals, renaturation, form the double stranded oligonucleotide with sticky end;
(2) linearized vector that the expression vector lentiCRISPRv2 described double stranded oligonucleotide being connected into sequence as shown in SEQ ID NO:51 obtains through BsmBI digestion with restriction enzyme, obtain the recombinant expression vector lentiCRISPRv2-GFRA1 carrying sgRNA oligonucleotide, transform competent bacteria, Screening and Identification goes out correct positive colony, and described positive colony is shaken to bacterium, extracts plasmid;
(3) the false type slow virus of sgRNA and Cas9 simultaneously carrying target GFRA1 gene is packed out with described expression vector lentiCRISPRv2-GFRA1, packaging plasmid and package cell line;
(4) use described false type slow virus infection object cell, and cultivate further; Then collect infected object cell, with the gene fragment of its genomic dna described target sequence for template amplification comprises, cut through sex change, renaturation and enzyme, that determines GFRA1 gene knocks out situation.
7. the method for CRISPR-Cas9 specific knockdown pig GFRA1 gene according to claim 6, it is characterized in that, described packaging plasmid is plasmid pLP1, plasmid pLP2 and plasmid pLP/VSVG; Described packing cell is HEK293T cell.
8. the method for CRISPR-Cas9 specific knockdown pig GFRA1 gene according to claim 6, it is characterized in that, described object cell is pig PIEC cell;
Described with the gene fragment of its genomic dna described target sequence for template amplification comprises, cut through sex change, renaturation and enzyme, that determines GFRA1 gene knocks out situation, is specially:
A () is to infect the genomic dna of the object cell of virus for template, the GFRA1 gene fragment of the target sequence of described sgRNA is comprised, simultaneously with the genomic dna of the wild-type cell of same primers amplification uninfecting virus with the upstream and downstream primer amplification of GFRA1 gene;
B GFRA1 gene fragment that the above-mentioned amplification of () purifying is arrived, then in the future the GFRA1 gene fragment of the object cell of self-infection virus and GFRA1 gene fragment heat denatured, the renaturation respectively from wild-type cell, form hybrid DNA molecule;
C () cuts the hybrid DNA molecule after renaturation with Cruiser enzyme;
D () electrophoresis detection digestion products, detects the GFRA1 gene knockout effect of target sequence mediation.
9. the recombinant expression vector lentiCRISPRv2-GFRA1 used in the method for CRISPR-Cas9 specific knockdown pig GFRA1 gene, it is characterized in that, the sequence of the skeleton carrier of described recombinant expression vector is as shown in SEQ ID NO:51; The target sequence of the entrained sgRNA of target sequence as described in any one of claim 1-3, the target sequence shown in SEQIDNO:1 or 4 in preferred sequence table.
10. the purposes of the sgRNA as described in any one of claim 1-3 or recombinant expression vector lentiCRISPRv2-GFRA1 according to claim 9 in the method for CRISPR-Cas9 specific knockdown pig GFRA1 gene.
CN201580000470.0A 2015-06-11 2015-06-11 Method for specifically knocking out pig GFRA1 gene by CRISPR-Cas9 and sgRNA for specifically targeting GFRA1 gene Expired - Fee Related CN105518138B (en)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/CN2015/081232 WO2016197360A1 (en) 2015-06-11 2015-06-11 Method for specific knockout of swine gfra1 gene using crispr-cas9 specificity, and sgrna used for specifically targeting gfra1 gene

Publications (2)

Publication Number Publication Date
CN105518138A true CN105518138A (en) 2016-04-20
CN105518138B CN105518138B (en) 2021-07-27

Family

ID=55724975

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201580000470.0A Expired - Fee Related CN105518138B (en) 2015-06-11 2015-06-11 Method for specifically knocking out pig GFRA1 gene by CRISPR-Cas9 and sgRNA for specifically targeting GFRA1 gene

Country Status (2)

Country Link
CN (1) CN105518138B (en)
WO (1) WO2016197360A1 (en)

Cited By (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9526784B2 (en) 2013-09-06 2016-12-27 President And Fellows Of Harvard College Delivery system for functional nucleases
US9840699B2 (en) 2013-12-12 2017-12-12 President And Fellows Of Harvard College Methods for nucleic acid editing
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US10227581B2 (en) 2013-08-22 2019-03-12 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104498493A (en) * 2014-12-30 2015-04-08 武汉大学 Method for specifically knocking out hepatitis B virus by CRISPR/Cas9 and gRNA applied to specific targeting HBV DNA

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150315576A1 (en) * 2012-11-01 2015-11-05 Massachusetts Institute Of Technology Genetic device for the controlled destruction of dna
DK2925866T3 (en) * 2012-11-30 2018-10-29 Univ Aarhus CIRCULAR RNA FOR INHIBITING MICRO-RNA
CN104480144B (en) * 2014-12-12 2017-04-12 武汉大学 CRISPR/Cas9 recombinant lentiviral vector for human immunodeficiency virus gene therapy and lentivirus of CRISPR/Cas9 recombinant lentiviral vector

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104498493A (en) * 2014-12-30 2015-04-08 武汉大学 Method for specifically knocking out hepatitis B virus by CRISPR/Cas9 and gRNA applied to specific targeting HBV DNA

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
LEE，KH等: "Characterization of GFRα-1-positive and GFRα-1-negative spermatogonia in neonatal pig testis", 《REPROD DOMEST ANIM》 *
LINDFORS,PH等: "Deficient nonpeptidergic epidermis innervation and reduced inflammatory pain in glial cell line-derived neurotrophic factor family receptor alpha 2 knock-out mice", 《JOURNAL OF NEUROSCIENCE》 *
REYES LM等: "Creating Class I MHC Null Pigs Using gRNA and the Cas9 Endonuclease", 《J IMMUNOL》 *
ZUPING HE等: "Gfra1 Silencing in Mouse Spermatogonial Stem Cells Results in Their Differentiation Via the Inactivation of RET Tyrosine Kinase", 《BIOL REPROD》 *
ZUPING HE等: "Gfra1 Silencing in Mouse Spermatogonial Stem Cells Results in Their Differentiation Via the Inactivation of RET Tyrosine Kinase", 《BIOLOGY OF REPRODUCTION》 *
无: "PREDICTED: Sus scrofa GDNF family receptor alpha 1 (GFRA1), transcript variant 2, mRNA", 《NCBI GENBANK》 *

Cited By (48)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12006520B2 (en) 2011-07-22 2024-06-11 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US11920181B2 (en) 2013-08-09 2024-03-05 President And Fellows Of Harvard College Nuclease profiling system
US10954548B2 (en) 2013-08-09 2021-03-23 President And Fellows Of Harvard College Nuclease profiling system
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10227581B2 (en) 2013-08-22 2019-03-12 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US11299755B2 (en) 2013-09-06 2022-04-12 President And Fellows Of Harvard College Switchable CAS9 nucleases and uses thereof
US9999671B2 (en) 2013-09-06 2018-06-19 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US9526784B2 (en) 2013-09-06 2016-12-27 President And Fellows Of Harvard College Delivery system for functional nucleases
US9737604B2 (en) 2013-09-06 2017-08-22 President And Fellows Of Harvard College Use of cationic lipids to deliver CAS9
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US10912833B2 (en) 2013-09-06 2021-02-09 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US9840699B2 (en) 2013-12-12 2017-12-12 President And Fellows Of Harvard College Methods for nucleic acid editing
US11124782B2 (en) 2013-12-12 2021-09-21 President And Fellows Of Harvard College Cas variants for gene editing
US11053481B2 (en) 2013-12-12 2021-07-06 President And Fellows Of Harvard College Fusions of Cas9 domains and nucleic acid-editing domains
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11578343B2 (en) 2014-07-30 2023-02-14 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US12043852B2 (en) 2015-10-23 2024-07-23 President And Fellows Of Harvard College Evolved Cas9 proteins for gene editing
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11999947B2 (en) 2016-08-03 2024-06-04 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US12084663B2 (en) 2016-08-24 2024-09-10 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11932884B2 (en) 2017-08-30 2024-03-19 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11795452B2 (en) 2019-03-19 2023-10-24 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11643652B2 (en) 2019-03-19 2023-05-09 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US12031126B2 (en) 2020-05-08 2024-07-09 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence

Also Published As

Publication number Publication date
WO2016197360A1 (en) 2016-12-15
CN105518138B (en) 2021-07-27

Similar Documents

Publication Publication Date Title
CN105518138A (en) Method knocking out pig GFRA1 genes with CRISPR-Cas9 specificity and sgRNA for specificity targeting GFRA1 genes
CN105518137A (en) Method for specifically removing pig SALL1 gene by CRISPR-Cas9 and sgRNA used for specific targeting SALL1 gene
CN105492608A (en) Method using CRISPR-Cas9 to specifically knock off pig PDX1 gene and sgRNA of PDX1 gene for specific targeting
CN105518139A (en) Method for knocking out pig FGL2 genes with CRISPR-Cas9 specificity and sgRNA for specificity targeting FGL2 genes
CN105518135A (en) Method for pig CMAH gene specific knockout through CRISPR-Cas9 and sgRNA for specially targeting CMAH gene
CN105518134A (en) Method for pig SLA-2 gene specific knockout through CRISPR-Cas9 and sgRNA for specially targeting SLA-2 gene
CN105492609A (en) Method for CRISPR-Cas9 specific knockout of pig GGTA1 gene and sgRNA for specific targeted GGTA1 gene
CN105518140A (en) Method for pig vWF gene specific knockout through CRISPR-Cas9 and sgRNA for specially targeting vWF gene
CN105593367A (en) CRISPR-Cas9 specificity pig SLA-1 gene knockout method and sgRNA used for specific targeting SLA-1 gene
CN106414740A (en) Method for specific knockout of swine SLA-3 gene using CRISPR-Cas9 specificity, and sgRNA used for specifically targeting sla-3 gene
CN105907758B (en) CRISPR-Cas9 guide sequence and primer thereof, transgenic expression vector and construction method thereof
CN106755091A (en) Gene knockout carrier, MH7A cell NLRP1 gene knockout methods
CN107630018A (en) A kind of kit for being used to editing or repairing HBB gene
CN106987560B (en) Construction method of RK-13 cell HBB gene knockout stable strain
CN111849979B (en) sgRNA for targeted knockout of RPSA gene and construction method of RPSA gene knockout cell line
CN107034238A (en) One kind immortalizes special network cell line and its construction method
CN108611351B (en) sgRNA of ID1 gene, method for knocking out ID1 gene, BHK-21 cell line, and use thereof
CN107267532A (en) The construction method of JS2008 plants of full-length infectious CDNAs of PEDV and application
CN107365803A (en) Exempt from the method that drug screening quickly obtains mouse Rosa26 Gene targeting foreign genes
CN114058619B (en) Construction of RIPLET knockout cell line and application of RIPLET knockout cell line as picornaviridae virus vaccine production cell line
CN116463297A (en) Recombinant serum type 4 avian adenovirus expressing chicken infectious anemia virus VP1 protein and preparation method thereof
WO2024183423A1 (en) Crispr/cas9-grna targeting plasmid, donor plasmid, and method for preparing immortalized mouse cell line
CN104593381A (en) Corn salt-tolerant gene and applications thereof
CN106244556A (en) The method of rite-directed mutagenesis ApoE gene
CN104975043A (en) Shuttle vector for constructing recombinant MVA virus and having marker gene self-deleting system

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20210727

CF01 Termination of patent right due to non-payment of annual fee