CN107034238A - One kind immortalizes special network cell line and its construction method - Google Patents
One kind immortalizes special network cell line and its construction method Download PDFInfo
- Publication number
- CN107034238A CN107034238A CN201710272011.9A CN201710272011A CN107034238A CN 107034238 A CN107034238 A CN 107034238A CN 201710272011 A CN201710272011 A CN 201710272011A CN 107034238 A CN107034238 A CN 107034238A
- Authority
- CN
- China
- Prior art keywords
- special network
- cell
- network cell
- cell line
- culture
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0688—Cells from the lungs or the respiratory tract
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
- C12N2510/04—Immortalised cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/22011—Polyomaviridae, e.g. polyoma, SV40, JC
- C12N2710/22022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
- C12N2740/15041—Use of virus, viral particle or viral elements as a vector
- C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Abstract
The present invention relates to a kind of construction method for immortalizing special network cell line, comprise the following steps：(1) the mouse lung tissue block shredded is digested in Type Ⅱ collagen enzyme, filtered, centrifugation, cell precipitation is collected, is cultivated in the medium, after fibroblast is adherent, supernatant is transferred to another culture dish, liquid is changed in culture after 12 hours, continues to cultivate 35 days；(2) scraped with micro pipette tips as cell, strike off fibroblast, it is repeated multiple times strike off after, carry out the specificity structure telopode special network cell of observation and immune labeled identification；(3) using special network cell as host cell, with the retroviral vector host cells infected containing the large T antigens of SV 40, by passage, screening, identification.The special network cell line culture of immortalization of the present invention remains in that relatively stable state to 50 generations, solves prior art separating for several times and extracts the problem of can not ensureing special network cell purity and stability.
Description
Technical field
It is a kind of construction method for immortalizing special network cell line specifically the present invention relates to cell engineering field.
Background technology
The function of the special network cell of research at present is the Different Organs using different genera animal (such as mouse, rat, pig)
The special network cell of (lungs, kidney, heart etc.) primary extraction, extraction process is time-consuming and each extract is required for being isolated and purified
With identification, it is necessary to put into substantial amounts of manpower and materials.Because separating for several times and extraction primary cell are due to that different personnel are carried out,
Therefore, it is difficult to ensure the purity and stability of extraction cell.Under normal circumstances, the primary special network cell low-density of 100% purifying
It is all dead in one week during culture.
China《China's transplanting impurity》The paper of in May, 2016 publication《New interstitial is isolated in rat kidney cortex thin
Born of the same parents-spy's network cell》, isolate and purify and original cuiture TC：Rat kidney cortex is aseptically obtained, will using sterile scissors
Tissue is cut into about 1mm × 1mm bulk, PBS 3 times, and digestive juice is the PBS configurations using not calcium ions and magnesium ion
10mg/mL Type Ⅱ collagens enzyme and 2000U/mL DNA enzymatics, tissue is placed in 37 DEG C of oscillators and digests 4h, and the cell of collection is profound firelight or sunlight
1500 leave heart 5min, move in 40 μm of cell filters and filter, and cell is inoculated in the DMEM/F12 cultures of 10% hyclone
Base, is placed in 37 DEG C, 5%CO2 cell culture incubator cultures, removes heteroproteose cell using the method for micro-dissections, specific method is as follows：TC
After cluster growth, in striking off heteroproteose cell using cell scraper under phase contrast microscope, upper strata heteroproteose cell suspension PBS flushings are discarded,
Good results are repeated up to, then row passage.Chinese patent 2016101653339 discloses a kind of dog fat of immortalization
Mescenchymal stem cell system and its construction method, using dog fat mesenchymal stem cell as host cell, transfection carries the big T of SV40 and resisted
Former slow virus carrier, Tag gene integrations are entered in dog fat mesenchymal stem cell genome, are obtained by continuous passage screening
Express SV40 large T antigens gene and the cell line with multi-lineage potential.But in the prior art, on present invention immortalization
The construction method of special network cell line, yet there are no report.
The content of the invention
First purpose of the present invention is that there is provided a kind of structure for immortalizing special network cell line for deficiency of the prior art
Construction method.
There is provided built to obtain by method as described above for deficiency of the prior art for second object of the present invention
Immortalize special network cell line.
To realize above-mentioned first purpose, the present invention is adopted the technical scheme that：
A kind of construction method for immortalizing special network cell line, comprises the following steps：
(1) the mouse lung tissue block shredded is digested in Type Ⅱ collagen enzyme, filtered, cell precipitation is collected in centrifugation,
Cultivated in DMEM/F12 culture mediums containing 10%FBS, after fibroblast is adherent, supernatant be transferred to another culture dish,
Liquid is changed in culture after 12 hours, continue to cultivate 3-5 days；
(2) scraped with micro pipette tips as cell, strike off fibroblast, it is repeated multiple times strike off after, carry out specificity structure
Telopode observation and the special network cell of immune labeled identification；
(3) using special network cell as host cell, with the retroviral vector infection host containing SV-40- large T antigens
Cell, by passage, screening, identification.
Further, the retroviral vector containing SV-40- large T antigens reverses for EF1A-SV40-IRES-puro
Record viral vector.
Further, the step 3 includes：
(1) synthetic primer is designed, performing PCR amplification is entered by template of the plasmid containing SV40 large T antigen genes, passes through two ends
Contained restriction enzyme site is connected on the overexpression slow virus carrier after digestion；Connection product is transferred to the bacterium impression prepared
State cell, identifies the advanced performing PCR of monoclonal bacterium colony grown, PCR identification positive bacterias drop into row sequencing identification, compare correct
Clone is that the target gene successfully constructed is overexpressed slow virus carrier；
| Oligo titles | The to3 ' of oligomerization single-stranded DNA sequence 5 ' |
| SV40-F | CCG GAATTCATGGATAAAGTTTTAAACAGAGAGGAATC |
| SV40-R | GCTCTAGATTACAAGTCCTCTTCAGAAATGAG |
(2) with the Lentiviral and packaging plasmid cotransfection slow virus incasing cells built, coating virus is collected
Virus stock solution used, is concentrated by ultrafiltration, and determine titre；
(3) with the fresh culture dilution virus stock solution used containing 8 μ g/mL Polybrene, it is added in target cell, 6 hours
After change liquid, 2 μ g/mL puromycin, 37 DEG C, 5%CO are added into cell2, cellar culture 24h, screenability stabilization is forever
Biochemical spy's network cell line.
To realize above-mentioned second purpose, the present invention is adopted the technical scheme that：
The special network cell line of immortalization built by method as described above.
The invention has the advantages that：
1st, the special network cell line culture of immortalization of the invention remains in that relatively stable state to 50 generations, solves existing
The problem of technology separating for several times and extraction can not ensure special network cell purity and stability；And avoid separating for several times and extract former
Generation, every time separation and extraction are required for purifying repeatedly and the spent a large amount of manpowers of a variety of methods identification and resource.
2nd, the primary special network cell of Cell-IQ cells Real Time Image System observation purifying and the present invention immortalize special network cell line
Growing state, as a result show：7 days complete cell deaths after the primary special network cell attachment of purifying, immortalization of the invention is special
The generation of network cell line the 50th adherent rear 24h, 36h, 48h, 72h, 96h well-growns.
3rd, the cell cycle of relatively more special network cell line and special network cell-SV40 cell lines.Special network cell-SV40 cell lines
The sub-G1 phases substantially reduce, and show the reduction of its apoptosis rate, and S phases and G2 phases are significantly raised, the special network cell line of immortalization of the invention
May be by accelerating S phases and G2 phase processes to cause cell propagation increase.
4th, immunofluorescence technique observes the related immune mark of the special generation cell of network cell line the 50th under laser confocal microscope
Remember thing vimentin and CD34 expression, FITC (green) marks show CD34- expression, keyfluor594 (red) marks
Show vimentin expression.
Brief description of the drawings
Accompanying drawing 1 is om observation spy network cells characteristic structure telopode (↑) (200 ×).
Accompanying drawing 2 is that immunofluorescence technique identifies the related immune marker of special network cell under laser confocal microscope
Vimentin and CD34 have expression.Wherein A.DAPI (blueness) marks nucleus；B.FITC (green) marks show CD34-'s
Expression；C.keyfluor594 (red) marks the expression for showing vimentin；D.DAPI (blueness) marks nucleus, FITC
(green) mark shows CD34- expression, and keyfluor594 (red) marks the expression for showing vimentin.
Accompanying drawing 3 is the special network cell ultrastructure of electron microscopic observation.It can be seen that obvious mitochondria (↑) and endoplasm web frame (▲).
Accompanying drawing 4 is that immuno-electron microscope identifies related immune marker vimentin, CD34, PDGF and the ckit of special network cell
Expression.A. under immuno-electron microscope, the ultra microstructure of special network cell.The related immune marker of special network cell under B, C, D. immuno-electron microscope
Vimentin, CD34-, PDGF and ckit expression.Immunological marker thing and corresponding immune colloid gold granular size are respectively
vimentin-10nm；CD34-18nm；PDGF-25nm；ckit-40nm.
Accompanying drawing 5 is PHY-801 Vector maps.
Accompanying drawing 6 is agarose gel electrophoresis result.Extract primary special network groups of cells (cell is not transfected), NC group (empty carriers
Lenti transfection controls group) and special network cell line group (recombinant slow virus expression vector Lenti-SV40 transfection groups) mRNA, reverse
CDNA is formed after record, using the plasmid containing SV40 large T antigen genes as template, T1 and T2 are that primer enters performing PCR amplification.After amplification
Product electrophoresis observation result is simultaneously taken pictures, and occurs band at 2154bp, is primarily determined that as the amplified production of SV40 large T antigen genes.
Accompanying drawing 7 is that Cell-IQ cells Real Time Image System observes and recorded after the primary special network cell attachment of purifying 24h extremely
96h growing state.
Accompanying drawing 8 is that the adherent rear 24h of the special network cell line of the present invention is observed and recorded to Cell-IQ cells Real Time Image System extremely
96h growing state.
Accompanying drawing 9 is om observation the 3rd generation of the invention, the 10th generation, the 30th generation and the 50th generation special network cell line characteristic structural
telopode(↑)(200×)。
Accompanying drawing 10 is that immunofluorescence technique identifies the special generation of network cell line the 3rd of the invention, the 10th under laser confocal microscope
Related immune the label vimentin and CD34 in generation, the 30th generation and the 50th generation expression.
Accompanying drawing 11 is that immuno-electron microscope identifies the present invention special generation of network cell line the 5th, the 10th generation, the 30th generation and the 50th generation cell
Related immune label vimentin, CD34, PDGF and ckit expression.
Embodiment
The invention will be further elucidated with reference to specific embodiments.It should be understood that these embodiments are merely to illustrate this hair
Bright rather than limitation the scope of the present invention.In addition, it is to be understood that after the content of the invention recorded has been read, art technology
Personnel can make various changes or modifications to the present invention, and these equivalent form of values equally fall within the application appended claims and limited
Fixed scope.
The present invention of embodiment 1 immortalizes the structure of special network cell line
(1) adherent method stage by stage is taken when extracting primary special network cell：C57 mouse lungs are separated, under aseptic condition
1m is cut into physiological saline3Tissue block, be placed in 2mg/ml Type Ⅱ collagen enzymes 37 degree and digest 30 minutes, 70 llm mesh
After filtering, 1500rm is centrifuged 5 minutes, collects cell precipitation, and 30 points are cultivated in the DMEM/F12 culture mediums containing 10%FBS
Clock, after fibroblast is adherent, another culture dish is transferred to by supernatant, liquid is changed in culture after 12 hours, continued after cultivating 3-5 days
The special network cell of micro- Microscopic observation.
(2) repeatedly purify to ensure purity：Scraped with micro pipette tips as cell, using the characteristic structural of the cell as standard
Other cells are struck off under the microscope.Special network cell is repeatedly obtained after purification, has both avoided flow-sorting process primary to fragility
The damage of cell, it also avoid infinite dilution method picking monoclonal and causes the primary cell dead.
(3) according to form and immune labeled identification：It is repeated multiple times strike off after, carry out specificity structure telopode observation
(Fig. 1) and the special network cell of immune labeled identification.Observe that vimentin and CD34 expression is positive (Fig. 2) under Laser Scanning Confocal Microscope.
The special network cell ultrastructure (Fig. 3) of electric Microscopic observation.Special network cell is observed after immune colloid gold granules stain, under Electronic Speculum
Vimentin, CD34, ckit and PDGF expression are positive (Fig. 4).
(4) special network cell is moved actively under the microscope, and except this structure of specific telopode, special network cell is also
Show multiform state property.Microfilament specific stain shows the Subfilament Structure enriched in special network cell, supports its motion active
Characteristic.
The structure of the SV40 stable cell strains of embodiment 2
Stage 1：It is overexpressed the structure of slow virus carrier
Synthetic primer is designed first, expands purpose fragment, then be connected into after digestion by restriction enzyme site contained by its two ends
Overexpression slow virus carrier on；Connection product is transferred to the bacterium competent cell prepared, to the monoclonal bacterium colony grown
Advanced performing PCR identification, PCR identification positive bacterias drop into row sequencing identification, and it is the purpose base successfully constructed to compare correct clone
Because being overexpressed slow virus carrier.
First, experiment material and method
(1) material
1. reagent
| Reagent name | Reagent source |
| PCR is with reagent primer (R＆F) | Sangon Biotech (Shanghai) Co., Ltd. |
| Taq polymerase | NEB |
| QIAGEN Plasmid take out greatly Kit | QIAGEN |
| BSA | Sigma |
| LB or SOB or SOC | Alphaaeser |
| CaCL2 | Sigma |
| T4 DNA ligase | Fermentas |
| T4 DNA ligase buffer | Fermentas |
| MgSO4 | Sigma |
| Agarose | Bio-Rad |
| DNA ladder | Fermentas |
| Positive clone are sequenced | Invitrogen |
| Restriction endonuclease 1 | Fermentas |
| Restriction endonuclease 2 | Fermentas |
2. instrument
(2) method
1. design and synthesize primer
1) corresponding objective gene sequence is found in NCBI according to gene name.
2) determine that used carrier is.Container name is PHY-801, and carrier original paper is EF1A-SV40-IRES-puro.Carrier
Collection of illustrative plates is as shown in Figure 5.
3) with sequence analysis software find out aim sequence present in restriction enzyme, and the carrier that correspondingly uses determines
Restriction enzyme site EcoR I and the Xba I at primer two ends.
4) primer is designed using primer-design software, and the restriction enzyme site determined is added at 5 ' ends.
| Oligo titles | The to3 ' of oligomerization single-stranded DNA sequence 5 ' |
| SV40-F | CCG GAATTCATGGATAAAGTTTTAAACAGAGAGGAATC |
| SV40-R | GCTCTAGATTACAAGTCCTCTTCAGAAATGAG |
5) Sangon Biotech (Shanghai) Co., Ltd. is sent to be synthesized designed primer sequence.
2. the double digestion of carrier
1) by the bacterium solution incubated overnight containing vector plasmid, and fresh bacterium solution 3-5mL is taken to extract plasmid.Specific method is referred to
Qiagen plasmid is small to take out specification.
2) the 1 fresh plasmids of μ g are taken, double digestion is carried out with corresponding restriction enzyme.Digestion system is as follows：
In 37 DEG C of digestion about 3h.
3) digestion products are entered into row agarose gel electrophoresis, after electrophoresis terminates, carries out glue reclaim, step is as follows：Ultraviolet
Under lamp, the adhesive tape comprising purpose fragment is cut.The gross weight that weighs with scale simultaneously subtracts the weight of blank pipe and calculates the weight of gel, presses
100mg=100 μ L carry out the volume of calculated for gel, and the QG buffer of 3 times of gel volumes of addition are placed in 50 DEG C of water-baths and will coagulated
Glue thoroughly melts.Period suitably rocks EP pipes, accelerates the dissolving of gel.
4) after isogel thoroughly melts, add the isopropanol isometric with gel and be well mixed.
5) aforesaid liquid is transferred completely into filter post, 13000rpm centrifugations 30s.(can be repeated once) and then discard in pipe
Liquid, 750 μ L PE buffer are added into post.Centrifuge 1min..Liquid in pipe is discarded, it is empty from 2min again.Change one newly
1.5mL EP pipe, 20 μ L ddH is added into pillar2O, centrifuges 1min., can be by the DNA of dissolving again in order to improve the rate of recovery
Centrifugation one minute in secondary addition pillar.Pillar is discarded, the carrier segments as reclaimed, and determine concentration.
3. the amplification and digestion of purpose fragment
(1) primer of synthesis is diluted to final concentration of 10 μm of ol/L stock solution.
(2) performing PCR amplification is entered using the primer and template of dilution.System is as follows：
Above-mentioned material is added and mixes and puts and be put into from after in PCR instrument in light-wall pipe, choose suitable annealing temperature and
Elongating temperature, you can start PCR amplifications.
(3) PCR terminates laggard row agarose gel electrophoresis, and reclaims target gene.Method is ibid.
(4) target gene after recovery is subjected to double digestion, digestion system is as follows：
In 37 DEG C of digestion about 5h or overnight.
(5) digestion products are subjected to agarose electrophoresis and reclaim purpose fragment, method is ibid.
4. the connection of over-express vector and purpose fragment
(1) concentration for reclaiming carrier and purpose fragment is determined, and by carrier：Purpose fragment=1:7 molar ratio is calculated
Volume ratio needed for carrier and purpose fragment.
(2) connection of over-express vector and purpose fragment, linked system is as follows：
Connected in 37 DEG C after 30min, be immediately placed on 5 DEG C of ice-water bath coolings.
5. conversion
(1) by competent cell be placed on ice (4 DEG C) after after its naturally to thaw, take 10 μ L connection products add competence it is thin
In born of the same parents on ice (4 DEG C) placement 30min.
(2) after thermal shock 90s in 42 DEG C of water-baths.Then (4 DEG C) placement 2-3min on ice are immediately placed in.
(3) add SOC cultures of the 500 μ L without antibiotic and be based on 37 DEG C, 225rpm shaken cultivations 45min.
(4) 3000rpm centrifuges 2min, discards 900 μ L supernatant, and the piping and druming of the bacterium solution of ttom of pipe is scattered, be added to containing
On carrier in the culture plate of correspondence resistance (ammonia benzyl blocks that etc.), smoothen that (temperature of spreader can not with the spreader of sterilizing
It is too high, with non-ironing dead thalline), it is inverted in incubated overnight in 37 DEG C of constant incubators.
6.PCR is identified
(1) several single bacterium colonies of picking, carry out shaking bacterium culture in a small amount.
(2) bacterium solution PCR Preliminary Identifications are carried out, template is only substituted for fresh bacterium solution 2-3 μ L by method ibid step 3.
(3) sample of the positive will be initially identified as, each clone selects two and send sequencing company to carry out sequencing identification.
2nd, experimental data
Stage 2：The packaging and measure of slow virus
With Lentiviral and packaging plasmid (packaging mix) cotransfection slow virus incasing cells of structure,
Coating virus, collects virus stock solution used, is concentrated by ultrafiltration, and determine titre.
Experiment flow：Extracting high-purity, the overexpression slow virus carrier of endotoxin-free and its auxiliary packaging original paper carrier matter
The overexpression slow virus carrier built and its auxiliary packaging original paper vector plasmid, are total to by grain using transgene reagent
Transfect into slow virus incasing cells, transfect after 12h plus Enhancing buffer, then change fresh culture after 4h, continue
Cultivate after 48h, collect the cell supernatant rich in lentiviral particle, the slow virus concentrate of high titre is obtained after being concentrated to it.
First, experiment material and method
1. cell line
The incasing cells of slow virus：Anchorage dependence type is into epithelioid cell, and growth medium is DMEM (containing 10%FBS).
Attached cell is through cultivating growing multiplication formation cell monolayer.
2. bacterial strain
Coli strain DH5 α.For expanding slow virus carrier and auxiliary package carrier plasmid.
3. slow virus packaging system
The slow virus recombinant plasmid and packaging plasmid that successfully construct are carried using the plasmid extraction kit of Qiagen companies
Take.The DNA of gained is dissolved in sterile TE, determines its concentration and purity with UV Absorption method, it is ensured that carry DNA
A260/A280 between 1.8~2.0.
4. reagent
| Reagent name | Reagent source |
| Platform expects orchid | Shanghai Sheng Gong bioengineering Co., Ltd |
| Hyclone | GIBCO |
| DMSO | sigma |
| DMEM | GIBCO |
| Pancreatin | GIBCO |
| Polyethylenimine,liner,MW-25000 | cat#23966 |
5. instrument
| Instrument title | Instrument is originated |
| Fluorescence microscope | Olympus |
| CO2Incubator | Thermo |
| Biohazard Safety Equipment | Thermo |
| Centrifugal ultrafiltration unit | MILLIPORE |
(2) method
1. slow virus is packed
1) cell point disk
The day before transfection, the cell grown is passed in 10cm culture dishes in proper proportions, when cell is grown to
Prepare transfection when 80%~90%.
2) liquid is changed before transfecting
The cell for needing to transfect is renewed fresh culture medium, 10mL/10cm wares by the preceding 1~2h of transfection.
3) transfect
Sterile 1.5mL EP are taken to manage, rotaring redyeing system according to the form below：
After mixing, room temperature place 15min-20min after, be uniformly added drop-wise to and changed in advance in the culture dish of liquid, after be placed in CO2
Cultivated in incubator.
4) Enhancing buffer are added
Transfect after 12h, 100 × Enhancing buffer are uniformly added dropwise and promote transfection.
5) liquid is changed
Transfect after 18~20h, carefully sop up cell culture fluid and abandon in filling in the waste liquid cup of thimerosal, then add 15mL new
Fresh cell culture medium (DMEM for containing 2% serum) continues to cultivate.
6) collection virus
Change after liquid 48h, draw cell supernatant in 50mL centrifuge tubes, 4 DEG C, 4500g centrifuges 5min, and supernatant is with 0.45 μm
It is transferred to after filter filtering in new centrifuge tube, filtrate is finally transferred to centrifugal filter devices in batches
In, 4 DEG C, 4500g centrifuges 10min, abandons the liquid of lower floor in filling in the waste liquid glass of thimerosal, 4 DEG C for the last time, 4500g,
20min is centrifuged, now the liquid in visible filter upper strata is viral concentration liquid.
7) virus packing is with preserving
Virus is dispensed with 50 μ L, -80 DEG C are stored in.
2. titer determination
1) copy number of RT-PCR analytical integrations
Viral diagnosis takes 0.1 μ L plasmid standards and testing sample genomic DNA respectively, separately stays 1 hole to add sterilized water
As no template control (no-template control).Each sample is repeated 1 times.Genome detection takes 0.1 μ L genes respectively
Group standard items and testing sample genomic DNA, separately stay 1 hole to add sterilized water as no template control (no-template
control).Each sample is repeated 1 times.RT-PCR cycling conditions are set as：95 DEG C of 5min, followed by 95 DEG C of 15s, 60 DEG C of 1min
40 circulation.
2) data analysis
The slow virus carrier copy number integrated in the DNA sample measured is demarcated with genome number, obtains every genome
The viral copy number of integration.Titre (integration units per mL, IU mL-1) calculation formula it is as follows：IU mL-1
=(C × N × D × 1000)/V.Wherein：Viral copy numbers of the C=averagely per genome conformity；The number of cell when N=infects；
Extension rate=10 of D=viral vectors；The volume number (0.5 μ L, 5 μ L, 50 μ L and 100 μ L) for the dilution virus that V=is added.Drop
Spending span is:107-109。
2nd, experimental data
SV40 gene overexpression slow virus titer determination results are：
TU mL-1=(8.83 × 1.9*105× 10 × 1000)/50=3.3554*108
Stage 3：The steady strain structure RT-PCR that turns verifies its expression effect
1. it is overexpressed the steady structure for turning strain
The primary special network cell of identified purifying is divided into 3 groups：Primary special network groups of cells (cell is not transfected), NC groups
(empty carrier Lenti transfection controls group) and special network cell line group (recombinant slow virus expression vector Lenti-SV40 transfection groups).With
Suitable ratio (degree of polymerization is about 30% or so) is inoculated with target cell in 6 orifice plates.After 24 hours, before infection, virus stock solution used from-
80 DEG C of refrigerators are ice bath melted after taking out, and it is former to dilute virus with the fresh culture of the μ g/mL Polybrene of reinforcing agent 8 containing infection
Liquid, absorbs old culture medium in 6 orifice plates, plus containing slow virus dilution into target cell, liquid is changed after 6 hours.This slow virus carrier
With puromycin resistances, 2 μ g/mL puromycin, 37 DEG C, 5%CO are added into cell2, cellar culture 24h, to sieve
Choosing surely turns strain.4th day, when cell aggregation degree is about 80%-90%, pass in blake bottle.5th day, efficiency of infection detection：Receive
Surely turn after strain, efficiency of infection is verified by RT-qPCR.
2. the amplification and checking of purpose fragment
(1) the RNA extracts kits of QIAGEN companies are used and are extracted with reference to kit operational procedure in each group cell
RNA.First using the aggressiveness of OLIGO six as reverse transcriptase primer, it is template to extract the total serum IgE in each group cell, in reverse transcriptase catalysis
Lower reverse transcription goes out cDNA.System is：RNA template 500ng, μ L, the primerscript RT Enzyme mix I of 5 × buffer solution 2
The μ L of 0.5 50 μM of six aggressiveness of OLIGO of μ L, 10 μm of ol/L 0.5,100 μM of μ L, DEPC water of Random 6mers 0.5 supply 10 μ L.
37℃15min。
(2) using the cDNA of synthesis as masterplate, SV40 large T antigen gene upstream and downstream primers enter performing PCR amplification, and primer sequence is
SV40-F:AACCTATGGAACTGATGAATG；SV40-R:GGAGGAGTAGAATGTTGAGA.Product electrophoresis observation knot after amplification
Really, there is band (Fig. 6) at recombinant slow virus expression vector Lenti-SV40 transfection groups 2154bp, primarily determine that as the big T of SV40
The amplified production of antigen gene, other two groups do not occur band.
The application method of the present invention of embodiment 3
1st, sterile working.Nutrient solution during operation can add appropriate mycillin.Before experiment is carried out, desinfection chamber and sterile
Operating desk is sterilized for 30-60 minutes with ultra violet lamp, wipes sterile working lift face with 70%ethanol, and open sterile working
After desk fan is operated 10 minutes, just start experimental implementation.Operation only handles one plant of cell line every time, and identical even if culture medium
Unusable same bottle culture medium, with avoid error from obscuring or iuntercellular pollute.After experiment is finished, experiment article is taken out of work
Platform, sterile working lift face is wiped with 70%ethanol.Staff should be noted that inherently safe, must be dressed during experiment experiment clothing and
Gloves.
2nd, this cell line is cultivated using the DMEM+F12 culture mediums containing 10%FBS, treats cell length to 85%-90%
Passed on during density, cell is digested with the pancreatin containing EDTA during passage, 1：2 passages.
Embodiment 4
1st, immortalize：
1. observe and have recorded 24h after primary special network cell attachment after purification with Cell-IQ cells Real Time Image System
To the growing state of one week.As shown in fig. 7, Cell-IQ cells Real Time Image System observation and to have recorded the primary special network of purifying thin
The adherent rear 24h to 96h of born of the same parents growing state.A. 24h after primary special network cell attachment is purified；B. primary special network cell attachment is purified
36h afterwards, part cell divides, and moves (↑)；C, D. purify 48h and 72h, part cell after primary special network cell attachment
It is deadE. 7 days, complete cell death after primary special network cell attachment are purified.
2. 24h to 96h after special network cell attachment is immortalized to 2nd generation, the 10th generation, the 20th generation, the 30th generation and the 50th generation
Growing state also observed and recorded.As shown in figure 8, spy is observed and have recorded to Cell-IQ cells Real Time Image System
The adherent rear 24h to 96h of network cell line growing state.A-E. special network cell line 2nd generation adherent rear 24h, 36h, 48h, 72h,
96h；F-J. special network cell line the 5th generation adherent rear 24h, 36h, 48h, 72h, 96h；K-O. special network the 10th generation of cell line it is adherent after
24h, 36h, 48h, 72h, 96h；P-T. special network cell line the 30th generation adherent rear 24h, 36h, 48h, 72h, 96h；U-Y. special network is thin
Born of the same parents are the 50th generation adherent rear 24h, 36h, 48h, 72h, 96h.
2nd, stability
1. the generation of om observation the 3rd, the 10th generation, the 30th generation and the 50th generation special network cell line characteristic structural telopode, and
Photographed to record.As shown in figure 9, om observation spy network cells characteristic structure telopode, A-D are respectively the 3rd generation, the 10th
Form and characteristic structural telopode (↑) under generation, the 30th generation and the 50th generation special network cell line light microscopic.
2. with immunofluorescence technique observe under laser confocal microscope the generation of spy's network cell line the 5th, the 10th generation, the 30th generation and
Related immune the label vimentin and CD34 of 50th generation cell expression are simultaneously taken pictures.As shown in Figure 10, immunofluorescence
Method identifies the related immune mark of the 3rd generation, the 10th generation, the 30th generation and the 50th generation special network cell line under laser confocal microscope
Thing vimentin and CD34 expression.A-D. special network cell line the 5th generation cell vimentin and CD34 expression；E-H. special network is thin
Born of the same parents are the 10th generation cell vimentin and CD34 expression；I-L. special network cell line the 30th generation cell vimentin and CD34 table
Reach；M-P. special network cell line the 50th generation cell vimentin and CD34 expression.
A, E, I, M.DAPI (blueness) mark nucleus；B, F, J, N.FITC (green) mark the expression for showing CD34-；
C, G, K, O.keyfluor594 (red) mark the expression for showing vimentin；D, H, L, P.DAPI (blueness) mark cell
Core, FITC (green) marks show CD34- expression, and keyfluor594 (red) marks the expression for showing vimentin.
3. the related immune mark of the special generation of network cell line the 5th, the 10th generation, the 30th generation and the 50th generation cell is identified with immuno-electron microscope
Remember thing vimentin, CD34, PDGF and ckit expression.As shown in figure 11, immunological marker thing and corresponding immune colloid gold
Grain size is respectively vimentin-10nm；CD34-18nm；PDGF-25nm；ckit-40nm.In A, B. spy's network the 5th generation of cell line, are thin
Born of the same parents vimentin, CD34-, PDGF and ckit expression；C, D. spy's network cell line the 10th generation cell vimentin, CD34-, PDGF
With ckit expression；E, F. spy's network cell line the 30th generation cell vimentin, CD34-, PDGF and ckit expression；G, H. spy's network
Cell line the 50th generation cell vimentin, CD34-, PDGF and ckit expression.
3rd, the cell cycle of relatively more special network cell line and special network cell-SV40 cell lines.Special network cell-SV40 cell lines
The sub-G1 phases substantially reduce, and show the reduction of its apoptosis rate, and S phases and G2 phases are significantly raised, illustrate that it may be by accelerating S phases and G2
Phase process causes cell propagation increase.
Described above is only the preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
Member, on the premise of the inventive method is not departed from, can also make some improvement and supplement, and these are improved and supplement also should be regarded as
Protection scope of the present invention.
SEQUENCE LISTING
<110>Zhongshan Hospital Attached to Fudan Univ
<120>One kind immortalizes special network cell line and its construction method
<130> /
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 38
<212> DNA
<213>Artificial sequence
<400> 1
ccggaattca tggataaagt tttaaacaga gaggaatc 38
<210> 2
<211> 32
<212> DNA
<213>Artificial sequence
<400> 2
gctctagatt acaagtcctc ttcagaaatg ag 32
<210> 3
<211> 21
<212> DNA
<213>Artificial sequence
<400> 3
aacctatgga actgatgaat g 21
<210> 4
<211> 20
<212> DNA
<213>Artificial sequence
<400> 4
ggaggagtag aatgttgaga 20
Claims (5)
1. a kind of construction method for immortalizing special network cell line, it is characterised in that comprise the following steps：
(1) the mouse lung tissue block shredded is digested in Type Ⅱ collagen enzyme, filter, centrifugation, collect cell precipitation, containing
Cultivated in 10%FBS DMEM/F12 culture mediums, after fibroblast is adherent, supernatant is transferred to another culture dish, cultivated
Liquid is changed after 12 hours, continues to cultivate 3-5 days；
(2) scraped with micro pipette tips as cell, strike off fibroblast, it is repeated multiple times strike off after, carry out specificity structure
Telopode observation and the special network cell of immune labeled identification；
(3) it is thin with the retroviral vector infection host containing SV-40- large T antigens using special network cell as host cell
Born of the same parents, by passage, screening, identification.
2. the construction method of special network cell line is immortalized according to claim 1, it is characterised in that described big containing SV-40-
The retroviral vector of T antigens is EF1A-SV40-IRES-puro retroviral vectors.
3. the construction method of special network cell line is immortalized according to claim 1, it is characterised in that the step 3 includes：
(1) synthetic primer is designed, performing PCR amplification is entered by template of the plasmid containing SV40 large T antigen genes, by contained by two ends
Restriction enzyme site is connected on the overexpression slow virus carrier after digestion；Connection product is transferred to the bacterium competence prepared thin
Born of the same parents, identify the advanced performing PCR of monoclonal bacterium colony grown, PCR identification positive bacterias drop into row sequencing identification, compare correct clone
The target gene as successfully constructed is overexpressed slow virus carrier；
(2) with the Lentiviral and packaging plasmid cotransfection slow virus incasing cells built, coating virus collects virus
Stoste, is concentrated by ultrafiltration, and determine titre；
(3) with the fresh culture dilution virus stock solution used containing 8 μ g/mL Polybrene, it is added in target cell, is changed after 6 hours
Liquid, 2 μ g/mL puromycin, 37 DEG C, 5%CO are added into cell2, cellar culture 24h, the stable immortalization of screenability
Special network cell line.
4. the construction method of special network cell line is immortalized according to claim 3, it is characterised in that is transferred to the big T of SV-40- and is resisted
Original, realizes cell immortality.
5. the special network cell line of the immortalization built by any methods describeds of claim 1-4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710272011.9A CN107034238B (en) | 2017-04-24 | 2017-04-24 | Immortalized specific cell line and construction method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710272011.9A CN107034238B (en) | 2017-04-24 | 2017-04-24 | Immortalized specific cell line and construction method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107034238A true CN107034238A (en) | 2017-08-11 |
| CN107034238B CN107034238B (en) | 2021-04-20 |
Family
ID=59535183
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710272011.9A Active CN107034238B (en) | 2017-04-24 | 2017-04-24 | Immortalized specific cell line and construction method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107034238B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108342368A (en) * | 2018-01-25 | 2018-07-31 | 武汉珈创生物技术股份有限公司 | A kind of low pH is incubated the verification method of inactivation of virus |
| CN108865977A (en) * | 2018-07-24 | 2018-11-23 | 新乡医学院 | A kind of newborn rat skin end septal cell massive amplification method and application |
| CN109706181A (en) * | 2019-01-29 | 2019-05-03 | 中国农业科学院北京畜牧兽医研究所 | A kind of method, immortalization pig liver sternzellen system and application constructing immortalization pig liver sternzellen system |
| CN112941033A (en) * | 2021-03-11 | 2021-06-11 | 深圳市人民医院 | Construction method of immortalized feeder layer cell strain, immortalized feeder layer cell strain and application |
| CN113755424A (en) * | 2021-10-08 | 2021-12-07 | 复旦大学附属中山医院 | Exosome of mouse lung specific channel cell line and extraction method and application thereof |
| CN114231567A (en) * | 2021-12-15 | 2022-03-25 | 复旦大学附属中山医院 | Human lung specific channel cell line construction method |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105779395A (en) * | 2016-03-22 | 2016-07-20 | 西北农林科技大学 | Immortalized canine adipic mesenchymal stem cell line and constructing method thereof |
-
2017
- 2017-04-24 CN CN201710272011.9A patent/CN107034238B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105779395A (en) * | 2016-03-22 | 2016-07-20 | 西北农林科技大学 | Immortalized canine adipic mesenchymal stem cell line and constructing method thereof |
Non-Patent Citations (2)
| Title |
|---|
| L. M. POPESCU.ET AL: "Telocytes in human epicardium", 《J. CELL. MOL. MED. 》 * |
| 黎力平等: "大鼠肾脏皮质中分离出新型间质细胞-特络细胞", 《中华移植杂志》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108342368A (en) * | 2018-01-25 | 2018-07-31 | 武汉珈创生物技术股份有限公司 | A kind of low pH is incubated the verification method of inactivation of virus |
| CN108865977A (en) * | 2018-07-24 | 2018-11-23 | 新乡医学院 | A kind of newborn rat skin end septal cell massive amplification method and application |
| CN109706181A (en) * | 2019-01-29 | 2019-05-03 | 中国农业科学院北京畜牧兽医研究所 | A kind of method, immortalization pig liver sternzellen system and application constructing immortalization pig liver sternzellen system |
| CN112941033A (en) * | 2021-03-11 | 2021-06-11 | 深圳市人民医院 | Construction method of immortalized feeder layer cell strain, immortalized feeder layer cell strain and application |
| CN113755424A (en) * | 2021-10-08 | 2021-12-07 | 复旦大学附属中山医院 | Exosome of mouse lung specific channel cell line and extraction method and application thereof |
| CN114231567A (en) * | 2021-12-15 | 2022-03-25 | 复旦大学附属中山医院 | Human lung specific channel cell line construction method |
| CN114231567B (en) * | 2021-12-15 | 2023-09-26 | 复旦大学附属中山医院 | Construction method of human lung vein cell line |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107034238B (en) | 2021-04-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107034238A (en) | One kind immortalizes special network cell line and its construction method | |
| CN105518137A (en) | Method for specifically removing pig SALL1 gene by CRISPR-Cas9 and sgRNA used for specific targeting SALL1 gene | |
| CN105492608A (en) | Method using CRISPR-Cas9 to specifically knock off pig PDX1 gene and sgRNA of PDX1 gene for specific targeting | |
| CN105518134A (en) | Method for pig SLA-2 gene specific knockout through CRISPR-Cas9 and sgRNA for specially targeting SLA-2 gene | |
| CN105518138A (en) | Method knocking out pig GFRA1 genes with CRISPR-Cas9 specificity and sgRNA for specificity targeting GFRA1 genes | |
| CN105492609A (en) | Method for CRISPR-Cas9 specific knockout of pig GGTA1 gene and sgRNA for specific targeted GGTA1 gene | |
| CN105518139A (en) | Method for knocking out pig FGL2 genes with CRISPR-Cas9 specificity and sgRNA for specificity targeting FGL2 genes | |
| CN105518140A (en) | Method for pig vWF gene specific knockout through CRISPR-Cas9 and sgRNA for specially targeting vWF gene | |
| CN106755091A (en) | Gene knockout carrier, MH7A cell NLRP1 gene knockout methods | |
| CN105518135A (en) | Method for pig CMAH gene specific knockout through CRISPR-Cas9 and sgRNA for specially targeting CMAH gene | |
| CN105779395A (en) | Immortalized canine adipic mesenchymal stem cell line and constructing method thereof | |
| CN108342362A (en) | A kind of stable cell lines MDCK and its construction method for expanding recombination hepatitis infectiosa canis virus CAV2 | |
| CN106085946A (en) | Can be with the Pig testicular cell strain ST S of suspension culture and preparation method thereof and application | |
| CN104928292B (en) | The design method of sgRNA a kind of and slow virus carrier, the plasmid of building | |
| CN106497976A (en) | A kind of HBB gene kit for correcting severe beta Thalassemia autologous patient candidate stem cell | |
| CN105950656A (en) | Method for rapidly obtaining gene knockout cell strains | |
| CN107267532A (en) | The construction method of JS2008 plants of full-length infectious CDNAs of PEDV and application | |
| CN101654685B (en) | Human Bcl-2 and human VEGF165 double-gene co-expression recombinant vector and building method thereof | |
| CN109628414A (en) | A kind of mRNA transmethylase deficiency mumps virus and its preparation method and application | |
| CN104830907A (en) | A constructing method of a bone marrow stem cell expressing an osteogenic gene | |
| CN102140440A (en) | Method for separating and culturing poultry bone mesenchymal stem cells by using bone marrow tissue block | |
| CN105039241A (en) | Pelodiscus sinensis heart cell continuous cell line and establishing method and ultra-low-temperature cryopreservation method thereof | |
| CN105200059A (en) | SiRNA for targeted inhibition of mouse UCP2 gene expression and construction of expression vector thereof | |
| WO2021121321A1 (en) | Fusion protein that improves gene editing efficiency and application thereof | |
| CN107177630A (en) | A kind of anti-PCV2 transgene pigs preparation method without exogenous marker gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |