CN106755091A - Gene knockout carrier, MH7A cell NLRP1 gene knockout methods - Google Patents

Abstract

The present invention relates to the field of molecular biology, in particular to a gene knockout vector and its construction method and application, and a method for knocking out the NLRP1 gene of MH7A cells. The present invention adopts the CRISPR-Cas9 gene knockout system, uses NLRP1 as the target gene to design the CRISPR targeting sequence and prepares a knockout vector for the NLRP1 gene, and uses it to transfect MH7A cells, which can efficiently knock out MH7A cells In order to effectively build a research platform for rheumatoid arthritis, it can greatly promote the research on the pathogenesis of rheumatoid arthritis, and can promote the interaction between NLRP1 inflammasome and various inflammatory factors in rheumatoid arthritis. and research on the molecular mechanism related to the pathogenesis of synovitis.

Description

Gene knockout vector, MH7A cell NLRP1 gene knockout method

technical field

The present invention relates to the field of molecular biology, in particular to a gene knockout vector and its construction method and application, and a method for knocking out the NLRP1 gene of MH7A cells.

Background technique

Rheumatoid Arthritis (Rheumatoid Arthritis, RA) is a chronic autoimmune disease characterized mainly by synovitis of the joints. The incidence of RA in my country is about 0.3% to 0.6%. The incidence rate is high, the disability rate is high, and severe endanger human health.

The etiology of RA is still not very clear, but studies in recent years have shown that its pathogenesis may be related to nucleotide-binding oligomerization domain-like receptor protein 1 (nucleotide-binding, leucine-rich repeat pyrin domaincontaining protein 1, NLRP1). The innate immune system recognizes invading microorganisms and danger signals in the body through specific pattern-recognition receptors (PRRs). PRR is mainly divided into two categories, one of which is the Nod-like receptor (NOD-like receptor, NLR) located in the cytoplasm, and NLP participates in proteins such as apoptosis-related speck-like protein and caspase Under this condition, a complex of proteins called the inflammasome can form. Among them, NLRP1 inflammasome is the precursor of NLRP1 and apoptosis-associated speck-like protein (ASC) and caspase-1, caspase-5 after recognizing intracellular pathogen-associated molecular pattern (PAMP). The protein complex formed by molecular combination promotes the maturation and release of inflammatory factors such as IL-1β, IL-18, IL-33 after activation, and plays an important role in innate immunity.

Rheumatoid arthritis synovial fibroblast (MH7A) is a common model cell for the study of rheumatoid arthritis. Therefore, if a kind of MH7A cell with NLRP1 gene knockout can be constructed, it will be able to effectively build a rheumatoid arthritis. The research platform greatly promotes the research on the pathogenesis of rheumatoid arthritis, and can promote the research on the molecular mechanism related to the interaction between NLRP1 inflammasome and various inflammatory factors on the pathogenesis of rheumatoid arthritis and synovitis.

In view of this, the present invention is proposed.

Contents of the invention

The object of the present invention is to provide a gene knockout vector, which can be used to knock out human NLRP1 gene.

The present invention also provides a construction method and application of the gene knockout vector; specifically, the application is a method for knocking out the NLRP1 gene in MH7A cells.

In order to realize the above-mentioned purpose of the present invention, special adopt following technical scheme:

A gene knockout vector, which is obtained by linking the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 into a plasmid capable of expressing CRISPR-Cas9 gene editing system-related enzymes.

CRISPR (clustered, regularly interspaced, short palindromic repeats) is an immune mechanism from bacteria to degrade invading viral DNA or other foreign DNA. In bacteria and archaea, CRISPR systems are divided into three types, among which type I and type III require multiple CRISPR-associated proteins (Cas proteins) to function together, while type II systems only need one Cas protein, which is the basis for the CRISPR system. It provides convenient conditions for wide application.

Currently, the CRISPR-Cas9 system from Streptococcus pyogenes is the most widely used. Cas9 protein (contains two nuclease domains, which can cut two single strands of DNA respectively. Cas9 first combines with crRNA and tracrRNA to form a complex, and then binds and invades DNA through the PAM sequence to form an RNA-DNA complex structure, and then target DNA double strands are cut, resulting in DNA double strand breaks.

Due to the simple structure of the PAM sequence (5'-NGG-3'), a large number of targets can be found in almost all genes, so it is widely used. The CRISPR-Cas9 system has been successfully applied to plants, bacteria, yeast, fish and mammalian cells, and is currently the most efficient genome editing system.

In this application, the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 is the target sequence with PAM sequence screened from the common coding region of NLRP1. These two target sites have good sequence specificity, are not easy to off-target, and have high knockout efficiency.

Preferably, in the gene knockout vector as described above, the plasmid capable of expressing enzymes related to the CRISPR-Cas9 gene editing system is pGK1.1linear vector.

The method for constructing the gene knockout vector as described above comprises the following steps:

1), select the first exon of the common coding region of the five transcripts of the NLRP1 gene for CRISPR targeting sequence design, and obtain the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2;

2), design forward oligonucleotide sequence and reverse oligonucleotide sequence according to the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2;

3), annealing the forward oligonucleotide sequence and the reverse oligonucleotide sequence to form a double-stranded oligonucleotide;

4), connecting the double-stranded oligonucleotide into a linearized plasmid capable of expressing enzymes related to the CRISPR-Cas9 gene editing system to obtain a gene knockout vector.

The design method of the forward oligonucleotide sequence and the reverse oligonucleotide sequence is designed according to the cohesive end of the plasmid used to express the relevant enzymes of the CRISPR-Cas9 gene editing system. In one embodiment of the application, There are specific embodiments for designing forward oligonucleotide sequences and reverse oligonucleotide sequences for pGK1.1 linear vector.

A host cell containing a gene knockout vector as described above.

Since the NLRP1 gene is relatively conservative, the gene knockout vector provided by the present invention is suitable for almost all mammalian cells expressing the NLRP1 gene.

A method for knocking out the NLRP1 gene in MH7A cells, comprising the following steps:

a), transforming the gene knockout vector according to claim 2 into G10Competent Cell, and culturing it with a culture medium containing antibiotics corresponding to the gene knockout vector resistance;

b) Use the universal primer VSP primer of pGK1.1 linear vector as the upstream primer, and use the reverse oligonucleotide sequence designed by SEQ ID NO:1 or SEQ ID NO:2 as the downstream primer to screen positive clones and verify by sequencing;

c), extracting the plasmids in the correct positive clones verified in step b) and transfecting MH7A cells to obtain cell pool cells;

d), 24 hours after transfection, the cells of the cell pool were treated with puromycin;

e) After 72 hours of transfection, the MH7A cells were diluted by limiting dilution to a 96-well plate to prepare monoclones, and the obtained monoclones were cultured;

f), using the genomic DNA of the monoclonal as a template, and carrying out PCR amplification with the nucleotide sequence shown in SEQ ID NO:3 or SEQ ID NO:4 as primers;

g) Use Cruiser ^TM to perform enzyme digestion on the amplified product to screen positive clones and verify them by sequencing.

The MH7A cells used in the present invention were purchased from Shanghai Hongshun Biotechnology Co., Ltd., the cell product number: C0878, and were derived from the Japanese RICKEN cell bank.

Preferably, in the method for knocking out the NLRP1 gene in MH7A cells as described above, in step c), the concentration of the plasmid is 1 μg/μl to 3 μg/μl, and the concentration of the MH7A cells is 2×10 ⁶ to 3×10 ⁶ cells/mL.

Further preferably, in step c), the transfection is electroporation;

The electroporation conditions are as follows: the electroporation voltage is 1000V-1100V, the electroporation time is 28ms-32ms, and electroporation is performed once.

The volume of the electric cup used in the present invention is 200 μl.

In an embodiment of the present invention, a specific implementation process of electroporation condition exploration is provided.

Preferably, in the method for knocking out the NLRP1 gene of MH7A cells as described above, in step d), when the cells in the cell pool are treated with puromycin, the concentration of puromycin used is 0.45 μg/mL-0.55 μg /mL.

Preferably, the method for knocking out the NLRP1 gene in MH7A cells as described above, after step g), further includes the following steps:

For the positive clones verified to be correct in step g), the positive clones with different mutations of the two alleles were re-do TA cloning and sent for sequencing, and compared with the wild type to determine the mutation of each allele.

Usually human cells are diploid. If the two parents of the positive clone cells have inconsistent base deletions, there will be overlapping peaks in the monoclonal sequencing peak map, and further PCR amplification is required to amplify the target gene fragment of the positive clone cells, and then connect to the T vector. On the above, use universal sequencing primers to sequence to see what the two parental base deletions are.

Preferably, the NLRP1 gene-knockout MH7A cells prepared by the method for knocking out the NLRP1 gene of MH7A cells as described above.

Compared with prior art, the beneficial effect of the present invention is:

The present invention adopts the CRISPR-Cas9 gene knockout system, takes NLRP1 as the target gene to carry out the CRISPR target sequence design and prepares the knockout vector for the NLRP1 gene, and uses it to transfect MH7A cells, which can efficiently knock out the MH7A cells In order to effectively build a research platform for rheumatoid arthritis, it can greatly promote the research on the pathogenesis of rheumatoid arthritis, and can promote the interaction between NLRP1 inflammasome and various inflammatory factors in rheumatoid arthritis. and research on the molecular mechanism related to the pathogenesis of synovitis.

Description of drawings

In order to more clearly illustrate the specific implementation of the present invention or the technical solutions in the prior art, the following will briefly introduce the accompanying drawings that need to be used in the specific implementation or description of the prior art. Obviously, the accompanying drawings in the following description The drawings show some implementations of the present invention, and those skilled in the art can obtain other drawings based on these drawings without any creative work.

Fig. 1 is 1000V in embodiment 1, 30ms, the photo under the microscope after 24h after electroporation under the condition of 1pulse; Fig. 1A is the photo under the light microscope; Fig. 1B is the green fluorescent photo that the cell sends after electroporation;

Figure 2 is the plasmid map of pGK1.1linear vector;

Fig. 3 is the nucleic acid electrophoresis diagram of the carrier fragment after the pGK1.1 carrier is digested with BbsI in step 3 of Example 2;

Fig. 4 is the electrophoresis graph of colony PCR amplification using VSP primer and downstream negative-strand Oligo primer in step 2 of Example 3.

Figure 5 is the pool sequencing peak map of the Guide#1 site;

Figure 6 is the pool sequencing peak map of the Guide#2 site;

Figure 7 is the pool sequencing peak map of the Guide#3 site.

detailed description

Embodiments of the present invention will be described in detail below in conjunction with examples, but those skilled in the art will understand that the following examples are only for illustrating the present invention, and should not be considered as limiting the scope of the present invention. Those who do not indicate the specific conditions in the examples are carried out according to the conventional conditions or the conditions suggested by the manufacturer. The reagents or instruments used were not indicated by the manufacturer, and they were all conventional products that could be purchased from the market.

Embodiment 1 pre-experimental operation

1. Monoclonal growth verification test.

Limiting dilution: Make MH7A cells into a cell suspension and count the cells, then take a certain amount of cell suspension for dilution, so that the number of cells in each well of the final 96-well plate is 1 or 5, (100 μl per well) after confirming that the dilution is accurate , will be diluted in 37 ° C, 5% CO ₂ incubator static culture; after 7 to 10 days under the microscope, it can be found that monoclones can be formed, the cells have a tendency to proliferate and can form cell clusters.

2. Explore the electroporation conditions of MH7A cells

After the MH7A cells are made into a uniform single-cell suspension, take a part of it and mix it evenly for platelet trypan blue staining and counting (electroporation can only be performed if the viable cell rate is >95%), and calculate the concentration of the cell suspension; take 1×10 ⁷ cells Suspend in a sterile tube and centrifuge at 1000rpm for 4min; take the cell pellet, add a certain amount of DPBS to it, mix well and add pEGFP-N1 plasmid (10μg in total, endotoxin-removed treatment), so that the final total system is about 410μl; After uniformity, use the tip of the electric transfer gun to add to the two electric shock cups respectively, so that the liquid surface of the nozzle is raised, and no bubbles are formed in the cup, cover the lid to mark, and then conduct electric transfer. Electroporation voltage conditions were: 1000V, 1100V; (30ms, 1pulse); after mixing and electric shock, the cells were taken and equal parts were placed in each well of the prepared preheated 6-well plate. After 24 hours to 48 hours, observe under the microscope, and take pictures (visible and fluorescent field of view). The state of the cells after 24 hours of electroporation is shown in Figure 1. It can be seen from Figure 1 that the cell viability and the percentage of green fluorescent cells are relatively better for 1000V electroporation.

3. Exploring the minimum total lethal concentration of MH7A cells (Puro)

Adherent cells: After counting the cell suspension, inoculate 50,000 cells (500ul per well) in each well of a 24-well plate, and add different concentrations of puromycin (Puro, mother solution concentration 1mg/ml, drug The killing concentration gradient is: 0, 0.5, 1ug/ml), observe the cells under the microscope after 2 to 3 days, and select the lowest concentration that completely kills the cells as the drug screening concentration for subsequent experiments. The obtained Puro drug screening concentration was 0.5 μg/ml.

The construction method of embodiment 2 gene knockout vector

In this embodiment, a method for constructing a gene knockout vector for knocking out the NLRP1 gene is provided, comprising the following steps:

1. Target site design and synthesis

1) Design CRISPR-Cas9 knockout target sites

First, a pair of oligo DNA of about 20bp needs to be designed in the target DNA region, and designed through the following online tools:

CRISPR Design at MIT: http://crispr.mit.edu/

The common CDS region of the five transcripts of the NLRP1 gene was selected, and the first exon of the common CDS region was found for target site design. It is best to input only one exon at a time to avoid the Guide sequence spanning introns.

Among them, bases in capital letters represent exons, and bases marked in bold and underlined represent selected target sequences.

The NCBI scoring of the target sequence is as follows:

2. Add adapters to primers

Primer synthesis needs to add extra bases to the head of the target sequence, add CACC to the forward primer, and add AAAC to the reverse primer. It is important to note that the first base of the target sequence must be G. If the target sequence you choose If a base is not G, you can add a G before the target sequence by yourself. The target sequence primers are designed as follows:

Guide#1

NLRP1-1F: TCGCCAATAAAGCGCACTCC

NLRP1-1R: GGAGTGCGCTTTATTGGCGA

Guide#2

NLRP1-2F: CATGGAGGTGGCCTCGTACC

NLRP1-2R: GGTACGAGGCCACCTCCATG

Guide#3

NLRP1-3F: GGCCGCCTGGCCTGTTACT

NLRP1-3R: AGTAACAGGCCAGGCGGCCC

Wherein, the part in bold and underline is an additional added sequence, which is the part to be complementary to the vector after digestion with BbsI.

3. Knockout vector construction

1) Oligo hybridization, knockout vector ligation reaction

Dilute the synthesized two single-stranded Oligo DNAs to 10 μM, anneal to form dsDNA, and then connect with the linearized pGK1.1linear vector carrier, which can be directly connected with T4DNA Ligase. The annealing reaction system is as follows:

Digest pGK1.1linear vector with BbsI

pGK1.1linear vector is a linearized vector, which can be directly used in T4DNA Ligase ligation reaction without enzyme digestion. The pGK1.1 vector has been optimized, and its transfection and knockout efficiency is higher than that of general CRISPR vectors. The plasmid map of pGK1.1linear vector is shown in Figure 2. Before constructing the target site knockout vector, the pGK1.1 vector was digested with BbsI and the vector fragment was recovered by gel. The nucleic acid electrophoresis of the recovered vector fragment is shown in Figure 3.

After centrifuging the above system briefly, place it in a PCR instrument and incubate at 95°C for 3 minutes, and then cool naturally for 20 minutes after incubation. Take 1 μl of hybridized dsDNA for T4 DNA ligase ligation reaction, the reaction system is as follows:

After the above system was centrifuged briefly, it was placed in a PCR instrument and incubated at 16°C for 30min.

Example 3

In this embodiment, a method for knocking out the NLRP1 gene in MH7A cells is provided.

1. Transform the gene knockout vector obtained in Example 2 into G10Competent Cell:

Take 1 tube of G10Competent Cell from the -80°C refrigerator and thaw on ice.

After melting, add 10 μl of the ligation product, flick to mix, and incubate on ice for 30 minutes.

Shock in a water bath at 42°C for 60 sec, quickly take it out and place it on ice to cool for 2-3 min.

Add 800 μl of anti-SOC-free liquid medium to the tube, and resume culturing on a shaker (37° C./160 rpm) for 45 minutes.

Centrifuge at 4500 rpm for 5 min, discard 800 μl of supernatant, suspend the pellet in the remaining 100 μl of supernatant, spread evenly on the screening plate containing Kan resistance, and incubate overnight.

2. Screen positive recombinants

On the second day of transfection, use the upstream primer VSP primer and the respective downstream negative-strand Oligo primers for colony PCR screening. The correct size of the positive clone PCR should be 100bp. The electrophoresis results after PCR amplification are shown in Figure 4. The screened positive clones Plasmids were extracted for further sequencing verification.

Correctly sequenced plasmids were concentrated to a concentration above 1 μg/μl.

The sequence of the upstream primer VSP primer is: GGACTATCATATGCTTACCG.

3. Electrotransfection of target cells

1) Take the MH7A cell suspension in good logarithmic growth phase and count it with trypan blue to determine the number of cells and cell viability (cell viability >95%).

2) Take 5×10 ⁶ cells in a 15ml centrifuge tube, centrifuge and discard the supernatant (1000rpm/4min).

3) Suspend the cell pellet in 210μl DPBS, transfer to a 1.5ml EP tube, add the required amount of constructed knockout plasmid 5μg-8μg (plasmid concentration requires 1μg/μl-3μg/μl), and mix gently .

4) Transfer the above-mentioned cell plasmid mixture to the electroporation cup with a special electroporation gun tip. After confirming that the solution in the electroporation cup has no bubbles and the liquid level is raised, cover the electroporation cup and place it on the electroporation instrument to set the electroporation conditions. Then perform electroporation. After the peak pattern is normal, take out the cell solution and transfer it to a six-well plate medium (the medium needs to be preheated at 37°C without antibiotics); pool cells are obtained after electroporation

The conditions of electroporation are: 1000V, 30ms, 1pulse.

5. Pool cell sequencing to detect knockout efficiency

24h after electroporation, puro was treated with medicine; the concentration of puro used was 0.5 μg/mL.

After electroporation for 72 hours, pool cells were counted with trypan blue;

Before screening positive clones, the knockout efficiency of pool cells (mixed clones) needs to be verified in vivo, but the results can only be used as a reference;

Generally, in sequence sequencing near the target site, positive samples should appear nested peaks in the target site and subsequent sequences. For example, when the knockout efficiency is low, the signal intensity is often low, which affects the judgment. Judging from the results of pool sequencing peaks (Figure 5, Figure 6, Figure 7), there is almost no set of peaks near the target site of Guide#3, and the knockout efficiency is low; therefore, this site is discarded, and only Guide#1 and Guide#2 site. That is, the final gene knockout vector obtained in the present application is the nucleotide sequence shown in SEQ ID NO: 1 (Guide #1 sequence removes the terminal AGG) or SEQ ID NO: 2 (Guide #2 sequence removes the terminal TGG) into pGK1.1linearvector to obtain.

6. Preparation and growth of monoclonal

Dilute the cells into 10 96-well plates by limiting dilution method, and culture them statically in a CO ₂ incubator at 37°C; observe the growth of the monoclonals after one week, and transfer the grown monoclonals to 48-wells for expansion after about two weeks ; When the cells cover 1/2 of the 48 wells, a part (10 ² -10 ⁴ ) can be taken out, and the genome of the cells can be extracted using the Genloci TNA extraction kit (cat.no.GP0155, GP0156).

7. Extraction of monoclonal genomic DNA

1) Take 10 ² to 10 ⁴ cells in a 1.5ml EP tube, centrifuge at room temperature at 1500rpm for 5min, and carefully suck off the culture medium.

2) Add 150 μl PBS to resuspend the cells, centrifuge at 1500 rpm for 5 min at room temperature, and carefully discard the supernatant.

3), repeat step 2 once.

4) Add an appropriate volume (recommended volume is 50 μl to 200 μl) of the pre-prepared mixture of solution A and solution B into the centrifuge tube, pipette the tip of the pipette 5 times, and place it on ice for 10 minutes to fully lyse the cells.

5) Add twice the volume of absolute ethanol, mix evenly by inversion, and precipitate at -20°C for more than 20 minutes.

6) Centrifuge at 12000 rpm for 20 min at 4°C and discard the supernatant.

7) Add 400 μl to 500 μl of pre-cooled 75% ethanol to wash the precipitate, centrifuge at 12000 rpm for 10 minutes at 4°C, carefully discard the supernatant, and dry naturally (not more than 5 minutes).

8) Add an appropriate volume (recommended volume is 10 μl to 30 μl) of sterilized double distilled water to dissolve the precipitate, and the solution can be directly used for PCR reaction or stored at -20°C.

8. PCR amplification of the target fragment

1), material design lead

Highly specific Primers are designed near the knockout target site, and the length of the amplified product is about 340bp. Primers primer sequence is as follows:

Primer F: SEQ ID NO: 3

PrimerR: SEQ ID NO: 4

2), PCR amplification to obtain hybrid DNA

Prepare the following reaction system in a sterilized PCR tube, use high-specificity Primers, and amplify fully hybridized DNA products between wild-type and mutant.

3), the PCR reaction procedure is as follows:

Cool naturally to below 40°C (wild-type fragments and mutant fragments hybridize).

After PCR, take 2-3 μl for electrophoresis detection, and the target fragment is required to be bright and single.

9. Positive clones screened by Cruiser ^TM Enzyme

Prepare the following reaction system in a sterilized PCR tube:

PCR amplification product

Immediately after reacting at 45°C for 20 min, 2 µl of 6×Stop Buffer was added to the above 10 µl reaction system, followed by agarose electrophoresis or storage at -20°C.

10. Positive clones were screened by sequencing

Sequencing verification was performed on the positive clones initially screened by Crusier enzyme digestion to further confirm the positive clones.

11. TA clone

For the positive clones with different mutations of the two alleles among the positive clones, TA cloning was performed again and then sent for sequencing, compared with the wild type to determine the mutation of each allele.

It should be noted that at last: above each embodiment is only in order to illustrate technical scheme of the present invention, and is not intended to limit; Although the present invention has been described in detail with reference to foregoing each embodiment, those of ordinary skill in the art should understand that: It is still possible to modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements for some or all of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the technical solutions of the various embodiments of the present invention. range.

SEQUENCE LISTING

<110> Chongqing Southwest Hospital

<120> Gene Knockout Vector, MH7A Cell NLRP1 Gene Knockout Method

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 20

<212>DNA

<213> Artificial sequence

<400> 1

tcgccaataa agcgcactcc 20

<210> 2

<211> 19

<212>DNA

<213> Artificial sequence

<400> 2

catggaggtg gcctcgtacc 19

<210> 3

<211> 20

<212>DNA

<213> Artificial sequence

<400> 3

taagagccaa ggcaaaggac 20

<210> 4

<211> 20

<212>DNA

<213> Artificial sequence

<400> 4

cagtgacctc agcccccatct 20

Claims (10)

1. A gene knockout carrier, characterized in that, the gene knockout carrier is that the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 is connected to an expressible CRISPR-Cas9 gene editing system related enzyme The plasmid is obtained. 2. The gene knockout vector according to claim 1, wherein the plasmid capable of expressing enzymes related to the CRISPR-Cas9 gene editing system is pGK1.1linear vector. 3. The construction method of the gene knockout vector described in claim 1 or 2, is characterized in that, comprises the following steps: 1), select the first exon of the common coding region of the five transcripts of the NLRP1 gene for CRISPR targeting sequence design, and obtain the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2; 2), design forward oligonucleotide sequence and reverse oligonucleotide sequence according to the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2; 3), annealing the forward oligonucleotide sequence and the reverse oligonucleotide sequence to form a double-stranded oligonucleotide; 4), connecting the double-stranded oligonucleotide into a linearized plasmid capable of expressing enzymes related to the CRISPR-Cas9 gene editing system to obtain a gene knockout vector. 4. A host cell containing the gene knockout vector according to claim 1 or 2. 5. The method for knocking out the NLRP1 gene in MH7A cells, comprising the following steps: a), transforming the gene knockout vector according to claim 2 into G10Competent Cell, and culturing it with a culture medium containing antibiotics corresponding to the gene knockout vector resistance; b) Use the universal primer VSP primer of pGK1.1linear vector as the upstream primer, and use the reverse oligonucleotide sequence designed by SEQ ID NO:1 or SEQ ID NO:2 as the downstream primer to screen positive clones and verify by sequencing; c), extracting the plasmids in the correct positive clones verified in step b) and transfecting MH7A cells to obtain cell pool cells; d), 24 hours after transfection, the cells of the cell pool were treated with puromycin; e) After 72 hours of transfection, the MH7A cells were diluted by limiting dilution to a 96-well plate to prepare monoclones, and the obtained monoclones were cultured; f), using the genomic DNA of the monoclonal as a template, and carrying out PCR amplification with the nucleotide sequence shown in SEQ ID NO:3 or SEQ ID NO:4 as primers; g) Use Cruiser ^TM to perform enzyme digestion on the amplified product to screen positive clones and verify them by sequencing. 6. The method for knocking out the NLRP1 gene of MH7A cells according to claim 5, wherein in step c), the concentration of the plasmid is 1 μg/μl˜3 μg/μl, and the concentration of the MH7A cells is 2× 10 ⁶ ～3×10 ⁶ cells/mL. 7. The method for knocking out the NLRP1 gene of MH7A cells according to claim 6, characterized in that, in step c), the transfection is electroporation; The electroporation conditions are: electroporation voltage 1000V-1100V, electroporation time 28ms-32ms, electroporation once. 8. The MH7A cell NLRP1 gene knockout method according to claim 5, characterized in that, in step d), when the cells in the cell pool are treated with puromycin, the concentration of puromycin used is 0.45 μg/mL～0.55μg/mL. 9. The method for knocking out the NLRP1 gene of MH7A cells according to any one of claims 5 to 8, characterized in that, after step g), further comprising the following steps: For the positive clones verified to be correct in step g), the positive clones with different mutations of the two alleles were re-do TA cloning and sent for sequencing, and compared with the wild type to determine the mutation of each allele. 10. The NLRP1 gene-knocked MH7A cells prepared by the method for knocking out the NLRP1 gene of MH7A cells according to any one of claims 5-9.