WO2019086007A1

WO2019086007A1 - Sgrna for targeting and guiding cas9 protein to efficiently cleave tcr and b2m gene loci

Info

Publication number: WO2019086007A1
Application number: PCT/CN2018/113800
Authority: WO
Inventors: 杜冰; 刘明耀; 谭炳合; 李伟; 张楫钦; 邵艳姣; 陈曦; 席在喜
Original assignee: 上海邦耀生物科技有限公司
Priority date: 2017-11-02
Filing date: 2018-11-02
Publication date: 2019-05-09
Also published as: CN109750035B; CN109750035A

Abstract

Provided are an sgRNA for targeting and guiding a Cas9 protein to cleave TCR and/or B2M gene loci to knock out the TCR and/or B2M genes, and a reagent for preparing universal CAR-T cells, which reagent contains the sgRNA or an expression vector for expressing the sgRNA. Also provided are universal CAR-T cells engineered with the sgRNA.

Description

Targeting and directing Cas9 protein to efficiently cleave sgRNA at TCR and B2M loci

Technical field

The present invention relates to the field of biotechnology, and in particular to a nucleotide sequence having a nuclease-directing function.

Background technique

Chimeric Antigen Receptor T-Cell (CAR-T) is one of the more effective treatments for malignant tumors. The basic principle of this technique is to extract T cells from patients and culture them in vitro. In the process of culturing, the patient's own T cells express specific tumor antigen receptors by genetic engineering. After identifying tumor-associated antigens or tumor-specific antigens, T cells can be efficiently activated and proliferated, releasing anti-tumor. Active molecules, thus exerting a powerful tumor killing effect. After the engineered T cells multiply in vitro, CAR-T is injected back into the patient, and the cancer cells expressing the specific antigen are attacked. CAR-T therapy has achieved great success in the treatment of hematoma and is a new and powerful means of combating cancer. The core of CAR-T therapy is the chimeric antigen receptor, which is a CAR molecule. CAR molecules generally consist of extracellular tumor recognition regions, junction regions, transmembrane regions, and intracellular T cell activation domains, which serve as antigen recognition. The extracellular recognition region is often developed by the single-chain antibody variable region SCFv, which recognizes and binds to a specific antigen, and the intracellular activation domain is mainly composed of a costimulatory molecule-CD3ζ molecule. CAR molecule recognition antigen is not dependent. The leukocyte antigen HLA molecule has a clear advantage over endogenous TCR molecules in tumor-associated antigen recognition.

T cell receptor-mediated somatic activation, ie T cell receptor (TCR) on the surface of T cell membrane, is responsible for recognition by the major histocompatibility complex (MHC, human called leukocyte antigen, ie HLA) The antigen presented by the molecule, unlike the B cell receptor, does not recognize the free antigen, but recognizes the antigenic peptide fragment presented by the MHC molecule. Typically, a T cell receptor is a heterodimer composed of two distinct subunits. The specific binding of T cell receptors to the polypeptides presented by MHC triggers a series of biochemical reactions and activates T cells through numerous co-receptors, enzymes and transcription factors to promote their division and differentiation. During allogeneic transplantation, lymphocytes in the graft recognize the antigen of the recipient cell, develop an immune response, attack the recipient cell, and produce graft versus host disease (GVHD).

Human leucocyte antigen (HLA), an organism often repels xenografts or allografts, and the antigen encoded by the donor's gene encodes an antigen, which is recognized by the recipient's immune cells. Causes rejection, this type of antigen is mainly human leukocyte antigen, HLA antigen. Allotransplantation refers to the way in which an organ, tissue or cell derived from an individual is transplanted to another homologous but not the same individual, in such a way as to replace the function. Allogeneic transplantation is often at risk of transplant rejection and graft versus host disease (GvHD). In the present technology, it relates to transplanting a healthy individual-derived CAR-T cell into a cancer patient to exert an anti-tumor effect, and belongs to the category of allogeneic transplantation.

CRISPR/Cas9 gene editing technology, CRISPR (Clustered regular interspaced short palindromic repeats), which is called regular clustering interval short palindrome repetition, is a rapidly developing gene editing tool in recent years. It was originally discovered that bacteria are used to protect themselves against viral infections. The acquired immune system response phenomenon is a genetic weapon against the attacker. Later, the researchers found that it can be transformed and developed into an accurate and efficient gene editing tool that can mediate deletion, insertion, mutation, and even activation or inhibition of target genes. It is a widely used gene. Editing tools.

Healthy individual-derived T cells were cultured in vitro and expressed to express CAR molecules, followed by knockdown of TCR and B2M molecules in CAR-T cells using CRISPR/Cas9 gene editing technology to reduce graft-versus-host disease and immunity. The risk of rejection is to be made into a universal CAR-T, and finally the transformed CAR-T cells are returned to cancer patients for anticancer effects. However, the following problems still exist: 1. The existing guide sgRNA sequence still has a certain off-target risk; 2. The existing guide sgRNA sequence mediated the target gene sequence is inefficient; 3. The multi-gene knockout efficiency is low, the sequence is They will interfere with each other.

Therefore, there is a need in the art for sgRNAs that are highly efficient in gene cleavage, do not interfere with each other, are not easily off target, and are stable.

Summary of the invention

It is an object of the present invention to provide an sgRNA which has high gene cleavage efficiency, does not interfere with each other, is not easily off target, and is stable.

Another object of the present invention is to provide an agent for preparing universal CAR-T cells capable of knocking out TCR and B2M genes efficiently, specifically, stably, not easily off target, and without interfering with each other.

In a first aspect of the invention, there is provided an agent for the preparation of a universal CAR-T cell, the reagent comprising:

(i) an sgRNA targeting TCR and/or B2M or an expression vector for expressing the sgRNA, the sgRNA being one or more nucleotide sequences selected from the group consisting of:

(A) sgRNA targeting the alpha chain of the TCR:

TRAC-sgRNA0, TRAC-sgRNA5, TRAC-sgRNA6, TRAC-sgRNA7, TRAC-sgRNA8, TRAC-sgRNA9, TRAC-sgRNA10, TRAC-sgRNA11, TRAC-sgRNA12, TRAC-sgRNA13, TRAC-sgRNA14, TRAC-sgRNA15, TRAC- sgRNA16, TRAC-sgRNA17, TRAC-sgRNA18, TRAC-sgRNA19, TRAC-sgRNA20;

Preferably, TRAC-sgRNA5, TRAC-sgRNA6, TRAC-sgRNA7, TRAC-sgRNA8, TRAC-sgRNA9, TRAC-sgRNA10, TRAC-sgRNA12, TRAC-sgRNA13, TRAC-sgRNA14, TRAC-sgRNA15, TRAC-sgRNA16, TRAC- sgRNA17, TRAC-sgRNA20;

(B1) sgRNA targeting the β1 chain of TCR:

TRBC1-sgRNA1, TRBC1-sgRNA2, TRBC1-sgRNA3, TRBC1-sgRNA4, TRBC1-sgRNA5, TRBC1-sgRNA6, TRBC1-sgRNA7, TRBC1-sgRNA8, TRBC1-sgRNA9, TRBC1-sgRNA10, TRBC1-sgRNA11, TRBC1-sgRNA12, TRBC1- sgRNA13, TRBC1-sgRNA14, TRBC1-sgRNA15;

Preferably, TRBC1-sgRNA3, TRBC1-sgRNA4, TRBC1-sgRNA5, TRBC1-sgRNA6, TRBC1-sgRNA7, TRBC1-sgRNA8, TRBC1-sgRNA9, TRBC1-sgRNA11, TRBC1-sgRNA12, TRBC1-sgRNA13, TRBC1-sgRNA14, TRBC1- sgRNA15;

(B2) sgRNA targeting the β2 chain of TCR:

TRBC2-sgRNA1, TRBC2-sgRNA2, TRBC2-sgRNA3, TRBC2-sgRNA4, TRBC2-sgRNA5, TRBC2-sgRNA6, TRBC2-sgRNA7, TRBC2-sgRNA8, TRBC2-sgRNA9, TRBC2-sgRNA10, TRBC2-sgRNA11, TRBC2-sgRNA12, TRBC2- sgRNA13, TRBC2-sgRNA14, TRBC2-sgRNA15;

Preferably, TRBC2-sgRNA1, TRBC2-sgRNA3, TRBC2-sgRNA4, TRBC2-sgRNA5, TRBC2-sgRNA6, TRBC2-sgRNA8, TRBC2-sgRNA9, TRBC2-sgRNA10, TRBC2-sgRNA12, TRBC2-sgRNA13;

(C) sgRNA targeting B2M:

B2M-sgRNA1, B2M-sgRNA2, B2M-sgRNA3, B2M-sgRNA4, B2M-sgRNA5, B2M-sgRNA6, B2M-sgRNA7, B2M-sgRNA8, B2M-sgRNA9, B2M-sgRNA10, B2M-sgRNA11, B2M-sgRNA12, B2M- sgRNA13, B2M-sgRNA14, B2M-sgRNA15, B2M-sgRNA16, B2M-sgRNA17, B2M-sgRNA18, B2M-sgRNA19, B2M-sgRNA20;

Preferably, B2M-sgRNA1, B2M-sgRNA2, B2M-sgRNA3, B2M-sgRNA4, B2M-sgRNA5, B2M-sgRNA6, B2M-sgRNA7, B2M-sgRNA13, B2M-sgRNA17, B2M-sgRNA20;

And optionally (ii) an expression cassette that expresses a Cas9 protein or expresses a Cas9 protein.

In another preferred embodiment, the sgRNA that targets the alpha chain of the TCR comprises 1, 2, 3, 4 or 5 sgRNAs.

In another preferred embodiment, the sgRNA of the β1 chain that targets the TCR comprises 1, 2, 3, 4 or 5 sgRNAs.

In another preferred embodiment, the sgRNA that targets the β2 chain of the TCR comprises 1, 2, 3, 4 or 5 sgRNAs.

In another preferred embodiment, the B2M-targeting sgRNA comprises 1, 2, 3, 4 or 5 sgRNAs.

In another preferred embodiment, the sgRNA comprises an sgRNA that targets a TCR and/or a sgRNA that targets B2M.

In another preferred embodiment, the TCR-targeting sgRNA comprises an sgRNA that targets an alpha chain and/or a beta chain that targets a TCR.

In another preferred embodiment, the sgRNA that targets the β chain of the TCR comprises an sgRNA that targets a β1 chain and/or a β2 chain that targets the TCR.

In another preferred embodiment, the sgRNA that targets the alpha chain of the TCR comprises at least one selected from the group consisting of TRAC-sgRNA5, TRAC-sgRNA6, TRAC-sgRNA17, or TRAC-sgRNA20.

In another preferred embodiment, the sgRNA targeting the β1 chain of the TCR comprises at least one selected from the group consisting of TRBC1-sgRNA4, TRBC1-sgRNA11, TRBC1-sgRNA13, TRBC1-sgRNA14, or TRBC1-sgRNA15.

In another preferred embodiment, the sgRNA targeting the β2 chain of the TCR comprises at least one selected from the group consisting of TRBC2-sgRNA1, TRBC3-sgRNA3, TRBC2-sgRNA6, or TRBC2-sgRNA10.

In another preferred embodiment, the B2M-targeting sgRNA comprises at least one selected from the group consisting of B2M-sgRNA2, B2M-sgRNA3, B2M-sgRNA4, B2M-sgRNA5, or B2M-sgRNA6.

In another preferred embodiment, the TCR-targeting sgRNA comprises an sgRNA comprising a recognition region sequence selected from the group consisting of the nucleotide sequences set forth in any one of SEQ ID NO.: 1-47.

In another preferred embodiment, the B2M-targeting sgRNA comprises an sgRNA comprising a recognition region sequence selected from the group consisting of the nucleotide sequences set forth in any one of SEQ ID NO.: 48-67.

In another preferred embodiment, each sgRNA comprises a nucleotide comprising its corresponding recognition region sequence. For example, TRAC-sgRNA0 comprises a nucleotide comprising the sequence set forth in SEQ ID NO.: 1.

In another preferred embodiment, the sequence of each sgRNA comprises each sgRNA recognition region sequence and a corresponding full length sgRNA sequence. For example, TRAC-sgRNA0 comprises the sequence set forth in SEQ ID NO.: 1 and the corresponding full length sgRNA sequence (SEQ ID NO.: 1 + SEQ ID NO.: 68).

In another preferred embodiment, the sequence of each sgRNA is a sgRNA recognition region sequence or a corresponding full length sgRNA sequence.

In another preferred embodiment, the sequence of each sgRNA comprises a sequence selected from the group consisting of: (1) a sgRNA recognition region sequence; or (2) a corresponding full-length sgRNA sequence.

In another preferred embodiment, the full-length sgRNA sequence contains the sgRNA recognition region sequence and the sgRNA framework sequence in sequence from the 5' end to the 3' end.

In another preferred embodiment, the framework sequence is set forth in SEQ ID NO.:68.

In another preferred embodiment, the sequence of each sgRNA is as shown in Table 1.

In another preferred embodiment, the sgRNA recognition region sequence is a nucleotide sequence selected from any one of SEQ ID NO.: 1-67.

In another preferred embodiment, the recognition region sequence of the TCR-targeting sgRNA is a nucleotide sequence selected from any one of SEQ ID NO.: 1-47.

In another preferred embodiment, the recognition region sequence of the B2M-targeting sgRNA is a nucleotide sequence selected from any one of SEQ ID NO.: 48-67.

In another preferred embodiment, the TCR-targeting sgRNA or B2M-targeting sgRNA further comprises an additional sequence (ie, a framework sequence) linked to the recognition region sequence and located at the 3' end.

In another preferred embodiment, the TCR-targeting sgRNA or B2M-targeting sgRNA further comprises an additional sequence at the 3' end of the recognition region sequence.

In another preferred embodiment, the additional sequence is set forth in SEQ ID NO.:68.

In another preferred embodiment, each sgRNA that targets the TCR and/or B2M gene is modified with or without a chemical group.

In another preferred embodiment, the TCR or B2M gene is derived from a mammal, preferably from a mouse, rat, or human.

In a second aspect of the invention, a kit is provided, the kit comprising:

(1) a first container and a first expression vector located in the first container, the first expression vector comprising a first expression cassette, the first expression cassette for expressing the TCR-targeting sgRNA; /or

(2) a second container and a second expression vector in the second container, the second expression vector comprising a second expression cassette for expressing the B2M-targeting sgRNA; Optional

(3) a third container and a third expression vector in the third container, the third expression vector comprising a third expression cassette for expressing an expression cassette of the Cas9 protein.

In another preferred embodiment, any two or three of the first, second and third containers are the same container.

In another preferred embodiment, the first, second and third expression vectors are independent or linked.

In another preferred embodiment, the first, second and third expression vectors are located in the same or different containers.

In another preferred embodiment, the first, second and third expression cassettes are located on the same or different carriers.

In another preferred embodiment, the first, second and third expression cassettes are located on the same carrier.

In another preferred embodiment, the vector is selected from the group consisting of DNA, RNA, plasmid, lentiviral vector, adenoviral vector, retroviral vector, transposon, other gene transfer systems, or a combination thereof.

In another preferred embodiment, the expression vector is a vector obtained by inserting the sgRNA into a PX458 vector.

In a third aspect of the invention, a method of preparing a universal CAR-T cell, the method comprising:

(1) providing a CAR-T cell to be engineered;

(2) engineering the CAR-T cells with the reagent of the first aspect of the invention to obtain universal CAR-T cells;

The optional (3) validated CAR-T cells are universal CAR-T cells.

In another preferred embodiment, the CAR-T cells to be engineered are derived from human and non-human mammals.

According to a fourth aspect of the present invention, a general-purpose CAR-T cell comprising the reagent according to the first aspect of the present invention, the kit of the second aspect of the present invention or the present invention is provided CAR-T cells prepared by the method described in the third aspect.

In another preferred embodiment, the universal CAR-T cell is a CAR-T cell that does not express or underexpress the TCR or B2M gene.

In another preferred embodiment, the "low expression" refers to the ratio of the expression level G1 of the TCR or B2M gene of the CAR-T cell to the expression level G0 of the TCR or B2M gene of the normal CAR-T cell, that is, G1/G0 ≤ 0.5, preferably G1/G0 ≤ 0.3, more preferably ≤ 0.2, more preferably ≤ 0.1, most preferably 0.

According to a fifth aspect of the invention, there is provided a cell preparation comprising the universal type CAR-T cell of the fourth aspect of the invention.

In another preferred embodiment, the cell preparation is a liquid preparation.

In another preferred embodiment, the dosage form of the cell preparation includes an injection.

In another preferred embodiment, the concentration of the CAR-T cells in the preparation is 1 × 10 ⁴ - 1 × 10 ¹⁰ cells / ml, preferably 1 × 10 ⁵ - 1 × 10 ⁹ cells / ml. .

In a sixth aspect of the invention, there is provided use of the agent of the first aspect of the invention for (a) knocking out a TCR and/or B2M gene; and/or (b) preparing a universal CAR-T cell.

In a seventh aspect of the invention, there is provided an sgRNA selected from the group consisting of:

(1) a sgRNA targeting a TCR, the recognition region sequence of the sgRNA being a nucleotide sequence selected from any one of SEQ ID NO.: 1-47; and/or

(2) A sgRNA targeting B2M, the recognition region sequence of the sgRNA being a nucleotide sequence selected from any one of SEQ ID NO.: 48-67.

In another preferred embodiment, the TCR-targeting sgRNA or B2M-targeting sgRNA further comprises an additional sequence linked to the recognition region sequence and located at the 3' end.

In an eighth aspect of the invention, a vector comprising the sgRNA of the seventh aspect of the invention is provided.

In a ninth aspect of the invention, there is provided a gene editing system comprising the sgRNA of the seventh aspect of the invention.

In another preferred embodiment, the gene editing system is a CRISPR/Cas system, preferably a CRISPR/Cas9 system.

In another preferred embodiment, gene inactivation editing is performed using the CRISPR/Cas9 system, and the obtained gene inactivation rate is ≥70%, preferably ≥80%, more preferably ≥90%.

It is to be understood that within the scope of the present invention, the various technical features of the present invention and the various technical features specifically described hereinafter (as in the embodiments) may be combined with each other to constitute a new or preferred technical solution. Due to space limitations, we will not repeat them here.

DRAWINGS

Figure 1 shows the results of sgRNA-mediated genomic sequence cleavage of fluorescent signals targeting a TRAC site. Among them, TRAC-sgRNA# is represented by sgRNA#, for example, TRAC-sgRNA0 is represented by sgRNA0.

Figure 2 shows the sgRNA-mediated genomic sequence cleavage fluorescence signal statistics for targeting B2M sites. Among them, B2M-sgRNA# is represented by sgB2M-#, for example, B2M-sgRNA1 is represented by sgB2M-1.

Figure 3 shows the results of sgRNA-mediated genomic sequence cleavage of fluorescent signals targeting the TRBC1 site. Among them, TRBC1-sgRNA# is represented by sgA#, for example, TRBC1-sgRNA1 is represented by sgA1.

Figure 4 shows the results of sgRNA-mediated genomic sequence cleavage of fluorescent signals targeting the TRBC2 site. Among them, TRBC2-sgRNA# is represented by sgA#, for example, TRBC2-sgRNA1 is represented by sgA1.

Figure 5 shows that sgRNA targeting TRAC, TRBC1, and TRBC2 is incubated with Cas9 protein and then electroporated into human peripheral blood cells. Simultaneously, B5M-targeted sgRNA is incubated with Cas9 protein and then electroporated into human peripheral blood cells. Flow cytometry The expression of TCR and B2M molecules in the transfected cells was analyzed.

Detailed ways

The inventors have extensively and extensively studied and screened a large number of sgRNAs targeting the α chain, β1 chain, β2 chain and B2M gene locus of TCR, and unexpectedly found a reagent for preparing universal CAR-T cells. An sgRNA that targets TCR and/or B2M or an expression vector for expression of the sgRNA. The sgRNA of the present invention can efficiently and specifically, stably, not easily off target, and knock out the TCR and B2M genes without interfering with each other, thereby greatly improving the efficiency of gene knockout. Furthermore, the universal CAR-T cells engineered with the sgRNA of the present invention are effective in reducing the risk of graft versus host disease and immune rejection. The present invention has been completed on this basis.

the term

All technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs, unless otherwise defined. All publications and other references mentioned herein are incorporated by reference.

As used herein, "containing", "having" or "including" includes "including", "consisting essentially of", "consisting essentially of", and "consisting of."

Chimeric antigen receptor T cell technology

T cell receptor (TCR)

The T cell membrane surface expresses a T cell receptor and is responsible for recognizing an antigen presented by a major histocompatibility complex (MHC, a human leukocyte antigen, ie, an HLA molecule).

The T cell receptor (TCR) is a glycoprotein on the surface of a cell membrane in the form of a heterodimer from an alpha chain/beta chain or a gamma chain/delta chain. The composition of the TCR profile of the immune system is produced by V(D)J recombination in the thymus and then positive and negative selection. In the peripheral environment, TCR mediates the specific recognition of major histocompatibility complex-peptide complex (pMHC) by T cells, and thus it is critical for the cellular immune function of the immune system.

The International Immunogenetics Information System (IMGT) can be used to describe TCR. The native alpha beta heterodimeric TCR has an alpha chain and a beta chain. Broadly speaking, each strand comprises a variable region, a junction region, and a constant region, and the beta strand typically also contains a short polymorphic region between the variable region and the junction region, but the polymorphic region is often considered part of the junction region. The TCR junction region was determined by the unique IMGT TRAJ and TRBJ, and the constant region of the TCR was determined by the TACT and TRBC of IMGT.

Unlike B cell receptors, TCR does not recognize free antigens, but rather recognizes antigenic peptide fragments presented by MHC molecules. Typically, a T cell receptor is a heterodimer composed of two distinct subunits. The specific binding of T cell receptors to the polypeptides presented by MHC triggers a series of biochemical reactions and activates T cells through numerous co-receptors, enzymes and transcription factors to promote their division and differentiation. During allogeneic transplantation, lymphocytes in the graft recognize the antigen of the recipient cell, develop an immune response, attack the recipient cell, and produce graft versus host disease (GVHD).

B2M

22 microglobulin (B2M) is a beta light chain of human leukocyte antigen class I molecule (HLA-I). Its main function is to participate in the recognition of lymphocytes and target cell surface antigens, so B2M is closely related to histocompatibility. Almost all nucleated cells in the body can synthesize β2 microglobulin and attach to the cell surface. Deletion of β2 microglobulin leads to an abnormal polymerization of HLA-I molecules, which cannot form intact functional molecules. The present invention utilizes this property to knock out B2M molecules in CAR T cells by gene editing technology, thereby failing to express normal HLA class I molecules, thereby reducing the graft rejection effect of CAR T cells.

CRISPR/Cas Gene Editing Technology

The "CRISPR/Cas technology", "CRISPR/Cas genome editing", "CRISPR/Cas genome editing technology", and "CRISPR/Cas genome editing method" generally refer to the use of the CRISPR/Cas system for the target DNA sequence. Modified technology. "CRISPR/Cas technology" may also include methods for regulating gene expression using similar principles, such as CRISPR/dCas9-based gene expression regulation techniques.

CRISPR (Clustered regular interspaced short palindromic repeats), which is called regular clustering interval and short palindrome repetition, is a rapidly developing gene editing tool in recent years. It was originally discovered to be a bacterial immune system to protect against acquired viral immune system response. Is a genetic weapon against the attacker. Later, the researchers found that it can be transformed and developed into an accurate and efficient gene editing tool that can mediate deletion, insertion, mutation, and even activation or inhibition of target genes, including humans and mice. The genes in zebrafish, bacteria, fruit flies, yeast, nematodes and crop cells mean that CRISPR/Cas9 is a widely used gene editing tool. Currently, the CRISPR-Cas9 system from Streptococcus pyogenes is the most widely used. The nuclease Cas9 protein in this system contains two nuclease domains that can cleave two single strands of DNA, respectively. The CRISPR/Cas9 system works by first combining Cas9 with crRNA and tracrRNA to form a complex, and then binding the specific DNA sequence through the PAM sequence to form an RNA-DNA complex structure, thereby cleavage of the target DNA duplex and breaking the DNA double strand. The organism then repairs the double-strand breaks that occur by initiating non-homologous end-links or homologous recombination mechanisms, which in turn mediates the deletion, insertion, etc. of the nucleotide sequence.

SgRNA of the invention

As used herein, "sgRNA", "guide RNA" or "invention sgRNA" are used interchangeably and each refers to an sgRNA that targets a TCR and/or B2M gene selected from one or more of the following groups. Glycosidic acid sequence:

(A) sgRNA targeting the alpha chain of the TCR:

(B1) sgRNA targeting the β1 chain of TCR:

(B2) sgRNA targeting the β2 chain of TCR:

(C) sgRNA targeting B2M.

In another preferred embodiment, each of the sgRNAs is as described in the first aspect of the invention.

Table 1

Note: Each full-length sgRNA sequence is equal to the sequence of the recognition region of the corresponding sgRNA + the sequence shown in SEQ ID NO.: 68 (from the 5' end to the 3' end), ie the full length sgRNA sequence from the 5' end to the 3' end The end is composed of the recognition region sequence of the corresponding sgRNA and the sgRNA framework sequence as shown in SEQ ID NO.:68.

In the present invention, a method of designing sgRNA is provided. Typically, the method of synthesizing and screening sgRNAs comprises the steps of:

1 sgRNA design

The oligo of each sgRNA is designed and synthesized, annealed, and ligated to a suitable vector (such as a commercially available vector such as PX458 vector).

2 Target screening

2.1 Luciferase Reporting System

1. Aspirate 50 ul of supernatant from 96-well plates transfected for 48 h after plasmid transfection into opaque 96-well plates for detection of luciferase expression.

2. Quickly add 50 ul of the reaction solution to each well of the 96-well plate of the supernatant, and immediately place it in a luminescence detector for detection.

3. The target with the highest expression of luciferase is obtained statistically as a high-efficiency target.

2.2 T7E1 digestion

1. Design a PCR product for the target sequence, obtain a DNA fragment near the target site by PCR, and the PCR product is purified by a common DNA kit.

2. T7E1 digestion analysis: After purification, the PCR product is subjected to one-step annealing treatment, and the annealing procedure is as follows

The annealed product was subjected to T7E1 digestion and incubated at 37 ° C for 1 hour.

3. Polyacrylamide gel electrophoresis

The DNA samples were sequentially added to the polyacrylamide gel, and 1 x TBE solution was added to the electrophoresis tank, and the constant pressure was 100 V to Loading to the bottom of the polyacrylamide gel. The gel was taken out and immersed in a TBE solution containing EB (EB content 5 μL/100 mL) for 10 minutes. Ten minutes later, the polyacrylamide gel was taken out and photographed under ultraviolet light.

4. Gray-scale analysis or TA cloning calculates the cutting efficiency of different targets, and selects the highest target of cutting efficiency (such as the first three) as a high-efficiency target.

Cas9 protein

Those skilled in the art know that the core of CRISPR/Cas is Cas protein and sgRNA. Based on the teachings of the present invention, those skilled in the art will appreciate that the sgRNA expression cassettes of the present invention can be used in conjunction with various Cas proteins for use in a variety of CRISPR/Cas systems, such as CRISPR/Cas9 systems, CRISPR/nCas9 systems, CRISPR/ dCas9 system.

The Cas9 protein is a multifunctional protein whose protein structure includes a recognition region composed of an α-helix (REC), a nuclease region composed of an HNH domain and a RuvC domain, and a PAM binding region at the C-terminus. These two important nuclease domains, RuvC and HNH, cleave the DNA complementary strand and the non-complementary strand of gRNA, respectively, resulting in blunt-ended DNA double-strand breaks. When the D10A in the RuvC domain is mutated, it can cause the inactivation of the RuvC domain. When the H840A in the HNH domain is mutated, it can lead to the inactivation of the HNH domain. A single-point mutant can make Cas9 a nickase, abbreviated as nCas9, which can form a single-stranded DNA break. The recognition of Cas9 and target DNA is dependent on the tracrRNA:crRNA complex as well as the PAM sequence located downstream of the target site.

sgRNA-mediated CRISPR/Cas system of the invention

Based on the sgRNA of the present invention, the present invention provides a gene editing system comprising the sgRNA, preferably a CRISPR/Cas system.

Those skilled in the art will recognize that the CRISPR/Cas system can be used in a variety of fields including, but not limited to, genome editing, gene expression regulation, and genetic engineering. In a specific embodiment, the CRISPR/Cas system of the invention is used for genome editing and gene expression regulation.

In a specific embodiment, the CRISPR/Cas system includes, but is not limited to, a CRISPR/Cas9 system, a CRISPR/nCas9 system, or a CRISPR/dCas9 system; preferably, the CRISPR/Cas system is a CRISPR/Cas9 system.

As described above, the core of the CRISPR/Cas system of the present invention is the Cas9 protein and sgRNA, both of which may be in the same expression vector or in different expression vectors. However, since the sgRNA and Cas9 proteins reduce the process of subcloning the sgRNA expression cassette into the Cas9 plasmid in different expression vectors, making the operation simpler, in a preferred embodiment, the expression cassette of sgRNA and the expression plasmid of Cas9 Total conversion.

Based on the technical content of the present invention and the common knowledge in the art, those skilled in the art are aware of various technical points regarding the expression of Cas9, the selection of targeting sequences, and the DNA transformation system, for example, those skilled in the art can refer to Nodvig et al. (Nodvig et Al., 2015) performed expression of Cas9 and performed DNA transformation.

As used herein, the term "gene inactivation" refers to the joining of non-homologous ends in eukaryotes after Cas9 is subjected to double-stranded cleavage of a specific site under the guidance of sgRNA, without the involvement of donor DNA. The system introduces DNA sequence insertion or base deletion, etc., which causes a gene to lose its biological function; and the term "genetic precision editing" refers to precise and predictable genetic manipulation at a specific DNA site, such as a target DNA fragment. Knockouts, insertions, substitutions, point mutations, and the like, involve donor DNA and homologous recombination mechanisms. Therefore, those skilled in the art know that the accuracy of gene editing is much more difficult than gene inactivation. Furthermore, it is known to those skilled in the art that the length of donor DNA fragment donor DNA also has a large impact on the efficiency of genome editing. Increase in the length of the donor DNA homologous arm of the donor DNA fragment can increase the efficiency of DNA homologous recombination and improve the efficiency of DNA editing. However, the efficiency of homologous recombination in most eukaryotic wild strains is very low, sometimes only a few percent efficiency. Mainly non-homologous end joining systems play a role. For donor DNA fragments of donor DNA fragments with short homology arms, the genome editing efficiency is lower.

However, the sgRNA-mediated genome editing system of the present invention has excellent genome editing ability compared to the prior art. In a specific embodiment, the gene inactivation rate obtained using the genome editing system of the present invention is higher than 95%, more preferably 100%.

In the present invention, "homologous arm" has the same meaning as commonly understood by those skilled in the art, and refers to a flanking sequence on the donor DNA which is located on both sides of the target sequence and which is completely identical to the genomic sequence for recognizing and recombining. region. Thus, in view of the teachings of the present invention, one skilled in the art can select and determine the length of the homology arm by itself. At the same time, those skilled in the art are also aware that genome editing efficiency obtained with long homology arms is generally higher than with short homology arms. Compared with the prior art, the significant advantage of the present invention is that the precise editing of the gene can be performed, and in particular, the efficiency of precise editing of the gene using the donor DNA of the short homology arm is significantly improved.

In a preferred embodiment, the CRISPR/Cas9 system can perform gene precision editing using a donor DNA of a 15-3000 bp homology arm; in a further preferred embodiment, the CRISPR/Cas9 system can utilize the same 20-200 bp system. The donor DNA of the source arm is genetically edited. For example, the homology arm of the donor DNA can be less than 100 bp, even less than 40 bp, or even less than 20 bp, while the CRISPR/Cas9 system utilizes a short homology arm. The efficiency of genome editing for genome editing can reach more than 60%, even more than 75%, and even more than 95%.

In a preferred embodiment, the genome editing system of the invention is particularly useful for genome editing in CAR-T cells. In another preferred embodiment, the genome editing system of the invention is used to knock out TCR and/or B2M genes in CAR-T cells.

Universal CAR-T cell

As used herein, "universal CAR-T cells", "CAR-T cells of the invention", or "general-type CAR-T cells of the invention" all refer to CAR-T cells that do not express or underexpress the TCR or B2M genes. The universal CAR-T cells can effectively reduce the risk of graft-versus-host disease and immune rejection, thereby improving the therapeutic effect of CAR-T cells.

The main advantages of the invention include:

(a) The reagent for preparing universal CAR-T cells provided by the present invention is stable, not easy to off target, and knocks out TCR and B2M genes without mutual interference, and has good specificity, high cutting efficiency, and greatly improved gene knocking. In addition to efficiency.

(b) The universal CAR-T cells provided by the present invention can effectively reduce the risk of graft-versus-host disease and immune rejection, thereby improving the therapeutic effect of CAR-T cells.

The invention is further illustrated below in conjunction with specific embodiments. It is to be understood that the examples are not intended to limit the scope of the invention. Experimental methods in which the specific conditions are not indicated in the following examples are generally carried out according to the conditions described in conventional conditions, for example, Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturing conditions. The conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are by weight and parts by weight.

Unless otherwise defined, all professional and scientific terms used herein have the same meaning as those skilled in the art. In addition, any methods and materials similar or equivalent to those described can be applied to the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.

Example 1 sgRNA screening design

1 sgRNA design

The recognition region sequence and full length sequence of each sgRNA sequence are shown in Table 1. The corresponding target sequence of the recognition region sequence of each sgRNA sequence is replaced by "U" in the sequence of the recognition region, respectively.

The oligo corresponding to the corresponding sgRNA was synthesized, annealed, and then ligated into the PX458 vector.

A partial representative oligo sequence is shown below, and oligo corresponding to each of the other sgRNAs can be prepared in the same manner.

Oligo for TRBC1-sgRNA1:

TRBC1-sgRNA1-oligo-F: CACCGAGCTCAGCTCCACGTGGTC (SEQ ID NO.: 70)

TRBC1-sgRNA1-oligo-R: AAACGACCACGTGGAGCTGAGCTC (SEQ ID NO.: 71)

Oligo for template PCR cloning:

TRBC1-luci-Donor-F: ATCCTGGCTCCAACCCCTCTTC (SEQ ID NO.: 72)

TRBC1-luci-Donor-R: ATCTGTCTGCTACCTGGATCTTTC (SEQ ID NO.: 73)

2 Target screening

2.1 Luciferase Reporting System

2.2 T7E1 digestion

3. Polyacrylamide gel electrophoresis

1) The DNA sample was sequentially added to the polyacrylamide gel, and 1x TBE solution was added to the electrophoresis tank, and the constant pressure was 100 V to Loading to the bottom of the polyacrylamide gel.

2) The gel was taken out and immersed in a TBE solution containing EB (EB content: 5 μL/100 mL) for 10 minutes. Ten minutes later, the polyacrylamide gel was taken out and photographed under ultraviolet light.

4. Gray scale analysis or TA clone to calculate the cutting efficiency of different targets, and select the first three targets with the highest cutting efficiency as the high efficiency target.

Example 2 Design of sgRNA T7-oligo fragment

The sgRNA targeting the α chain, β1 chain, β2 chain and B2M of TCR was designed to replace the following 18 Ns with the target sequence targeted by sgRNA.

After synthesis of sgRNA T7-oligo, according to the synthetic feedback information, dilute to 100 μM mother liquor with RNase free water, and then store in -20 ° C refrigerator for use.

Example 3 Preparation of sgRNA precursors by overlapping PCR

The kit is ToYoBo High FideliUUy DNA polymerase KOD-Plus-

The liquid primer is diluted ten times as a template, and the system is as follows:

Parameter setting: Cycle 28, extension temperature 68 ° C, 20 s, Tm 50 ° C.

Two replicate tubes were set for each target, and 5 ul of samples were taken after the end of PCR. The agarose gel electrophoresis was used to see the brightness of the strips.

Example 4 Purification of sgRNA precursor by phenol chloroform method

1. Two tubes were combined to make a total of 95 μl, and 105 μl of RNase free water was added to 200 ul.

2. Add 200 ul of phenol chloroform, vortex shake evenly, let stand for 3 min, centrifuge at 12000 rpm for 5 min;

3. Pipette the upper aqueous phase, add an equal volume of chloroform, vortex shake evenly, let stand for 3 min, centrifuge at 12000 rpm for 5 min;

4. Pipette the upper aqueous phase, add 1/10 volume of 3M NaAC (sodium acetate) and 2.5 volumes of absolute ethanol, mix, and let stand at -20 °C for 30-40min;

5. After the floc appears, centrifuge at 12000 rpm for 5 min at 4 ° C, discard the supernatant, and buckle dry.

6. Add 500ul of pre-cooled 75% (formed by DEPC water) ethanol to each tube, centrifuge at 12000rpm for 5min at 4°C, discard the supernatant, and dry.

7. RNase free water 11ul dissolved, 1ul concentration, then set at -20 °C low temperature storage.

(Note: DNA concentration is controlled at 1000-2000 ng/ul)

Example 5 Preparation of sgRNA by in vitro transcription (TaKaRa in vitro transcription T7 kit, #6140)

1. Prepare the following reaction solutions;

(Note: template DNA must be added last to prevent precipitation; full RNase free environment)

2. The above solution was uniformly mixed and then gently centrifuged, and the transcription reaction solution was collected at the bottom of the reaction tube and reacted at 42 ° C for 3 hours.

3. DNase treatment; after the transcription reaction, 3 μl of DNase I8 was added thereto and mixed. The reaction was carried out at 37 ° C for 30 minutes.

Example 6 Transcription of sgRNA

Phenol/chloroform extraction and isopropanol precipitation were carried out as follows.

When the volume of the reaction solution is less than 100 μl, RNase free H ₂ O (or DEPC water) is added to make up 100 μl.

1. Add an equal volume of phenol chloroform, stir with vorTex, and centrifuge at room temperature for 1 minute at 12,000 rpm for 5 minutes.

2. The upper layer (water layer) was transferred to a new Tube, an equal volume of chloroform was added, stirred at vortex, and centrifuged at 12,000 rpm for 5 minutes at room temperature.

3. The upper layer (water layer) was transferred to a new tube, and 1/10 volume of 3 M sodium acetate, an equal volume of isopropanol was added, and the mixture was well mixed.

4. After standing at room temperature for 5 minutes, let it stand at -20 ° C for 5 minutes, and centrifuge at room temperature for 1 minute at 55,000 rpm.

5. Remove the supernatant and wash the pellet with 80% DEPC water in ethanol.

6. After drying, add 20 μl of RNase free water to dissolve the pellet. The concentration is preferably about 2,000 ng/ul.

7. If necessary, store in small portions at -80 °C.

Example 7 Preparation of U-CART by Electrotransfer

Instruments and materials:

1Lonza 4D-Nucleofector ^TM System Nuclear Transfer

2 kit is P3Primary Cell 4D-Nucleofector ^TM X Kit, Lonza, V4XP-3024

3 prepared activated CAR-T cells

4 Commercialized Cas9 protein (placed on ice) (

SpCas9Nuclease 3NLS, IDT)

5 sgRNA of each target (placed on ice).

Specific procedures (applicable to 100μl size electric rotor):

1. According to 82μl Solution+18μl supplement/each electric rotor, according to the total number of electric revolutions, configure an electro-transfer mix, mix and let room temperature.

2. Incubate Cas9 protein and total sgRNA (according to Cas9: total sgRNA=20ug: 10ug is optimal), the incubation system is:

Cas9 (10ug/ul): 2μl

10×Cas9buffer: 1μl

Total sgRNA 10ug: xμl

RNase free water is added to 10μl

3. Count the cells before electroporation, and control the number of cells per electroconductor at 1-5×10 ⁶ .

4. Centrifuge at room temperature for 3 min at 13000 rpm/min, collect CART cells, wash twice with PBS (preheat), and gently resuspend the cells with the previously configured electromixer.

5. Add 100 ul to each EP tube and the blank control group for incubating Cas9 protein and total sgRNA. After blowing, transfer to the corresponding electric rotor. Be careful not to cause bubbles to affect the efficiency of electrotransfer.

6. Place the cell culture plate with the complete medium in the incubator for preheating before electroporation.

7. Turn on the electro-rotator, place the electric rotor into the slot, and select the corresponding program (Stimulated human T cell) to start the electrical rotation.

8. After the electroporation, the cells are quickly transferred to a cell culture plate and cultured in an incubator.

9. If necessary, after 24 h, the amount of Cas9 protein and total sgRNA was halved or 1/4 of the amount was subjected to secondary electroporation under the same conditions.

10. The above cells were placed in an incubator for amplification for about 10 days, the TCR/B2M knockout efficiency was detected by flow cytometry, and the single knock and double knock negative cells were enriched by magnetic bead negative selection.

The result is shown in Figure 1-5.

As can be seen from Figure 1, the knockout efficiency from high to low is: first group (TRAC-sgRNA5, TRAC-sgRNA6, TRAC-sgRNA17, TRAC-sgRNA20)> second group (TRAC-sgRNA7, TRAC-sgRNA8, TRAC-sgRNA9, TRAC-sgRNA10, TRAC-sgRNA12, TRAC-sgRNA13, TRAC-sgRNA14, TRAC-sgRNA15, TRAC-sgRNA16) > third group (TRAC-sgRNA0, TRAC-sgRNA11, TRAC-sgRNA18, TRAC-sgRNA19).

As can be seen from Figure 2, the knockout efficiency from high to low is: first group (B2M-sgRNA2, B2M-sgRNA3, B2M-sgRNA4, B2M-sgRNA5, B2M-sgRNA6)> second group (B2M-sgRNA1) B2M-sgRNA7, B2M-sgRNA13, B2M-sgRNA17, B2M-sgRNA20)>Group 3 (B2M-sgRNA8, B2M-sgRNA9, B2M-sgRNA10, B2M-sgRNA11, B2M-sgRNA12, B2M-sgRNA14, B2M-sgRNA15, B2M -sgRNA16, B2M-sgRNA18, B2M-sgRNA19).

As can be seen from Figure 3, the knockout efficiency from high to low is: the first group (TRBC1-sgRNA4, TRBC1-sgRNA11, TRBC1-sgRNA13, TRBC1-sgRNA14, TRBC1-sgRNA15)> the second group (TRBC1-sgRNA3, TRBC1-sgRNA5, TRBC1-sgRNA6, TRBC1-sgRNA7, TRBC1-sgRNA8, TRBC1-sgRNA9, TRBC1-sgRNA12)> third group (TRBC1-sgRNA1, TRBC1-sgRNA2, TRBC1-sgRNA10).

As can be seen from Figure 4, the knockout efficiency from high to low is: first group (TRBC2-sgRNA1, TRBC3-sgRNA3, TRBC2-sgRNA6, TRBC2-sgRNA10)> second group (TRBC2-sgRNA4, TRBC2-sgRNA5, TRBC2-sgRNA8, TRBC2-sgRNA9, TRBC2-sgRNA12, TRBC2-sgRNA13)> third group (TRBC2-sgRNA2, TRBC2-sgRNA7, TRBC2-sgRNA11, TRBC2-sgRNA14, TRBC2-sgRNA15).

In addition, the sgRNA of the present invention is used to transform, and the sgRNA targeting TRAC, TRBC1, and TRBC2 is incubated with the Cas9 protein, and then electroporated into human peripheral blood cells, and simultaneously incubated with the sgRNA targeting B2M and Cas9 protein, and then electrotransfected with humans. Peripheral blood cells, flow cytometry analysis.

The results are shown in Figure 5. The expression of TCR and B2M molecules in the transfected cells was significantly decreased, suggesting that the modified universal CAR-T cells can effectively reduce the risk of graft-versus-host disease and immune rejection.

All documents mentioned in the present application are hereby incorporated by reference in their entirety in their entireties in the the the the the the the the In addition, it should be understood that various modifications and changes may be made by those skilled in the art in the form of the appended claims.

Claims

An agent for preparing universal CAR-T cells, characterized in that the reagents comprise:

(i) an sgRNA targeting TCR and/or B2M or an expression vector for expressing the sgRNA, the sgRNA being one or more nucleotide sequences selected from the group consisting of:

(A) sgRNA targeting the alpha chain of the TCR:

TRAC-sgRNA0, TRAC-sgRNA5, TRAC-sgRNA6, TRAC-sgRNA7, TRAC-sgRNA8, TRAC-sgRNA9, TRAC-sgRNA10, TRAC-sgRNA11, TRAC-sgRNA12, TRAC-sgRNA13, TRAC-sgRNA14, TRAC-sgRNA15, TRAC- sgRNA16, TRAC-sgRNA17, TRAC-sgRNA18, TRAC-sgRNA19, TRAC-sgRNA20;

Preferably, TRAC-sgRNA5, TRAC-sgRNA6, TRAC-sgRNA7, TRAC-sgRNA8, TRAC-sgRNA9, TRAC-sgRNA10, TRAC-sgRNA12, TRAC-sgRNA13, TRAC-sgRNA14, TRAC-sgRNA15, TRAC-sgRNA16, TRAC- sgRNA17, TRAC-sgRNA20;

(B1) sgRNA targeting the β1 chain of TCR:

TRBC1-sgRNA1, TRBC1-sgRNA2, TRBC1-sgRNA3, TRBC1-sgRNA4, TRBC1-sgRNA5, TRBC1-sgRNA6, TRBC1-sgRNA7, TRBC1-sgRNA8, TRBC1-sgRNA9, TRBC1-sgRNA10, TRBC1-sgRNA11, TRBC1-sgRNA12, TRBC1- sgRNA13, TRBC1-sgRNA14, TRBC1-sgRNA15;

Preferably, TRBC1-sgRNA3, TRBC1-sgRNA4, TRBC1-sgRNA5, TRBC1-sgRNA6, TRBC1-sgRNA7, TRBC1-sgRNA8, TRBC1-sgRNA9, TRBC1-sgRNA11, TRBC1-sgRNA12, TRBC1-sgRNA13, TRBC1-sgRNA14, TRBC1- sgRNA15;

(B2) sgRNA targeting the β2 chain of TCR:

TRBC2-sgRNA1, TRBC2-sgRNA2, TRBC2-sgRNA3, TRBC2-sgRNA4, TRBC2-sgRNA5, TRBC2-sgRNA6, TRBC2-sgRNA7, TRBC2-sgRNA8, TRBC2-sgRNA9, TRBC2-sgRNA10, TRBC2-sgRNA11, TRBC2-sgRNA12, TRBC2- sgRNA13, TRBC2-sgRNA14, TRBC2-sgRNA15;

Preferably, TRBC2-sgRNA1, TRBC2-sgRNA3, TRBC2-sgRNA4, TRBC2-sgRNA5, TRBC2-sgRNA6, TRBC2-sgRNA8, TRBC2-sgRNA9, TRBC2-sgRNA10, TRBC2-sgRNA12, TRBC2-sgRNA13;

(C) sgRNA targeting B2M:

B2M-sgRNA1, B2M-sgRNA2, B2M-sgRNA3, B2M-sgRNA4, B2M-sgRNA5, B2M-sgRNA6, B2M-sgRNA7, B2M-sgRNA8, B2M-sgRNA9, B2M-sgRNA10, B2M-sgRNA11, B2M-sgRNA12, B2M- sgRNA13, B2M-sgRNA14, B2M-sgRNA15, B2M-sgRNA16, B2M-sgRNA17, B2M-sgRNA18, B2M-sgRNA19, B2M-sgRNA20;

Preferably, B2M-sgRNA1, B2M-sgRNA2, B2M-sgRNA3, B2M-sgRNA4, B2M-sgRNA5, B2M-sgRNA6, B2M-sgRNA7, B2M-sgRNA13, B2M-sgRNA17, B2M-sgRNA20;

And optionally (ii) an expression cassette that expresses a Cas9 protein or expresses a Cas9 protein.
The reagent according to claim 1, wherein the sequence of each sgRNA in the reagent comprises each sgRNA recognition region sequence and a corresponding full-length sgRNA sequence.
A kit, characterized in that the kit contains:

(i) a first container and a first expression vector located in the first container, the first expression vector comprising a first expression cassette, the first expression cassette for expressing the TCR-targeting sgRNA; /or

(2) a second container and a second expression vector in the second container, the second expression vector comprising a second expression cassette for expressing the B2M-targeting sgRNA; Optional

(3) a third container and a third expression vector located in the third container, the third expression vector comprising a third expression cassette for expressing an expression cassette of the Cas9 protein;

Wherein the recognition region sequence of the TCR-targeting sgRNA is a nucleotide sequence selected from any one of SEQ ID NO.: 1-47; and/or

The recognition region sequence of the B2M-targeting sgRNA is a nucleotide sequence selected from any one of SEQ ID NO.: 48-67.
A method of preparing universal CAR-T cells, the method comprising:

(1) providing a CAR-T cell to be engineered;

(2) utilising the CAR-T cell with the reagent of claim 1, to obtain a universal CAR-T cell;

The optional (3) validated CAR-T cells are universal CAR-T cells.
A general-purpose CAR-T cell characterized in that the CAR-T cell is a CAR-T prepared by the reagent according to claim 1, the kit according to claim 3 or the method according to claim 4. cell.
A cell preparation comprising the universal type CAR-T cell of claim 5.
Use of the agent according to claim 1 for the (a) knockout of the TCR and/or B2M genes; and/or (b) preparation of universal CAR-T cells.
An sgRNA, characterized in that the sgRNA is selected from the group consisting of:

(1) a sgRNA targeting a TCR, the recognition region sequence of the sgRNA being a nucleotide sequence selected from any one of SEQ ID NO.: 1-47; and/or

(2) A sgRNA targeting B2M, the recognition region sequence of the sgRNA being a nucleotide sequence selected from any one of SEQ ID NO.: 48-67.
A vector comprising the sgRNA of claim 8.
A gene editing system, characterized in that the gene editing system comprises the sgRNA of claim 8.