WO2023274386A1

WO2023274386A1 - Universal car-t cell targeting egfr and preparation method therefor

Info

Publication number: WO2023274386A1
Application number: PCT/CN2022/103092
Authority: WO
Inventors: 尚小云; 王丹; 李甲璐; 蒋海娟; 马少文; 高兴旺; 马丽; 沈慧
Original assignee: 宁波茂行生物医药科技有限公司
Priority date: 2021-07-01
Filing date: 2022-06-30
Publication date: 2023-01-05

Abstract

A universal CAR-T cell targeting EGFR and a preparation method therefor. The universal CAR-T cell contains a chimeric antigen receptor. The chimeric antigen receptor contains a targeting moiety. The targeting moiety comprises HCDR3. The HCDR3 comprises an amino acid sequence as shown in SEQ ID NO:8. During the recognition of tumor antigens, the universal CAR-T cell can also reduce the immune rejection reaction caused by allogeneic CAR-T treatment, thereby prolonging the survival time of the cell and increasing the anti-tumor effect.

Description

Universal CAR-T cells targeting EGFR and preparation method thereof

technical field

This application relates to the field of biomedicine, in particular to a universal CAR-T cell targeting EGFR and its preparation method and application.

Background technique

EGFR belongs to the ErbB family of receptor tyrosine kinases and plays a key role in epithelial cell physiology. Ligand-induced homodimerization or heterodimerization of EGFR will lead to autophosphorylation of its tyrosine kinase domain, which will recruit a series of downstream signaling pathways, such as PI3K/AKT and Ras/ Faf/MEK/ERK. EGFR is frequently mutated or overexpressed in different types of cancer and is a target used in clinical practice for several cancer therapies. In pathological states, mainly in lung cancer, breast cancer and glioblastoma, EGFR is a driver of tumorigenesis. Abnormal activation of EGFR in cancer is mainly due to amplification and point mutations at genomic loci, but transcriptional upregulation or ligand overproduction due to autocrine/paracrine mechanisms has also been found. Furthermore, EGFR is increasingly considered as a biomarker of tumor drug resistance due to the discovery that amplification or secondary mutation of EGFR occurs under drug stress. EGFR is overexpressed in 63% of primary and 10% of secondary glioblastomas. EGFR affects the migration of neural stem cells during development and promotes cell proliferation by activating MAPK and PI3K/Akt signaling pathways.

With the development of the theory of tumor immunity and the advancement of technology, cellular immunotherapy for tumors has attracted more and more attention. CAR-T cell technology is a cell-based therapy that has produced excellent results in tumor immunotherapy, especially in the treatment of blood tumors. CAR-T immunotherapy uses genetically modified T cells that can specifically recognize and kill tumor cells expressing specific antigens without being restricted by MHC. CAR-T immunotherapy has achieved good results in the treatment of various B cell malignancies, such as CAR-T cells targeting CD19 in the treatment of acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL) and non-Hodgkin's lymphoma ( NHL). Meanwhile, the clinical application of CAR-T cells against glioma is underway and has shown encouraging results. However, the patient's autologous T cells are difficult to expand in vitro or their functions are reduced, resulting in insufficient quantity or poor quality of the prepared CAR-T cell products. Universal CAR T cells are T cells isolated from healthy donors. The prepared CAR-T cells not only have high expansion efficiency and strong vitality, but also increase the positive rate of infection. However, universal CAR-T also faces graft-versus-host Problems with disease (GVHD) and immune rejection.

Therefore, there is an urgent need for universal CAR-T cells targeting EGFR, which can not only recognize tumor cell surface antigens, but also reduce immune rejection caused by allogeneic CAR-T therapy, prolong cell survival time, and improve anti-tumor effects.

Contents of the invention

The purpose of the present invention is to prepare a universal CAR-T cell targeting EGFR, recognize tumor cell surface antigens, and knock out the TCR and HLA-A genes expressed by the cells, thereby reducing the immune rejection caused by allogeneic CAR-T therapy Response, prolong cell survival time, improve anti-tumor effect.

One of the purposes of the present application is to provide a chimeric antigen receptor targeting EGFR. The details are as follows: the anti-EGFR scFv is used as the targeting part, and is connected to the intracellular signal transduction domain through the hinge region and the transmembrane region of the CD8 molecule. Composition of the signal domain.

Another purpose of the present application is to provide a UCAR-T cell with higher safety. First, the source of the donor is based on the HLA-B homozygote in the population. One of the alleles of the patient’s HLA-B is consistent with the homozygote of the donor. Cells from these donors can cover a high proportion of the patient population. Reduce the rejection caused by HLA-B. HLA-B mainly selects B*40 homozygote, B*15 homozygote, B*46 homozygote, B*13 homozygote, B*51 homozygote, B*58 homozygote, B*07 homozygote with high frequency in the population Homozygote, B*35 homozygote, B*44 homozygote, B*52 homozygote, B*57 homozygote, B*54 homozygote, B*55 homozygote. The knockout strategy targets HLA-A molecules that are highly related to TRAC and rejection, while retaining other HLA-I molecules, which not only reduces the rejection of allogeneic cells, but also avoids the complete knockout of HLA molecules being cleared by NK cells The occurrence of allogeneic CAR-T cells greatly prolongs the half-life of allogeneic CAR-T cells in vivo. Simultaneously reduced GVHD response induced by allogeneic cell therapy. TCR gene selects gene TRAC encoding TCRα chain, and HLA-A selects A*02 homozygote, A*11 homozygote, A*02/A11 heterozygote and A*24 homozygote with high frequency in the population.

Another object of the present application is to provide a gene editing method for knocking out TCR and HLA-A with high efficiency. The transfection methods of CRISPR/Cas9 gene editing mainly include plasmid method, mRNA method and RNP method. The RNP method refers to the assembly of spcas9 ribonucleoprotein (RNP) and sgRNA into an RNP complex in vitro, and the complex is introduced into cells by electroporation. Compared with the other two methods, it has the advantages of fast degradation of spCas9 protein and low off-target risk, and is very The electrotransfer efficiency is greatly improved, thereby improving the editing efficiency of the target gene. Using the optimized RNP method to double knockout TRAC and HLA-A genes, the double knockout efficiency can reach more than 90%.

Another object of the present application is to provide a method for preparing universal CAR-T cells targeting EGFR.

In certain embodiments, the chimeric antigen receptor comprises a targeting moiety comprising HCDR3 comprising the amino acid sequence shown in SEQ ID NO:8.

In certain embodiments, the targeting moiety comprises HCDR2 comprising the amino acid sequence shown in SEQ ID NO:6.

In certain embodiments, the targeting moiety comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO:4.

In certain embodiments, the targeting moiety comprises HCDR1, HCDR2 and HCDR3 in the heavy chain variable region set forth in SEQ ID NO: 1.

In some embodiments, the targeting moiety comprises HCDR1, HCDR2, HCDR3, the HCDR3 comprises the amino acid sequence shown in SEQ ID NO:8; the HCDR2 comprises the amino acid sequence shown in SEQ ID NO:6; and The HCDR1 comprises the amino acid sequence shown in SEQ ID NO:4.

In certain embodiments, the targeting moiety comprises H-FR1, the C-terminus of the H-FR1 is directly or indirectly connected to the N-terminus of the HCDR1, and the H-FR1 comprises SEQ ID NO:3 Amino acid sequence shown.

In some embodiments, the targeting moiety comprises H-FR2, the H-FR2 is located between the HCDR1 and the HCDR2, and the H-FR2 comprises the amino acid sequence shown in SEQ ID NO:5 .

In some embodiments, the targeting moiety comprises H-FR3, the H-FR3 is located between the HCDR2 and the HCDR3, and the H-FR3 comprises the amino acid sequence shown in SEQ ID NO:7 .

In certain embodiments, the targeting moiety comprises H-FR4, the N-terminus of the H-FR4 is directly or indirectly connected to the C-terminus of the HCDR3, and the H-FR4 comprises SEQ ID NO:9 Amino acid sequence shown.

In some embodiments, the targeting moiety comprises H-FR1, H-FR2, H-FR3 and H-FR4, and the H-FR1 comprises the amino acid sequence shown in SEQ ID NO: 3; the H- FR2 comprises the amino acid sequence shown in SEQ ID NO:5; the H-FR3 comprises the amino acid sequence shown in SEQ ID NO:7; and the H-FR4 comprises the amino acid sequence shown in SEQ ID NO:9.

In certain embodiments, the targeting moiety comprises a VH comprising the amino acid sequence shown in SEQ ID NO:1.

In certain embodiments, the chimeric antigen receptor comprises a targeting moiety comprising LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 17.

In certain embodiments, the targeting moiety comprises LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 15.

In certain embodiments, the targeting moiety comprises LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 13.

In certain embodiments, the targeting moiety comprises LCDR1, LCDR2 and LCDR3 in the light chain variable region set forth in SEQ ID NO: 10.

In some embodiments, the targeting moiety comprises LCDR1, LCDR2, LCDR3, and the LCDR3 comprises the amino acid sequence shown in SEQ ID NO: 17; the LCDR2 comprises the amino acid sequence shown in SEQ ID NO: 15; and The LCDR1 comprises the amino acid sequence shown in SEQ ID NO:13.

In certain embodiments, the targeting moiety comprises L-FR1, the C-terminus of the L-FR1 is directly or indirectly linked to the N-terminus of the LCDR1, and the L-FR1 comprises SEQ ID NO: 12 Amino acid sequence shown.

In some embodiments, the targeting moiety comprises L-FR2, the L-FR2 is located between the LCDR1 and the LCDR2, and the L-FR2 comprises the amino acid sequence shown in SEQ ID NO:14 .

In some embodiments, the targeting moiety comprises L-FR3, the L-FR3 is located between the LCDR2 and the LCDR3, and the L-FR3 comprises the amino acid sequence shown in SEQ ID NO:16 .

In some embodiments, the targeting moiety comprises L-FR4, the N-terminus of the L-FR4 is directly or indirectly connected to the C-terminus of the LCDR3, and the L-FR4 comprises SEQ ID NO: 18 Amino acid sequence shown.

In some embodiments, the targeting moiety comprises L-FR1, L-FR2, L-FR3 and L-FR4, and the L-FR1 comprises the amino acid sequence shown in SEQ ID NO: 12; the L- FR2 comprises the amino acid sequence shown in SEQ ID NO:14; said L-FR3 comprises the amino acid sequence shown in SEQ ID NO:16; and said L-FR4 comprises the amino acid sequence shown in SEQ ID NO:18.

In certain embodiments, the targeting moiety comprises a VL comprising the amino acid sequence shown in SEQ ID NO: 10.

In certain embodiments, the targeting moiety comprises an antibody or antigen-binding fragment.

In certain embodiments, the antigen-binding fragment is selected from the group consisting of Fab, Fab', F(ab)2, Fv fragment, F(ab')2, scFv, di-scFv, VHH and/or dAb.

In certain embodiments, the targeting moiety comprises a scFv.

In certain embodiments, the scFv targets EGFR.

In certain embodiments, the targeting moiety comprises the amino acid sequence shown in SEQ ID NO: 198.

In certain embodiments, the chimeric antigen receptor comprises a transmembrane domain comprising a transmembrane domain derived from a protein selected from the group consisting of: CD8A, CD8B, CD28, CD3e, CD3ε , 4-1BB, CD4, CD27, CD7, PD-1, TRAC, TRBC, CD3ζ, CTLA-4, LAG-3, CD5, ICOS, OX40, NKG2D, 2B4, CD244, FcεRIγ, BTLA, CD30, GITR, HVEM , DAP10, CD2, NKG2C, LIGHT, DAP12, CD40L, CD154, TIM1, CD226, DR3, CD45, CD80, CD86, CD9, CD16, CD22, CD33, CD37, CD64, and SLAM.

In certain embodiments, said transmembrane domain of said chimeric antigen receptor comprises a transmembrane domain derived from CD8A or CD8B.

In some embodiments, the transmembrane domain of the chimeric antigen receptor comprises the amino acid sequence shown in any one of SEQ ID NO:21 to SEQ ID NO:69.

In certain embodiments, the chimeric antigen receptor comprises a co-stimulatory signaling domain comprising a co-stimulatory signaling domain derived from a protein selected from the group consisting of: CD28, 4-1BB, CD27, CD2, CD7, CD8A, CD8B, OX40, CD226, DR3, SLAM, CDS, ICAM-1, NKG2D, NKG2C, B7-H3, 2B4, FcεRIγ, BTLA, GITR, HVEM, DAP10, DAP12, CD30, CD40, CD40L, TIM1, PD-1, LFA-1, LIGHT, JAML, CD244, CD100, ICOS, CD40, and MyD88.

In certain embodiments, the co-stimulatory signaling domain in the chimeric antigen receptor comprises a co-stimulatory signaling domain derived from 4-1BB.

In some embodiments, the co-stimulatory signaling domain in the chimeric antigen receptor comprises the amino acid sequence shown in any one of SEQ ID NO:70 to SEQ ID NO:102.

In certain embodiments, the N-terminal of the co-stimulatory signaling domain in the chimeric antigen receptor is directly or indirectly linked to the C-terminal of the transmembrane domain.

In certain embodiments, the chimeric antigen receptor comprises an intracellular signal transduction domain comprising an intracellular signal transduction domain derived from a protein selected from or Its combination: CD3ζ, CD3δ, CD3γ, CD3ε, CD79a, CD79b, FceRIγ, FceRIβ, FcγRIIa, bovine leukemia virus gp30, Epstein-Barr virus (EBV) LMP2A, simian immunodeficiency virus PBj14Nef, DAP10, DAP-12 and at least one Domains of ITAMs.

In certain embodiments, the intracellular signaling domain of the chimeric antigen receptor comprises an intracellular signaling domain derived from CD3ζ, CD3δ, CD3γ, or CD3ε.

In some embodiments, the intracellular signal transduction domain in the chimeric antigen receptor comprises SEQ ID NO:86, SEQ ID NO:90, SEQ ID NO:91, SEQ ID NO:103 to The amino acid sequence shown in any one of SEQ ID NO:113.

In certain embodiments, the N-terminus of the intracellular signal transduction domain in the chimeric antigen receptor is directly or indirectly linked to the C-terminus of the co-stimulatory signal transduction domain.

In certain embodiments, the chimeric antigen receptor includes a hinge region between the targeting moiety and the transmembrane domain, the hinge region comprising a hinge region derived from a protein selected from the group consisting of: CD28, IgG1, IgG4, IgD, 4-1BB, CD4, CD27, CD7, CD8, PD-1, ICOS, OX40, NKG2D, NKG2C, FcεRIγ, BTLA, GITR, DAP10, TIM1, SLAM, CD30, and LIGHT.

In certain embodiments, the hinge region comprises a hinge region derived from CD8.

In certain embodiments, the hinge region comprises the amino acid sequence shown in any one of SEQ ID NO: 114 to SEQ ID NO: 135.

In certain embodiments, the chimeric antigen receptor comprises a non-targeting portion, the non-targeting portion of the chimeric antigen receptor comprises the transmembrane domain of CD8A, the hinge region of CD8, the intracellular Costimulatory signaling domain and CD3ζ intracellular signaling domain.

In some embodiments, the non-targeting portion comprises the amino acid sequence shown in SEQ ID NO:19.

In some embodiments, the chimeric antigen receptor comprises the amino acid sequence shown in SEQ ID NO: 199.

In another aspect, the present application provides one or more isolated nucleic acid molecules encoding said chimeric antigen receptor.

In another aspect, the present application provides one or more vectors comprising said isolated nucleic acid molecule.

In some embodiments, the vector comprises a viral vector.

In some embodiments, the vector comprises a lentiviral vector.

In another aspect, the present application provides one or more immune cells comprising and/or expressing said isolated nucleic acid molecule or said vector, and/or said chimeric antigen receptor.

In some embodiments, the immune cells are of human origin.

In some embodiments, the immune cells include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, γδT cells, monocytes, dendritic cells, granulocytes, lymphocytes cells, leukocytes, and/or peripheral blood mononuclear cells.

In certain embodiments, the immune cells include T cells.

In certain embodiments, the immune cells include modified immune cells.

In certain embodiments, the modified immune cells include cells that reduce immune rejection from allogeneic cell therapy.

In certain embodiments, the functions of T cell antigen receptor (TCR) and major histocompatibility complex (MHCI, MHCII) in T cells in the modified immune cells are inhibited.

In some embodiments, the modification in the immune cells includes down-regulation of the expression and/or activity of one or more genes related to immune rejection.

In some embodiments, the gene related to immune rejection is selected from one or more genes in the group consisting of TRAC, TRBC, HLA-A, HLA-B, B2M and CIITA.

In certain embodiments, the expression and/or activity of the TRAC gene and the HLA-A gene are down-regulated in the modified immune cells compared with the unmodified corresponding cells in the immune cells.

In certain embodiments, the expression and/or activity of the CIITA gene is not down-regulated in the modified immune cells compared to the corresponding cells without the modification.

In certain embodiments, the expression and/or activity of the B2M gene is not down-regulated in the modified immune cells compared to the corresponding cells without the modification.

In certain embodiments, the expression and/or activity of the TRAC gene and the HLA-A gene are down-regulated in the modified immune cell compared with the corresponding wild-type cell.

In certain embodiments, the expression and/or activity of the B2M gene is not down-regulated in the modified immune cells compared to the corresponding wild-type cells.

In certain embodiments, the expression and/or activity of the CIITA gene is not down-regulated in the modified immune cells compared to the corresponding wild-type cells.

In certain embodiments, down-regulating the expression level and/or activity of the gene comprises down-regulating the expression and/or activity of a nucleic acid molecule encoding the gene; and/or down-regulating the expression and/or activity of a protein product encoded by the gene. / or the activity is downregulated.

In some embodiments, the modification includes: gene knockout, gene mutation and/or gene silencing.

In certain embodiments, said modification comprises administering to said immune cells one or more agents selected from the group consisting of antisense RNA, siRNA, shRNA and sgRNA.

In certain embodiments, the modification further comprises administering to the immune cells a sgRNA targeting an exon portion of the TRAC gene.

In some embodiments, the sgRNA targeting the exon portion of the TRAC gene comprises the nucleotide sequence shown in any one of SEQ ID NO:138 to SEQ ID NO:152.

In certain embodiments, the modification comprises administering to the immune cells a sgRNA targeting an exon portion of the HLA-A gene.

In some embodiments, the sgRNA targeting the exon portion of the HLA-A gene comprises the nucleotide sequence shown in any one of SEQ ID NO:153 to SEQ ID NO:193.

In certain embodiments, said modifying further comprises administering a Cas enzyme to said cell.

In certain embodiments, the Cas enzyme includes a Cas9 protein.

In certain embodiments, the modification comprises administering to the cell an antisense RNA comprising the nucleotide sequence shown in any one of SEQ ID NO: 194 to SEQ ID NO: 197.

In certain embodiments, the immune cells are HLA-B homozygous cells.

In some embodiments, the HLA-B homozygotes include HLA-B*40 homozygotes, HLA-B*15 homozygotes, HLA-B*46 homozygotes, HLA-B*13 homozygotes, HLA-B homozygotes *51 homozygote, HLA-B*58 homozygote, HLA-B*07 homozygote, HLA-B*35 homozygote, HLA-B*44 homozygote, HLA-B*52 homozygote, HLA-B*57 Homozygous, HLA-B*54 homozygous or HLA-B*55 homozygous.

In certain embodiments, the immune cells are HLA-A homozygous or heterozygous cells.

In some embodiments, the HLA-A homozygote or heterozygote includes HLA-A*02 homozygote, HLA-A*11 homozygote, HLA-A*02/A*11 heterozygote or HLA-A* 24 homozygotes.

In another aspect, the present application provides a method for preparing immune cells, which includes introducing the nucleic acid molecule and/or the carrier into the immune cells.

In some embodiments, the method further includes: before/after introducing the nucleic acid molecule and/or the vector into the immune cells, modifying the immune cells, the modification includes immune rejection-related The expression and/or activity of one or more of the genes is downregulated.

In certain embodiments, the gene associated with immune rejection is selected from one or more genes in the group consisting of TRAC, TRBC, HLA-A, HLA-B, B2M and CIITA.

In certain embodiments, in the method, the expression and/or activity of the TRAC gene and the HLA-A gene in the immune cells are down-regulated compared to the immune cells without the modification.

In certain embodiments, in the method, the expression and/or activity of the CIITA gene in the immune cells is not down-regulated compared to the immune cells without the modification.

In certain embodiments, in the method, the expression and/or activity of the B2M gene in the immune cells is not down-regulated compared to the immune cells without the modification.

In certain embodiments, in the method, the expression and/or activity of the TRAC gene and the HLA-A gene are down-regulated in the immune cells compared to wild-type cells.

In certain embodiments, in the method, the expression and/or activity of the CIITA gene is not down-regulated in the immune cells compared to wild-type cells.

In certain embodiments, in the method, the expression and/or activity of the B2M gene is not down-regulated in the immune cells compared to wild-type cells.

In certain embodiments, the down-regulation of the expression level and/or activity of the gene in the method includes down-regulation of the expression and/or activity of a nucleic acid molecule encoding the gene; and/or down-regulation of the gene encoded by the gene The expression and/or activity of the protein product is downregulated.

In some embodiments, the modification in the method includes: gene knockout, gene mutation and/or gene silencing.

In certain embodiments, said modifying in said method comprises administering to said immune cells one or more substances selected from the group consisting of antisense RNA, siRNA, shRNA and sgRNA.

In certain embodiments, said modifying in said method comprises administering to said immune cells a sgRNA targeting an exon portion of said TRAC gene.

In some embodiments, the sgRNA targeting the exon portion of the TRAC gene in the method comprises the nucleotide sequence shown in any one of SEQ ID NO:138 to SEQ ID NO:152.

In certain embodiments, said modifying in said method comprises administering to said immune cells a sgRNA targeting an exon portion of said HLA-A gene.

In some embodiments, the sgRNA targeting the exon portion of the HLA-A gene in the method comprises the nucleotides shown in any one of SEQ ID NO:153 to SEQ ID NO:193 sequence.

In certain embodiments, said modifying in said method further comprises administering a Cas enzyme to said cell.

In certain embodiments, the Cas enzyme in the method includes a Cas9 protein.

In certain embodiments, the immune cells of the method are derived from humans.

In some embodiments, the immune cells in the method include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, γδT cells, monocytes, dendritic cells, Granulocytes, lymphocytes, leukocytes and/or peripheral blood mononuclear cells.

In certain embodiments, the immune cells of the method comprise T cells.

In certain embodiments, the immune cells in the method are HLA-B homozygous cells.

In some embodiments, the HLA-B homozygotes in the method include HLA-B*40 homozygotes, HLA-B*15 homozygotes, HLA-B*46 homozygotes, HLA-B*13 homozygotes Zygote, HLA-B*51 homozygous, HLA-B*58 homozygous, HLA-B*07 homozygous, HLA-B*35 homozygous, HLA-B*44 homozygous, HLA-B*52 homozygous, HLA-B*57 homozygote, HLA-B*54 homozygote or HLA-B*55 homozygote.

In certain embodiments, the immune cells in the method are HLA-A homozygous or heterozygous cells.

In some embodiments, the HLA-A homozygote or heterozygote in the method includes HLA-A*02 homozygote, HLA-A*11 homozygote, HLA-A*02/A*11 heterozygote Or HLA-A*24 homozygous.

In another aspect, the present application provides the application of the chimeric antigen receptor, the isolated nucleic acid molecule, the vector, and/or the immune cells in the preparation of CAR-T cells.

In another aspect, the present application provides one or more pharmaceutical compositions, which comprise the chimeric antigen receptor, the isolated nucleic acid molecule, the carrier, and/or the immune cell, and optionally a pharmaceutically acceptable carrier.

In another aspect, the present application provides one or more of the antigen chimeric receptors, the isolated nucleic acid molecules, the vectors, the immune cells, and/or the pharmaceutical composition , for use in the treatment of a disease or condition associated with the expression of EGFR.

In certain embodiments, the diseases or disorders associated with the expression of EGFR include diseases or disorders associated with up-regulated expression of EGFR.

In certain embodiments, the disease or condition associated with expression of EGFR comprises a tumor.

In certain embodiments, the tumor comprises an EGFR positive tumor.

In certain embodiments, the tumor comprises a solid tumor.

In certain embodiments, the tumor comprises a hematoma.

In certain embodiments, the tumor comprises glioma, breast cancer, lung cancer, ovarian cancer, head and neck cancer, cervical cancer, esophageal cancer, pancreatic cancer, eye cancer, mesothelioma, biliary tract cancer, prostate cancer, Liver cancer, fibrosarcoma, colon and/or stomach cancer.

In certain embodiments, the tumor comprises fibrosarcoma.

In another aspect, the present application provides the chimeric antigen receptor, the isolated nucleic acid molecule, the carrier, the immune cell, and/or the pharmaceutical composition in the preparation of medicine Use, the medicine is used for treating diseases or diseases related to the expression of EGFR.

In certain embodiments, the tumor comprises an EGFR positive tumor.

In certain embodiments, the tumor comprises a solid tumor.

In certain embodiments, the tumor comprises a hematoma.

In certain embodiments, the tumor comprises fibrosarcoma.

In another aspect, the present application provides a method for preventing and/or treating diseases or conditions related to the expression of EGFR, which comprises administering an effective amount of the chimeric antigen receptor to a subject in need, wherein The isolated nucleic acid molecule, the carrier, the immune cell, and/or the pharmaceutical composition.

In certain embodiments, the tumor comprises an EGFR positive tumor.

In certain embodiments, the tumor comprises a solid tumor.

In certain embodiments, the tumor comprises a hematoma.

In certain embodiments, the tumor comprises fibrosarcoma.

Those skilled in the art can easily perceive other aspects and advantages of the present application from the following detailed description. In the following detailed description, only exemplary embodiments of the present application are shown and described. As those skilled in the art will appreciate, the content of the present application enables those skilled in the art to make changes to the specific embodiments which are disclosed without departing from the spirit and scope of the invention to which this application relates. Correspondingly, the drawings and descriptions in the specification of the present application are only exemplary rather than restrictive.

Description of drawings

The particular features of the invention to which this application relates are set forth in the appended claims. The features and advantages of the invention to which this application relates can be better understood with reference to the exemplary embodiments described in detail hereinafter and the accompanying drawings. A brief description of the accompanying drawings is as follows:

Figure 1 shows the exemplary anti-EGFR CAR gene lentiviral expression vector described in this application.

Figure 2 shows the construction strategy of anti-EGFR UCAR-T cells described in this application.

Figures 3A-3D show the phenotype detection results of anti-EGFR UCAR-T cells described in this application (knockout efficiency, transfection efficiency, amplification factor, memory T cell ratio).

Figure 4 shows the results of killing target cells by anti-EGFR UCAR-T cells described in the present application.

Figures 5A-5C show the detection results of cytokine secretion in the co-culture of anti-EGFR UCAR-T cells and target cells described in this application.

Figure 6 shows the anti-tumor effect of the anti-EGFR UCAR-T cells described in this application in vivo.

Figure 7 shows the results of the in vivo half-life detection of anti-EGFR UCAR-T cells described in this application.

Figures 8A-8B show the results of in vivo rejection of the anti-EGFR UCAR-T cells described in this application.

Figure 9 shows the off-target analysis of targeting anti-EGFR UCAR-T cells described in this application.

Figure 10 shows the chromosomal translocation analysis of targeting anti-EGFR UCAR-T cells described in this application.

Figure 11 shows the karyotype analysis of the targeting anti-EGFR UCAR-T cells described in this application.

Figure 12 shows the Cas9 residue analysis of targeting anti-EGFR UCAR-T cells described in this application.

Figure 13 shows the results of Sanger sequencing of the TRAC gene in this application after Sg9RNA editing.

Figure 14 shows the results of TA clone detection of the TRAC gene in this application after Sg9RNA editing.

Figure 15 shows the results of flow cytometry detection of the TRAC gene in this application after Sg9RNA editing.

Figure 16 shows the results of Sanger sequencing of the HLA-A02 gene in this application after Sg2RNA editing.

Figure 17 shows the results of Sanger sequencing of the HLA-A02 gene in this application after Sg5RNA editing.

Figure 18 shows the results of Sanger sequencing of the HLA-A11 gene in this application after Sg21 RNA editing.

Figure 19 shows the results of Sanger sequencing of the HLA-A11 gene in this application after editing by Rsg2 RNA.

20A-20B show the results of simultaneous knockout of HLA-A02 and TRAC in the modified immune effector cells of the present application.

21A-21B show the protein levels of HLA-A02 and TRAC in the modified immune effector cells of the present application.

Figure 22 shows the mRNA levels of TRAC, HLA-A, B2M and CIITA in the modified immune effector cells of the present application.

23A-23B show the protein levels of B2M and CIITA in the modified immune effector cells of the present application.

24A-24D show the protein levels of TRAC, HLA-A, B2M and CIITA in the modified immune effector cells of the present application.

Figures 25A-25B show the knockout of TRAC and HLA-A mRNA levels in the modified immune effector cells of the present application.

26A-26B show the protein levels of CD69 and CD137 in the modified immune effector cells of the present application.

Figure 27 shows the co-culture of the modified immune effector cells and NK cells of the present application.

Figure 28 shows the expression level of IFN-γ by the modified immune effector cells of the present application.

29A-29D show the protein levels of TRAC, HLA-A, B2M and CIITA in the modified immune effector cells of the present application.

Figure 30 shows the infection efficiency of the modified immune effector cells of the present application to CAR.

Figure 31 shows the expansion factor of the modified immune effector cells of the present application.

Figure 32 shows the killing effect of the modified immune effector cells of the present application on CD19 positive target cells.

Figure 33 shows the dosing regimen for administering the modified immune effector cells of the present application.

Figure 34 shows the killing effect of the modified immune effector cells of the present application on tumors in mice.

detailed description

The implementation of the invention of the present application will be described in the following specific examples, and those skilled in the art can easily understand other advantages and effects of the invention of the present application from the content disclosed in this specification.

Definition of Terms

In this application, the term "chimeric antigen receptor" or "CAR" generally refers to a group of polypeptides, usually two in the simplest embodiment, which, when in an immune cell, provide the cell with respect to a target cell ( Usually specific for cancer cells) and generate intracellular signals. In some embodiments, a CAR comprises at least one extracellular antigen-binding domain, a transmembrane domain, and a cytoplasmic signaling domain (also referred to herein as an "intracellular signaling domain") comprising Functional signaling domains of defined stimulatory and/or co-stimulatory molecules. In some embodiments, the set of polypeptides are in the same polypeptide chain (eg, comprising chimeric fusion proteins). In some embodiments, the set of polypeptides is discontinuous from each other, eg, in different polypeptide chains. In some aspects, the set of polypeptides includes a dimerization switch that, in the presence of a dimerization molecule, can couple the polypeptides to each other, eg, can couple an antigen binding domain to an intracellular signaling domain. In one aspect, the stimulatory molecule of the CAR is the zeta chain associated with the T cell receptor complex. In one aspect, the cytoplasmic signaling domain comprises a primary signaling domain (eg, the primary signaling domain of CD3-zeta). In one aspect, the cytoplasmic signaling domain further comprises one or more functional signaling domains derived from at least one co-stimulatory molecule as defined below. In one aspect, the co-stimulatory molecule may be selected from 4-1BB (ie 4-1BB), CD27, ICOS and/or CD28. In one aspect, a CAR comprises a chimeric fusion protein that may comprise an extracellular antigen recognition domain, a transmembrane domain and an intracellular signaling domain comprising a functional signaling domain derived from a stimulatory molecule. In one aspect, a CAR comprises a chimeric fusion protein that may comprise an extracellular antigen recognition domain, a transmembrane domain and an intracellular signaling domain comprising a functional signaling domain derived from a co-stimulatory molecule domains and functional signaling domains derived from stimulatory molecules. In one aspect, the CAR comprises a chimeric fusion protein which may comprise an extracellular antigen recognition domain, a transmembrane domain and an intracellular signal transduction domain comprising a protein derived from one or more co-stimulatory molecules. Functional signaling domains and functional signaling domains derived from stimulatory molecules. In one aspect, the CAR comprises a chimeric fusion protein which may comprise an extracellular antigen recognition domain, a transmembrane domain and an intracellular signal transduction domain comprising at least two derived from one or more common A functional signaling domain of a stimulatory molecule and a functional signaling domain derived from a stimulatory molecule. In one aspect, the CAR comprises an optional leader sequence at the amino terminus (N-ter) of the CAR fusion protein. In one aspect, the CAR further comprises a leader sequence at the N-terminus of the extracellular antigen recognition domain, wherein the leader sequence is optionally cleaved from the antigen recognition domain (e.g. scFv) during cellular processing and localizes the CAR to the cell membrane.

In this application, the term "EGFR protein" generally belongs to the ErbB family of receptor tyrosine kinases, which play a key role in the physiology of epithelial cells. The amino acid sequence of the human EGFR protein can be found at UniProt/Swiss-Prot Accession No. P00533. In the present application, the isolated antigen-binding fragment can bind to EGFR protein. In this application, the terms "EGFR protein", "EGFR antigen" and "EGFR-Fc recombinant protein" are used interchangeably and include any variant or isoform thereof naturally expressed by cells.

In this application, the term "complementarity determining region" (CDR) generally refers to the complementarity determining region within the variable region of an antigen-binding fragment. In the present application, there are 3 CDRs in the heavy chain variable region, and the CDRs are named HCDR1, HCDR2 and HCDR3 for each variable region. The exact boundaries of these CDRs have been defined differently according to different systems. The system described by Kabat (Kabat et al., Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md. (1987) and (1991)) not only provides a sequence that can be applied to any variable region of an antigen-binding fragment Clear residue numbering system, also provides the precise residue boundary that limits 3 CDRs.These CDRs can be called Kabat CDRs.Chothia and colleague (Chothia and Lesk, J.Mol.Biol.196:901-917 (1987) and Chothia et al., Nature 342:877-883 (1989)) found that despite the large diversity at the amino acid sequence level, certain subsections within the Kabat CDRs adopted nearly identical peptide backbone conformations. These subsections were named are L1, L2, and L3 or H1, H2, and H3, where "L" and "H" refer to the light and heavy chain regions, respectively. These regions may be referred to as Chothia CDRs, which have overlapping borders with Kabat CDRs .Other boundaries defining CDRs overlapping with Kabat CDRs have been described by Padlan (FASEB J.9:133-139 (1995)) and MacCallum (J Mol Biol 262(5):732-45 (1996)). In addition, other The definition of CDR boundaries for CDR may not strictly follow one of the above systems, but will still overlap with Kabat CDRs, although they can be shortened according to predictions or experimental findings that specific residues or groups of residues or even CDRs as a whole do not significantly affect antigen binding. or extended. In this application, the IMGT numbering system is used.

In this application, the term "FR" generally refers to the more highly conserved portions of antibody variable domains, known as the framework regions. For example, the variable domains of native heavy and light chains may each comprise four FR regions, four in VH (H-FR1, H-FR2, H-FR3, and H-FR4), and four in VL. (L-FR1, L-FR2, L-FR3 and L-FR4). "Framework region" generally refers to the art-recognized portion of an antibody variable region that exists between the more divergent (ie hypervariable) CDRs. Such framework regions are typically referred to as Frameworks 1 to 4 (FR1, FR2, FR3, and FR4) and provide the backbone for representing the six CDRs (three from the heavy chain and three from the light chain) in three-dimensional space, to Forms the antigen-binding surface.

In this application, the term "single chain antibody" or "scFv" generally refers to a molecule comprising an antibody heavy chain variable region (VH) and an antibody light chain variable region (VL) connected by a linker. Although the 2 domains, VL and VH, are encoded by separate genes, they can be joined using recombinant methods, through a synthetic linker, making them a single protein chain, where the VL and VH regions pair to form what is known as a single-chain Fv (scFv). monovalent molecule. See, eg, Bird et al., Science 242:423-426 (1988); and Huston et al., Proc. Natl. Acad. Sci. USA, 85:5879-5883 (1988). The term "antibody" when referring to fragments includes said single chain antibodies which can be produced by recombinant techniques or enzymatic or chemical cleavage of intact antibodies.

In this application, the term "homology" may generally be equated with sequence "identity". Homologous sequences may include amino acid sequences that may be at least 80%, 85%, 90%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identical to the subject sequence . Typically, a homologue will comprise the same active site, etc., as the subject amino acid sequence. Homology can be considered in terms of similarity (ie, amino acid residues having similar chemical properties/functions), or can be expressed in terms of sequence identity. In this application, a sequence having a percentage identity of any one of the SEQ ID NOs of the mentioned amino acid sequence or nucleotide sequence means having said percentage identity over the entire length of the mentioned SEQ ID NO the sequence of.

To determine sequence identity, sequence alignment can be performed by various means known to those skilled in the art, for example, using BLAST, BLAST-2, ALIGN, NEEDLE or Megalign (DNASTAR) software and the like. Those skilled in the art can determine appropriate parameters for alignment, including any algorithms needed to achieve optimal alignment across the full-length sequences being compared.

In this application, the term "KD" is used interchangeably with "KD", and generally refers to the dissociation equilibrium constant of a specific antibody-antigen interaction, and the unit is M (mol/L). KD can be calculated from species AB and its dissociated concentrations of species A and species B: KD=c(A)*c(B)/c(AB). It can be seen from the formula that the larger the KD value, the more dissociation, which means the weaker the affinity between substances A and B; on the contrary, the smaller the KD value, the less dissociation, which means the affinity between substances A and B stronger.

In this application, the term "isolated nucleic acid molecule" generally refers to an isolated form of nucleotides, deoxyribonucleotides or ribonucleotides or their analogs of any length, isolated from their natural environment or artificially synthesized .

In this application, the term "vector" generally refers to a nucleic acid molecule capable of self-replication in a suitable host, which transfers an inserted nucleic acid molecule into and/or between host cells. The vectors may include vectors mainly used for inserting DNA or RNA into cells, vectors mainly used for replicating DNA or RNA, and vectors mainly used for expression of transcription and/or translation of DNA or RNA. The carrier also includes a carrier having various functions as described above. The vector may be a polynucleotide capable of being transcribed and translated into a polypeptide when introduced into a suitable host cell. Generally, the vector can produce the desired expression product by culturing an appropriate host cell containing the vector.

In this application, the term "host cell" generally refers to an individual cell, cell line or cell culture that can or has contained a vector comprising the isolated nucleic acid molecule described herein, or is capable of expressing the isolated antigen-binding fragment described herein things. The host cells may include progeny of a single host cell. Due to natural, accidental or deliberate mutations, the progeny cells may not necessarily be completely identical in morphology or genome to the original parent cells, but they only need to be able to express the isolated antigen-binding fragments described in this application. The host cells can be obtained by using the vectors described in this application to transfect cells in vitro. The host cell can be a prokaryotic cell (such as Escherichia coli), or a eukaryotic cell (such as yeast cells, such as COS cells, Chinese hamster ovary (CHO) cells, HeLa cells, HEK293 cells, COS-1 cells, NSO cells or myeloma cells). For example, the host cells may be E. coli cells. For example, the host cell may be a yeast cell. For example, the host cell can be a mammalian cell. For example, the mammalian cells may be CHO-K1 cells.

In this application, the term "immune effector cells" generally refers to immune cells that participate in the immune response and perform effector functions. For example, the exercising effector functions may include clearing foreign antigens or promoting immune effector responses and the like. Immune cells may include plasma cells, T cells, B cells, natural killer (NK) cells, natural killer T (NKT) cells, mast cells, and myeloid-derived phagocytes.

The immune effector cells of the present application may be autologous/autogeneic ("own") or non-autologous ("non-self", eg allogeneic, syngeneic or allogeneic). In this application, the term "autologous" generally refers to cells from the same subject. "Allogeneic" generally refers to cells that are of the same species but are genetically different from those to which they are being compared. "Isgeneic" generally refers to cells of a different subject that are genetically identical to the cells being compared. "Allogeneic" generally refers to a cell of a different species than the compared cell. In some embodiments, the cells of the present application are autologous or allogeneic.

In this application, the term "modify" generally refers to altering the state or structure of a cell and/or changing the state or structure of a cell. The change is usually compared with the state or structure of the corresponding unmodified cell, and the change may include a change in the expression level or function of an endogenous gene, such as down-regulating the expression level of an endogenous gene in a cell by means of genetic engineering, Up-regulation or non-expression, the genetic engineering means may include homologous recombination, CRISPR/Cas9 system gene editing, etc.; the change may also include changes in cellular protein expression, structure or function, such as through the endogenous gene expression level or Changes in protein expression, changes in structure or function achieved by changes in function, such as changes in protein expression, changes in structure or function achieved by regulating protein translation, post-translational modification; the changes may also include introducing exogenous Genes, expression of foreign proteins, etc.

In this application, the term "TRAC" generally refers to the T cell receptor alpha chain constant region (T cell receptor alpha cons-stant). T cell receptor (TCR) generally refers to a specific receptor located on the surface of T cells that can recognize antigens bound to major histocompatibility complex (MHC) molecules. TCRs are usually composed of two different protein chains (ie heterodimers). In humans, the TCR in most T cells consists of an α chain and a β chain (encoded by TRA and TRB, respectively). This type of T cell is called αβT cells. and δ chains (encoded by TRG and TRD, respectively), this type of T cell is called γδ T cell. Typically, αβ T cells account for about 95% of the total T cells, and γδ T cells account for about 5% of the total T cells. This ratio varies during ontogeny and in disease states (such as leukemia) and also varies between species. different. Each chain that makes up the TCR contains a variable region and a constant region. In humans, the gene encoding the α chain (TRA, such as the information shown in HGNC: 12027) is located on chromosome 14 and consists of multiple gene segments, including variable Segment (V), connecting segment (J) and constant region (C), TRAC gene usually refers to the gene sequence (for example, the information shown in HGNC:12029) encoding T cell receptor α chain constant region (C), which is located in Chromosome 14 (14q11.2;14:22,547,505-22,552,131). Usually one of the variable segment (V) genes encoding the N-segment antigen recognition domain is rearranged with one of the junction segment (J) to generate a functional V region exon that is transcribed and spliced together with the The constant regions (C) are linked to form the T cell receptor alpha chain coding sequence.

In this application, the term "major histocompatibility complex antigen" ("MHC", also referred to as "human leukocyte antigen" ("HLA") in the case of humans) generally refers to the expression on the surface of cells conferring A protein with a cell's unique antigenic identity. MHC/HLA antigens are targets recognized by T cells and NK cells as derived from the same source of hematopoietic stem cells as immune cells ("self") or as derived from another source of hematopoietic reconstituted cells ("non-self") molecular. Two main classes of HLA antigens are recognized: HLA class I and HLA class II. HLA class I antigens (A, B, C in humans) allow each cell to be recognized as "self", while HLA class II antigens (DR, DP and DQ in humans) participate in the communication between lymphocytes and antigen-presenting cells reaction between. Both have been implicated in the rejection of transplanted organs. An important aspect of the HLA gene system is its polymorphism. Different alleles exist for each gene, MHC class I (A, B, and C) and MHC class II (DP, DQ, and DR). HLA alleles are indicated by numbers and subscripts. For example, two unrelated individuals may carry the class I HLA-B genes B5 and Bw41, respectively. Allelic products differ in one or more amino acids in the alpha and/or beta domains. A large number of specific antibodies or nucleic acid reagents are used to haplotype individuals using leukocytes expressing class I and class II molecules. The genes commonly used for HLA typing are the six MHC class I and II proteins, HLA-A; HLA-B and HLA-DR each have two alleles. The HLA genes are clustered in a "superlocus" present on chromosome position 6p21, which encodes six classical Transplantation of HLA genes and at least 132 protein-coding genes. The complete locus measures roughly 3.6Mb, with at least 224 loci. One effect of this clustering is a "haplotype", a set of alleles present on a single chromosome, inherited from one parent, that tends to be inherited as a group. The set of alleles inherited from each parent forms a haplotype, some of which tend to be associated together. Identifying a patient's haplotype can help predict the probability of finding a matching donor and help develop a search strategy because some alleles and haplotypes are more common than others and they are more common in different races and ethnicities The frequencies in the distribution are different.

In this application, "HLA-A" generally refers to a type of human leukocyte antigen polypeptide chain, encoded by the HLA-A gene located on human chromosome 6p21.3 (for example, the information shown in HGNC:4931). HLA-A is one of three major polypeptide types that make up MHC class I molecules on the surface of human cells, the others including HLA-B and HLA-C. The heterodimer composed of the α chain encoded by the HLA-A gene and the β chain (β2-microglobulin) encoded by the B2M gene is the HLA-A class MHC I molecule. The α chain encoded by the HLA-A gene may comprise an α1 domain, an α2 domain, an α3 domain, a transmembrane region, and a cytoplasmic region, wherein the α1 domain and the α2 domain may be combined with peptides to be activated by MHC I Molecules (eg HLA-A class) present the peptides to cells of the immune lineage. In humans, similar to most mammals, the α chain of the MHC I molecule is polymorphic, and its primary structure has many changes. As of December 2013, there are 2432 known HLA-A alleles , encoding 1740 active proteins and 117 inactive proteins. In this application, HLA-A alleles may include those named by the WHO HLA Factor Nomenclature Committee included in the IMGT/HLA database version 3.38.0 (https://www.ebi.ac.uk/ipd/imgt/hla/) Sequence information of the different HLA-A alleles.

In this application, the term "HLA-B" generally refers to a part of the gene family of the human leukocyte antigen (HLA) complex. HLA is the human version of the major histocompatibility complex (MHC), a family of genes present in many species. The genes in this complex are divided into three basic groups: class I, class II and class III. In humans, the HLA-B gene and two related genes, HLA-A and HLA-C, are the major MHC class I genes. The HLA-B gene is located in band 21.3 of the short (p) arm of chromosome 6, from base pairs 31,353,871 to 31,357,211. HLA-B is one of the three main HLAs that should be matched between donor and recipient. These are HLA-A, HLA-B (both MHC class I) and HLA-DR (MHC class II). If the two tissues have the same genes encoding the three HLAs, the likelihood and severity of rejection is minimized. Hundreds of versions (alleles) of HLA-B are known, each assigned a specific number (eg HLA-B27). Closely related alleles are grouped together; for example, at least 28 very similar alleles are subtypes of HLA-B27. These subtypes are designated HLA-B*2701 to HLA-B*2728.

In this application, the term "HLA-matched" refers to a donor-recipient pair in which there is no mismatch in HLA antigens between the donor and recipient, such as providing hematopoietic stem cell transplantation therapy to a recipient in need of A donor for a stem cell transplant. HLA-matched (i.e., in which all 6 alleles are matched) donor-recipient pairs have a reduced risk of graft rejection because endogenous T cells and NK cells are less likely to enter the graft recognized as foreign and thus less likely to mount an immune response against the graft.

In this application, the term "HLA-mismatched" refers to a donor- A recipient pair, such as a donor who provides a hematopoietic stem cell transplant to a recipient in need of hematopoietic stem cell transplantation therapy. In some embodiments, one haplotype is matched while the other is not. HLA-mismatched donor-recipient pairs may have an increased risk of graft rejection relative to HLA-matched donor-recipient pairs because endogenous Sexual T cells and NK cells are more likely to recognize an incoming graft as foreign, and such T cells and NK cells are therefore more likely to mount an immune response against the graft.

In this application, the term "B2M" generally refers to β2-microglobulin (β2-microglobulin), which is one of the components of MHC class I molecules. β2 microglobulin (also known as β chain) can form MHC class I molecules with HLA-encoded α chain. B2M is normally expressed in all nucleated cells. In humans, β2 microglobulin is encoded by the B2M gene located at 15q21.1 (for example, the information shown in HGNC:914).

In this application, the term "CIITA" generally refers to the transactivator of major histocompatibility complex class II (MHC II). The transactivator may be a protein having an acidic transcription activation domain, 4 LRRs (leucine rich repeats) and a GTP binding domain. The protein can be localized in the nucleus and acts as a positive regulator of the transcription of major histocompatibility complex class II (MHC II) genes, known as the "master control factor" for the expression of these genes. The protein also binds GTP and uses the binding to GTP to transport itself into the nucleus where it normally acts in a coactivator-like manner through acetyltransferase (AT) activity. In humans, the protein is encoded by a gene located at 16p13.13 (for example the information shown at HGNC:7067), enabling the generation of several transcript variants encoding different isoforms.

In this application, the term "wild-type cell" generally refers to a naturally occurring or naturally derived cell.

In this application, the term "T cells" generally refers to thymus-derived cells that participate in various cell-mediated immune responses.

In this application, the term "nucleic acid" or "polynucleotide" or "nucleic acid molecule" generally refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) and polymers thereof in single- or double-stranded form. Unless specifically limited, the term may include nucleic acids that contain analogs of natural nucleotides that have similar binding properties to a reference nucleic acid (for example, for which sequence information is shown) and in a manner similar to naturally occurring nucleotides metabolism. Unless otherwise stated, the sequence of a nucleic acid may include conservatively modified variants thereof, such as degenerate codon substitutions, alleles, orthologs, SNPs, and complementary sequences, as well as the sequences explicitly indicated.

In this application, the term "expression" generally refers to the transcription and/or translation of a specific nucleotide sequence.

In this application, the term "gene mutation" generally refers to changes in the composition or sequence of base pairs in the structure of a gene. For example, point mutations caused by single base changes, or deletions, duplications, and insertions of multiple bases.

In this application, the term "gene silencing" generally refers to preventing the expression of certain genes by regulatory mechanisms. It can mainly include two types: one is transcriptional gene silencing (TGS) at the transcriptional level caused by factors such as DNA methylation, heterochromatinization, and position effects, and the other is post-transcriptional gene silencing (post -transcriptional gene silencing (PTGS), that is, at the post-transcriptional level of the gene, it affects the expression of the gene by specifically interfering with the target RNA. Typically when a gene is silenced, the expression of the corresponding gene is downregulated/decreased. When a gene is knocked out, it usually shows no expression. For example, in a cell, when all alleles of a specific gene are knocked out, the expression of the gene disappears. Gene silencing is generally considered to be a gene knockdown mechanism, and methods commonly used to silence genes can be RNAi, etc.

In this application, the term "endogenous" refers to any substance derived from or produced within an organism, cell, tissue or system.

In this application, the term "exogenous" refers to any substance introduced from or produced outside of an organism, cell, tissue or system.

In this application, the term "antisense RNA" generally refers to a single-stranded RNA that is complementary to the transcript mRNA (messenger RNA). Antisense RNA can inhibit gene expression by binding to mRNA. For example, the combination of antisense RNA and target mRNA increases the sensitivity of the double-stranded RNA molecule to RNase III and degrades it; for example, antisense RNA binds to the upstream non-coding region of mRNA, thereby directly inhibiting the translation of target mRNA .

In this application, the term "siRNA" generally refers to the abbreviation of Small interfering RNA (small interfering RNA) or short in-terfering RNA (short interfering RNA). siRNA is a type of double-stranded non-coding RNA molecule with a length of about 18-28 base pairs, which can cause mRNA degradation through complementary binding to mRNA, thereby interfering with the expression of specific genes. In some embodiments, siRNA may be a product obtained by treating long double-stranded RNA or shRNA with Dicer enzyme. In some embodiments, the siRNA enters the cell and forms an RNA-induced silencing complex (RISC) with other proteins, the sense strand is degraded, and the antisense strand can bind to a complementary targeting sequence, thereby achieving gene silencing.

In this application, the term "shRNA" generally refers to the abbreviation of short hairpin RNA, namely "short hairpin RNA". shRNA usually includes two short inverted repeat sequences separated by a stem-loop sequence to form a hairpin structure. Usually, 5-6 T bases can also be included as the transcription terminator of RNA polymerase III. In some embodiments, shRNA can enter cells through viral vectors or plasmids, and be transcribed under the action of polymerase II or polymerase III, and the transcripts are exported from the nucleus (usually through Exportin 5) and then transported after being treated by Dicer To RISC, the sense strand is degraded, and the antisense strand can bind to a complementary targeting sequence, thereby achieving gene silencing.

In this application, the term "CRISPR/Cas system" generally refers to a group of molecules comprising an RNA-guided nuclease or other effector molecule and a gRNA molecule capable of directing and implementing the RNA-guided nuclease or other effector molecule Nucleic acid is modified at a target sequence, eg, causing degradation of the target sequence. In certain embodiments, a CRISPR system comprises a gRNA and a Cas protein, e.g., a Cas9 protein. Systems comprising Cas9 or functional mutants thereof are referred to herein as "Cas9 systems" or "CRISPR/Cas9 systems". In certain embodiments, the gRNA molecule and the Cas molecule can complex to form a ribonucleoprotein (RNP) complex.

In this application, the terms "gRNA molecule" or "guide RNA", "guide RNA", "guide RNA", "guide RNA molecule", "gRNA" are used interchangeably and generally refer to Nucleases or other effector molecules (generally complexed with gRNA molecules) to nucleic acid molecules on the target sequence. In certain embodiments, this is accomplished by hybridizing a portion of the gRNA to DNA (e.g., via a gRNA guidance domain) and by binding a portion of the gRNA molecule to an RNA-guided nuclease or other effector molecule (e.g., at least via gRNAtracr). described guide. In certain embodiments, a gRNA molecule consists of a single contiguous polynucleotide molecule, referred to herein as a "single guide RNA" or "sgRNA" or the like. In other embodiments, a gRNA molecule consists of multiple (eg, two) polynucleotide molecules that are themselves capable of associating (typically by hybridization), referred to herein as "dual guide RNA" or "dgRNA" and the like.

In this application, the term "Cas protein" generally refers to the enzyme responsible for cutting DNA in the CRISPR/Cas system. Enzymes from Type I, II, and III CRISPR/Cas systems may be included. For example, Cas3, Cas9, Cas10.

In this application, the term "Cas9 protein" generally refers to the enzyme from the bacterial type II CRISPR/Cas system responsible for cutting DNA. Cas9 can include the wild-type protein and its functional mutants.

In this application, "allele" generally refers to the different variations that the gene sequence at a locus may have. A genetic locus, also known as a gene locus or site, refers to a fixed location on a chromosome, such as where a certain gene is located. The arrangement of loci in the genome is called a genetic map.

In this application, the term "homozygous" generally refers to a genotyped individual whose two alleles on the same locus of the homologous chromosome are the same. A pair of relative genes can have individuals of both genotypes AA and aa.

In the present application, the term "heterozygote" generally refers to a diploid individual whose two alleles at the same site on the homologous chromosome are different, such as Aa. Heterozygous genotypes generally have higher fitness than homozygous dominant or homozygous recessive genotypes, a phenomenon known as heterozygous dominance.

In this application, the term "pharmaceutically acceptable" generally refers to a drug that is commensurate with a reasonable benefit/risk ratio, suitable within the scope of sound medical judgment for use in contact with human and animal tissues without undue toxicity, irritation, Those compounds, materials, compositions and/or dosage forms for allergic reactions or other problems or complications.

In this application, the term "pharmaceutically acceptable carrier" generally refers to any of those conventionally used, and is subject only to physico-chemical considerations such as solubility and reactivity with active binding agents. lack of) and is limited by the route of administration. The pharmaceutically acceptable carriers described herein, such as vehicles, adjuvants, excipients, and diluents, are well known to those skilled in the art and are readily available to the public. In one aspect, a pharmaceutically acceptable carrier is one that is chemically inert to the active ingredients of the pharmaceutical composition and that exhibits no adverse side effects or toxicity under the conditions of use. In some embodiments, the carrier does not produce an adverse, allergic or other inappropriate reaction when administered to an animal or a human. In some aspects, pharmaceutical compositions are free of pyrogens and other impurities that could be harmful to humans or animals. Pharmaceutically acceptable carriers include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like; their use is well known in the art.

Acceptable carriers, excipients, or stabilizers are nontoxic to recipients and are preferably inert at the dosages and concentrations employed, and include buffers such as phosphates, citrates, or other organic acids; antioxidants; , such as ascorbic acid; low-molecular-weight polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulin; hydrophilic polymers, such as polyvinylpyrrolidone; amino acids, such as glycine, glutamine, asparagine, arginine, or lysine amino acids; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrin; chelating agents, such as EDTA; sugar alcohols, such as mannitol or sorbitol; salt-forming counterions, such as sodium; and/or Or nonionic surfactants such as Tween, Pluronics or polyethylene glycol (PEG).

In this application, the term "comprises" generally refers to the meanings comprising, encompassing, comprising or encompassing. In some cases, it also means "for" and "consisting of".

In this application, the term "about" generally refers to a range of 0.5%-10% above or below the specified value, such as 0.5%, 1%, 1.5%, 2%, 2.5%, above or below the specified value. 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10%.

Detailed description of the invention

chimeric antigen receptor

In one aspect, the application provides a chimeric antigen receptor (CAR), which may comprise a targeting moiety, which may comprise at least one CDR in the heavy chain variable region VH. For example, the VH may comprise the amino acid sequence shown in SEQ ID NO:1. In this application, the HCDR of the isolated antigen-binding protein can be divided in any form, as long as the VH is identical to the amino acid sequence shown in SEQ ID NO: 1, the HCDR obtained by any form of division can fall under the protection of this application within range.

The CDR of an antibody, also known as the complementarity determining region, is part of the variable region. The amino acid residues in this region may make contacts with the antigen or antigenic epitope. Antibody CDRs can be determined by a variety of coding systems, such as CCG, Kabat, Chothia, IMGT, AbM, comprehensive consideration of Kabat/Chothia, etc. These numbering systems are known in the art, see, for example, http://www.bioinf.org.uk/abs/index.html#kabatnum. Those skilled in the art can use different coding systems to determine the CDR region according to the sequence and structure of the antibody. There may be differences in the CDR regions using different coding systems. In this application, the CDR covers the CDR sequence divided according to any CDR division method; also covers its variants, the variants include the amino acid sequence of the CDR through substitution, deletion and/or addition of one or more amino acids . For example 1-30, 1-20 or 1-10, and for example 1, 2, 3, 4, 5, 6, 7, 8 or 9 amino acid substitutions, deletions and/or or insertions; homologues thereof, which may be at least about 85% (e.g., at least about 85%, about 90%, about 91%, about 92%, Amino acid sequences having about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more) sequence homology. In certain embodiments, the isolated antigen binding proteins described herein are defined by the IMGT coding system.

In the present application, the targeting moiety may comprise HCDR3, and the HCDR3 may comprise the amino acid sequence shown in SEQ ID NO:8. For example, the HCDR3 of the targeting moiety can be defined by the IMGT coding system.

In the present application, the targeting moiety may comprise HCDR2, and the HCDR2 may comprise the amino acid sequence shown in SEQ ID NO:6. For example, the HCDR2 of the targeting moiety can be defined by the IMGT coding system.

In the present application, the targeting moiety may comprise HCDR1, and the HCDR1 may comprise the amino acid sequence shown in SEQ ID NO:4. For example, HCDR1 of the targeting moiety can be defined by the IMGT coding system.

In the present application, the targeting moiety may comprise HCDR1, HCDR2 and HCDR3 in the heavy chain variable region shown in SEQ ID NO:1.

In the present application, the targeting moiety may comprise HCDR1, HCDR2, HCDR3, and the HCDR3 may comprise the amino acid sequence shown in SEQ ID NO:8; the HCDR2 may comprise the amino acid sequence shown in SEQ ID NO:6; And the HCDR1 may comprise the amino acid sequence shown in SEQ ID NO:4. For example, the antigen-binding protein may comprise antibody A1 or an antigen-binding fragment (eg, scFv) having the same HCDR3 as it (eg, having the same HCDR1-3 as it).

In the present application, the targeting moiety may comprise H-FR1, the C-terminus of the H-FR1 is directly or indirectly linked to the N-terminus of the HCDR1, and the H-FR1 may comprise SEQ ID NO:3 Amino acid sequence shown.

In the present application, the targeting moiety may comprise H-FR2, the H-FR2 is located between the HCDR1 and the HCDR2, and the H-FR2 may comprise the amino acid sequence shown in SEQ ID NO:5 .

In the present application, the targeting moiety may comprise H-FR3, the H-FR3 is located between the HCDR2 and the HCDR3, and the H-FR3 may comprise the amino acid sequence shown in SEQ ID NO:7 .

In the present application, the targeting moiety may comprise H-FR4, the N-terminus of the H-FR4 is directly or indirectly linked to the C-terminus of the HCDR3, and the H-FR4 may comprise SEQ ID NO:9 Amino acid sequence shown.

In the present application, the targeting moiety may comprise H-FR1, H-FR2, H-FR3 and H-FR4, and the H-FR1 may comprise the amino acid sequence shown in SEQ ID NO: 3; the H- FR2 may comprise the amino acid sequence shown in SEQ ID NO:5; the H-FR3 may comprise the amino acid sequence shown in SEQ ID NO:7; and the H-FR4 may comprise the amino acid sequence shown in SEQ ID NO:9 . For example, the antigen-binding protein may comprise antibody A1 or an antigen-binding fragment (eg, scFv) having the same H-FR1-4 therewith.

In the present application, the targeting moiety in the chimeric antigen receptor may comprise a heavy chain variable region VH, and the VH may comprise the amino acid sequence shown in SEQ ID NO:1. For example, the nucleotide sequence encoding the VH can be SEQ ID NO:2.

In the present application, the VL may comprise the amino acid sequence shown in SEQ ID NO:10. In this application, the LCDR of the isolated antigen-binding protein can be divided in any form, as long as the VL is identical to the amino acid sequence shown in SEQ ID NO: 10, the LCDR obtained by dividing in any form can fall under the protection of this application within range.

In the present application, the antigen binding protein may comprise a light chain variable region VL, and the VL may comprise at least one, two or three of LCDR1, LCDR2 and LCDR3.

In the present application, the targeting moiety in the chimeric antigen receptor may comprise LCDR3, and the LCDR3 may comprise the amino acid sequence shown in SEQ ID NO:17. For example, the LCDR3 of the targeting moiety can be defined by the IMGT coding system.

In the present application, the targeting moiety in the chimeric antigen receptor may comprise LCDR2, and the LCDR2 may comprise the amino acid sequence shown in SEQ ID NO:15. For example, the LCDR2 of the targeting moiety can be defined by the IMGT coding system.

In the present application, the targeting moiety in the chimeric antigen receptor may comprise LCDR1, and the LCDR1 may comprise the amino acid sequence shown in SEQ ID NO:13. For example, LCDR1 of the targeting moiety can be defined by the IMGT coding system.

In the present application, the targeting moiety in the chimeric antigen receptor may comprise LCDR1, LCDR2 and LCDR3 in the light chain variable region shown in SEQ ID NO:10.

In the present application, the targeting moiety in the chimeric antigen receptor may comprise LCDR1, LCDR2, LCDR3, and the LCDR3 may comprise the amino acid sequence shown in SEQ ID NO: 17; the LCDR2 may comprise SEQ ID The amino acid sequence shown in NO:15; And the LCDR1 can comprise the amino acid sequence shown in SEQ ID NO:13. For example, the antigen-binding protein may comprise antibody A1 or an antigen-binding fragment (eg, scFv) that has the same LCDR3 as it (eg, has the same LCDR1-3 as it).

In the present application, the targeting moiety in the chimeric antigen receptor may comprise L-FR1, the C-terminus of the L-FR1 is directly or indirectly connected to the N-terminus of the LCDR1, and the L-FR1 -FR1 may comprise the amino acid sequence shown in SEQ ID NO: 12.

In the present application, the targeting moiety in the chimeric antigen receptor may comprise L-FR2, the L-FR2 is located between the LCDR1 and the LCDR2, and the L-FR2 may comprise SEQ Amino acid sequence shown in ID NO:14.

In the present application, the targeting moiety in the chimeric antigen receptor may comprise L-FR3, the L-FR3 is located between the LCDR2 and the LCDR3, and the L-FR3 may comprise SEQ Amino acid sequence shown in ID NO:16.

In the present application, the targeting moiety in the chimeric antigen receptor may comprise L-FR4, the N-terminus of the L-FR4 is directly or indirectly connected to the C-terminus of the LCDR3, and the L-FR4 -FR4 may comprise the amino acid sequence shown in SEQ ID NO: 18.

In the present application, the targeting moiety may comprise L-FR1, L-FR2, L-FR3 and L-FR4, and the L-FR1 may comprise the amino acid sequence shown in SEQ ID NO: 12; the L- FR2 may comprise the amino acid sequence shown in SEQ ID NO:14; the L-FR3 may comprise the amino acid sequence shown in SEQ ID NO:16; and the L-FR4 may comprise the amino acid sequence shown in SEQ ID NO:18 . For example, the antigen-binding protein may comprise antibody A1 or an antigen-binding fragment (eg, scFv) having the same L-FR1-4 therewith.

In the present application, the targeting moiety in the chimeric antigen receptor may comprise a light chain variable region VL, and the VL may comprise the amino acid sequence shown in SEQ ID NO:10. For example, the nucleotide sequence encoding the VL is SEQ ID NO: 11.

In the present application, the targeting moiety in the chimeric antigen receptor may comprise HCDR1-3 and LCDR1-3. The HCDR3 may comprise the amino acid sequence shown in SEQ ID NO:8; the HCDR2 may comprise the amino acid sequence shown in SEQ ID NO:6; and the HCDR1 may comprise the amino acid sequence shown in SEQ ID NO:4; the The LCDR3 may comprise the amino acid sequence shown in SEQ ID NO:17; the LCDR2 may comprise the amino acid sequence shown in SEQ ID NO:15; and the LCDR1 may comprise the amino acid sequence shown in SEQ ID NO:13. For example, the antigen-binding protein may comprise antibody A1 or an antigen-binding fragment (eg, scFv) that has the same LCDR3 and HCDR3 as it (eg, has the same LCDR1-3 and HCDR1-3 as it).

In the present application, the antigen binding protein may comprise a heavy chain variable region and a light chain variable region. The heavy chain variable region of the antigen binding protein may comprise HCDR1-3 and H-FR1-4. The light chain variable region of the antigen binding protein may comprise LCDR1-3 and L-FR1-4. For example, the HCDR1 may comprise the amino acid sequence shown in SEQ ID NO:4; the HCDR2 may comprise the amino acid sequence shown in SEQ ID NO:6; the HCDR3 may comprise the amino acid sequence shown in SEQ ID NO:8; The LCDR1 can include the amino acid sequence shown in SEQ ID NO:13; the LCDR2 can include the amino acid sequence shown in SEQ ID NO:15; the LCDR3 can include the amino acid sequence shown in SEQ ID NO:17. For example, the H-FR1 may comprise the amino acid sequence shown in SEQ ID NO:3; the H-FR2 may comprise the amino acid sequence shown in SEQ ID NO:5; the H-FR3 may comprise the amino acid sequence shown in SEQ ID NO:7 The amino acid sequence shown; the H-FR4 can comprise the amino acid sequence shown in SEQ ID NO:9; the L-FR1 can comprise the amino acid sequence of SEQ ID NO:12; the L-FR2 can comprise the amino acid sequence of SEQ ID NO The amino acid sequence shown in: 14; The L-FR3 can comprise the amino acid sequence shown in SEQ ID NO: 16; The L-FR4 can comprise the amino acid sequence shown in SEQ ID NO: 18. For example, the heavy chain variable region of the antigen binding protein may comprise the amino acid sequence shown in SEQ ID NO:1. For example, the antigen binding protein may include antibody A1 or an antigen binding protein having the same heavy chain variable region as it. For example, the light chain variable region of the antigen binding protein may comprise the amino acid sequence shown in SEQ ID NO: 10. For example, the antigen binding protein may comprise antibody A1 or an antigen binding protein having the same light chain variable region as it.

In the present application, the targeting moiety in the chimeric antigen receptor may include an antibody or an antigen-binding fragment.

In the present application, the antigen-binding fragment in the chimeric antigen receptor can be selected from the following group: Fab, Fab', F(ab)2, Fv fragment, F(ab')2, scFv, di- scFv, VHH and/or dAb.

In the present application, the targeting moiety in the chimeric antigen receptor may include scFv. For example, the scFv can target EGFR. For example, in the scFv, the C-terminus of the VH may be directly or indirectly linked to the N-terminus of the VL. For example, in the scFv, the C-terminus of the VL may be directly or indirectly linked to the N-terminus of the VH.

In the present application, it may comprise a transmembrane domain which may comprise a transmembrane domain derived from one or more proteins selected from the group consisting of: CD8A, CD8B, CD28, CD3e, CD3ε, 4- 1BB, CD4, CD27, CD7, PD-1, TRAC, TRBC, CD3ζ, CTLA-4, LAG-3, CD5, ICOS, OX40, NKG2D, 2B4, CD244, FcεRIγ, BTLA, CD30, GITR, HVEM, DAP10, CD2, NKG2C, LIGHT, DAP12, CD40L, CD154, TIM1, CD226, DR3, CD45, CD80, CD86, CD9, CD16, CD22, CD33, CD37, CD64, and SLAM.

In the present application, the transmembrane domain may comprise a transmembrane domain derived from CD8A or CD8B.

In the present application, wherein the transmembrane domain may comprise the amino acid sequence shown in any one of SEQ ID NO:21 to SEQ ID NO:69.

In the present application, it may comprise an intracellular co-stimulatory signaling domain which may comprise intracellular co-stimulatory signaling derived from one or more proteins selected from the group consisting of Domains: CD28, 4-1BB, CD27, CD2, CD7, CD8A, CD8B, OX40, CD226, DR3, SLAM, CDS, ICAM-1, NKG2D, NKG2C, B7-H3, 2B4, FcεRIγ, BTLA, GITR, HVEM , DAP10, DAP12, CD30, CD40, CD40L, TIM1, PD-1, LFA-1, LIGHT, JAML, CD244, CD100, ICOS, CD40, and MyD88.

In the present application, the intracellular co-stimulatory signaling domain may include a co-stimulatory signaling domain derived from 4-1BB.

In the present application, wherein the intracellular co-stimulatory signaling domain may comprise the amino acid sequence shown in any one of SEQ ID NO:70 to SEQ ID NO:102.

In the present application, it may comprise an intracellular signal transduction domain, which may comprise an intracellular signal transduction domain derived from one or more proteins selected from the group consisting of: CD3ζ, CD3δ, CD3γ, CD3ε, CD79a, CD79b, FceRIγ, FceRIβ, FcγRIIa, bovine leukemia virus gp30, Epstein-Barr virus (EBV) LMP2A, simian immunodeficiency virus PBj14Nef, DAP10, DAP-12 and structures containing at least one ITAM area.

In the present application, the intracellular signal transduction domain may comprise a signal transduction domain derived from CD3ζ, CD3δ, CD3γ or CD3ε.

In the present application, wherein the intracellular signal transduction domain may comprise any one of SEQ ID NO:86, SEQ ID NO:90, SEQ ID NO:91, SEQ ID NO:103 to SEQ ID NO:113 Amino acid sequence shown.

In the present application, it may comprise a hinge region between the targeting moiety and the transmembrane domain, which may comprise a hinge region derived from one or more proteins selected from the group consisting of: CD28, IgG1, IgG4 , IgD, 4-1BB, CD4, CD27, CD7, CD8, PD-1, ICOS, OX40, NKG2D, NKG2C, FcεRIγ, BTLA, GITR, DAP10, TIM1, SLAM, CD30, and LIGHT.

In the present application, the hinge region may comprise a hinge region derived from CD8.

In the present application, the hinge region may comprise the amino acid sequence shown in any one of SEQ ID NO:114 to SEQ ID NO:135.

In the present application, the chimeric antigen receptor may include a signal peptide. The signal peptide may comprise the amino acid sequence shown in SEQ ID NO:136. For example, the nucleic acid sequence of the signal peptide may comprise the nucleotide sequence of SEQ ID NO:137.

In the present application, the non-targeting portion of the chimeric antigen receptor may include a hinge region, a transmembrane domain, an intracellular co-stimulatory signal transduction domain and an intracellular signal transduction domain.

For example, the chimeric antigen receptor uses an anti-EGFR single-chain antibody (scFv) as a targeting moiety, and is connected to an intracellular signal transduction domain through a hinge region and a transmembrane domain, and the intracellular signal transduction domain is composed of The co-stimulatory signaling domain is composed of an intracellular signal transduction domain.

In certain embodiments, the non-targeting portion of the chimeric antigen receptor may comprise the transmembrane domain of the CD8A molecule, the hinge region of CD8, the intracellular co-stimulatory signaling domain of 4-1BB, and the intracellular signal transduction domain of CD3ζ. guiding domain.

For another example, the chimeric antigen receptor uses an anti-EGFR single-chain antibody (scFv) as a targeting moiety, and is connected to the intracellular signal transduction domain through the hinge region and transmembrane domain of the CD8 molecule, and the intracellular signal transduction structure The domain consists of the 4-1BB intracellular co-stimulatory signaling domain and the CD3ζ intracellular signaling domain.

In certain embodiments, the non-targeting portion of the chimeric antigen receptor comprises the amino acid sequence shown in SEQ ID NO: 19.

Nucleic acid molecules, vectors, cells

In another aspect, the present application provides one or more isolated nucleic acid molecules encoding the aforementioned chimeric antigen receptors.

In the present application, the isolated nucleic acid molecule may comprise the nucleotide sequence shown in SEQ ID NO:200.

In another aspect, the present application provides a vector, which may comprise the aforementioned isolated nucleic acid molecule.

In this application, the vector may include a viral vector or a non-viral vector.

In the present application, the non-viral vector may include Sleeping Beauty system or piggybac system.

In this application, the vector may include a lentiviral vector.

In another aspect, the present application provides a cell, which may comprise the aforementioned chimeric antigen receptor, the aforementioned isolated nucleic acid molecule, and/or the aforementioned vector.

In another aspect, the present application provides the aforementioned chimeric antigen receptor, the aforementioned isolated nucleic acid molecule, the aforementioned vector, the aforementioned cell, or the application of the aforementioned immune cell in the preparation of CAR-T cells.

Immune Cells

In another aspect, the present application provides an immune cell, which may comprise the aforementioned nucleic acid molecule or the aforementioned vector, and/or express the aforementioned CAR.

In this application, the immune cells may include human cells.

In the present application, the immune cells may include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, white blood cells and/or or peripheral blood mononuclear cells.

In the present application, the immune cells mentioned above may include T cells.

In this application, the immune cells may include modified immune cells.

In the present application, the modified immune cells may include cells that reduce immune rejection caused by allogeneic cell therapy.

In the present application, the functions of T cell antigen receptor (TCR) and major histocompatibility complex (MHCI, MHCII) in T cells in the modified immune cells are inhibited.

In the present application, the modification may include down-regulation of the expression and/or activity of one or more genes related to immune rejection.

In the present application, the gene related to immune rejection can be selected from one or more genes in the following group: TRAC, TRBC, HLA-A, HLA-B, B2M and CIITA.

In the present application, the gene related to immune rejection can be selected from one or more genes in the following group: TRAC, TRBC, HLA-A and HLA-B.

In the present application, the gene related to immune rejection can be selected from one or more genes in the following group: TRAC, TRBC and HLA-A.

In the present application, the gene related to immune rejection can be selected from one or more genes in the following group: TRAC and HLA-A.

In the present application, compared with the unmodified corresponding cells, the expression and/or activity of TRAC gene and HLA-A gene can be down-regulated in the modified immune cells.

In the present application, the expression and/or activity of the CIITA gene is not down-regulated in the modified immune cells compared with the corresponding cells without the modification.

In the present application, the expression and/or activity of the B2M gene is not down-regulated in the modified immune cells compared with the corresponding cells without the modification.

In the present application, compared with the corresponding wild-type cells, the expression and/or activity of TRAC gene and HLA-A gene are down-regulated in the modified immune cells.

In the present application, compared with the corresponding wild-type cells, the expression and/or activity of the B2M gene is not down-regulated in the modified immune cells.

In the present application, the expression and/or activity of the CIITA gene is not down-regulated in the modified immune cells compared with the corresponding wild-type cells.

In the present application, wherein the expression level and/or activity of the gene is down-regulated includes down-regulating the expression and/or activity of the nucleic acid molecule encoding the gene; and/or down-regulating the expression and/or activity of the protein product encoded by the gene or the activity is downregulated.

In the present application, the modification may include: gene knockout, gene mutation and/or gene silencing.

In the present application, the modification may include the knockout of any one of the two TRAC alleles and the knockout of any one of the two HLA-A alleles in the immune cells.

In the present application, the modification may include the knockout of two TRAC alleles and the knockout of any one of the two HLA-A alleles in the immune cells.

In the present application, the modification may include knocking out the exons of the TRAC gene and knocking out the exons of the HLA-A gene in the immune cells.

In the present application, the modification may include administering one or more substances selected from the group consisting of antisense RNA, siRNA, shRNA and CRISPR/Cas9 system to the immune cells.

In the present application, the modification may include administering the CRISPR/Cas9 system to the immune cells.

In the present application, the modification may further include administering sgRNA targeting the exon part of the TRAC gene to the immune cells.

In the present application, wherein the sgRNA targeting the exon part of the TRAC gene may comprise the nucleotide sequence shown in any one of SEQ ID NO:138 to SEQ ID NO:152.

In the present application, the modification may include administering to the immune cells sgRNA targeting the exon portion of the HLA-A gene.

In the present application, the sgRNA targeting the exon part of the HLA-A gene may comprise the nucleotide sequence shown in any one of SEQ ID NO:153 to SEQ ID NO:193.

In the present application, the modification may also include administering a Cas enzyme to the cell.

In the present application, Cas enzymes may include Cas9 protein.

In the present application, the modification may include applying antisense RNA to the cell, and the antisense RNA may comprise the nucleotide sequence shown in any one of SEQ ID NO:194 to SEQ ID NO:197.

In this application, the immune cells may be HLA-B homozygous cells.

In the present application, the HLA-B homozygous may include HLA-B*40 homozygous, HLA-B*15 homozygous, HLA-B*46 homozygous, HLA-B*13 homozygous, HLA-B *51 homozygote, HLA-B*58 homozygote, HLA-B*07 homozygote, HLA-B*35 homozygote, HLA-B*44 homozygote, HLA-B*52 homozygote, HLA-B*57 Homozygous, HLA-B*54 homozygous, HLA-B*55 homozygous.

In the present application, the immune cells may be HLA-A homozygous or heterozygous cells.

In the present application, the HLA-A homozygote or heterozygote may include HLA-A*02 homozygote, HLA-A*11 homozygote, HLA-A*02/A*11 heterozygote or HLA-A* 24 homozygotes.

On the other hand, the present application provides a method for preparing immune cells, which may include introducing the aforementioned nucleic acid molecules or the aforementioned vectors into the immune cells.

In the present application, the method may further include: before/after introducing the aforementioned nucleic acid molecule or the aforementioned vector into the immune cells, modifying the immune cells, the modification including one or The expression and/or activity of multiples were downregulated.

In the present application, the method may include: after introducing the aforementioned nucleic acid molecule or the aforementioned vector into the immune cells, modifying the immune cells, the modification including one or more genes related to immune rejection Expression and/or activity is downregulated.

For example, the method for preparing immune cells may include:

(1) introducing the aforementioned nucleic acid molecule or the aforementioned vector into immune cells;

(2) modifying the immune cells, the modification includes down-regulating the expression and/or activity of one or more genes related to immune rejection.

For example, the method for preparing immune cells may include:

(1) Collect peripheral blood from healthy people, separate PBMC, add CD3 magnetic beads according to the proportion to incubate, and sort CD3+ T cells; mix CD3/CD28 antibody-coupled magnetic beads, and take out an appropriate amount of magnetic beads according to the calculated amount. Add the bead suspension to the T cell culture system to activate the T cells and culture overnight;

(2) Infect T cells according to the titer of EGFR CAR virus;

(3) knock out TRAC and HLA-A genes at the same time;

(4) Sorting of CD3-negative T cells: CD3 magnetic beads were added in proportion to collect CD3-T cells (cells not bound to magnetic beads).

In the present application, the gene related to immune rejection is selected from one or more genes in the following group: TRAC, TRBC, HLA-A, HLA-B, B2M and CIITA.

In the present application, the expression and/or activity of the TRAC gene and the HLA-A gene in the immune cells are down-regulated compared with the expression and/or activity of the corresponding genes in the corresponding cells without the modification.

In the present application, the expression and/or activity of the CIITA gene is not down-regulated compared to the expression and/or activity of the corresponding gene in the corresponding cell without said modification.

In the present application, the expression and/or activity of the B2M gene is not down-regulated compared to the expression and/or activity of the corresponding gene in the corresponding cell without said modification.

In the present application, compared with the corresponding wild-type cells, the expression and/or activity of the TRAC gene and the HLA-A gene of the immune cells are down-regulated.

In the present application, the expression and/or activity of the CIITA gene was not down-regulated compared to the corresponding wild-type cells.

In the present application, the expression and/or activity of B2M genes was not down-regulated compared to corresponding wild-type cells.

In the present application, wherein the expression level and/or activity of the gene is down-regulated, which may include down-regulating the expression and/or activity of the nucleic acid molecule encoding the gene; and/or down-regulating the expression and/or activity of the protein product encoded by the gene. / or the activity is downregulated.

In the present application, the modification includes: gene knockout, gene mutation and/or gene silencing.

In the present application, the modification may include administering sgRNA targeting the exon part of the TRAC gene to the immune cells.

In the present application, the sgRNA targeting the exon part of the TRAC gene may comprise the nucleotide sequence shown in any one of SEQ ID NO:138 to SEQ ID NO:152.

In the present application, the modification may also include administering Cas enzyme to the cells.

In the present application, Cas enzymes may include Cas9 protein.

In the present application, the immune cells may include human cells.

In the present application, the immune cells may include T cells.

In the present application, the cells may be HLA-B homozygous cells.

In the present application, the cells may be HLA-A homozygous or heterozygous cells.

For example, the method for preparing immune cells may include:

(1) Collect the peripheral blood of healthy people, carry out HLA typing test, select the typing that meets our needs, separate PBMC, add CD3 magnetic beads according to the proportion and incubate, and carry out CD3+T cell sorting; CD3/CD28 antibody Mix the coupled magnetic beads evenly, take out an appropriate amount of magnetic bead suspension according to the calculated amount, add it to the T cell culture system, activate the T cells, and culture overnight;

(2) Infect T cells according to the titer of EGFR CAR virus;

(3) knock out TRAC and HLA-A genes at the same time;

Uses, pharmaceutical compositions and methods of treatment

In another aspect, the present application provides a pharmaceutical composition, which may comprise the aforementioned chimeric antigen receptor, the aforementioned isolated nucleic acid molecule, the aforementioned carrier, the aforementioned cell, and/or the aforementioned immune cell, and optionally A pharmaceutically acceptable carrier.

For example, the pharmaceutical composition may include the aforementioned immune cells and optionally a pharmaceutically acceptable carrier.

In another aspect, the present application provides the aforementioned antigen chimeric receptor, the aforementioned isolated nucleic acid molecule, the aforementioned carrier, the aforementioned cell, the aforementioned immune cell, and/or the aforementioned pharmaceutical composition, which can be used to treat Expression-related diseases or conditions.

In the present application, the diseases or disorders associated with the expression of EGFR may include diseases or disorders associated with up-regulation of the expression of EGFR.

In the present application, the diseases or conditions associated with the expression of EGFR may include EGFR-positive tumors. In EGFR-positive tumors, compared with normal cells, the protein expression of EGFR on the surface of tumor cells or in the tumor microenvironment is about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80% or higher. For example, the tumor may include glioma, breast cancer, lung cancer, ovarian cancer, head and neck cancer, cervical cancer, esophageal cancer, pancreatic cancer, eye cancer, mesothelioma, biliary tract cancer, prostate cancer, liver cancer, fibrosarcoma , colon and/or stomach cancer. For example, the tumor can include fibrosarcoma.

In another aspect, the present application provides the aforementioned chimeric antigen receptor, the aforementioned isolated nucleic acid molecule, the aforementioned vector, the aforementioned cell, the aforementioned immune cell, and/or the aforementioned pharmaceutical composition in the preparation of medicines, The medicament can be used to treat diseases or conditions associated with the expression of EGFR.

On the other hand, the present application provides a method for preventing or treating a disease or disorder related to the expression of EGFR, which may include administering to a subject in need an effective amount of the aforementioned chimeric antigen receptor, the aforementioned isolated nucleic acid molecule , the aforementioned carrier, the aforementioned cell, the aforementioned immune cell, and/or the aforementioned pharmaceutical composition.

In certain embodiments, the disease or disorder associated with expression of EGFR may include a disease or disorder associated with up-regulated expression of EGFR.

Not intending to be limited by any theory, the following examples are only for explaining the fusion protein, preparation method and application of the application, and are not intended to limit the scope of the invention of the application.

Example

Example 1

1.1 Design of anti-EGFR chimeric antigen receptor (CAR)

The anti-EGFR CAR structure includes: an EGFR antigen-binding region (derived from an anti-EGFR scFv whose amino acid sequence is shown in SEQ ID NO: 198), a CD8A extracellular hinge region, a CD8A transmembrane region, and a 4-1BB cell co-stimulatory domain and a CD3ζ activation signaling domain. The amino acid sequence of the non-antigen binding domain of EGFR CAR is shown in SEQ ID NO:19, and the nucleotide sequence is shown in SEQ ID NO:20.

1.2 Construction of lentiviral vector for EGFR CAR

According to the EGFR sequence information and the CAR vector structure, construct the EGFR CAR lentiviral expression vector, and the schematic diagram of the vector (see Figure 1). Optimization: select the commercial lentiviral expression vector pCDH-CMV-MCS-EF1-copGFP as the backbone, and carry out element transformation on the basis of this vector. First, the ampicillin resistance gene β-lactamase of the vector was replaced with the aminoglycoside phosphotransferase derived from Tn5, so that the vector had kanamycin resistance. Second, we deleted the CMV promoter and its adjacent downstream multiple cloning sites, which are potentially threatening for in vivo applications. Finally, the copGFP gene expressed by the EF1 promoter in the original vector was deleted, the SalI restriction site was retained, and the SmaI restriction site was added at the 5' end of SalI for vector construction to form the final destination vector. The added SmaI restriction site is a single restriction site for the final destination vector, and other sequence parts of the vector do not have this restriction site. After optimization, a chimeric antigen receptor lentiviral expression vector was constructed, and after the sequence was confirmed by sanger sequencing, the lentiviral packaging was carried out.

1.3 Design guide RNA

Through the website https://www.ncbi.nlm.nih.gov/, find and download the corresponding gene sequence, use the SnapGene software to open the gene sequence, and design sgRNA on different exons of the target gene. The non-limiting design principle of the sgRNA of the CRISPR/Cas9 system used in this example is: 5'-NNN(20)-NGG-3', NGG is called protospacer adjacent motif (PAM), wherein , N represents A, T, C or G. Since many sgRNAs can be designed on the same exon, and sgRNAs consisting of 20 nucleotide sequences may appear repeatedly in the genome, use the website http://crispr.cos.uni-heidelberg.de to Carry out the design and evaluation of sgRNA, paste the exon sequence to this website, the website designs sgRNA and conducts prediction evaluation, the higher the score in the evaluation, it means that there may be higher editing efficiency and lower off-target risk, from which Select the sgRNA with higher score to test. The sgRNA targeting the TRAC gene is shown in SEQ ID NO:138 to SEQ ID NO:152, the sgRNA targeting the HLA-A02 gene is shown in SEQ ID NO:153 to SEQ ID NO:174, and the targeting HLA-A11 gene The sgRNA of the gene is shown in SEQ ID NO:175 to SEQ ID NO:185, and the sgRNA targeting the HLA-A24 gene is shown in SEQ ID NO:186 to SEQ ID NO:193, which were synthesized by GenScript Biotechnology Company.

Example 2

2.1 Donor Screening

According to the HLA-B typing of the recipient, select HLA-B homozygotes that match the HLA-B typing of the recipient.

First, the source of the donor is based on the HLA-B homozygote in the population. One of the alleles of the patient's HLA-B is consistent with the donor's HLA-B homozygote. Cells from these donors can cover a high number of patient populations . Reduce the rejection caused by the inconsistency of HLA-B subtypes. HLA-B mainly selects B*40 homozygote, B*15 homozygote, B*46 homozygote, B*13 homozygote, B*51 homozygote, B*58 homozygote, B*07 homozygote with high frequency in the population Homozygote, B*35 homozygote, B*44 homozygote, B*52 homozygote, B*57 homozygote, B*54 homozygote, B*55 homozygote. HLA-A selects A*02 homozygotes, A*11 homozygotes and A*02/A11 heterozygotes with higher frequencies in the population.

2.2 Preparation of CD3+ T cells

(1) Isolation of PBMCs from peripheral blood

Peripheral blood was collected from healthy donors and diluted 1:1 with PBS buffer. Into a new 50mL centrifuge tube, first add cell separation solution (Ficoll) with 1/3 of the diluted blood volume, then add blood cell dilution solution very slowly along the tube wall, and centrifuge at 800g for 20min at room temperature (set the centrifuge to increase speed 1, reduce speed 0). After centrifugation, the liquid in the centrifuge tube is divided into PBS and serum layer, white blood cell layer, lymphocyte separation solution, and red blood cell layer from top to bottom. Remove the PBS and serum layer, move the white blood cell layer to a new 50ml centrifuge tube, add PBS to 40ml to wash the cells, and centrifuge at 450g for 10min. After centrifugation, the supernatant was discarded to obtain peripheral blood mononuclear cells. Cell counts were performed after the cells were resuspended.

(2) Recovery of frozen PBMC from healthy people

Resuscitate frozen healthy human PBMC cells in a 37°C water bath, and after complete thawing, transfer the cells into a 15ml centrifuge tube containing 10ml of X-VIVO15 medium (purchased from LONZA) containing 10% FBS, and centrifuge at 400g for 8min Remove the supernatant, add 2ml X-VIVO15 medium (containing 10% FBS and DNase I with a final concentration of 100μg/ml) and incubate at room temperature for 15min, shake constantly during the incubation; filter the solution after incubation with a 40μm filter Filter, and absorb 10ml of PBS buffer to resuspend the cells at the bottom, then add them to the filter, filter and centrifuge at 400g for 8min, discard the supernatant after centrifugation, and count the cells after resuspension.

(3) CD3 ⁺ T cell sorting

T cells in peripheral blood mononuclear cells (PBMC) were extracted using EasySep ^TM Human T Cell Separation Kit (purchased from StemCell Technologies, catalog number: 17951). Adjust the PBMC density to 5×10 ⁷ cells/ml, and add PBS buffer in the range of 0.25-2ml; first add cocktail to mix well, then add isolation cocktail at 50 μl/ml, mix well and place at room temperature for 5 minutes; shake RapidSpheres by vortex After vortexing for 30s, add 40μl/ml to the cells and mix well; add buffer to the multiple of 2.5ml, and gently blow up and down 2-3 times; add 2.5ml to each tube respectively, and put Place the cryovial on the magnetic stand, and let it stand at room temperature for 3 minutes; gently open the cap of the cryovial, carefully hold the two sides to pick up the magnetic stand, keep it upside down for 2-3 seconds, and pour the cell solution into a new centrifuge tube at one time; use 10 - After resuspending the cells in 20ml buffer (depending on the cell volume), centrifuge at 300g for 10min, discard the supernatant, and obtain CD3 ⁺ T cells.

(4) T cell activation

The activation reagent was configured according to the medium:Transact=99:1 volume ratio, and the medium was X-VIVO15 medium (containing 5% FBS, 200U/ml IL2, 10ng/ml IL7 and 5ng/ml IL15), and Transact was purchased from the U.S. Tianyi. T cells were fully resuspended with 1ml of activation reagent (containing 10μl Transact) per 1×106 cells, and incubated in a 37°C, 5% CO ₂ incubator for 1 day.

Example 3

3.1 Transfer virus

CD3+T cells were obtained according to the method of Example 2 (D0 day), and activated with CD3/CD28 antibody magnetic beads, and transfected with a lentiviral vector (the EGFR CAR lentiviral expression vector prepared in Example 1) on D1 day after activation, On D2, the lentiviral vector was washed away, and on D3, electroporation was performed.

3.2 Gene knockout

Use an electroporation kit (purchased from LONZA, catalog number V4XXP-3024) to transfer the RNP complex into the activated T cells prepared in 3.1 (take the CAR-T cells on D3 as the initial cells) by electroporation. After sampling and counting, the cells were collected and centrifuged, and the cell pellet was resuspended with PBS. Preheat the medium (X-VIVO15 medium + 10% FBS + IL2 (200 U/ml) + IL7 (10 ng/ml) + IL15 (5 ng/ml)) in the well plate 30 minutes in advance. Prepare the electroporation buffer: Nucleofector Solution: Supplement is configured according to 82:18; according to each electroporation system, use 1x10 ⁷ cells to distribute the RNP complex (Cas9:sgRNA=2:1), first add 10 μg sgRNA to the PCR tube ( RNase-free), add 20 μg of Cas9 protein (purchased from thermo, product number A36499), mix gently, and incubate at room temperature for 12 min. Count the above cells, centrifuge at 300g for 8min, discard the supernatant, add PBS to resuspend the cells, absorb 1E7 cells and centrifuge again at 300g for 8min, discard the supernatant, and resuspend the cells with 100μl of prepared electroporation buffer. Add the incubated RNP complex to the above cell suspension, mix gently, and then gently transfer the mixture to the electroporation cup. Place the electroporation cup on the Lonza-4D electroporation instrument, and select the EO-115 electroporation program for electroporation. Add the preheated medium to the electric transfer cup, then transfer the cells into the preheated medium in the well plate with a matching pipette, and then place it in a 37°C, 5% CO ₂ incubator for 48 hours to harvest the cells, sanger The editing efficiency was detected by sequencing, and the knockout efficiency was detected by FACS at the same time.

Wherein the sgRNA sequence TRAC sgRNA: AGAGTCTCTCAGCTGGTACA (SEQ ID NO: 138), A02 sgRNA: CTGACCATGAAGCCACCCCTG (SEQ ID NO: 155), A11 sgRNA: GGCCCCTCCTGCTCTATCCA (SEQ ID NO: 185).

3.3 CD3 negative T cell sorting

Sorting CD3-negative T cells, centrifuging after counting cells, discarding supernatant; resuspending cells with buffer and mixing, adding CD3 magnetic beads to 20ul CD3 magnetic beads/ ¹⁰⁷ cells, mixing evenly, and incubating in a 4-degree refrigerator. Add buffer to wash the cells and centrifuge to separate the magnetic beads. First, put the column on the magnetic pole, and put the centrifuge tube below it, soak the column (LD) with buffer, add the cells to the column, do not generate air bubbles, and wash the column twice with buffer , collect the washed liquid (CD3-T) in a 15ml centrifuge tube, and take some cells for cell counting.

3.4 Cell culture

Observe the state of the cells under the microscope, take the cells for dilution and counting, supplement the whole medium to maintain the cell density at 3x10^5-1x10^6 cells/ml, replenish/change the medium in the middle, and culture at 37°C and 5% CO ₂ . Cell harvesting: Collect cells in a centrifuge tube and discard after centrifugation, wash the cells again with normal saline, centrifuge, prepare a cryopreservation solution, resuspend the centrifuged cells in the cryopreservation solution, and draw the cell suspension into the final product with a cell freezer In the storage bag, label the cell cryopreservation bag for the next step of freezing.

3.5 Detection of gene knockout efficiency

(1) Sanger sequencing detection

For cell counting, take 3 to ⁵ ×104 cells, centrifuge at 2000r/min for 5min, remove the supernatant as much as possible, then add 20μl DE lysate to each tube, add the cells to the PCR tube after lysing, centrifuge briefly, and put on the PCR instrument. Machine conditions: 65°C for 30min, 4°C for 30s, 95°C for 2min, 16°C for no limit. Using the primer pair TRAC-For/TRAC-Rev, or HLA-A For/HLA-A Rev, the cleavage product was used as a template for PCR, and the PCR product was sent to Jinweizhi for Sanger sequencing. After getting the sanger sequencing results, use the EditR editor in the website: https://moriaritylab.shinyapps.io/editr_v10/ to predict where the editing occurs and the editing efficiency.

(2) flow cytometry cell count

Take 10E5 to 10E8 cells, centrifuge at 2000rpm for 5min, remove the supernatant, then add 100μl of PBS buffer to each tube to resuspend the cells, then add 5μl of anti-human AB TCR-APC (purchased from eBioscience) antibody, HLA-A12 Monoclonal Antibody ( BB7.2), APC, 5 μl of eBioscince ^TM (purchased from invitrogen) antibody, mix well and incubate at room temperature for 10 min. Centrifuge at 2000rpm for 5 minutes, wash twice with PBS buffer, resuspend the cells, and detect them with a BD FACSAria flow cytometer to obtain the positive rate of TCR and HLA-A12 expression on the cell surface. Knockout efficiency=(AB)/A×100%; A is the positive expression rate of the control group; B is the positive expression rate of the knockout group.

The results are shown in Figure 3A-3D, the CAR positive rate of anti-EGFR UCAR-T cells can reach more than 34% (Figure 3A), and the central memory ratio of anti-EGFR UCAR-T cells is about 45% (Figure 3B), anti- The double knockout efficiency of EGFR UCAR-T cells was as high as 95% (Figure 3C), and the average amplification factor was over 100X (Figure 3D).

Example 4 In vitro cytotoxicity analysis of anti-EGFR UCAR-T cells

4.1 Killing of target cells by anti-EGFR UCAR-T cells

(1) EGFR target cells: HT1080-Luciferase-GFP; adjust the state of the target cells to the logarithmic growth phase, and need to be continuously passaged twice before the experiment;

(2) Preparation of anti-EGFR UCAR-T cells and control group anti-EGFR CAR-T, T cells, flow cytometric detection of knockout efficiency, transfection efficiency, CD3-T sorting efficiency and the proportion of memory T cells, statistical expansion Multiplier (see Figure 2);

(3) several groups of cells prepared by centrifugation, each group of 6x10^6 cells;

(4) The target cells were resuspended in 1640+10% FBS, and three 24-well plates were taken for each target site, and the target cells were inoculated according to the amount of 2x10^5/well. (Both target cells and effector cells were seeded at a density of 2x10^6/ml). Then add effector cells according to the E/T (effect-to-target ratio, effector cells: target cells) ratio. Replenish each well to the maximum volume (such as 600ul). The control was inoculated with the same number of target cells without adding effector cells (600ul). The well plate was placed in a 5% CO ₂ , 37° C. incubator and incubated for 24 hours. E/T: 1:2, 1:1, 2:1, 5:1, 10:1 plank, repeat three times.

(5) Cultivate for 24 hours, take the orifice plate out of the incubator, and collect 200ul of supernatant. Then, the ability of recombinant CAR-T cells to lyse target cells was reflected by detecting Luciferase activity.

The formula for calculating the percentage of target cell lysis:

Result analysis: anit-EGFR UCAR-T has a significant killing effect on HT1080-Luciferase-GFP cells, and the killing efficiency can reach more than 90% when the effect-to-target ratio is 1:2 (see Figure 4).

4.2 Anti-EGFR UCAR-T cells co-cultured with target cells to detect cytokine secretion

The supernatant of the above co-culture system was collected to detect the secretion level of cytokines. Analysis of the results (Fig. 5A-5C): anti-EGFR UCAR-T was significantly activated, and a large amount of IL-2, IFN-γ and TNF-α cytokines were secreted.

Example 5 anti-tumor effect of anti-EGFR UCAR-T cells in vivo

8-10-week-old NSG mice were subcutaneously injected with tumor cell HT1080-Luciferase-GFP (5x10^6). The mice were divided into three groups with 5 mice in each group. The tumor formation time was generally 2-4 weeks. Anti-EGFR UCAR-T cells, anti-EGFR CAR-T cells, and non-gene-knockout T cells 5E6 were injected intratumorally into each group of mice, with a single point injection and an injection volume of 50ul. Tumor regression in mice was monitored by luciferase (see Figure 5).

Analysis of the results (Figure 6): In the mice reinfused with anti-EGFR UCAR-T cells, the tumor growth rate was significantly slowed down, and the anti-EGFR UCAR-T cells showed excellent anti-tumor effects.

Example 6 In vivo half-life detection of targeting EGFR UCAR cells

Prepare 15 humanized immune system mice (hHSC-NCG). Divide into 3 groups. Preparation of cells, experimental group anti-EGFR UCAR-T cells (knockout TRAC+HLA-A02); control group 1: anti-EGFR CAR-T; control group 2: anti-EGFR UCAR-T cells (knockout TRAC+B2M ); each mouse was injected with 1x10^7 cells, and blood was collected at different time points D0, 2h, D3, D7, D14, D21, D28, D35, D42, D49, D56, D60. Genomes were extracted from blood samples at different time points, and the copy/ng genome DNA was calculated by QPCR absolute quantification method. The positive control used UCAR-T cells harvested on the 14th day, and the negative control used DEPC water.

Analysis of results (Figure 7): anti-EGFR UCAR-T cells (knockout TRAC+HLA-A02) survived in mice for about 70 days, and underwent secondary expansion in week7-week9.

Example 7 In vitro safety verification of universal T cells

(1) GVHD response: Prepare TRAC, HLA-A double-knockout T cells, T cells without gene knockout, irradiate allogeneic PBMC, stimulate the two groups of cells prepared respectively, and detect the level of IFN-r.

Analysis of the results: TRAC, HLA-A double knockout T cell group IFN-γ secretion level is very low, indicating that TRAC knockout reduces the GVHD response.

(2) Allogeneic reaction: Allogeneic PBMC stimulated the cells of the two groups after irradiation, and detected the level of IFN-r.

Analysis of the results: TRAC, HLA-A double-knockout T cell group IFN-γ secretion level is very low, indicating that HLA-A knockout reduces the alloreaction.

Example 8 In vivo safety verification of universal T cells

(1) GVHD response: prepare TRAC, HLA-A double knockout T cells, and T cells without gene knockout. 8-10 weeks NSG mice were injected with 1x10^7 respectively, and the graft-versus-host reaction was observed through clinical indicators: survival rate, fur texture and skin integrity, etc. Cytokine detection: Peripheral blood serum was collected to detect the levels of cytokines such as IL6, IL-2, TNF-α, IFN-γ, etc. Blood collection time: before reinfusion, 24h, D3, D7, D14, D28, 2M. Detection of organ lesions: At the end of the observation period (about 2 months), the spleen, liver, skin, gastrointestinal tract, lung, and kidney of the mice were taken for HE section staining analysis.

RESULTS: Four of five mice injected with untreated T cells developed lethal graft-versus-host disease (GVHD) within 2 months of injection. None of the mice receiving TRAC, HLA-A double knockout cells developed GVHD; the TRAC, HLA-A double knockout T cell group secreted very low levels of cytokines IL6, IL-2, TNF-α, IFN-γ; and The morphology of different organs of the mice was normal. It shows that TRAC, HLA-A double-knockout T cell group greatly reduces the GVHD response.

(2) Allogeneic reaction: preparation of TRAC, HLA-A double knockout CAR-T cells, and co-injection of 1x10^7 TCR-HLA-A-double knockout CAR-T cells and 2x10^6 allogeneic T cells into NSG mice in vivo. Control group: Inject 1x10^7 TCR-CAR-T cells into NSG mice.

Blood was taken at different time points to measure the CAR copy number. The copy number changes of CAR in the two groups were compared. Time points: D1, D5, D7, D10, D14.

Cytokine detection: Peripheral blood serum was collected to detect the levels of cytokines such as IL6, IL-2, TNF-α, IFN-γ, etc. Time points: D1, D5, D7, D10, D14.

Conclusion: On D13, the rejection reaction of mice in the control group was obvious, and the copy number was basically undetectable; while the copy number of the experimental group was still at a high level, indicating that the rejection reaction was significantly weakened, and the survival time of the cells in the experimental group was prolonged in the mice ; It shows that TRAC, HLA-A double-knocked CAR-T cell group greatly reduces the rejection reaction (see Figure 8A-8B).

Example 9 Safety Analysis of Gene Editing

Prepare TRAC, HLA-A double knockout T cells, and T cells without gene knockout. After testing the knockout efficiency, perform the following analysis:

(1) Off target:

Control group: transfer to CAS9+ODN label

Experimental group: transfer CAS9+sgRNA(TRAC+HLA-A)+ODN tag

On-target and off-target-WGS: (Whole genome sequencing): 1×10^6 T cells without gene knockout, TRAC, and HLA-A double-knockout T cells were taken respectively and sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for detection .

Result analysis: The off-target rate in the experimental group was very low, and off-targets were mainly concentrated between genes and introns, and had little effect on gene functions (see Figure 9).

(2) Chromosomal translocations: qPCR methods were used to quantify rearrangements that may occur when editing the TRAC and HLA loci simultaneously. The two translocations are labeled TRAC:HLA, HLA:TRAC. A positive reference sample from the synthesized template plasmid was evaluated as an assay control. The amplified fragments on both sides of the HLA genome target region were used as internal controls. Genomic DNA was extracted for real-time quantitative PCR, and the gene copy number of genomic DNA was calculated according to the standard curve and Cq value.

Result analysis: double-knockout T cells (TRAC+HLA-A) detected whether chromosomal translocation occurred on D14 (harvest). The detection results: the detection values of both translocation methods were close to zero detection value, indicating that no rearrangement of the loci occurred ( See Figure 10).

(3) Karyotyping: Take 70-80% confluence of non-knockout T cells, TRAC, and HLA-A double-knockout T cells, each with 1×10^6 in 2 T25 flasks , filled with culture medium, covered with a fully sealed lid, wrapped with parafilm, and sent to Zhejiang Ruyao Biotechnology Co., Ltd. for testing.

Result analysis: Compared with the control group, the karyotype of the experimental group was normal (see 11).

(4) Residual Cas9 protein: During cell preparation, 1×10^6 cells at each of the three time points before knockout, after knockout, and before harvest were lysed, and then protein quantification kit (NOVATEINBIO, Cat. No. NB-E1372PR ) for quantification, the samples in each group were adjusted to the same loading volume of 2 μg, and the CRISPR/Cas9 protein ELISA kit was used for detection according to the instructions. The Cas9 protein in the sample is firmly and stably placed on the test paper well. Then use the detection antibody to recognize the bound Cas9 protein, and then develop with the developer. The Cas9 ratio is proportional to the absorbance, and the absolute amount of Cas9 protein is quantified by comparing with the Cas9 control.

Result analysis: Double knockout T cells (TRAC+HLA-A) detected the residue of spCas9 at four time points before electroporation (D3), before electroporation (D5), D9, and D14 (harvest). Trace residues were detected before solution (D5), but not detected at the other three time points. (See Figure 12).

Example 10 Preparation of T cells with single gene knockout

The RNP complex was transferred into the activated T cells prepared in Example 2 by electroporation using an electroporation kit (purchased from LONZA, product number V4XXP-3024). Preheat the medium (X-VIVO15 medium + 10% FBS + IL2 (200 U/ml) + IL7 (10 ng/ml) + IL15 (5 ng/ml)) in the well plate 30 minutes in advance. The electroporation buffer was configured according to Nucleofector Solution: Supplement=82:18. Prepare the RNP complex: the sgRNA sequence of TRAC is sg9 (as shown in SEQ ID NO: 138), the sgRNA sequence of HLA-A is HLA-A02 Sg2 (as shown in SEQ ID NO: 154) or HLA-A02Sg5 (as shown in SEQ ID NO: 154) ID NO: 155) or HLA-A11 sg21 (as shown in SEQ ID NO: 185) or HLA-A11Rsg2 (as shown in SEQ ID NO: 184), first add 20 μg sgRNA to the PCR tube (no RNase) 10 μg of Cas9 protein (purchased from thermo, catalog number A36499) was added, mixed gently, and incubated at room temperature for 12 min. Count the activated T cells cultured in Example 2, centrifuge at 300g for 8min, discard the supernatant, add PBS to resuspend the cells, absorb 1E7 cells and centrifuge again at 300g for 8min, discard the supernatant, and resuspend the cells with 100μl of prepared electroporation buffer . Add the incubated RNP complex to the above cell suspension, mix gently, and then gently transfer the mixture to the electroporation cup. Place the electroporation cup on the Lonza-4D electroporation instrument, and select the EO-115 electroporation program for electroporation. Add the preheated medium into the electro-cup, then transfer the cells into the preheated medium in the well plate with a matching pipette, and then place them in a 37°C, 5% CO ₂ incubator for culture.

Example 11 Comparison of Gene Knockout Efficiency Detection Methods

(1) Sanger sequencing detection

For cell counting, take 3-5×104 cells, centrifuge at 2000r/min for 5min, remove the supernatant as much as possible, then add 20μl DE lysate to each tube, add the cells to the PCR tube after lysing, centrifuge briefly, and put it on the PCR instrument. Conditions: 65°C for 30min, 4°C for 30s, 95°C for 2min, 16°C indefinitely. Using the primer pair TRAC-For/TRAC-Rev, or HLA-A For/HLA-A Rev, the cleavage product was used as a template for PCR, and the PCR product was sent to Jinweizhi for Sanger sequencing. After getting the sanger sequencing results, use the EditR editor in the website: https://moriaritylab.shinyapps.io/editr_v10/ to predict where the editing occurs and the editing efficiency.

(2) TA clone sequencing detection

Utilize AxyPrepTM PCR Product Cleaning Kit (purchased from AXYGEN) to purify the PCR product, then use the kit (DNA A-Tailing Kit, purchased from TaKaRa) to add sticky ends to the purified PCR product, pass DNA Ligation Kit Ver2.1 (purchased from TaKaRa) and the product was connected to the T vector (pMDTM19-T Vector Cloning Kit was purchased from TaKaRa), the connected product was transformed into competent cells (DH5alpha), and then spread on the LB plate containing ampicillin resistance, and placed in a 37°C incubator After cultivating for about 12 hours, pick a single colony, and send the single colony liquid to Jinweizhi for sequencing. Knockout efficiency = number of mutant clones/total number of clones.

(3) Flow cytometry cell counting

Take 10E5 to 10E8 cells, centrifuge at 2000rpm for 5min, remove the supernatant, then add 100μl of PBS buffer to each tube to resuspend the cells, then add 5μl of anti-human AB TCR-APC (purchased from eBioscience) antibody, HLA-A02 Monoclonal Antibody ( BB7.2), APC, 5 μl of eBioscince ^TM (purchased from invitrogen) antibody, mix well and incubate at room temperature for 10 min. Centrifuge at 2000rpm for 5 minutes, wash twice with PBS buffer, resuspend the cells, and detect them with a BD FACSAria flow cytometer to obtain the positive rate of TCR and HLA-A02 expression on the cell surface. Knockout efficiency=(AB)/A×100%; A is the positive expression rate of the control group; B is the positive expression rate of the knockout group.

The three detection results of TRAC single gene knockout are shown in Figure 13 to Figure 15, and the knockout efficiency calculation results are shown in Table 1. The three detection methods are basically the same, and only the Sanger sequencing method was used to detect the editing efficiency in subsequent experiments.

Table 1 Results of gene knockout efficiency detection method

The results of the Sanger sequencing method for HLA-A02 gene editing are shown in Figures 16-17, and the editing efficiency is 90%; the results of the Sanger sequencing method for HLA-A11 gene editing are shown in Figures 18-19.

Example 12 Preparation of T cells with double gene knockout of TRAC gene and HLA-A gene

The RNP complex was transferred into the activated T cells prepared in Example 2 by electroporation using an electroporation kit (purchased from LONZA, product number: V4XXP-3024). Preheat the medium (X-VIVO15 medium + 10% FBS + IL2 (200 U/ml) + IL7 (10 ng/ml) + IL15 (5 ng/ml)) in the well plate 30 minutes in advance. The electroporation buffer was configured according to Nucleofector Solution: Supplement=82:18. Prepare the RNP complex: 20 μg TRAC sgRNA (TRAC Sg9), 20 μg HLA-A sgRNA (HLA-A02 Sg2 or HLA-A02 Sg5 or HLA-A11 sg21 or targeting HLA-A*24:02:01, HLA-A A*30:01:01:01, HLA-A*33:01:01:01, HLA-A*03:01:01:01, HLA-A*01:01:01:01, or HLA-A* 26:01:01:01 sgRNA) into PCR tubes (no RNA), and then add 10 μg Cas9 protein (purchased from thermo, product number A36499) respectively, mix gently, and incubate at room temperature for 12 minutes. Count the activated T cells cultured in Example 2, centrifuge at 300g for 8min, discard the supernatant, add PBS to resuspend the cells, absorb 1E7 cells and centrifuge again at 300g for 8min, discard the supernatant, and resuspend the cells with 100μl of prepared electroporation buffer . Add the incubated TRAC and HLA-A RNP complex to the above cell suspension, mix gently, and then gently transfer the mixture to the electroporation cup. Place the electroporation cup on the Lonza-4D electroporation instrument, and select the EO-115 electroporation program for electroporation. Add the preheated medium into the electro-cup, then transfer the cells into the preheated medium in the well plate with a matching pipette, and then place them in a 37°C, 5% CO ₂ incubator for culture.

The double-gene knockout efficiency is detected by sequencing, and TRAC-negative and HLA-A-negative T cells with a double-gene knockout efficiency of not less than 80% can be obtained. The results are shown in Figure 20-21. Among them, Figure 20A shows the results of using HLA-A02 Sg5 to knock out HLA-A02, and the upper line shows the results of the control group (that is, the results of knocking out HLA-A02 Sg5 are not used); the next line shows the simultaneous knockout of HLA -The results of A02 and TRAC; where Figure 20B shows the results of knocking out TRAC using TRAC Sg9, where the upper line shows the results of the control group (that is, no knocking out with TRAC Sg9); the next line shows simultaneous knockout HLA-A02 and TRAC results. Figure 21A-21B shows the knockout situation of knockout HLA-A02 and TRAC protein level, wherein NEG refers to the negative control, WT refers to the situation without any knockout treatment, TRAC+HLA-A double knockout refers to the simultaneous knockout of HLA- Results of A02 and TRAC.

Example 13 Differences in the expression of TRAC gene, HLA-A gene, B2M gene and CIITA gene in T cells with double gene knockout and corresponding genes in corresponding cells

(1) The activated T cells prepared in Example 2 were divided into two groups, one group was used as a control, and the other group prepared TRAC gene and HLA-A gene double gene knockout T cells according to the method in Example 5, according to Sanger sequencing was performed in the manner of step (1) of Example 4. According to the sequencing results, the TRAC and HLA-A double gene knockout cells were obtained. The prepared double gene knockout T cells are incubated with corresponding TRAC and HLA-A antibodies, and the double gene knockout cell lines can be obtained by flow sorting or magnetic bead sorting.

(2) To detect the change of mRNA expression level between the double gene knockout T cells and the control group. RNA extraction kit (purchased from QIAGEN, catalog number: 74004) was used to extract RNA, and reverse transcription kit (purchased from Applied Biosystems, catalog number: 4368814) was used to reverse transcribe RNA to obtain cDNA, which was used as template for quantitative PCR detection.

(3) Detecting the changes in the protein expression level of the double-gene knockout T cells compared with the control group. Use the whole protein extraction reagent (purchased from Thermo Scientific, product number: 87787) to extract protein, and detect the protein expression level by Western Blot method or flow cytometry method, and the antibodies used are TRAC antibodies (purchased from eBioscience, product number: 17-9986-42) , HLA-A antibody (purchased from Merck, catalog number: 17-9876-41), B2M antibody (purchased from Invitrogen, catalog number: A15770) and CIITA antibody (purchased from OriGene, catalog number: CF812200).

Sanger sequencing detects that the nucleotide sequence of TRAC and/or HLA-A genes in double gene knockout T cells has changed relative to the control group; quantitative PCR shows that TRAC and/or HLA-A genes in double gene knockout T cells The gene mRNA expression was down-regulated, while the mRNA expression of B2M and/or CIITA gene was not down-regulated. The results of FACS and Western Blot showed that the protein expression was down-regulated in double gene knockout T cells, but the expression of B2M and/or CIITA protein was not down-regulated.

The results are shown in Figure 22-23. Wherein, what Fig. 22 shows is the mRNA level determination of gene expression, and wherein Fig. 22 shows the mRNA level of TRAC, HLA-A, B2M and CIITA; Wherein WT refers to the situation without any knockout treatment, double knockout group refers to TRAC gene and HLA-A gene double knockout T cells results. Figure 23 shows the protein level determination of gene expression, wherein Figure 23A-23B shows the protein expression levels of B2M and CIITA respectively; wherein NEG refers to the negative control, WT refers to the situation without any knockout treatment, TRAC+HLA-A Double knockout refers to the result of T cells with double gene knockout of TRAC gene and HLA-A gene.

Example 14. Preparation of T cells knocked out of the TRAC gene, HLA-A/B2M gene and CIITA gene and verification of the expression changes of the corresponding three genes

(1) Prepare the control group and TRAC gene, HLA-A gene and CIITA gene three-gene knockout cells, and TRAC gene, B2M gene and CIITA gene three-gene knockout cells according to the method of Example 13 step (1).

(2) Detect changes in protein expression levels by FACS and Western Blot methods according to the method of step (3) in Example 13.

Compared with control cells, the protein expression levels of TRAC, HLA-A and CIITA genes in TRAC, HLA-A and CIITA gene knockout T cells were down-regulated; compared with control cells, TRAC, B2M and CIITA triple gene knockout The protein expressions of TRAC, HLA-A and CIITA genes were down-regulated in T cells.

(3) Use TRAC (purchased from eBioscience, catalog number: 17-9986-42), HLA-A (purchased from Merck, catalog number: 17-9876-41), B2M (purchased from: Invitrogen, catalog number: A15770) antibodies through flow-through Cytometry was used to detect the knockout efficiency of the double gene knockout cells in Example 13 and the two triple gene knockout cells in this example. The results showed that the efficiency of multiple gene knockouts was simultaneously achieved at the single cell level. Except significantly higher than triple gene knockout.

The results are shown in Figures 24A-24D. 24A-24C show the knockout status of TRAC, HLA-A and B2M protein levels in sequence. Among them, WT refers to the situation without any knockout treatment, TRAC+HLA-A double knockout refers to the result of T cells with double gene knockout of TRAC gene and HLA-A gene; TRAC+HLA-A+CIITA triple knockout refers to TRAC, The result of the T cells of HLA-A and CIITA triple gene knockout; wherein TRAC+B2M+CIITA triple knockout refers to the result of B2M, CIITA and TRAC triple gene knockout of T cells; TRAC+HLA-A knockdown refers to Example 16 Results of preparation of TRAC and HLA-A knockdown T cells. Figure 24D shows the knockdown of CIITA protein levels.

The results in Figure 24 show that the protein levels of TRAC, HLA-A, CIITA and B2M were down-regulated compared with the WT control group. At the same time, compared with TRAC+HLA-A+CIITA triple knockout or TRAC+B2M+CIITA triple knockout, the knockout efficiency of TRAC+HLA-A double knockout is higher.

Embodiment 15 designs antisense RNA sequence

Obtain the transcribed RNA sequences of the corresponding genes (TRAC gene and HLA-A gene) through the database https://www.ncbi.nlm.nih.gov/ or www.ensembl.org/, and design siRNA with reference to the following principles:

Try to avoid sequences that are 50-100 nucleotides downstream of the start codon and 100 nucleotides upstream of the stop codon; choose sequences that are less than 30 nucleotides in length; avoid 4 or more consecutive identical bases; avoid Intron regions; avoid repetitive sequences; avoid single nucleotide polymorphism (SNP) sites; sequence GC content between 30% and 60%, preferably sequence patterns AA(N<sub>19), NA(N <sub>21) or NAR(N<sub>17)YNN, A is adenylate; T is thymidylate; R is adenylate or guanylate (purines); Y is thymidylate or cytidine Acid (pyrimidines); N is adenylic acid, thymidylic acid, guanylic acid or cytidylic acid; comparative analysis of homology on the selected sequence to avoid significant homology between antisense RNA and other genes or sequences , resulting in off-target effects. Homology analysis was performed using NCBI Blast tool: Nucleotide-nucleotide BLAST (blastn), UCSC Blat tool or Ensembl Blast.

The antisense RNA sequence that design obtains comprises HLA-A-homo-551 (it comprises the nucleotide sequence shown in SEQ ID NO:194); HLA-A-homo-NEG (it comprises the nucleotide sequence shown in SEQ ID NO:195) nucleotide sequence); TRAC-homo-375 (which comprises the nucleotide sequence shown in SEQ ID NO: 196); TRAC-homo-NEG (which comprises the nucleotide sequence shown in SEQ ID NO: 197).

Example 16 Preparation of T cells knocked down by TRAC gene and HLA-A gene

Double gene knockdown was performed using the antisense RNA designed by Example 15. The company prepares lentivirus (Gimma) with antisense RNA sequences of TRAC gene and HLA-A gene. CD3 ⁺ T cells were prepared according to the method in Example 2 (D0 days), and activated with CD3/CD28 antibody magnetic beads, and the activated T cells were transfected with lentiviruses carrying the antisense RNA sequences of the TRAC gene and the HLA-A gene (D1 day), wash off the lentiviral vector on D2, and continue to culture until D5. The T cells cultured to D5 days were collected, and the gene knockdown efficiency was detected by quantitative PCR or Western Blot and other methods. The obtained T cells are labeled with corresponding TRAC and HLA-A antibodies, and T cells with TRAC gene and HLA-A gene knockdown can be obtained by flow sorting or magnetic bead sorting. The results showed that the mRNA and protein expression levels of TRAC and HLA-A were down-regulated in the TRAC and HLA-A gene knockdown group. Among them, Figures 25A-25B sequentially show the knockout status of TRAC and HLA-A mRNA levels. Among them, WT refers to the situation without any knockout treatment, and TRAC+HLA-A double knockout refers to the result of T cells with double gene knockout of TRAC gene and HLA-A gene. Among them, the knockout levels of TRAC and HLA-A protein levels can be referred to the results in FIG. 24 .

Example 17 Differences of different T cell activities

Prepare the T cells without gene knockout, double gene knockout, three gene knockouts and double gene knockdown in Examples 2, 12, 14 and 16, compare the cell counts of several T cell activities in each group and take them respectively 1*10 ⁶ cells were inoculated in a 24-well plate, and PHA (0.3 μg/ml) (ionomycin +) or 5 ng/ml PMA and 50 ng/ml ionomycin were added to the cells in each well, and after continuing to culture for 5 hours, use CD69 (early activation) (purchased from BD Biosciences, catalog number: FN50) and CD137 (late stage) (purchased from BD Biosciences, catalog number: 4B4-1) antibodies were used to detect the activation status of cells by flow cytometry. The results showed that the activity of T cells with double gene knockout and double gene knockout was better than that of triple gene knockout T cells.

The protein expression of CD69 and CD137 are shown in Fig. 26A-26B respectively. Among them, WT refers to the situation without any knockout treatment, TRAC+HLA-A double knockout refers to the result of T cells with double gene knockout of TRAC gene and HLA-A gene; TRAC+HLA-A+CIITA triple knockout refers to TRAC, The result of the T cells of HLA-A and CIITA triple gene knockout; wherein TRAC+B2M+CIITA triple knockout refers to the result of B2M, CIITA and TRAC triple gene knockout of T cells; TRAC+HLA-A knockdown refers to Example 16 Results of preparation of TRAC and HLA-A knockdown T cells.

Example 18 Differences in Reactivity of Different T Cells to Allogeneic NK Cells

The T cells without gene knockout, double gene knockout, three gene knockouts and double gene knockdown in Examples 2, 12, 14 and 16 were labeled with CFSE (invitrogen, C34554), and the cell counts were taken as 1 *10 ⁶ cells were co-cultured with NK cells (NK92MI) at a ratio of 1:1. After 24 hours, the co-cultured cells were collected, and the ratio of CFSE-positive cells in the mixed cells was detected by flow cytometry.

The results showed that the cytotoxicity of NK cells against double-gene knockout and double-gene knockout T cells was lower than that of triple-gene knockout T cells. The result is shown in Figure 27. Among them, NK+T refers to the situation in which NK cells are co-cultured with T cells without any knockout treatment; NK+TRAC+HLA-A knockdown refers to the combination of NK cells with the TRAC gene and HLA-A gene prepared in Example 16 The results of the knockdown T cells co-culture; NK+TRAC+HLA-A double knockout refers to the co-culture of NK cells and T cells with TRAC gene and HLA-A gene double gene knockout; NK+TRAC+HLA -A+CIITA triple knockout refers to the situation where NK cells are co-cultured with TRAC, HLA-A and CIITA triple knockout T cells; NK+TRAC+B2M+CIITA triple knockout refers to the situation where NK cells are combined with B2M, The case of co-culture of knockout T cells.

Example 19 Differences of different T cell alloimmune rejection reactions

No gene knockout, double gene knockout, three gene knockout and double gene knockdown T cells in Examples 2, 12, 14 and 16 were prepared from peripheral blood from donor 1. CD3 ⁺ T cells were prepared from peripheral blood from donor 2. Each group of cells prepared from the peripheral blood of donor 1 was mixed with the CD3 ⁺ T cells prepared from the peripheral blood of donor 2 in equal proportions, and the expression level of IFN-γ in the cell mixed system was detected 24 hours later. The results showed that the expression level of IFN-γ in the double gene knockout T cell group was lower than that in the triple gene knockout T cell group.

The results are shown in Figure 28, WT refers to the situation without any knockout treatment, TRAC+HLA-A double knockout refers to the result of T cells with double gene knockout of TRAC gene and HLA-A gene; TRAC+HLA-A+CIITA Triple knockout refers to the result of T cells knocked out by three genes of TRAC, HLA-A and CIITA; where TRAC+B2M+CIITA triple knockout refers to the result of T cells knocked out by three genes of B2M, CIITA and TRAC; TRAC+HLA-A knockout Low refers to the result of TRAC gene and HLA-A gene knockdown T cells prepared in Example 16.

Example 20 Preparation of CAR-T cells with double gene knockout of TRAC gene and HLA-A gene, CAR-T cells with triple gene knockout of TRAC gene, HLA-A gene and CIITA gene, and knockout of TRAC gene, B2M gene and CIITA gene Removed CAR-T cells

(1) Obtain CD3 ⁺ T cells (on D0 day) according to the method in Example 2, and activate them with CD3/CD28 antibody magnetic beads. lentivirus) transfection, the lentiviral vector was washed out on D2, and the CAR-positive T cells were sorted on D3 and continued to culture until D5.

(2) Take the CAR-T cells on day D5 as initial cells, prepare TRAC gene and HLA-A gene double gene knockout cells according to the methods in Example 12 and Example 14 respectively, TRAC gene, HLA-A gene and CIITA gene as well as TRAC gene, B2M gene and CIITA gene knockout CAR-T cells.

(3) The double-gene knockout and triple-gene knockout CAR-T cells can be obtained through flow cytometry detection, and the yield of double-gene knockout CAR-T cells is higher than that of triple-gene knockout CAR-T cells.

The results are shown in Figures 29A-29D. Among them, Figures 17A-17C show the knockout status of TRAC, HLA-A and B2M protein levels in sequence. Figure 29D shows the knockdown of CIITA protein levels. Among them, WT refers to the situation without any knockout treatment, TRAC+HLA-A double knockout refers to the result of CAR-T cells with double gene knockout of TRAC gene and HLA-A gene; TRAC+HLA-A+CIITA triple knockout refers to The results of CAR-T cells with triple gene knockout of TRAC, HLA-A and CIITA; where TRAC+B2M+CIITA triple knockout refers to the results of CAR-T cells with triple gene knockout of B2M, CIITA and TRAC.

Among them, the transfection efficiency of CD19CAR is shown in Figure 30A-30B. Among them, CAR30%+ represents the transfection efficiency of CD19 CAR.

Figure 31 shows the expansion factor of different cells. Among them, CAR-T cells with double gene knockout of TRAC gene and HLA-A gene had the highest amplification factor.

Example 21 Anti-tumor effect of CAR-T cells with double gene knockout of TRAC gene and HLA-A gene

CAR-T cells (targeting CD19, CD20 or BCMA) with double knockout of the TRAC gene and HLA-A gene in Example 21 were prepared, and inoculated with target cells expressing luciferase gene (leukemia or lymphoma cells positive for the target gene line, such as Raji, Jurkat, MM1S, etc.) into the well plate, and then add double gene knockout CAR-T cells, Three-gene knockout CAR-T cells or T cells without gene knockout were co-cultured for 24 hours and then transferred to the detection well plate, luciferase substrate was added, and the fluorescence value was detected by a microplate reader. Killing efficiency=1-target cell T cell co-culture fluorescence value/target cell fluorescence value cultured alone.

The results showed that CAR-T cells with double knockout of TRAC gene and HLA-A gene had a significant killing effect on tumor cells.

Figure 32 shows the killing effect of Raji-Luciferase on CD19 target cells, among which the killing effect of CAR-T cells with double knockout of TRAC gene and HLA-A gene is the most significant. Among them, each E/T ratio is the result corresponding to the legend of A-D from left to right.

Example 22 Anti-tumor effect of CAR-T cells with double gene knockout of TRAC gene and HLA-A gene

NSG mice were injected with tumor cells intravenously. After the tumor was successfully established, CAR-T cells with double gene knockout of TRAC gene and HLA-A gene, CAR-T cells with triple gene knockout, or CAR-T cells without gene knockout were reinfused into the mice. T cells, monitoring tumor volume in mice.

The tumor growth rate was significantly slowed down in mice transfused with double-gene knockout CAR-T cells.

The results are shown in Figures 33-34. Among them, Figure 33 shows the administration method to mice, i.v. means intravenous injection, and CAR-T cells represent double-gene knockout CAR-T cells expressing CD19 CAR and triple-gene knockout CAR-T cells. Figure 32 shows the volume of tumors in mice after administration of CAR-T cells. Among them, Figure 32 from left to right shows the three genes of CD19 CAR-T cells, TRAC, HLA-A and CIITA respectively administered with normal saline, unmodified T cells, TRAC gene and HLA-A gene knockout. Tumor volume in mice after knockout CD19 CAR-T cells, B2M, CIITA and TRAC knockout CD19 CAR-T cells. The results showed that the growth rate of tumors was significantly slowed down in mice transfused with CAR-T cells with double gene knockout of TRAC gene and HLA-A gene.

In summary,

1. The present application prepares a chimeric antigen receptor targeting EGFR. The antigen-binding domain (targeting part) of the recombinant receptor is derived from scFv, which has the characteristics of stable structure.

2. The present application provides a lentiviral expression vector. Using pCDH-CMV-MCS-EF1-copGFP as the backbone, the ampicillin resistance gene β-lactamase of the vector was replaced with aminoglycoside phosphotransferase derived from Tn5, so that the vector had kanamycin resistance; The potentially threatening CMV promoter and its adjacent downstream multiple cloning sites in in vivo applications; delete the copGFP gene expressed by the EF1 promoter in the original vector, retain the SalI restriction site, and add it at the 5' end of SalI The SmaI restriction site is used for vector construction to form the final destination vector. The added SmaI restriction site is a single restriction site for the final destination vector, and other sequence parts of the vector do not have this restriction site.

3. This application optimizes the protein-RNA complex electrotransfection technology. A double gene knockout efficiency of more than 90% in primary T cells was obtained.

4. The source of donors for this application is based on the high frequency of HLA-B homozygotes in the population. One allele of the patient’s HLA-B is consistent with the donor’s homozygosity. Cells from these donors can cover a high number of patients population, and can reduce the rejection caused by HLA-B.

5. This application screened out the HLA-A molecules that are highly related to rejection and knocked them out, while retaining other HLA-I molecules, which not only reduced the rejection of allogeneic cells, but also avoided the complete knockout of HLA molecules being NK The occurrence of cell clearance greatly prolongs the half-life of allogeneic CAR-T cells in vivo.

6. This application is the first to construct high-efficiency double-knockout TCR, HLA-A EGFR-UCAR-T cells, to achieve a safe shelf-type ready-to-use therapeutic agent, improve anti-tumor effect, and be used for breast cancer and other diseases the treatment.

The foregoing detailed description has been offered by way of explanation and example, not to limit the scope of the appended claims. Variations on the presently recited embodiments of the present application will be apparent to those of ordinary skill in the art and remain within the scope of the appended claims and their equivalents.

Claims

A chimeric antigen receptor (CAR), which comprises a targeting moiety, the targeting moiety comprises HCDR3, and the HCDR3 comprises the amino acid sequence shown in SEQ ID NO:8.
The chimeric antigen receptor according to claim 1, wherein the targeting moiety comprises HCDR2, and the HCDR2 comprises the amino acid sequence shown in SEQ ID NO:6.
The chimeric antigen receptor according to any one of claims 1-2, wherein the targeting moiety comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO:4.
The chimeric antigen receptor according to any one of claims 1-3, wherein the targeting moiety comprises HCDR1, HCDR2 and HCDR3 in the heavy chain variable region shown in SEQ ID NO:1.
The chimeric antigen receptor according to any one of claims 1-4, wherein said targeting moiety comprises HCDR1, HCDR2, HCDR3, said HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 8; said HCDR2 comprising the amino acid sequence shown in SEQ ID NO:6; and the HCDR1 comprising the amino acid sequence shown in SEQ ID NO:4.
The chimeric antigen receptor according to any one of claims 1-5, wherein the targeting moiety comprises H-FR1, and the C-terminus of the H-FR1 is directly or indirectly connected to the N-terminus of the HCDR1 , and the H-FR1 comprises the amino acid sequence shown in SEQ ID NO:3.
The chimeric antigen receptor according to any one of claims 1-6, wherein said targeting moiety comprises H-FR2, said H-FR2 is located between said HCDR1 and said HCDR2, and said H -FR2 comprises the amino acid sequence shown in SEQ ID NO:5.
The chimeric antigen receptor according to any one of claims 1-7, wherein said targeting moiety comprises H-FR3, said H-FR3 is located between said HCDR2 and said HCDR3, and said H -FR3 comprises the amino acid sequence shown in SEQ ID NO:7.
The chimeric antigen receptor according to any one of claims 1-8, wherein the targeting moiety comprises H-FR4, and the N-terminus of the H-FR4 is directly or indirectly connected to the C-terminus of the HCDR3 , and the H-FR4 comprises the amino acid sequence shown in SEQ ID NO:9.
The chimeric antigen receptor according to any one of claims 1-9, wherein said targeting moiety comprises H-FR1, H-FR2, H-FR3 and H-FR4, said H-FR1 comprising SEQ ID The amino acid sequence shown in NO:3; the H-FR2 includes the amino acid sequence shown in SEQ ID NO:5; the H-FR3 includes the amino acid sequence shown in SEQ ID NO:7; and the H-FR4 includes Amino acid sequence shown in SEQ ID NO:9.
The chimeric antigen receptor according to any one of claims 1-10, wherein said targeting moiety comprises VH, said VH comprising the amino acid sequence shown in SEQ ID NO:1.
The chimeric antigen receptor according to any one of claims 1-11, wherein the targeting moiety comprises LCDR3, and the LCDR3 comprises the amino acid sequence shown in SEQ ID NO:17.
The chimeric antigen receptor according to any one of claims 1-12, wherein the targeting moiety comprises LCDR2 comprising the amino acid sequence shown in SEQ ID NO:15.
The chimeric antigen receptor according to any one of claims 1-13, wherein the targeting moiety comprises LCDR1 comprising the amino acid sequence shown in SEQ ID NO:13.
The chimeric antigen receptor according to any one of claims 1-14, wherein the targeting moiety comprises LCDR1, LCDR2 and LCDR3 in the light chain variable region shown in SEQ ID NO:10.
The chimeric antigen receptor according to any one of claims 1-15, wherein said targeting moiety comprises LCDR1, LCDR2, LCDR3, said LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 17; said LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 15; and the LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 13.
The chimeric antigen receptor according to any one of claims 1-16, wherein the targeting moiety comprises L-FR1, the C-terminus of the L-FR1 is directly or indirectly connected to the N-terminus of the LCDR1 , and the L-FR1 comprises the amino acid sequence shown in SEQ ID NO:12.
The chimeric antigen receptor according to any one of claims 1-17, wherein said targeting moiety comprises L-FR2, said L-FR2 is located between said LCDR1 and said LCDR2, and said L -FR2 comprises the amino acid sequence shown in SEQ ID NO: 14.
The chimeric antigen receptor according to any one of claims 1-18, wherein said targeting moiety comprises L-FR3, said L-FR3 is located between said LCDR2 and said LCDR3, and said L -FR3 comprises the amino acid sequence shown in SEQ ID NO: 16.
The chimeric antigen receptor according to any one of claims 1-19, wherein the targeting moiety comprises L-FR4, the N-terminus of the L-FR4 is directly or indirectly connected to the C-terminus of the LCDR3 , and the L-FR4 comprises the amino acid sequence shown in SEQ ID NO: 18.
The chimeric antigen receptor according to any one of claims 1-20, wherein said targeting moiety comprises L-FR1, L-FR2, L-FR3 and L-FR4, said L-FR1 comprising SEQ ID The amino acid sequence shown in NO:12; The L-FR2 includes the amino acid sequence shown in SEQ ID NO:14; The L-FR3 includes the amino acid sequence shown in SEQ ID NO:16; And the L-FR4 includes Amino acid sequence shown in SEQ ID NO:18.
The chimeric antigen receptor according to any one of claims 1-21, wherein the targeting moiety comprises a VL comprising the amino acid sequence shown in SEQ ID NO:10.
The chimeric antigen receptor according to any one of claims 1-22, wherein the targeting moiety comprises an antibody or an antigen binding fragment.
The chimeric antigen receptor according to claim 23, wherein said antigen-binding fragment is selected from the group consisting of Fab, Fab', F(ab)2, Fv fragment, F(ab')2, scFv, di-scFv , VHH and/or dAb.
The chimeric antigen receptor according to any one of claims 1-24, wherein the targeting moiety comprises a scFv.
The chimeric antigen receptor of claim 25, wherein the scFv targets EGFR.
The chimeric antigen receptor according to any one of claims 1-26, wherein the targeting moiety comprises the amino acid sequence shown in SEQ ID NO:198.
The chimeric antigen receptor according to any one of claims 1-27, comprising a transmembrane domain comprising a transmembrane domain derived from a protein selected from the group consisting of CD8A, CD8B, CD8A, CD8B, CD28, CD3e, CD3ε, 4-1BB, CD4, CD27, CD7, PD-1, TRAC, TRBC, CD3ζ, CTLA-4, LAG-3, CD5, ICOS, OX40, NKG2D, 2B4, CD244, FcεRIγ, BTLA, CD30, GITR, HVEM, DAP10, CD2, NKG2C, LIGHT, DAP12, CD40L, CD154, TIM1, CD226, DR3, CD45, CD80, CD86, CD9, CD16, CD22, CD33, CD37, CD64, and SLAM.
The chimeric antigen receptor of claim 28, wherein the transmembrane domain comprises a transmembrane domain derived from CD8A or CD8B.
The chimeric antigen receptor according to any one of claims 28-29, wherein the transmembrane domain comprises the amino acid sequence shown in any one of SEQ ID NO:21 to SEQ ID NO:69.
The chimeric antigen receptor according to any one of claims 1-30, comprising a co-stimulatory signaling domain comprising a co-stimulatory signaling structure derived from a protein selected from Domains or combinations thereof: CD28, 4-1BB, CD27, CD2, CD7, CD8A, CD8B, OX40, CD226, DR3, SLAM, CDS, ICAM-1, NKG2D, NKG2C, B7-H3, 2B4, FcεRIγ, BTLA, GITR , HVEM, DAP10, DAP12, CD30, CD40, CD40L, TIM1, PD-1, LFA-1, LIGHT, JAML, CD244, CD100, ICOS, CD40, and MyD88.
The chimeric antigen receptor of claim 31 , wherein the costimulatory signaling domain comprises a costimulatory signaling domain derived from 4-1BB.
The chimeric antigen receptor according to any one of claims 31-32, wherein the co-stimulatory signaling domain comprises the amino acid sequence shown in any one of SEQ ID NO:70 to SEQ ID NO:102.
The chimeric antigen receptor according to any one of claims 31-33, wherein the N-terminus of the co-stimulatory signaling domain is directly or indirectly linked to the C-terminus of the transmembrane domain.
The chimeric antigen receptor according to any one of claims 1-34, comprising an intracellular signaling domain comprising an intracellular signal derived from a protein selected from Transduction domains or combinations thereof: CD3ζ, CD3δ, CD3γ, CD3ε, CD79a, CD79b, FceRIγ, FceRIβ, FcγRIIa, bovine leukemia virus gp30, Epstein-Barr virus (EBV) LMP2A, simian immunodeficiency virus PBj14 Nef, DAP10, DAP -12 and a domain containing at least one ITAM.
The chimeric antigen receptor of claim 35, wherein the intracellular signaling domain comprises an intracellular signaling domain derived from CD3ζ, CD3δ, CD3γ, or CD3ε.
The chimeric antigen receptor according to any one of claims 35-36, wherein the intracellular signaling domain comprises SEQ ID NO:86, SEQ ID NO:90, SEQ ID NO:91, SEQ ID The amino acid sequence shown in any one of NO:103 to SEQ ID NO:113.
The chimeric antigen receptor according to any one of claims 35-37, wherein the N-terminus of the intracellular signaling domain is directly or indirectly linked to the C-terminus of the co-stimulatory signaling domain.
The chimeric antigen receptor according to any one of claims 1-38, comprising a hinge region between the targeting moiety and the transmembrane domain, said hinge region comprising a hinge region derived from a protein selected from or Combinations of: CD28, IgG1, IgG4, IgD, 4-1BB, CD4, CD27, CD7, CD8, PD-1, ICOS, OX40, NKG2D, NKG2C, FcεRIγ, BTLA, GITR, DAP10, TIM1, SLAM, CD30 and LIGHT .
The chimeric antigen receptor of claim 39, said hinge region comprising a hinge region derived from CD8.
The chimeric antigen receptor according to any one of claims 39-40, said hinge region comprising the amino acid sequence shown in any one of SEQ ID NO: 114 to SEQ ID NO: 135.
The chimeric antigen receptor according to any one of claims 1-41, said chimeric antigen receptor comprising a non-targeting portion, the non-targeting portion of said chimeric antigen receptor comprising the transmembrane domain of CD8A , the hinge region of CD8, the intracellular co-stimulatory signaling domain of 4-1BB and the intracellular signal transduction domain of CD3ζ.
The chimeric antigen receptor according to claim 42, the non-targeting portion of the chimeric antigen receptor comprises the amino acid sequence shown in any one of SEQ ID NO:19.
The chimeric antigen receptor according to any one of claims 1-43, comprising the amino acid sequence shown in SEQ ID NO:199.
An isolated nucleic acid molecule encoding the chimeric antigen receptor of any one of claims 1-44.
A vector comprising the isolated nucleic acid molecule of claim 45.
The vector of claim 46 comprising a viral vector.
The vector according to any one of claims 46-47, comprising a lentiviral vector.
Immune cells comprising and/or expressing the isolated nucleic acid molecule of claim 45 or the vector of any one of claims 46-48, and/or the chimera of any one of claims 1-44 Synthetic antigen receptors.
The immune cell according to claim 49, wherein said immune cell is derived from a human.
The immune cell according to any one of claims 49-50, wherein said immune cell comprises T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, γδT cells, monocytes , dendritic cells, granulocytes, lymphocytes, leukocytes and/or peripheral blood mononuclear cells.
Immune cells according to any one of claims 49-51 comprising T cells.
The immune cell according to any one of claims 49-52, wherein said immune cell comprises a modified immune cell.
The immune cell of claim 53, wherein the modified immune cell comprises a cell that reduces immune rejection induced by allogeneic cell therapy.
The immune cell according to any one of claims 53-54, wherein the T cell antigen receptor (TCR) and major histocompatibility complex (MHCI, MHCII) in the modified immune cell are in the T cell The function in is suppressed.
The immune cell according to any one of claims 53-55, wherein the modification comprises down-regulation of the expression and/or activity of one or more genes related to immune rejection.
The immune cell according to claim 56, wherein the gene related to immune rejection is selected from one or more genes in the group consisting of TRAC, TRBC, HLA-A, HLA-B, B2M and CIITA.
The immune cell according to any one of claims 53-57, wherein the expression and/or activity of the TRAC gene and the HLA-A gene are down-regulated in the modified immune cell compared with the unmodified corresponding cell.
The immune cell according to any one of claims 53-58, wherein the expression and/or activity of the CIITA gene is not down-regulated in the modified immune cell compared with the corresponding cell without the modification.
The immune cell according to any one of claims 53-59, wherein the expression and/or activity of the B2M gene is not down-regulated in the modified immune cell compared with the corresponding cell without the modification.
The immune cell according to any one of claims 53-60, wherein the expression and/or activity of the TRAC gene and the HLA-A gene are down-regulated in the modified immune cell compared with the corresponding wild-type cell.
The immune cell according to any one of claims 53-61, wherein the expression and/or activity of the B2M gene is not down-regulated in the modified immune cell compared with the corresponding wild-type cell.
The immune cell according to any one of claims 53-62, wherein the expression and/or activity of the CIITA gene is not down-regulated in the modified immune cell compared with the corresponding wild-type cell.
The immune cell according to any one of claims 56-63, wherein down-regulation of the expression level and/or activity of the gene comprises down-regulation of the expression and/or activity of the nucleic acid molecule encoding the gene; and/or down-regulation of the expression level and/or activity of the nucleic acid molecule encoding the gene; The expression and/or activity of the protein product encoded by the gene is downregulated.
The immune cell according to any one of claims 53-64, wherein the modification comprises: gene knockout, gene mutation and/or gene silencing.
The immune cell according to any one of claims 53-65, wherein the modification comprises administering to the immune cell one or more substances selected from the group consisting of antisense RNA, siRNA, shRNA and sgRNA.
The immune cell according to any one of claims 53-66, wherein the modification further comprises administering to the immune cell an sgRNA targeting the exon portion of the TRAC gene.
The immune cell according to claim 67, wherein the sgRNA targeting the exon portion of the TRAC gene comprises the nucleotide sequence shown in any one of SEQ ID NO:138 to SEQ ID NO:152.
The immune cell according to any one of claims 53-68, wherein the modification comprises administering to the immune cell an sgRNA targeting an exon portion of the HLA-A gene.
The immune cell according to claim 69, wherein the sgRNA targeting the exon portion of the HLA-A gene comprises the nucleotide sequence shown in any one of SEQ ID NO:153 to SEQ ID NO:193 .
The immune cell according to any one of claims 53-70, wherein said modification further comprises administering a Cas enzyme to said cell.
The immune cell according to claim 71, wherein the Cas enzyme comprises a Cas9 protein.
The immune cell according to any one of claims 53-72, wherein said modification comprises administering to said cell an antisense RNA comprising any of SEQ ID NO: 194 to SEQ ID NO: 197 The nucleotide sequence shown in item.
The immune cell according to any one of claims 49-73, wherein the immune cell is an HLA-B homozygous cell.
The immune cell according to claim 74, wherein said HLA-B homozygote comprises HLA-B*40 homozygote, HLA-B*15 homozygote, HLA-B*46 homozygote, HLA-B*13 homozygote , HLA-B*51 homozygote, HLA-B*58 homozygote, HLA-B*07 homozygote, HLA-B*35 homozygote, HLA-B*44 homozygote, HLA-B*52 homozygote, HLA - B*57 homozygote, HLA-B*54 homozygote or HLA-B*55 homozygote.
The immune cell according to any one of claims 49-75, wherein the immune cell is an HLA-A homozygous or heterozygous cell.
The immune cell according to claim 76, wherein said HLA-A homozygote or heterozygote comprises HLA-A*02 homozygote, HLA-A*11 homozygote, HLA-A*02/A*11 heterozygote or Homozygous for HLA-A*24.
A method for preparing immune cells, comprising introducing the nucleic acid molecule of claim 45 and/or the carrier of any one of claims 46-48 into immune cells.
The method according to claim 78, further comprising: before/after introducing the nucleic acid molecule according to claim 45 and/or the vector according to any one of claims 46-48 into immune cells, modifying the For immune cells, the modification includes down-regulation of the expression and/or activity of one or more genes related to immune rejection.
The method according to claim 79, wherein the gene related to immune rejection is selected from one or more genes in the group consisting of TRAC, TRBC, HLA-A, HLA-B, B2M and CIITA.
According to the method according to any one of claims 78-80, the expression and/or activity of the TRAC gene and the HLA-A gene in the immune cells are down-regulated compared with the immune cells without the modification.
According to the method according to any one of claims 78-81, the expression and/or activity of the CIITA gene in the immune cells is not down-regulated compared with the immune cells without the modification.
According to the method according to any one of claims 78-82, the expression and/or activity of B2M genes in the immune cells are not down-regulated compared with the immune cells without the modification.
The method according to any one of claims 78-83, wherein the expression and/or activity of the TRAC gene and the HLA-A gene are down-regulated in the immune cells compared to wild-type cells.
The method according to any one of claims 78-84, wherein the expression and/or activity of the CIITA gene is not down-regulated in the immune cells compared to wild-type cells.
The method according to any one of claims 78-85, the expression and/or activity of B2M genes in said immune cells is not down-regulated compared to wild-type cells.
The method according to any one of claims 79-86, wherein the down-regulation of the expression level and/or activity of the gene comprises down-regulation of the expression and/or activity of the nucleic acid molecule encoding the gene; and/or down-regulation of the gene The expression and/or activity of the protein product encoded by the gene is downregulated.
The method according to any one of claims 79-87, wherein said modification comprises: gene knockout, gene mutation and/or gene silencing.
The method according to any one of claims 79-88, wherein said modification comprises administering to said immune cells one or more substances selected from the group consisting of antisense RNA, siRNA, shRNA and sgRNA.
The method according to any one of claims 79-89, wherein said modification comprises administering to said immune cells an sgRNA targeting an exon portion of said TRAC gene.
The method according to claim 90, wherein the sgRNA targeting the exon portion of the TRAC gene comprises the nucleotide sequence shown in any one of SEQ ID NO:138 to SEQ ID NO:152.
The method according to any one of claims 79-91, wherein the modification comprises administering to the immune cells an sgRNA targeting an exon portion of the HLA-A gene.
The method according to claim 92, wherein the sgRNA targeting the exon portion of the HLA-A gene comprises the nucleotide sequence shown in any one of SEQ ID NO:153 to SEQ ID NO:193.
The method according to any one of claims 79-93, wherein said modifying further comprises administering a Cas enzyme to said cell.
The method of claim 94, wherein the Cas enzyme comprises a Cas9 protein.
The method according to any one of claims 79-95, wherein said modification comprises administering to said cell an antisense RNA comprising any one of SEQ ID NO:194 to SEQ ID NO:197 Nucleotide sequence shown.
The method according to any one of claims 78-96, wherein the immune cells are of human origin.
The method according to any one of claims 78-97, wherein the immune cells comprise T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, γδT cells, monocytes, dendrites cells, granulocytes, lymphocytes, leukocytes and/or peripheral blood mononuclear cells.
The method according to any one of claims 78-98, wherein the immune cells comprise T cells.
The method according to any one of claims 78-99, wherein the immune cells are HLA-B homozygous cells.
The method according to claim 100, wherein the HLA-B homozygotes comprise HLA-B*40 homozygotes, HLA-B*15 homozygotes, HLA-B*46 homozygotes, HLA-B*13 homozygotes, HLA-B*51 homozygote, HLA-B*58 homozygote, HLA-B*07 homozygote, HLA-B*35 homozygote, HLA-B*44 homozygote, HLA-B*52 homozygote, HLA- B*57 homozygote, HLA-B*54 homozygote or HLA-B*55 homozygote.
The method according to any one of claims 78-101, wherein the immune cells are HLA-A homozygous or heterozygous cells.
The method according to claim 102, wherein said HLA-A homozygote or heterozygote comprises HLA-A*02 homozygote, HLA-A*11 homozygote, HLA-A*02/A*11 heterozygote or HLA -A*24 homozygous.
The chimeric antigen receptor of any one of claims 1-44, the isolated nucleic acid molecule of claim 45, the vector of any one of claims 46-48, and/or claim 49- Use of the immune cells described in any one of 77 in the preparation of CAR-T cells.
A pharmaceutical composition comprising the chimeric antigen receptor of any one of claims 1-44, the isolated nucleic acid molecule of claim 45, the carrier of any one of claims 46-48, and /or the immune cell according to any one of claims 49-77, and optionally a pharmaceutically acceptable carrier.
The antigen chimeric receptor of any one of claims 1-44, the isolated nucleic acid molecule of claim 45, the vector of any one of claims 46-48, any of claims 49-77 The immune cell according to one item, and/or the pharmaceutical composition according to claim 105, which is used for treating diseases or conditions related to the expression of EGFR.
The use according to claim 106, wherein the diseases or disorders associated with the expression of EGFR include diseases or disorders associated with the up-regulation of the expression of EGFR.
The use according to any one of claims 106-107, wherein the disease or condition associated with the expression of EGFR comprises a tumor.
The use according to claim 108, wherein the tumor comprises an EGFR positive tumor.
The use according to any one of claims 108-109, wherein the tumor comprises a solid tumor.
The use according to any one of claims 108-110, wherein the tumor comprises a hematoma.
The use according to any one of claims 108-111, wherein the tumor comprises glioma, breast cancer, lung cancer, ovarian cancer, head and neck cancer, cervical cancer, esophageal cancer, pancreatic cancer, eye cancer, Cancer of the skin, biliary tract, prostate, liver, fibrosarcoma, colon and/or stomach.
The use according to any one of claims 108-112, wherein the tumor comprises fibrosarcoma.
The chimeric antigen receptor of any one of claims 1-44, the isolated nucleic acid molecule of claim 45, the vector of any one of claims 46-48, any of claims 49-77 The immune cell described in one item, and/or the use of the pharmaceutical composition described in claim 105 in the preparation of medicines for treating diseases or conditions related to the expression of EGFR.
The use according to claim 114, wherein the diseases or disorders associated with the expression of EGFR comprise diseases or disorders associated with the up-regulation of the expression of EGFR.
The use according to any one of claims 114-115, wherein the disease or disorder associated with the expression of EGFR comprises a tumor.
The use according to claim 116, wherein the tumor comprises an EGFR positive tumor.
The use according to any one of claims 116-117, wherein the tumor comprises a solid tumor.
The use according to any one of claims 116-118, wherein the tumor comprises a hematoma.
The use according to any one of claims 116-119, wherein the tumor comprises glioma, breast cancer, lung cancer, ovarian cancer, head and neck cancer, cervical cancer, esophageal cancer, pancreatic cancer, eye cancer, Cancer of the skin, biliary tract, prostate, liver, fibrosarcoma, colon and/or stomach.
The use according to any one of claims 116-120, wherein the tumor comprises fibrosarcoma.
A method for preventing and/or treating diseases or disorders associated with the expression of EGFR, comprising administering an effective amount of the chimeric antigen receptor according to any one of claims 1-44 to a subject in need, the claim The isolated nucleic acid molecule of 45, the carrier of any one of claims 46-48, the immune cell of any one of claims 49-77, and/or the pharmaceutical composition of claim 105 .
The method according to claim 122, wherein the disease or disorder associated with the expression of EGFR comprises a disease or disorder associated with up-regulation of the expression of EGFR.
The method according to any one of claims 122-123, wherein the disease or condition associated with expression of EGFR comprises a tumor.
The method of claim 124, wherein the tumor comprises an EGFR positive tumor.
The method of any one of claims 124-125, wherein the tumor comprises a solid tumor.
The method of any one of claims 124-126, wherein the tumor comprises a hematoma.
The method according to any one of claims 124-127, wherein the tumor comprises glioma, breast cancer, lung cancer, ovarian cancer, head and neck cancer, cervical cancer, esophageal cancer, pancreatic cancer, eye cancer, Cancer of the skin, biliary tract, prostate, liver, fibrosarcoma, colon and/or stomach.
The method of any one of claims 124-128, wherein the tumor comprises fibrosarcoma.