CN108913718A

CN108913718A - A kind of preparation method and application of the CAR-T cell of targeting EGFR v III

Info

Publication number: CN108913718A
Application number: CN201810801441.XA
Authority: CN
Inventors: 刘希; 尚小云
Original assignee: Suzhou Mao Hang Bio Technology Co Ltd
Current assignee: Suzhou Mao Hang Bio Technology Co Ltd
Priority date: 2018-07-20
Filing date: 2018-07-20
Publication date: 2018-11-30

Abstract

The preparation method and application of a kind of targeting EGFR v III and the CAR-T cell through gene modification are allowed to be more suitable for express in source of people host, prepare CAR-T cell including optimizing the amino acid sequence codon of targeting EGFR v III；And the PD-1 gene on CAR-T cell is knocked out using the method for single base editor；Or combination secreting leukocytes mesonium 12 (IL-12), for promoting the T cell proliferation of activation；Or combination secretion anti-PD1 antibody releases tumor tissues to the inhibiting effect of T cell for combining the PD1 in other T cells.The present invention selects PiggyBac Transposon System to improve the expression efficiency of transfection efficiency and quiding gene, and shortens the operating time, simplifies the preparation procedure of CAR-T, avoids when in addition the present invention knocks out PD-1 gene using viral vectors, safety is higher.

Description

A kind of preparation method and application of the CAR-T cell of targeting EGFR v III

Technical field

The present invention relates to field of immunology, and in particular to immunotherapy field more particularly to a kind of targeting EGFR v's III The preparation method and applications of CAR-T cell.

Background technique

EGFR (Epidermal Growth Factor Receptor) is a kind of glycoprotein, belong to tyrosine kinase type by Body, is the product of proto-oncogene C-erb-1 (HER-1) coding expression, and molecular weight 170KDa, EGFR are located at cell membrane surface, lean on It is activated with ligand binding, is the receptor of epidermal growth factor (EGF) cell Proliferation and signal transduction, EGFR and its respective ligand In conjunction with and activate, as signal transduction compound, and then downstream signal transduction access is activated to cause a series of cell effects：Promote Signal transduction and cell Growth and Differentiation accelerate the cell cycle to carry out and promote vascularization, promote the growth and transfer of tumour.

Many malignant tumours are presented EGFR overexpression, the proliferation of EGFR and tumour cell, angiogenesis, tumor invasion, Transfer and the inhibition of Apoptosis are related, and the imbalance of access will lead to the generation of a variety of human epithelium's malignant tumours, cause The reason of EGFR access is lacked of proper care includes the overexpression of EGFR and the sustained activation that itself mutation generates.(epidermis is raw by EGFRv III III type mutant of growth factor receptor body) it is EGF-R ELISA (EGFR) most common mutant forms, this saltant type lacks 801 base-pairs between normal EGFR the 2nd to the 7th exon have been lost, and 1 and 8 exons are directly connected to, and in junction shape At a new glycine, for EGFR wild type, EGFRv III has lacked the 6-273 amino acid residue of extracellular fragment, i.e., The ligand binding domain of EGFR, itself discord ligand binding, that is, can produce lasting phosphorylation, receptor made to generate lasting stimulation Signal results in the excessive activation of EGFR access, and EGFRvIII can improve tumour cell oncogenicity, promotes tumor cell proliferation, Inhibit apoptosis, and change cellular morphology, improve cell viability, reduces cell adhesion, keep tumour cell more aggressive. EGFRvIII is a kind of novel tumour-specific target spot, other than being widely present in glioma, in breast cancer, non-small cell lung Cancer, oophoroma and prostate cancer etc. are found.

CAR-T is then a kind of by the way that the defense cell (T cell) of patient oneself is taken out, artificial (relying on gene technology) In addition a kind of component (cancer cell identification antigen receptor) that can identify cancer cell, and massive duplication, then patient is given back to, thus The killing ability of patient's self-defense cell is excited to kill cancer cell.CAR molecule mainly includes extracellular antigen binding domain (Single chain antibody Fragment, ScFv), to identify tumor surface specific protein, transmembrane region and letter intracellular Number area.

It, should if Chinese patent CN201610994507.2 discloses a kind of self CAR-T cell preparation method and applications Invention makes the CD28-CD137-CD19-CD3 full-length gene of building of CRISPR/Cas9 technological sourcing to patient T cells At CAR-T cell, then after amplification in vitro, feeds back to patient's body and carry out antineoplaston, with traditional tumour treatment side Method is compared, and this method is cell targeted treatment, Small side effects, and the T cell Jing Guo gene modification can be in its surface-stable Expression antigen binding domain, identify target antigen while, no MHC is restricted, improves the therapeutic effect of tumour.

For another example Chinese patent CN201710217134.2 discloses a kind of CAR-T cell of targeted therapy hematologic malignancies Research method, include the following steps：Construct T cell, that is, CAR-T of CD19, CD20, CD33 mosaic antigen receptor modification；It builds CAR-T building and CAR-T cell large scale preparation process system under the conditions of vertical GMP；Establish the safety evaluatio of CAR-T system System；Screening meets the patient for the treatment of indication；Clinical experimental study, the invention will compare non-based on transposons and transposase The effect of viral CAR-T technology clinically, it is safer, at low cost clinically to promote.

Although CAR-T is fruitful in terms for the treatment of leukaemia, lymthoma, general in the clinical therapeutic efficacy to solid tumor All over unsatisfactory, in numerous clinical trials, it includes proliferation and sustainability is limited, tumours filtration that CAR-T, which exposes many, Ability is poor, the problems such as being suppressed in tumor microenvironment, wherein how in the tumor microenvironment of inhibition to keep it for cell Proliferation and continuous capability in vitro, continue to play its killing it is particularly important with secreting function, and consider how using CAR-T with And other treatment means such as antibody, vaccine etc. combine, and improve local microenvironment, destroying tumour inherent structure becomes research One of hot spot.

The present invention uses the PiggyBac transposons from lepidopterous insects, and activity is higher in mammalian hosts, And it is larger to carry segment.In addition, preparation process is relatively easy using pUC pUC, by transposase by exogenous origin gene integrator Enter genome, easy to operate and integration efficiency is relatively high, it is important that it is safer relative to retroviral systems, and EGFRvIII only occurs in tumour cell, does not express in normal tissue cell, this keeps EGFRvIII swollen well as one The target of tumor treatment, therefore select III albumen of EGFRv may be than other CAR-T cells as the CAR-T immunization therapy of target antigen Treatment has less side effect.

Summary of the invention

On the one hand, the present invention provides a kind of preparation method of the CAR-T cell of targeting EGFR v III, include the following steps：

(1) plasmid for preparing PBMC cell, the III gene ScFV sequence containing EGFRv, by the III gene ScFV sequence containing EGFRv After plasmid and the transposase plasmids cotransfection PBMC cell being used cooperatively with EGFRv III, the PBMC cell after being transfected should III gene ScFV sequence of EGFRv is incorporated on the genome of PBMC cell after transfection；

(2) PBMC cell after amplification transfects as T cell activation agent and is cultivated using CD3 antibody, obtains targeting EGFR v III CAR-T cell, incorporate III gene ScFV sequence of EGFRv on the genome of the CAR-T cell.

In the above method, the plasmid for preparing the III gene ScFV sequence containing EGFRv includes：Prepare III chimeric antigen of EGFRv by Body (is named as III CAR of EGFRv) in the present invention, that is, III gene ScFV sequence of EGFRv.

The plasmid of the III gene ScFV sequence containing EGFRv is named as III-CAR-BBZ-puro of PB-EGFRv in the present invention III CAR plasmid of plasmid or EGFRv, the plasmid contain III gene ScFV sequence of EGFRv, which can be with For to wild-type sequence carry out codon optimization after sequence, after codon optimization sequence be SEQ ID NO.1 shown in core Nucleotide sequence.

Further, the transposase plasmids are specially transposase plasmids Transposase.

Further, III CAR of EGFRv is using PiggyBac Transposon System in PiggyBac-transposon Carrier is sequentially connected in series people EF1 α promoter, signal peptide, after birth exoantigen combined area, hinge area, intracellular signal transduction area and T 2A What the resistant gene puromycin of small peptide connection was prepared.

Further, after birth exoantigen combined area is codon optimization, in combination with III albumen of EGFRv III single-chain antibody of EGFRv is sequentially connected in series c-myc Epitope tag, CD8 Hinge Chimerical receptor hinge, CD8 Transmembrane Chimerical receptor transmembrane region.

Further, the intracellular signal transduction area be preferably CD28-4-1BB-CD3 ζ, CD28 and 4-1BB be it is chimeric by Body costimulatory molecules, can mediate foreign gene high effective integration in host cell, and high efficiency stable expression.

Further, the sequence of the III-CAR-BBZ-puro plasmid of PB-EGFRv is core shown in SEQ ID NO.2 Nucleotide sequence.

Further, described to turn by the plasmid of the III gene ScFV sequence containing EGFRv and with what EGFRv III was used cooperatively Seat enzyme plasmid co-transfection PBMC cell be specially：The III CAR plasmid of EGFRv and its transposase plasmids of preparation are turned reagent with electricity and mixed It closes, is added in the PBMC cell of preparation and carries out electrotransfection.

Further, PBMC cell is specific as T cell activation agent and after cultivating amplification transfection for the use CD3 antibody For：T cell is stimulated using CD3 antibody, is aided with puromycin screening, and cultivates the T cell after amplification transfection to be targeted The CAR-T cell of EGFRv III.

Further, the preparation PBMC cell includes：(1) peripheral blood is acquired with anticoagulant tube, rocking in acquisition makes Peripheral blood is sufficiently mixed with anti-coagulants, and with phosphate buffer PBS 1：1 dilution；(2) peripheral blood dilution and lymphocyte Separating liquid mixes in equal volume, slow to rise slow drop centrifugation, the tunica albuginea confluent monolayer cells after drawing centrifugation；(3) by obtained tunica albuginea confluent monolayer cells with It is centrifuged, continues with the cleaning of PBS or 1,640 three times, precipitating after PBS or serum-free cell culture medium (such as RPMI 1640) mixing PBMC cell is obtained afterwards.

Further, the transfection uses electrotransfection system, including

PBMC cell preparation system；

Amaxa electrotransfection kit；

Electrotransfection system receives and turns the electrotransfection reagent of kit from Amaxa electricity and by itself and III CAR plasmid of EGFRv And its mixture is formed after transposase plasmids mixing；And it receives the PBMC cell from PBMC cell preparation system and adds wherein Enter the mixture and carries out electroporation transfection；

Further, CD3 antibody screening in the step 5；And puromycin sieves training system, for screening and cultivating expansion T cell after increasing transfection is with the CAR-T cell of targeting EGFR v III.

It is yet another object of the invention to provide it is a kind of according to the above method obtain isolated T cell, cell line or secondly For culture.

Further, the CAR-T cell of the targeting EGFR v III can also be transformed, is allowed to have corresponding function Energy：

The transformation includes step：Prepare targeting EGFR v's III and knock out PD-1 gene CAR-T cell；

Or：Prepare targeting EGFR v's III and secrete IL-12 CAR-T cell；

Or：Prepare targeting EGFR v's III and secrete anti-PD1 CAR-T cell.

Compared with the prior art, beneficial effects of the present invention are：

(1) present invention select PiggyBac Transposon System improve transfection efficiency and transgenosis expression efficiency and when Between, simplify the preparation procedure of CAR-T, enhances the load capacity of system.

(2) present invention uses pUC pUC, and preparation process is relatively easy, is transferred to foreign gene by transposase and is integrated into Genome, easy to operate and integration efficiency are relatively high.

(3) safer relative to retroviral systems, and EGFRv III only occurs in tumour cell, in normal tissue Cell is not expressed, this makes EGFRvIII become the target of a good oncotherapy, therefore selects III albumen of EGFRv as target The CAR-T immunization therapy of antigen may have less side effect than other CAR-T cell therapies.

Detailed description of the invention

Fig. 1 is the circular plasmids map of III CAR-BBZ-puro of PB-EGFRv in embodiment 2.

Fig. 2 is the linear carrier map of III CAR-BBZ-puro of PB-EGFRv in embodiment 2；

Fig. 3 is the Vector map that III CAR-BBZ-puro-IRES-IL2 of PB-EGFRv of IL12 can be secreted in embodiment 5；

Fig. 4 is the III CAR-BBZ-puro-IRES-anti- of PB-EGFRv that anti-PD1 antibody can be secreted in embodiment 6 The Vector map of PD1；

Specific embodiment

The present invention is described further with attached drawing with reference to embodiments, and the embodiment for illustrating invention should not solve It is interpreted as this clearly demarcated range of limitation.Present disclosure can be improved from material, method and reaction condition simultaneously, All these improvement should all be fallen within spirit and scope of the invention.

1 codon optimization of embodiment

(1) prepare III Chimeric antigen receptor of EGFRv (CAR), i.e. 139CAR delivers company to ScFv segment and carries out codon Optimization, be allowed to be easier to express in human body cell, after codon optimization sequence be SEQ ID NO.1 shown in nucleotides sequence Column.

(2) target fragment is synthesized, the rear ScFv segment replaced in 139CAR makes PB-EGFRv III-as shown in Fig. 1 The linear carrier map of the circular plasmids map of CAR-BBZ-puro and attached III-CAR-BBZ-puro of PB-EGFRv shown in Fig. 2.

The preparation of 2 PBMC cell of embodiment

Human peripheral 15mL is taken, anticoagulant (EATA or heparin) processing, room temperature 15 minutes, room temperature 350*g was centrifuged 5 minutes, was inhaled Blood plasma is stand-by out；

1 times of volume PBS buffer dilution is added in haemocyte to mix, takes 15mL centrifuge tube, 5mL lymphocyte point is added Chaotropic Ficoll is slowly added to 5mL dilution haemocyte in upper layer, this step must be slow, prevents Ficoll from mixing with haemocyte.

Slow to rise slow drop, room temperature 450*g is centrifuged 25 minutes, and haemocyte is successively divided into platelet layer, leukocytic cream from top to bottom (tunica albuginea), ficoll (Ficoll) layer and red blood cell layer are drawn platelet layer (2mL), by leukocytic cream (tunica albuginea layer, about 3mL) It is transferred in new 15mL centrifuge tube.

10mL PBS buffer is added, 300*g is centrifuged 10 minutes, abandons supernatant, and precipitating is resuspended in 10mL PBS buffer In, supernatant is abandoned in 170*g centrifugation after ten minutes, and precipitating is resuspended in 10mL PBS buffer, and 300*g is centrifuged after cell count It abandons supernatant again after ten minutes, adjusts cell density to every milliliter 2 × 10⁷A cell.

The preparation of the CAR-T cell of 3 targeting EGFR v III of embodiment

(1), after PBMC slightly being cultivated 1 hour with 1640 culture medium of RPMI containing 10%FBS, 300*g is centrifuged 8 points Clock removes supernatant completely；Configuration electricity swivel system：By III CAR-BBZ-puro of plasmid PB-EGFRv, (sequence is SEQ ID NO.2 institute The nucleotide sequence shown) 5 μ g, transposase plasmids Transposase (can be used

http://www.biofeng.com/zaiti/buru/Super-PiggyBac-Transposase.ht ml is disclosed Transposase) 5 μ g, 82 μ L electricity turn buffer and 18 μ L supplement 1 are mixed；

(2), the plasmid electricity that step (1) prepares is turned into buffer solution mixture and cell is resuspended, and be transferred in electric revolving cup, used Instrument Lonza 2B, U-014 program carries out electricity and turns, and the cell after electricity turns is transferred quickly in the culture medium preheated in advance, and 37 DEG C Two hours of incubator culture are digested with the DNase 1 of 5 μ g/mL, remove the DNA that electricity turns middle dead cell release；After 30 minutes, To cell count and liquid is changed, is cultivated with the AIM-V culture medium (complete medium) containing 300 IU/mL IL-2,10%FBS 24 In orifice plate, wherein every hole 2mL, cell culture density is 1.5 × 10⁶A/mL；

(3) CD3 antibody is added after electricity turns 24 hours to final concentration of 50ng/mL, continues to cultivate, every other day add 300IU/mL IL-2 obtains the CAR-T cell of targeting EGFR v III in culture 15 days；The cell is after quality inspection meets clinical requirement EGFR vIII positive tumor patient can be defeated by.

Embodiment 4 using single base knock out system prepare targeting EGFR v's III and knock out PD-1 gene CAR-T cell

Based on the accuracy and specificity of the BE3 single base editor mediated, gene knockout strategy is designed：Drawn by CT mutation Enter terminator codon, such as CAA, CAG, CGA be mutated into terminator codon TAA, TAG, TGA, terminates the translation of encoding gene, To realize gene knockout.BE3 is the Cas9 fusion protein for carrying APOBEC1 enzyme.Plasmid is xCas9 (3.7)-BE3, simple below Cas9 plasmid is claimed (http to can be used:Cas9 plasmid disclosed in //www.addgene.org/108380/).

20bp-NGG the target sequence (PAM sequence) of the code area (area CDS) of selected gene to be knocked out PD1, make it includes Complete target codon CAA, CAG or CGA；

Wherein target single base C is located at (left end) the 4th of target sequence, target codon and the interval NGG 14bp, and The upstream of target codon close to base (H) cannot be G；The sgRNA sequence is and the complementary corresponding 20bp sequence of target sequence Column；

Select sgRNA for CTACAACTGGGCTGGCGGCCAGG(CAA is target codon, and AGG is PAM sequence).

Synthesize 5 '-ACCG-CTACAACTGGGCTGGCGGCCAGG and

5 '-AAAC-CCTGGCCGCCAGCCCAGTTGTAG, and anneal, it is allowed to be combined into double-strand cohesive terminus,cohesive termini product, lead Entering the pGL3-U6-sgRNA plasmid through I digestion of Bsa, (those skilled in the art can obtain its sequence by network retrieval, such as http://www.youbio.cn/product/vt8203), prepare plasmid pGL3-hPD1sg：

(1), by behind 1640 culture medium culture of RPMI 1 hour of PBMC containing 10%FBS, 300*g is centrifuged 8 minutes, completely Remove supernatant；By pGL3-hPD1sg, Cas9 plasmid, III CAR-BBZ-puro plasmid of PB-EGFRv and transposase Transposase tetra- A each 5 μ g of plasmid, 82 μ L electricity turn buffer and 18 μ L supplement 1 mix plasmid electricity turns buffer solution mixture；

(2), the plasmid electricity that step (1) prepares is turned into buffer solution mixture and PBMC cell is resuspended, and be transferred in electric revolving cup, Electricity being carried out using instrument Lonza 2B, U-014 program to turn, the cell after electricity turns is transferred quickly in the culture medium preheated in advance, Two hours of 37 DEG C of incubator cultures remove the DNA that electricity turns middle dead cell release with the digestion of DNase 1 of 5 μ g/mL；

(3), after 30 minutes, by cell count and liquid is changed, with the AIM-V culture medium of IL-2 containing 300IU/mL, 10%FBS (complete medium) is cultivated in 24 orifice plates, wherein every hole 2mL, cell culture density is 1.5 × 10⁶A/mL；

(4), CD3 antibody is added after electricity turns 24 hours to final concentration 50ng/mL, continues to cultivate, every other day add 300IU/mL IL-2, culture 15 days after can be obtained using single base knock out system prepare targeting EGFR v's III and knock out PD-1 The CAR-T cell of gene；

(5), CAR-T cell genomic dna made from extraction step (4), and in advance designed detection on-target Primer carries out PCR amplification target fragment, purification and recovery；Mutant, 3% agarose gel electrophoresis are detected using T7EN1 digestion Digestion is tested and analyzed, and PCR product is connected into carrier T, is transformed into DH5 α bacterium, 21 single colonies of random picking are surveyed Sequence, cutting efficiency after assessment target fragment is cut；The cell can be defeated by EGFR vIII sun after quality inspection meets clinical requirement Property tumor patient.

Embodiment 5 prepare targeting EGFR v's III and secrete IL-12 CAR-T cell

Using PiggyBac Transposon System, III CAR-BBZ-puro- of PB-EGFRv as shown in Figure of description 3 is constructed IRES-IL12 plasmid.The plasmid be in PB-EGFRvIII CAR-BBZ-puro plasmid be inserted into IRES-IL12 sequence construct and At, and it is mixed with transposase plasmids, host cell is PBMC cell；

IRES is internal ribosome entry site (Internal Ribosome Entry Site), and wherein IL12 sequence is such as Nucleotide sequence shown in SEQ ID NO.3.

III CAR-BBZ-puro-IRES-IL12 plasmid of PB-EGFRv is mixed with transposase Transposase plasmid, place Chief cell is PBMC cell；

(1), III CAR-BBZ-puro-IRES-IL12 of PB-EGFRv and each 5 μ of transposase Transposase plasmid is selected G, and turn kit specification requirement according to Lonza Amaxa electricity, 82 μ L electricity are added and turn buffer and 18 μ L supplement1 It mixes, wherein III CAR-BBZ-puro of original plasmid PB-EGFRv and transposase plasmids are as control.

(2), buffer solution mixture is turned with the plasmid electricity prepared and cell is resuspended, and be transferred in electric revolving cup, use instrument Lonza 2B, U-014 program carries out electricity and turns, and the cell after electricity turns is transferred quickly in the culture medium preheated in advance, and 37 degrees Celsius Two hours of incubator culture remove the DNA that electricity turns middle dead cell release with the digestion of DNase 1 of 5 μ g/mL；

(4), CD3 antibody is added after electricity turns 24 hours to final concentration 50ng/mL, continues to cultivate, every other day adds IL-2, Culture 15 days after can be obtained targeting EGFR v's III and secrete IL-12 CAR-T cell；The cell, which meets clinic through quality inspection, to be wanted EGFR vIII positive tumor patient can be defeated by after asking.

Embodiment 6 prepare targeting EGFR v's III and secrete anti-PD1 CAR-T cell.

The III CAR-BBZ-puro-IRES-anti-PD1 plasmid of PB-EGFRv as shown in Figure of description 4 is constructed, to While targeting EGFR v III, combination secretion anti-PD1 antibody；

Wherein, III CAR-BBZ-puro-IRES-anti-PD1 plasmid of PB-EGFRv is in PB-EGFRvIII CAR- It is inserted into IRES-anti-PD1 sequence construct in BBZ-puro plasmid to form, and it is mixed with transposase plasmids, host cell is PBMC cell；

The IRES is internal ribosome entry site (Internal Ribosome Entry Site), wherein Anti-PD1 sequence is nucleotide sequence shown in SEQ ID NO.4.

(1), III CAR-BBZ-puro-IRES-anti-PD1 of PB-EGFRv and transposase Transposase plasmid are selected Each 5 μ g, and turn kit specification requirement according to Lonza Amaxa electricity, 82 μ L electricity are added and turn buffer and 18 μ L Supplement1 is mixed, and wherein III CAR-BBZ-puro of original plasmid PB-EGFRv and transposase plasmids are as control.

(2), buffer solution mixture is turned with the plasmid electricity prepared and cell is resuspended, and be transferred in electric revolving cup, use instrument Lonza 2B, U-014 program carries out electricity and turns, and the cell after electricity turns is transferred quickly in the culture medium preheated in advance, and 37 degrees Celsius Two hours of incubator culture with the DNase1 digestion of 5 μ g/mL, remove the electric DNA for turning middle dead cell release；

(4), CD3 antibody is added after electricity turns 24 hours to final concentration 50ng/mL, continues to cultivate, every other day add 300IU/mL IL-2, culture 15 days after can be obtained targeting EGFR v's III and secrete anti-PD1 CAR-T cell；The cell EGFR vIII positive tumor patient can be defeated by after quality inspection meets clinical requirement.

Sequence table

<110>Suzhou Mao Hang Biotechnology Co., Ltd

<120>A kind of preparation method and application of the CAR-T cell of targeting EGFR vIII

<130> 200180710

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 726

<212> DNA

<213>Artificial sequence (rengongxulie)

<400> 1

gacatccaga tgacccagag ccctagcagc ctgagcgcta gcgtgggaga tagagtgacc 60

atcacttgca gagccagcca gggcatcagg aacaacctgg cttggtacca gcagaagccc 120

ggaaaggccc ctaagaggct gatctacgcc gctagcaatc tgcagagcgg agtgcctagc 180

agattcaccg gcagcggaag cggaaccgag ttcaccctga tcgtgtccag cctgcagcca 240

gaggacttcg ccacctacta ctgcctgcag caccactctt accctctgac aagcggcgga 300

ggaaccaagg tggagatcaa gggcagcacc tctggaagcg gcaaaccagg aagcggagag 360

ggaagcgaag tgcaggtgct ggaaagcgga ggaggactgg tgcagccagg aggatctctg 420

agactgtctt gcgccgctag cggattcacc ttcagcagct acgccatgtc ttgggtccgg 480

caggcaccag gaaaaggact cgagtgggtc agcgccatta gcggaagcgg aggctctaca 540

aactacgccg acagcgtgaa gggcaggttc accatcagcc gggacaacag caagaacacc 600

ctgtacctgc agatgaacag cctgcgcgca gaggataccg ccgtgtacta ttgcgccgga 660

tctagcggtt ggagcgagta ttggggccag ggaacactgg tgacagtgtc tagcgccgct 720

ggaagc 726

<210> 2

<211> 7827

<212> DNA

<213>Artificial sequence (rengongxulie)

<400> 2

actcttcctt tttcaatatt attgaagcat ttatcagggt tattgtctca tgagcggata 60

catatttgaa tgtatttaga aaaataaaca aataggggtt ccgcgcacat ttccccgaaa 120

agtgccacct aaattgtaag cgttaatatt ttgttaaaat tcgcgttaaa tttttgttaa 180

atcagctcat tttttaacca ataggccgaa atcggcaaaa tcccttataa atcaaaagaa 240

tagaccgaga tagggttgag tgttgttcca gtttggaaca agagtccact attaaagaac 300

gtggactcca acgtcaaagg gcgaaaaacc gtctatcagg gcgatggccc actacgtgaa 360

ccatcaccct aatcaagttt tttggggtcg aggtgccgta aagcactaaa tcggaaccct 420

aaagggagcc cccgatttag agcttgacgg ggaaagccgg cgaacgtggc gagaaaggaa 480

gggaagaaag cgaaaggagc gggcgctagg gcgctggcaa gtgtagcggt cacgctgcgc 540

gtaaccacca cacccgccgc gcttaatgcg ccgctacagg gcgcgtccca ttcgccattc 600

aggctgcgca actgttggga agggcgatcg gtgcgggcct cttcgctatt acgccagctg 660

gcgaaagggg gatgtgctgc aaggcgatta agttgggtaa cgccagggtt ttcccagtca 720

cgacgttgta aaacgacggc cagtgagcgc gcctcgttca ttcacgtttt tgaacccgtg 780

gaggacgggc agactcgcgg tgcaaatgtg ttttacagcg tgatggagca gatgaagatg 840

ctcgacacgc tgcagaacac gcagctagat taaccctaga aagataatca tattgtgacg 900

tacgttaaag ataatcatgt gtaaaattga cgcatgtgtt ttatcggtct gtatatcgag 960

gtttatttat taatttgaat agatattaag ttttattata tttacactta catactaata 1020

ataaattcaa caaacaattt atttatgttt atttatttat taaaaaaaac aaaaactcaa 1080

aatttcttct ataaagtaac aaaactttta tgagggacag ccccccccca aagcccccag 1140

ggatgtaatt acgtccctcc cccgctaggg ggcagcagcg agccgcccgg ggctccgctc 1200

cggtccggcg ctccccccgc atccccgagc cggcagcgtg cggggacagc ccgggcacgg 1260

ggaaggtggc acgggatcgc tttcctctga acgcttctcg ctgctctttg agcctgcaga 1320

cacctggggg gatacgggga aaaggcctcc acggccaagg atctgcgatc gctccggtgc 1380

ccgtcagtgg gcagagcgca catcgcccac agtccccgag aagttggggg gaggggtcgg 1440

caattgaacg ggtgcctaga gaaggtggcg cggggtaaac tgggaaagtg atgtcgtgta 1500

ctggctccgc ctttttcccg agggtggggg agaaccgtat ataagtgcag tagtcgccgt 1560

gaacgttctt tttcgcaacg ggtttgccgc cagaacacag ctgaagcttc gaggggctcg 1620

catctctcct tcacgcgccc gccgccctac ctgaggccgc catccacgcc ggttgagtcg 1680

cgttctgccg cctcccgcct gtggtgcctc ctgaactgcg tccgccgtct aggtaagttt 1740

aaagctcagg tcgagaccgg gcctttgtcc ggcgctccct tggagcctac ctagactcag 1800

ccggctctcc acgctttgcc tgaccctgct tgctcaactc tacgtctttg tttcgttttc 1860

tgttctgcgc cgttacagat ccaagctgtg accggcgcct actctagagc caccatgctg 1920

ctgctcgtta caagtctgct gctgtgtgaa ctgcctcatc ccgctttcct gctgatccca 1980

gacatccaga tgacccagag ccctagcagc ctgagcgcta gcgtgggaga tagagtgacc 2040

atcacttgca gagccagcca gggcatcagg aacaacctgg cttggtacca gcagaagccc 2100

ggaaaggccc ctaagaggct gatctacgcc gctagcaatc tgcagagcgg agtgcctagc 2160

agattcaccg gcagcggaag cggaaccgag ttcaccctga tcgtgtccag cctgcagcca 2220

gaggacttcg ccacctacta ctgcctgcag caccactctt accctctgac aagcggcgga 2280

ggaaccaagg tggagatcaa gggcagcacc tctggaagcg gcaaaccagg aagcggagag 2340

ggaagcgaag tgcaggtgct ggaaagcgga ggaggactgg tgcagccagg aggatctctg 2400

agactgtctt gcgccgctag cggattcacc ttcagcagct acgccatgtc ttgggtccgg 2460

caggcaccag gaaaaggact cgagtgggtc agcgccatta gcggaagcgg aggctctaca 2520

aactacgccg acagcgtgaa gggcaggttc accatcagcc gggacaacag caagaacacc 2580

ctgtacctgc agatgaacag cctgcgcgca gaggataccg ccgtgtacta ttgcgccgga 2640

tctagcggtt ggagcgagta ttggggccag ggaacactgg tgacagtgtc tagcgccgct 2700

ggaagcgaac agaagctcat aagcgaagaa gatctgttcg tccccgtgtt cctgcctgcc 2760

aagccaacaa ctacccctgc tccacgacca cctactccag cacctaccat cgcaagtcag 2820

cccctgtcac tgcgacctga ggcttgccgg ccagcagctg gaggagcagt gcacacccga 2880

ggcctggact tcgcatgcga tatctacatt tgggcaccac tggctggaac ctgtggggtc 2940

ctgctgctga gcctggtcat caccctgtat tgtaaccaca gaaataggag caaacgctcc 3000

cgactgctgc attccgacta catgaacatg acacctcgga gaccaggccc cactagaaag 3060

cattaccagc catatgcccc acccagggat ttcgcagcct atcggagccg gttcagcgtc 3120

gtgaaaaggg ggcgcaagaa actgctgtac atcttcaagc agccttttat gcgcccagtg 3180

cagacaactc aggaggaaga cggatgctct tgtcggttcc cagaggagga ggaaggaggc 3240

tgcgagctga gagtgaagtt cagccggagc gccgatgcac cagcatatca gcagggacag 3300

aatcagctgt acaacgagct gaatctgggc aggcgcgagg aatatgacgt gctggataag 3360

cgacgaggac gggaccccga aatgggagga aaacccagaa ggaagaaccc tcaggagggg 3420

ctgtataatg aactgcagaa agacaagatg gctgaggcat acagcgaaat tggaatgaaa 3480

ggagagcgcc gacgggggaa gggacacgat gggctgtacc agggactgtc aaccgccact 3540

aaagatacct acgacgcact gcacatgcag gctctgcccc caagagaatt cgaaggatcc 3600

gcggccgctg agggcagagg aagtcttcta acatgcggtg acgtggagga gaatcccggc 3660

ccttccggga tgaccgagta caagcccacg gtgcgcctcg ccacccgcga cgacgtcccc 3720

agggccgtac gcaccctcgc cgccgcgttc gccgactacc ccgccacgcg ccacaccgtc 3780

gatccggacc gccacatcga gcgggtcacc gagctgcaag aactcttcct cacgcgcgtc 3840

gggctcgaca tcggcaaggt gtgggtcgcg gacgacggcg ccgcggtggc ggtctggacc 3900

acgccggaga gcgtcgaagc gggggcggtg ttcgccgaga tcggcccgcg catggccgag 3960

ttgagcggtt cccggctggc cgcgcagcaa cagatggaag gcctcctggc gccgcaccgg 4020

cccaaggagc ccgcgtggtt cctggccacc gtcggcgtct cgcccgacca ccagggcaag 4080

ggtctgggca gcgccgtcgt gctccccgga gtggaggcgg ccgagcgcgc cggggtgccc 4140

gccttcctgg agacctccgc gccccgcaac ctccccttct acgagcggct cggcttcacc 4200

gtcaccgccg acgtcgaggt gcccgaagga ccgcgcacct ggtgcatgac ccgcaagccc 4260

ggtgcctgaa tctaggtcga caatcaacct ctggattaca aaatttgtga aagattgact 4320

ggtattctta actatgttgc tccttttacg ctatgtggat acgctgcttt aatgcctttg 4380

tatcatgcgt taactaaact tgtttattgc agcttataat ggttacaaat aaagcaatag 4440

catcacaaat ttcacaaata aagcattttt ttcactgcat tctagttgtg gtttgtccaa 4500

actcatcaat gtatcttatc atgtctggaa ttgactcaaa tgatgtcaat tagtctatca 4560

gaagctcatc tggtctccct tccgggggac aagacatccc tgtttaatat ttaaacagca 4620

gtgttcccaa actgggttct tatatccctt gctctggtca accaggttgc agggtttcct 4680

gtcctcacag gaacgaagtc cctaaagaaa cagtggcagc caggtttagc cccggaattg 4740

actggattcc ttttttaggg cccattggta tggctttttc cccgtatccc cccaggtgtc 4800

tgcaggctca aagagcagcg agaagcgttc agaggaaagc gatcccgtgc caccttcccc 4860

gtgcccgggc tgtccccgca cgctgccggc tcggggatgc ggggggagcg ccggaccgga 4920

gcggagcccc gggcggctcg ctgctgcccc ctagcggggg agggacgtaa ttacatccct 4980

gggggctttg ggggggggct gtccctgata tctataacaa gaaaatatat atataataag 5040

ttatcacgta agtagaacat gaaataacaa tataattatc gtatgagtta aatcttaaaa 5100

gtcacgtaaa agataatcat gcgtcatttt gactcacgcg gtcgttatag ttcaaaatca 5160

gtgacactta ccgcattgac aagcacgcct cacgggagct ccaagcggcg actgagatgt 5220

cctaaatgca cagcgacgga ttcgcgctat ttagaaagag agagcaatat ttcaagaatg 5280

catgcgtcaa ttttacgcag actatctttc tagggttaat ctagctgcat caggatcata 5340

tcgtcgggtc ttttttccgg ctcagtcatc gcccaagctg gcgctatctg ggcatcgggg 5400

aggaagaagc ccgtgccttt tcccgcgagg ttgaagcggc atggaaagag tttgccgagg 5460

atgactgctg ctgcattgac gttgagcgaa aacgcacgtt taccatgatg attcgggaag 5520

gtgtggccat gcacgccttt aacggtgaac tgttcgttca ggccacctgg gataccagtt 5580

cgtcgcggct tttccggaca cagttccgga tggtcagccc gaagcgcatc agcaacccga 5640

acaataccgg cgacagccgg aactgccgtg ccggtgtgca gattaatgac agcggtgcgg 5700

cgctgggata ttacgtcagc gaggacgggt atcctggctg gatgccgcag aaatggacat 5760

ggataccccg tgagttaccc ggcgggcgcg cttggcgtaa tcatggtcat agctgtttcc 5820

tgtgtgaaat tgttatccgc tcacaattcc acacaacata cgagccggaa gcataaagtg 5880

taaagcctgg ggtgcctaat gagtgagcta actcacatta attgcgttgc gctcactgcc 5940

cgctttccag tcgggaaacc tgtcgtgcca gctgcattaa tgaatcggcc aacgcgcggg 6000

gagaggcggt ttgcgtattg ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc 6060

ggtcgttcgg ctgcggcgag cggtatcagc tcactcaaag gcggtaatac ggttatccac 6120

agaatcaggg gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa 6180

ccgtaaaaag gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca 6240

caaaaatcga cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc 6300

gtttccccct ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata 6360

cctgtccgcc tttctccctt cgggaagcgt ggcgctttct catagctcac gctgtaggta 6420

tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca 6480

gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga 6540

cttatcgcca ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg 6600

tgctacagag ttcttgaagt ggtggcctaa ctacggctac actagaagga cagtatttgg 6660

tatctgcgct ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg 6720

caaacaaacc accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag 6780

aaaaaaagga tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa 6840

cgaaaactca cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat 6900

ccttttaaat taaaaatgaa gttttaaatc aatctaaagt atatatgagt aaacttggtc 6960

tgacagttac caatgcttaa tcagtgaggc acctatctca gcgatctgtc tatttcgttc 7020

atccatagtt gcctgactcc ccgtcgtgta gataactacg atacgggagg gcttaccatc 7080

tggccccagt gctgcaatga taccgcgaga cccacgctca ccggctccag atttatcagc 7140

aataaaccag ccagccggaa gggccgagcg cagaagtggt cctgcaactt tatccgcctc 7200

catccagtct attaattgtt gccgggaagc tagagtaagt agttcgccag ttaatagttt 7260

gcgcaacgtt gttgccattg ctacaggcat cgtggtgtca cgctcgtcgt ttggtatggc 7320

ttcattcagc tccggttccc aacgatcaag gcgagttaca tgatccccca tgttgtgcaa 7380

aaaagcggtt agctccttcg gtcctccgat cgttgtcaga agtaagttgg ccgcagtgtt 7440

atcactcatg gttatggcag cactgcataa ttctcttact gtcatgccat ccgtaagatg 7500

cttttctgtg actggtgagt actcaaccaa gtcattctga gaatagtgta tgcggcgacc 7560

gagttgctct tgcccggcgt caatacggga taataccgcg ccacatagca gaactttaaa 7620

agtgctcatc attggaaaac gttcttcggg gcgaaaactc tcaaggatct taccgctgtt 7680

gagatccagt tcgatgtaac ccactcgtgc acccaactga tcttcagcat cttttacttt 7740

caccagcgtt tctgggtgag caaaaacagg aaggcaaaat gccgcaaaaa agggaataag 7800

ggcgacacgg aaatgttgaa tactcat 7827

<210> 3

<211> 1623

<212> DNA

<213>Artificial sequence (rengongxulie)

<400> 3

atgtgtcacc agcagttggt catctcttgg ttttccctgg tttttctggc atctcccctc 60

gtggccatat gggaactgaa gaaagatgtt tatgtcgtag aattggattg gtatccggat 120

gcccctggag aaatggtggt cctcacctgt gacacccctg aagaagatgg tatcacctgg 180

accttggacc agagcagtga ggtcttaggc tctggcaaaa ccctgaccat ccaagtcaaa 240

gagtttggag atgctggcca gtacacctgt cacaaaggag gcgaggttct aagccattcg 300

ctcctgctgc ttcacaaaaa ggaagatgga atttggtcca ctgatatttt aaaggaccag 360

aaagaaccca aaaataagac ctttctaaga tgcgaggcca agaattattc tggacgtttc 420

acctgctggt ggctgacgac aatcagtact gatttgacat tcagtgtcaa aagcagcaga 480

ggctcttctg acccccaagg ggtgacgtgc ggagctgcta cactctctgc agagagagtc 540

agaggggaca acaaggagta tgagtactca gtggagtgcc aggaggacag tgcctgccca 600

gctgctgagg agagtctgcc cattgaggtc atggtggatg ccgttcacaa gctcaagtat 660

gaaaactaca ccagcagctt cttcatcagg gacatcatca aacctgaccc acccaagaac 720

ttgcagctga agccattaaa gaattctcgg caggtggagg tcagctggga gtaccctgac 780

acctggagta ctccacattc ctacttctcc ctgacattct gcgttcaggt ccagggcaag 840

agcaagagag aaaagaaaga tagagtcttc acggacaaga cctcagccac ggtcatctgc 900

cgcaaaaatg ccagcattag cgtgcgggcc caggaccgct actatagctc atcttggagc 960

gaatgggcat ctgtgccctg caggggcgga ggcggaagcg gaggcggagg aagcggcggt 1020

ggcggcagca gaaacctccc cgtggccact ccagacccag gaatgttccc atgccttcac 1080

cactcccaaa acctgctgag ggccgtcagc aacatgctcc agaaggccag acaaactcta 1140

gaattttacc cttgcacttc tgaagagatt gatcatgaag atatcacaaa agataaaacc 1200

agcacagtgg aggcctgttt accattggaa ttaaccaaga atgagagttg cctaaattcc 1260

agagagacct ctttcataac taatgggagt tgcctggcct ccagaaagac ctcttttatg 1320

atggccctgt gccttagtag tatttatgaa gacttgaaga tgtaccaggt ggagttcaag 1380

accatgaatg caaagcttct gatggatcct aagaggcaga tctttctaga tcaaaacatg 1440

ctggcagtta ttgatgagct gatgcaggcc ctgaatttca acagtgagac tgtgccacaa 1500

aaatcctccc ttgaagaacc ggatttttat aaaactaaaa tcaagctctg catacttctt 1560

catgctttca gaattcgggc agtgactatt gatagagtga tgagctatct gaatgcttcc 1620

taa 1623

<210> 4

<211> 2196

<212> DNA

<213>Artificial sequence (rengongxulie)

<400> 4

atggagttct ggttgtcatg ggtctttctg gtagctattc ttaagggagt acagtgtcag 60

gtgcagctgg tgcagagcgg cgtggaagtg aaaaaaccgg gcgcgagcgt gaaagtgagc 120

tgcaaagcga gcggctatac ctttaccaac tattatatgt attgggtgcg ccaggcgccg 180

ggccagggcc tggaatggat gggcggcatt aacccgagca acggcggcac caactttaac 240

gaaaaattta aaaaccgcgt gaccctgacc accgatagca gcaccaccac cgcgtatatg 300

gaactgaaaa gcctgcagtt tgatgatacc gcggtgtatt attgcgcgcg ccgcgattat 360

cgctttgata tgggctttga ttattggggc cagggcacca ccgtgaccgt gagcagcgcg 420

agcaccaaag gcccgagcgt gtttccgctg gcgccgtgca gccgcagcac cagcgaaagc 480

accgcggcgc tgggctgcct ggtgaaagat tattttccgg aaccggtgac cgtgagctgg 540

aacagcggcg cgctgaccag cggcgtgcat acctttccgg cggtgctgca gagcagcggc 600

ctgtatagcc tgagcagcgt ggtgaccgtg ccgagcagca gcctgggcac caaaacctat 660

acctgcaacg tggatcataa accgagcaac accaaagtgg ataaacgcgt ggaaagcaaa 720

tatggcccgc cgtgcccgcc gtgcccggcg ccggaatttc tgggcggccc gagcgtgttt 780

ctgtttccgc cgaaaccgaa agataccctg atgattagcc gcaccccgga agtgacctgc 840

gtggtggtgg atgtgagcca ggaagatccg gaagtgcagt ttaactggta tgtggatggc 900

gtggaagtgc ataacgcgaa aaccaaaccg cgcgaagaac agtttaacag cacctatcgc 960

gtggtgagcg tgctgaccgt gctgcatcag gattggctga acggcaaaga atataaatgc 1020

aaagtgagca acaaaggcct gccgagcagc attgaaaaaa ccattagcaa agcgaaaggc 1080

cagccgcgcg aaccgcaggt gtataccctg ccgccgagcc aggaagaaat gaccaaaaac 1140

caggtgagcc tgacctgcct ggtgaaaggc ttttatccga gcgatattgc ggtggaatgg 1200

gaaagcaacg gccagccgga aaacaactat aaaaccaccc cgccggtgct ggatagcgat 1260

ggcagctttt ttctgtatag ccgcctgacc gtggataaaa gccgctggca ggaaggcaac 1320

gtgtttagct gcagcgtgat gcatgaagcg ctgcataacc attataccca gaaaagcctg 1380

agcctgagcc tgggcaaaga attcgaagga tccgcggccg ctgagggcag aggaagtctt 1440

ctaacatgcg gtgacgtgga ggagaatccc ggcccttccg ggatggagtt ctggttgtca 1500

tgggtctttc tggtagctat tcttaaggga gtacagtgtg aaattgtgct gacccagagc 1560

ccggcgaccc tgagcctgag cccgggcgaa cgcgcgaccc tgagctgccg cgcgagcaaa 1620

ggcgtgagca ccagcggcta tagctatctg cattggtatc agcagaaacc gggccaggcg 1680

ccgcgcctgc tgatttatct ggcgagctat ctggaaagcg gcgtgccggc gcgctttagc 1740

ggcagcggca gcggcaccga ttttaccctg accattagca gcctggaacc ggaagatttt 1800

gcggtgtatt attgccagca tagccgcgat ctgccgctga cctttggcgg cggcaccaaa 1860

gtggaaatta aacgcaccgt ggcggcgccg agcgtgttta tttttccgcc gagcgatgaa 1920

cagctgaaaa gcggcaccgc gagcgtggtg tgcctgctga acaactttta tccgcgcgaa 1980

gcgaaagtgc agtggaaagt ggataacgcg ctgcagagcg gcaacagcca ggaaagcgtg 2040

accgaacagg atagcaaaga tagcacctat agcctgagca gcaccctgac cctgagcaaa 2100

gcggattatg aaaaacataa agtgtatgcg tgcgaagtga cccatcaggg cctgagcagc 2160

ccggtgacca aaagctttaa ccgcggcgaa tgctag 2196

Claims

1. a kind of method for the CAR-T cell for preparing targeting EGFR v III, includes the following steps：

(1) plasmid for preparing PBMC cell, the III gene ScFV sequence containing EGFRv, by the plasmid of the III gene ScFV sequence containing EGFRv And after the transposase plasmids cotransfection PBMC cell being used cooperatively with EGFRv III, the PBMC cell after being transfected, the transfection III gene ScFV sequence of EGFRv is incorporated on the genome of PBMC cell afterwards；

(2) PBMC cell after amplification transfects as T cell activation agent and is cultivated using CD3 antibody, obtains targeting EGFR v's III CAR-T cell incorporates III gene ScFV sequence of EGFRv on the genome of the CAR-T cell.

2. according to the method described in claim 1, the plasmid of the III gene ScFV sequence containing EGFRv in the step (1) is Be sequentially connected in series in PiggyBac-transposon carrier using PiggyBac Transposon System people EF1 α promoter, signal peptide, Resistant gene puromycin that after birth exoantigen combined area, hinge area, intracellular signal transduction area are connected with T2A small peptide preparation and At.

3. according to the method described in claim 2, wherein after birth exoantigen combined area is for combining III albumen of EGFRv III single-chain antibody of EGFRv (scFv), be sequentially connected in series c-myc Epitope tag, CD8Hinge Chimerical receptor hinge and CD8Transmembrane Chimerical receptor transmembrane region.

4. according to the method described in claim 2, wherein intracellular signal transduction area is CD28-4-1BB--CD3 ζ, CD28 and 4- 1BB is Chimerical receptor costimulatory molecules.

5. according to the method described in claim 1, wherein III gene ScFV sequence of EGFRv is the EGFRv after codon optimization III gene ScFV sequence, the sequence after optimization are nucleotide sequence shown in SEQ ID NO.1.

6. according to the method described in claim 1, wherein preparation PBMC cell includes：(1) peripheral blood is acquired；(2) peripheral blood is thin Born of the same parents mix with lymphocyte separation medium, slow to rise slow drop centrifugation, the tunica albuginea confluent monolayer cells after drawing centrifugation；(3) the tunica albuginea layer that will be obtained Cell is centrifuged after mixing with PBS or serum-free cell culture medium, continues to be cleaned three times with PBS or serum-free cell culture medium, PBMC cell is obtained after precipitating.

7. according to the method described in claim 2, the sequence of the plasmid of the III gene ScFV sequence containing EGFRv is SEQ Nucleotide sequence shown in ID NO.2.

8. being allowed to have according to the method described in claim 1, further including the CAR-T cell of the transformation targeting EGFR v III Corresponding function：

Or：Prepare targeting EGFR v's III and secrete IL-12 CAR-T cell；

Or：Prepare targeting EGFR v's III and secrete anti-PD1 CAR-T cell.

9. a kind of electrotransfection system for the CAR-T cell for being used to prepare targeting EGFR v III, including：

(1) PBMC cell preparation system；

(2) Amaxa electrotransfection kit；

(3) electrotransfection system, receive the electricity from Amaxa electrotransfection kit turn reagent and by it with III CAR plasmid of EGFRv and Mixture is formed after the mixing of its transposase plasmids；And it receives the PBMC cell from PBMC cell preparation system and is added wherein The mixture carries out electrotransfection；

(4) CD3 positive T cell stimulation enrichment system and sieve training system, for screening and cultivating the T cell after amplification transfects to obtain Obtain the CAR-T cell of targeting EGFR v III.

10. the method and application of preparation engineering CAR-T described in one of -8 according to claim 1.