CN107936122A

CN107936122A - A kind of slow virus and its preparation method and application

Info

Publication number: CN107936122A
Application number: CN201711481042.1A
Authority: CN
Inventors: 韦丹; 付苏雷; 连杰; 李德志; 赵礼军; 吴雷振
Original assignee: HENAN HUALONG BIOLOGICAL TECHNOLOGY Co Ltd
Current assignee: HENAN HUALONG BIOLOGICAL TECHNOLOGY Co Ltd
Priority date: 2017-12-29
Filing date: 2017-12-29
Publication date: 2018-04-20

Abstract

The present invention provides a kind of slow virus and preparation method thereof, the slow virus after birth glycoprotein of the slow virus is modified with element S in element G upstreams；Wherein, the element S is the auxilin element of specific recognition NK cell membrane surface proteins, and the element G is the protein component derived from wild type slow virus envelope glycoprotein.The single-chain antibody that the present invention passes through the anti-NK cell surface molecules CD56 of modified specificity identification NK cells on slow virus envelope glycoprotein, it can be combined with the CD56 molecules of the NK cell surfaces infected, furthered the distance of virion and NK cells, film fusion is promoted, improves slow virus infect efficiency.

Description

A kind of slow virus and its preparation method and application

Technical field

The invention belongs to biological technical field, is related to a kind of slow virus and its preparation method and application, more particularly to a kind of It is used to prepare slow virus of CAR-NK cells and its preparation method and application.

Background technology

Chimeric antigen receptor T cell immunotherapy (Chimeric Antigen Receptor T-Cell Immunotherapy, CAR-T) it is one of tumour adoptive immunotherapy technology of greatest concern in recent years, mainly by T Cell surface expression Chimeric antigen receptor, carries out the identification and killing of cancer cell antigen.CAR-T immunotherapies are in multiple clinics Experiment, especially blood bome tumor treatment in achieve significant effect.According to the report, by CAR-T immunotherapies, 90% urgency Property lymphocytic leukemia patient obtains complete incidence graph (S.L.Maude et al.Chimeric antigen receptor T cells for sustained remissions in leukemia.Engl.J.Med.,371,1507-1517(2014))。 But CAR-T immunotherapies be faced with cytokine storm, undershooting-effect, to solid tumor without significant curative effect the problems such as.

NK cells are the lymphocytes to tumour cell with strong lethal effect of a kind of non-MHC dependences, are mainly passed through The intersection regulation and control of cell surface activation acceptor and Inhibitory receptor carry out the identification of tumour cell.When NK cell recognition tumours are thin After born of the same parents, by discharging perforin and granzyme element, the apoptosis of expression film TNF family molecule inducing target cells.However, tumor patient Internal NK cell quantities are limited, lethal effect is weaker, and there are escape mechanism for tumour so that the antitumor action of NK cells It cannot be not fully exerted.

The effect for the NK cell killing tumour cells that CAR molecular modifications are significantly increased in NK cell surfaces.It is existing at present Numerous studies design the CAR-NK for different tumor targets, and are carrying out clinical trial.CAR-NK has the following advantages： Cytokine storm side reaction is small, and graft versus host disease(GVH disease) does not occur, and life cycle is short, safe.Existing CAR-NK skills There is also defect for art：It is less efficient to be used to prepare the slow-virus infection of NK cells, only 10% or so.It is mainly rich by screening at present Collect to improve the content of CAR-NK positive cells, but be the increase in the triviality and cost of method.

Therefore it provides a kind of slow virus with efficient infection ability, is used to prepare CAR-NK cells, is controlled in tumour immunity Treatment field is of great significance.

The content of the invention

In view of the deficiencies of the prior art, the present invention provides a kind of slow virus and its preparation method and application, the slow disease of preparation Poison has the ability for efficiently infecting NK cells, simplifies the preparation process of CAR-NK cells, reduces immunization therapy cost.

For this purpose, the present invention uses following technical scheme：

In a first aspect, the present invention provides a kind of slow virus after birth glycoprotein, the slow virus after birth glycoprotein is in element G Upstream is modified with element S；

Wherein, the element S is the auxilin element of specific recognition NK cell membrane surface proteins, and the element G is Protein component derived from wild type slow virus envelope glycoprotein.

Peplos is wrapped around one layer of coating outside virus protein capsid, is mainly derived from host cell membrane, but Comprising the viral glycoprotein of itself, major function is to assist cell entry host cell.The glycoprotein of envelope membrane surface identifies first And host cell surface receptor is combined, subsequent peplos and host cell film combination, last viral capsid and viral genome Into host cell, course of infection is completed.The present invention passes through the modified specificity identification NK cells on slow virus envelope glycoprotein Auxilin element, the distance of furthered virion and NK cells, promotes film fusion, improves slow virus and infect effect Rate.

Preferably, it is connecting element G's and element S that the slow virus after birth glycoprotein, which further includes element L, the element L, Connect peptide.

Preferably, the element S is anti-CD56 single-chain antibodies.

Preferably, the element S is with histidine-tagged.

The anti-NK cell surface molecules CD56 of present invention modified specificity identification NK cells on slow virus envelope glycoprotein Single-chain antibody (single chain antibody fragment, scFv), can be with the NK cell surfaces infected CD56 molecules combine, and the distance of furthered virion and NK cells, promotes film fusion, improve slow virus infect efficiency.

Preferably, the nucleotide sequence of the element S is as shown in SEQ ID NO.1；

Nucleotide sequence shown in the SEQ ID NO.1 is：

CATCATCATCATCATCATCAAGTACAGCTCCAACAGTCAGGACCCGGTCTCGTTAAACCTTCCCAAACGCTGTCCCT CACTTGCGCCATCAGCGGAGATTCCGTGAGCTCTAACTCTGCCGCTTGGAACTGGATTAGGCAATCCCCCTCCCGAG GACTGGAATGGCTGGGAAGAACTTACTACCGCTCCAAATGGTACAACGACTACGCAGTGTCCGTCAAGTCTCGAATC ACTATCAACCCTGACACAAGCAAAAATCAGTTTTCCCTGCAACTCAACTCAGTCACCCCTGAGGACACGGCGGTTTA CTATTGCGCTAGAGAGAATATTGCCGCATGGACCTGGGCGTTCGATATATGGGGTCAGGGAACAATGGTAACCGTCA GCTCCGGCGGCGGCGGATCTGGAGGTGGTGGCTCAGGTGGCGGAGGCTCCGAAATCGTTATGACACAGTCCCCTGGA ACACTCTCCCTGTCTCCTGGTGAAAGAGCTACTCTGTCCTGCCGCGCTAGTCAATCCGTATCCTCCTCCTACCTTGC TTGGTACCAACAAAAGCCCGGACTTGCCCCACGCCTCCTTATTTACGACACCTCACTCCGCGCAACAGATATCCCAG ATAGATTCTCCGGATCAGGCTCCGGGACCGCTTTTACACTGACAATTTCTAGGCTCGAACCAGAGGACTTCGCTGTA TATTACTGCCAACAGTATGGCTCTTCACCAACATTCGGACAAGGCACCAAAGTCGAAATCAAACGCACCGTAGCC.

Preferably, the element L is flexible peptide.

Preferably, the nucleotide sequence of the flexible peptide is as shown in SEQ ID NO.2；

Nucleotide sequence shown in the SEQ ID NO.2 is：

GGAGGCGGTTCAGGAGGTGGCTCGAGCGGAGGCGGTTCA.

Preferably, the element G is any one in VSV-G, RD114, BaEv or MLV or at least two combination.

In the present invention, the VSV-G is vesicular stomatitis virus glycoprotein G, and the RD114 is endogenous feline viral bag Membrane glycoprotein, the BaEv are baboon endogenous retrovirus envelope glycoprotein, and the MLV is murine leukemia virus coating sugar Albumen.

Second aspect, the present invention provides a kind of nucleic acid sequence for encoding slow virus after birth glycoprotein as described in relation to the first aspect Row.

The third aspect, the present invention provides a kind of carrier, the carrier includes the nucleotide sequence as described in second aspect.

Preferably, the carrier is pMD2.G.

Preferably, the nucleotide sequence of the carrier is as shown in SEQ ID NO.3.

Fourth aspect, the present invention provides a kind of slow virus, the slow virus is imported just like the carrier described in the third aspect, The slow virus after birth glycoprotein of expression as described in relation to the first aspect.

5th aspect, the present invention provides a kind of method for preparing the slow virus as described in fourth aspect, including following step Suddenly：

(1) carrier of the structure as described in the third aspect；

(2) by the carrier described in step (1) and packaging plasmid cotransfection mammalian cell, viral packaging is carried out.

Preferably, the method for step (1) described structure is the nucleotide sequence as described in second aspect is inserted into pMD2.G Between HindIII and AdeI restriction enzyme sites, structure obtains the carrier.

Preferably, step (2) described mammalian cell is 293T cells.

As optimal technical scheme, the present invention provides a kind of method for preparing the slow virus as described in fourth aspect, bag Include following steps：

(1) nucleotide sequence as described in second aspect is inserted between HindIII the and AdeI restriction enzyme sites of pMD2.G, structure Build to obtain the carrier；

(2) by the carrier described in step (1) and packaging plasmid cotransfection 293T cells, viral packaging is carried out.

6th aspect, the present invention provides a kind of pharmaceutical composition, described pharmaceutical composition is included as described in relation to the first aspect Slow virus after birth glycoprotein, the nucleotide sequence as described in second aspect, the carrier as described in the third aspect or such as fourth aspect In the slow virus any one or at least two combination.

Preferably, described pharmaceutical composition further includes any in pharmaceutically acceptable carrier, excipient or diluent It is a kind of or at least two combination.

7th aspect, is used to prepare T cell the present invention provides a kind of pharmaceutical composition as described in terms of the 6th and is immunized The medicine of therapy for tumor.

Compared with prior art, the present invention has the advantages that：

(1) the anti-NK cell surfaces point that the present invention passes through the modified specificity identification NK cells on slow virus envelope glycoprotein The single-chain antibody of sub- CD56, can be combined with the CD56 molecules of the NK cell surfaces infected；

(2) slow virus envelope glycoprotein of the invention has furthered the distance of virion and NK cells, promotes film fusion, Slow virus infect efficiency is improved, obtained slow virus infects the efficiency of NK cells up to more than 80%.

Brief description of the drawings

Fig. 1 (A) is the electrophoretogram of the SEQ ID NO.3 sequences added with a segment signal peptide sequence, and Fig. 1 (B) is pMD2.G The electrophoretogram of nucleic acid fragments of the upper restriction enzyme site HindIII to insertion point, Fig. 1 (C) are insertion point on pMD2.G to digestion The electrophoretogram of the nucleic acid fragment of site Adel, Fig. 1 (D) are the electrophoretogram of fusion product, and Fig. 1 (E) is the pMD2.G's after digestion Electrophoretogram, Fig. 1 (F) they are anti-CD56-VSVG-pMD2.G carrier digestion products electrophoretograms, wherein, M is DNA standard molecular weights, Be followed successively by from bottom to top 100bp, 200bp, 300bp, 400bp, 500bp, 600bp, 700bp, 800bp, 900bp, 1000bp, 1200bp, 1500bp, 2000bp, 2500bp, 3000bp, 3500bp, 4000bp, 5000bp, 6000bp, 8000bp and The molecular weight of 10000bp；

Fig. 2 (A) is the sequencing result of anti-CD56-VSVG-pMD2.G carriers 1-248bp, and Fig. 2 (B) is anti-CD56- The sequencing result of VSVG-pMD2.G carriers 249-496bp, Fig. 2 (C) are anti-CD56-VSVG-pMD2.G carriers 497-682bp Sequencing result, Fig. 2 (D) be anti-CD56-VSVG-pMD2.G carriers 683-882bp sequencing result；

Fig. 3 is the structure schematic diagram of slow virus after birth glycoprotein；

Fig. 4 is the structure diagram of anti-CD56-VSVG-pMD2.G carriers；

Fig. 5 is lentiviral particle protein immunoblot result figure, wherein, 1-anti-CD56-VSVG-pMD2.G carrier eggs White immunoblot results figure, the wild VSVG-pMD2.G carrier proteins immunoblot results figures of 2-；

Fig. 6 is the infect efficiency figure that slow virus infects NK cells.

Embodiment

The technological means and its effect taken for the present invention is further explained, with reference to embodiments with attached drawing to this hair It is bright to be further described.It is understood that the specific embodiments described herein are used only for explaining the present invention, rather than Limitation of the invention.

In the examples where no specific technique or condition is specified, according to the described technology of document in the art or condition, Or carried out according to product description.Reagents or instruments used without specified manufacturer, be can be by regular channel commercially available from The conventional products of acquisition.

Material：

PCR purification kits (Shanghai life work biology)；

Gel reclaims kit (Shanghai life work biology)；

HindIII enzymes (Thermo Scientific)；

AdeI enzymes (Thermo Scientific)；

T4DNA ligases (Thermo Scientific).

The structure of 1 slow virus envelope vector anti-CD56-VSVG-pMD2.G of embodiment

(1) synthesis is added with a segment signal peptide sequence (SEQ ID NO.4 at 5' ends：TTTATTCATTGGGGTGAATTGC) Coding slow virus after birth glycoprotein nucleotide sequence, shown in length 829bp, electrophoresis result such as Fig. 1 (A), purpose fragment length Spend for 829bp；

(2) restriction enzyme site is expanded according to the requirement of the sequence of carrier pMD2.G and insertion point, design primer respectively HindIII to insertion point nucleic acid fragment and insertion point to the nucleic acid fragment of restriction enzyme site AdeI, primer sequence is shown in Table 1：

1 PCR primer of table

1. the system of PCR amplification restriction enzyme site HindIII to the nucleic acid fragment of insertion point is shown in Table 2, program for 95 DEG C/ 3min, (95 DEG C/20s, 45 DEG C/22s, 72 DEG C/35s) 20 circulations, 72 DEG C/5min, the electrophoresis result of PCR product is shown in Fig. 1 (B), purpose fragment length is 641bp；

2 restriction enzyme site HindIII of table to the nucleic acid fragment of insertion point PCR system

Title	Volume
		10 × pfu buffer solutions	5μL
dNTP	1μL
		Primer1(SEQ ID NO.5)	2μL
Primer2(SEQ ID NO.6)	2μL
		pMD2.G	1μL
Pfu enzymes	0.5μL(5U/μL)
		ddH₂O	Polishing is to 50 μ L

2. the system of PCR amplification insertion point to the nucleic acid fragment of restriction enzyme site Adel is shown in Table 3, program is 95 DEG C/3min, (95 DEG C/20s, 48 DEG C/22s, 72 DEG C/30s) 20 circulations, 72 DEG C/5min, the electrophoresis result of PCR product is shown in Fig. 1 (C), purpose Fragment length is 440bp；

3 insertion point of table to the nucleic acid fragment of restriction enzyme site Adel PCR system

3. PCR, which merges restriction enzyme site HindIII, is added with SEQ ID to the nucleic acid fragment (fragment 1) of insertion point, 5' ends NO.4 coding slow virus after birth glycoprotein nucleotide sequence (fragment 2) and insertion point to restriction enzyme site AdeI nucleic acid fragment (fragment 3), fusion system are shown in Table 4, and program is 95 DEG C/3min, (95 DEG C/20s, 55 DEG C/22s, 72 DEG C/120s) 22 circulations, 72 DEG C/5min, the electrophoresis result of fusion product is shown in Fig. 1 (D), and purpose fragment length is 1850bp；

4 PCR fusion systems of table

Title	Volume
		10 × pfu buffer solutions	5μL
dNTP	1μL
		Primer1(SEQ ID NO.5)	2μL
Primer4(SEQ ID NO.8)	2μL
		Fragment 1	1μL
Fragment 2	1μL
		Fragment 3	1μL
Pfu enzymes	0.5μL(5U/μL)
		ddH₂O	Polishing is to 50 μ L

4. using PCR purification kits gel recycling PCR fusion products, fusion is produced using HindIII enzymes and AdeI enzymes Thing carries out double digestion, and digestion system is shown in Table 5, and system is put into 37 DEG C of isothermal reaction 2h in PCR instrument；

5 fusion product digestion system of table

Title	Volume
		Fusion product	1μg
10 × FD buffer solutions	5μL
		HindIII enzymes	1μL(10U/μL)
AdeI enzymes	1μL(10U/μL)
		ddH₂O	Polishing is to 50 μ L

5. carrying out double digestion to pMD2.G using HindIII enzymes and AdeI enzymes, digestion system is shown in Table 6, and system is put into PCR instrument In 37 DEG C of isothermal reaction 2h, the electrooptical structure of the pMD2.G after digestion is shown in Fig. 1 (E), there is the fragment that two length do not wait, using solidifying The big digestion pMD2.G (4.8kb) of plastic recovery kit recycling fragment；

6 pMD2.G digestion systems of table

Title	Volume
		pMD2.G	1μg
10 × FD buffer solutions	5μL
		HindIII enzymes	1μL(10U/μL)
AdeI enzymes	1μL(10U/μL)
		ddH₂O	Polishing is to 50 μ L

6. connecting the fusion product and pMD2.G of digestion, linked system is shown in Table 7, and it is anti-that system is put into 16 DEG C of constant temperature in PCR instrument 2h is answered, obtains connection product；

7 linked system of table

Title	Volume
		The pMD2.G of digestion	4μL
The fusion product of digestion	10μL
		10 × T4DNA ligase buffer solutions	2μL
T4DNA ligases	1μL(5U/μL)
		ddH₂O	Polishing is to 20 μ L

(3) 10 μ L connection products are drawn, are converted using 42 DEG C of heat shock methods, competence bacterial strain XL10-Gold, tablet It is incubated overnight after coating in 37 DEG C of incubators；Single bacterium after picking conversion is fallen within test tube, 37 DEG C, 220rpm/min cultivated At night, extract carrier, and carrier identification is carried out using double digestion, and sequencing identification is carried out to recombinant vector, digestion the result is shown in Figure 1 (F), Two bar segments that length is respectively 1430bp and 5.2kb are obtained, illustrate the success of anti-CD56-VSVG-pMD2.G vector constructions, The sequencing result of carrier is shown in Fig. 2 (A)-Fig. 2 (D).

The structure diagram of the slow virus envelope glycoprotein of restructuring is as shown in Figure 3；Anti-CD56-VSVG-pMD2.G carriers Structure diagram it is as shown in Figure 4.

2 slow virus of embodiment is packed and verification

(1) 24h before transfection, 293T cells are passed on according to packaging quantity, according to 24 it is small when after can reach 70- The density of 80% degrees of fusion is inoculated with；

(2) it is using coprecipitation of calcium phosphate infection protocol that anti-CD56-VSVG-pMD2.G vector introductions is thin to 293T after 24h Born of the same parents, cell culture medium is changed to fresh DMEM high glucose mediums by 2h before transfection, and the preparation method of transfection liquid is：To 15mL from The anti-CD56-VSVG-pMD2.G carriers of preparation and the mixed liquor of packaging plasmid, the CaCl with respective volume are added in heart pipe₂ It is uniformly mixed obtained CaCl₂- DNA mixed liquors, incubate 5-10min at room temperature, and slowly frothing to add in BBS liquid dropwise mixes, room Temperature is lower to incubate 20-30min, obtains transfection liquid；

(3) transfection liquid is added dropwise in the nutrient solution of 293T cells, continues to cultivate 4-6h after mixing, it is clear with PBS after 4-6h Wash 1-2 times, be changed to the DMEM culture mediums containing 10% hyclone, 1640 cultures containing 5% hyclone are changed to after 16h Base, 4 DEG C of preservations of supernatant are collected after 24h, 1640 culture mediums containing 5% hyclone is changed to, is collected after 24h according to cell state Supernatant, concentrating virus liquid；

(4) virus liquid is centrifuged into 10min with 400g at 4 DEG C, takes supernatant, supernatant is filtered by 0.45 μm of PVDF Film, centrifuges 90min under 4 DEG C of bars, it can be seen that viral pellet, abandons supernatant, according to virus liquid initial volume, with 1 with 20000g:100 Ratio, dissolved and precipitated with appropriate PBS, and is transferred in 1.5mL centrifuge tubes；

(5) virus liquid in centrifuge tube is centrifuged into 5min with 500g, takes supernatant, dispense virus liquid, directly used or shift Saved backup to -80 DEG C of refrigerators.

Protein immunoblot (western blot) detection is carried out to the lentiviral particle of harvest, the result is shown in Fig. 5, it is seen that warp The slow virus that anti-CD56-VSVG-pMD2.G carriers obtain can be with normal expression histidine (His) label protein.

3 slow-virus infection NK cells of embodiment

NK cells are obtained using trophocyte cultivation cellar culture, positive rate is up to more than 95%.

Follow the steps below NK cell infections：

(1) the NK cells of acquisition are resuspended using GT-T561 culture mediums, density is 2 × 10⁶/mL；

(2) 12 orifice plates are inoculated into the density in 1mL/ holes, add 200 μ l virus liquids, 37 DEG C, 5%CO₂8h is cultivated, is added Isometric GT-T561 culture mediums containing 2% autoserum and 400U/mL IL-2, continue culture to 24h；

(3) the GT-T561 culture mediums containing 1% autoserum and 200U/mL IL-2 are replaced medium to, with 1 × 10⁶/mL Density inoculation continue culture to 48h.

Collect metainfective cell and carry out FCM analysis, the results are shown in Figure 6, slow virus of the invention, due to slow Viral after birth glycoprotein is modified with anti-CD56 single-chain antibodies, compared with wild type slow virus, there is higher to infect NK cells Efficiency, infect efficiency is up to more than 80%.

In conclusion anti-NK cell of the present invention by the modified specificity identification NK cells on slow virus envelope glycoprotein The single-chain antibody of surface molecular CD56, can be combined, furthered virion with the CD56 molecules of the NK cell surfaces infected With the distance of NK cells, film fusion is promoted, improves slow virus infect efficiency, obtained slow virus infects the efficiency of NK cells Up to more than 80%.

Applicant states that the present invention illustrates the method detailed of the present invention, but not office of the invention by above-described embodiment It is limited to above-mentioned method detailed, that is, does not mean that the present invention has to rely on above-mentioned method detailed and could implement.Technical field Technical staff it will be clearly understood that any improvement in the present invention, equivalence replacement and auxiliary element to each raw material of product of the present invention Addition, selection of concrete mode etc., all fall within protection scope of the present invention and the open scope.

Sequence table

<110>Hua Long Bioisystech Co., Ltd of Henan Province

<120>A kind of slow virus and its preparation method and application

<130> 20171228

<141> 2017-12-29

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 768

<212> DNA

<213>Artificial synthesized ()

<400> 1

catcatcatc atcatcatca agtacagctc caacagtcag gacccggtct cgttaaacct 60

tcccaaacgc tgtccctcac ttgcgccatc agcggagatt ccgtgagctc taactctgcc 120

gcttggaact ggattaggca atccccctcc cgaggactgg aatggctggg aagaacttac 180

taccgctcca aatggtacaa cgactacgca gtgtccgtca agtctcgaat cactatcaac 240

cctgacacaa gcaaaaatca gttttccctg caactcaact cagtcacccc tgaggacacg 300

gcggtttact attgcgctag agagaatatt gccgcatgga cctgggcgtt cgatatatgg 360

ggtcagggaa caatggtaac cgtcagctcc ggcggcggcg gatctggagg tggtggctca 420

ggtggcggag gctccgaaat cgttatgaca cagtcccctg gaacactctc cctgtctcct 480

ggtgaaagag ctactctgtc ctgccgcgct agtcaatccg tatcctcctc ctaccttgct 540

tggtaccaac aaaagcccgg acttgcccca cgcctcctta tttacgacac ctcactccgc 600

gcaacagata tcccagatag attctccgga tcaggctccg ggaccgcttt tacactgaca 660

atttctaggc tcgaaccaga ggacttcgct gtatattact gccaacagta tggctcttca 720

ccaacattcg gacaaggcac caaagtcgaa atcaaacgca ccgtagcc 768

<210> 2

<211> 39

<212> DNA

<213>Artificial synthesized ()

<400> 2

ggaggcggtt caggaggtgg ctcgagcgga ggcggttca 39

<210> 3

<211> 6629

<212> DNA

<213>Artificial synthesized ()

<400> 3

gattctgcct aataaaaaac atttattttc attgcaatga tgtatttaaa ttatttctga 60

atattttact aaaaagggaa tgtgggaggt cagtgcattt aaaacataaa gaaatgaaga 120

gctagttcaa accttgggaa aatacactat atcttaaact ccatgaaaga aggtgaggct 180

gcaaacagct aatgcacatt ggcaacagcc cctgatgcct atgccttatt catccctcag 240

aaaaggattc aagtagaggc ttgatttgga ggttaaagtt ttgctatgct gtattttaca 300

ttacttattg ttttagctgt cctcatgaat gtcttttcac tacccatttg cttatcctgc 360

atctctcagc cttgactcca ctcagttctc ttgcttagag ataccacctt tcccctgaag 420

tgttccttcc atgttttacg gcgagatggt ttctcctcgc ctggccactc agccttagtt 480

gtctctgttg tcttatagag gtctacttga agaaggaaaa acagggggca tggtttgact 540

gtcctgtgag cccttcttcc ctgcctcccc cactcacagt gacccggaat ccctcgacat 600

ggcagtctag cactagtgcg gccgcagatc tgcttcctcg ctcactgact cgctgcgctc 660

ggtcgttcgg ctgcggcgag cggtatcagc tcactcaaag gcggtaatac ggttatccac 720

agaatcaggg gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa 780

ccgtaaaaag gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca 840

caaaaatcga cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc 900

gtttccccct ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata 960

cctgtccgcc tttctccctt cgggaagcgt ggcgctttct catagctcac gctgtaggta 1020

tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca 1080

gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga 1140

cttatcgcca ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg 1200

tgctacagag ttcttgaagt ggtggcctaa ctacggctac actagaagaa cagtatttgg 1260

tatctgcgct ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg 1320

caaacaaacc accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag 1380

aaaaaaagga tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa 1440

cgaaaactca cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat 1500

ccttttaaat taaaaatgaa gttttaaatc aatctaaagt atatatgagt aaacttggtc 1560

tgacagttac caatgcttaa tcagtgaggc acctatctca gcgatctgtc tatttcgttc 1620

atccatagtt gcctgactcc ccgtcgtgta gataactacg atacgggagg gcttaccatc 1680

tggccccagt gctgcaatga taccgcgaga cccacgctca ccggctccag atttatcagc 1740

aataaaccag ccagccggaa gggccgagcg cagaagtggt cctgcaactt tatccgcctc 1800

catccagtct attaattgtt gccgggaagc tagagtaagt agttcgccag ttaatagttt 1860

gcgcaacgtt gttgccattg ctacaggcat cgtggtgtca cgctcgtcgt ttggtatggc 1920

ttcattcagc tccggttccc aacgatcaag gcgagttaca tgatccccca tgttgtgcaa 1980

aaaagcggtt agctccttcg gtcctccgat cgttgtcaga agtaagttgg ccgcagtgtt 2040

atcactcatg gttatggcag cactgcataa ttctcttact gtcatgccat ccgtaagatg 2100

cttttctgtg actggtgagt actcaaccaa gtcattctga gaatagtgta tgcggcgacc 2160

gagttgctct tgcccggcgt caatacggga taataccgcg ccacatagca gaactttaaa 2220

agtgctcatc attggaaaac gttcttcggg gcgaaaactc tcaaggatct taccgctgtt 2280

gagatccagt tcgatgtaac ccactcgtgc acccaactga tcttcagcat cttttacttt 2340

caccagcgtt tctgggtgag caaaaacagg aaggcaaaat gccgcaaaaa agggaataag 2400

ggcgacacgg aaatgttgaa tactcatact cttccttttt caatattatt gaagcattta 2460

tcagggttat tgtctcatga gcggatacat atttgaatgt atttagaaaa ataaacaaat 2520

aggggttccg cgcacatttc cccgaaaagt gccacctgac gtggatcccc tgagggggcc 2580

cccatgggct agaggatccg gcctcggcct ctgcataaat aaaaaaaatt agtcagccat 2640

gagcttggcc cattgcatac gttgtatcca tatcataata tgtacattta tattggctca 2700

tgtccaacat taccgccatg ttgacattga ttattgacta gttattaata gtaatcaatt 2760

acggggtcat tagttcatag cccatatatg gagttccgcg ttacataact tacggtaaat 2820

ggcccgcctg gctgaccgcc caacgacccc cgcccattga cgtcaataat gacgtatgtt 2880

cccatagtaa cgccaatagg gactttccat tgacgtcaat gggtggagta tttacggtaa 2940

actgcccact tggcagtaca tcaagtgtat catatgccaa gtacgccccc tattgacgtc 3000

aatgacggta aatggcccgc ctggcattat gcccagtaca tgaccttatg ggactttcct 3060

acttggcagt acatctacgt attagtcatc gctattacca tggtgatgcg gttttggcag 3120

tacatcaatg ggcgtggata gcggtttgac tcacggggat ttccaagtct ccaccccatt 3180

gacgtcaatg ggagtttgtt ttggcaccaa aatcaacggg actttccaaa atgtcgtaac 3240

aactccgccc cattgacgca aatgggcggt aggcgtgtac ggtgggaggt ctatataagc 3300

agagctcgtt tagtgaaccg tcagatcgcc tggagacgcc atccacgctg ttttgacctc 3360

catagaagac accgggaccg atccagcctc ccctcgaagc ttacatgtgg taccgagctc 3420

ggatcctgag aacttcaggg tgagtctatg ggacccttga tgttttcttt ccccttcttt 3480

tctatggtta agttcatgtc ataggaaggg gagaagtaac agggtacaca tattgaccaa 3540

atcagggtaa ttttgcattt gtaattttaa aaaatgcttt cttcttttaa tatacttttt 3600

tgtttatctt atttctaata ctttccctaa tctctttctt tcagggcaat aatgatacaa 3660

tgtatcatgc ctctttgcac cattctaaag aataacagtg ataatttctg ggttaaggca 3720

atagcaatat ttctgcatat aaatatttct gcatataaat tgtaactgat gtaagaggtt 3780

tcatattgct aatagcagct acaatccagc taccattctg cttttatttt atggttggga 3840

taaggctgga ttattctgag tccaagctag gcccttttgc taatcatgtt catacctctt 3900

atcttcctcc cacagctcct gggcaacgtg ctggtctgtg tgctggccca tcactttggc 3960

aaagcacgtg agatctgaat tctgacacta tgaagtgcct tttgtactta gcctttttat 4020

tcattggggt gaattgccat catcatcatc atcatcaagt acagctccaa cagtcaggac 4080

ccggtctcgt taaaccttcc caaacgctgt ccctcacttg cgccatcagc ggagattccg 4140

tgagctctaa ctctgccgct tggaactgga ttaggcaatc cccctcccga ggactggaat 4200

ggctgggaag aacttactac cgctccaaat ggtacaacga ctacgcagtg tccgtcaagt 4260

ctcgaatcac tatcaaccct gacacaagca aaaatcagtt ttccctgcaa ctcaactcag 4320

tcacccctga ggacacggcg gtttactatt gcgctagaga gaatattgcc gcatggacct 4380

gggcgttcga tatatggggt cagggaacaa tggtaaccgt cagctccggc ggcggcggat 4440

ctggaggtgg tggctcaggt ggcggaggct ccgaaatcgt tatgacacag tcccctggaa 4500

cactctccct gtctcctggt gaaagagcta ctctgtcctg ccgcgctagt caatccgtat 4560

cctcctccta ccttgcttgg taccaacaaa agcccggact tgccccacgc ctccttattt 4620

acgacacctc actccgcgca acagatatcc cagatagatt ctccggatca ggctccggga 4680

ccgcttttac actgacaatt tctaggctcg aaccagagga cttcgctgta tattactgcc 4740

aacagtatgg ctcttcacca acattcggac aaggcaccaa agtcgaaatc aaacgcaccg 4800

tagccggagg cggttcagga ggtggctcga gcggaggcgg ttcaaagttc accatagttt 4860

ttccacacaa ccaaaaagga aactggaaaa atgttccttc taattaccat tattgcccgt 4920

caagctcaga tttaaattgg cataatgact taataggcac agccttacaa gtcaaaatgc 4980

ccaagagtca caaggctatt caagcagacg gttggatgtg tcatgcttcc aaatgggtca 5040

ctacttgtga tttccgctgg tatggaccga agtatataac acattccatc cgatccttca 5100

ctccatctgt agaacaatgc aaggaaagca ttgaacaaac gaaacaagga acttggctga 5160

atccaggctt ccctcctcaa agttgtggat atgcaactgt gacggatgcc gaagcagtga 5220

ttgtccaggt gactcctcac catgtgctgg ttgatgaata cacaggagaa tgggttgatt 5280

cacagttcat caacggaaaa tgcagcaatt acatatgccc cactgtccat aactctacaa 5340

cctggcattc tgactataag gtcaaagggc tatgtgattc taacctcatt tccatggaca 5400

tcaccttctt ctcagaggac ggagagctat catccctggg aaaggagggc acagggttca 5460

gaagtaacta ctttgcttat gaaactggag gcaaggcctg caaaatgcaa tactgcaagc 5520

attggggagt cagactccca tcaggtgtct ggttcgagat ggctgataag gatctctttg 5580

ctgcagccag attccctgaa tgcccagaag ggtcaagtat ctctgctcca tctcagacct 5640

cagtggatgt aagtctaatt caggacgttg agaggatctt ggattattcc ctctgccaag 5700

aaacctggag caaaatcaga gcgggtcttc caatctctcc agtggatctc agctatcttg 5760

ctcctaaaaa cccaggaacc ggtcctgctt tcaccataat caatggtacc ctaaaatact 5820

ttgagaccag atacatcaga gtcgatattg ctgctccaat cctctcaaga atggtcggaa 5880

tgatcagtgg aactaccaca gaaagggaac tgtgggatga ctgggcacca tatgaagacg 5940

tggaaattgg acccaatgga gttctgagga ccagttcagg atataagttt cctttataca 6000

tgattggaca tggtatgttg gactccgatc ttcatcttag ctcaaaggct caggtgttcg 6060

aacatcctca cattcaagac gctgcttcgc aacttcctga tgatgagagt ttattttttg 6120

gtgatactgg gctatccaaa aatccaatcg agcttgtaga aggttggttc agtagttgga 6180

aaagctctat tgcctctttt ttctttatca tagggttaat cattggacta ttcttggttc 6240

tccgagttgg tatccatctt tgcattaaat taaagcacac caagaaaaga cagatttata 6300

cagacataga gatgaaccga cttggaaagt aactcaaatc ctgcacaaca gattcttcat 6360

gtttggacca aatcaacttg tgataccatg ctcaaagagg cctcaattat atttgagttt 6420

ttaattttta tgaaaaaaaa aaaaaaaaac ggaattcacc ccaccagtgc aggctgccta 6480

tcagaaagtg gtggctggtg tggctaatgc cctggcccac aagtatcact aagctcgctt 6540

tcttgctgtc caatttctat taaaggttcc tttgttccct aagtccaact actaaactgg 6600

gggatattat gaagggcctt gagcatctg 6629

<210> 4

<211> 22

<212> DNA

<213>Artificial synthesized ()

<400> 4

tttattcatt ggggtgaatt gc 22

<210> 5

<211> 25

<212> DNA

<213>Artificial synthesized ()

<400> 5

gacacaagct tacatgtggt accga 25

<210> 6

<211> 20

<212> DNA

<213>Artificial synthesized ()

<400> 6

gcaattcacc ccaatgaata 20

<210> 7

<211> 44

<212> DNA

<213>Artificial synthesized ()

<400> 7

tggctcgagc ggaggcggtt caaagttcac catagttttt ccac 44

<210> 8

<211> 31

<212> DNA

<213>Artificial synthesized ()

<400> 8

gacacgtcga ccacatggtg aggagtcacc t 31

Claims

1. a kind of slow virus after birth glycoprotein, it is characterised in that the slow virus after birth glycoprotein is modified with member in element G upstreams Part S；

Wherein, the element S is the auxilin element of specific recognition NK cell membrane surface proteins, and the element G is derivative From the protein component of wild type slow virus envelope glycoprotein.

2. slow virus after birth glycoprotein according to claim 1, it is characterised in that the element S and element G pass through element L is connected, and the element L is connection peptide；

Preferably, the element S is anti-CD56 single-chain antibodies；

Preferably, the element S is with histidine-tagged；

Preferably, the element L is flexible peptide；

A kind of 3. nucleotide sequence for encoding slow virus after birth glycoprotein as claimed in claim 1 or 2.

4. a kind of carrier, it is characterised in that the carrier includes nucleotide sequence as claimed in claim 3；

Preferably, the carrier is pMD2.G；

Preferably, the nucleotide sequence of the carrier is as shown in SEQ ID NO.3.

5. a kind of slow virus, it is characterised in that the slow virus is imported with carrier as claimed in claim 4, expression such as right It is required that the slow virus after birth glycoprotein described in 1 or 2.

A kind of 6. method for preparing slow virus as claimed in claim 5, it is characterised in that comprise the following steps：

(1) carrier as claimed in claim 4 is built；

7. according to the method described in claim 6, it is characterized in that, the method for step (1) described structure is will be such as claim 3 Between HindIII the and AdeI restriction enzyme sites of the nucleotide sequence insertion pMD2.G, structure obtains the carrier；

Preferably, step (2) described mammalian cell is 293T cells.

8. the method according to claim 6 or 7, it is characterised in that comprise the following steps：

(1) by between HindIII the and AdeI restriction enzyme sites of nucleotide sequence as claimed in claim 3 insertion pMD2.G, build Obtain the carrier；

9. a kind of pharmaceutical composition, it is characterised in that described pharmaceutical composition includes slow virus as claimed in claim 1 or 2 After birth glycoprotein, nucleotide sequence as claimed in claim 3, carrier as claimed in claim 4 or as claimed in claim 5 In slow virus any one or at least two combination；

Preferably, described pharmaceutical composition further includes any one in pharmaceutically acceptable carrier, excipient or diluent Or at least two combination.

10. a kind of pharmaceutical composition as claimed in claim 9 is used to prepare the medicine of T cell Immuno Suppressive Therapy tumour.