KR102009270B1 - Recombinant foot-and-mouth disease virus expressing protective antigen of type O-Thi60 - Google Patents

Abstract

The present invention relates to a recombinant virus expressing a defensive antigen of Thi60 strain of the foot-and-mouth type O Cathay local type, a method of manufacturing the same, and a use thereof as a vaccine, and can maximize the protective effect of the foot-and-mouth type O serotype in a wider range.

Description

Recombinant foot-and-mouth disease virus expressing protective antigen of type O-Thi60}

The present invention relates to a recombinant virus expressing a defensive antigen of foot-and-mouth disease O-Thi60 strain, more specifically, a recombinant vector, a recombinant vector prepared using the recombinant vector, Thi60 strain (O THI) of foot-and-mouth disease O type Cathay regional type The present invention relates to a recombinant virus expressing a protective antigen of A, a method for producing the same, and a use thereof as a vaccine.

Foot and mouth disease (FMD) is a viral bullous disease that infects animals with two hoofs and is characterized by rapid replication and rapid spread. This disease is classified as a very important animal disease by the World Animal Health Organization (OIE) due to its economic importance, and it is the most important factor in the trade of livestock products because it is impossible to trade between countries when it occurs.

The foot-and-mouth disease pathogen is a single-stranded bipolar RNA virus belonging to the genus Piconaviridae and Aphthovirus, and has seven different serotypes (A, O, C, Asia1, SAT 1, SAT2, SAT3). It is classified.

In addition, since there are about 10 or more regional types among foot and mouth disease virus type O, if developed strictly, all vaccines for these regional types should be developed and used as vaccine strains. However, for the development of all vaccine strains, it is necessary to continuously culture the field strains in cells to have an appropriate proliferative capacity, and this method is time-consuming and there is no guarantee that the result will be good.

In order to solve this problem, the present inventors have participated in the prior art, three siRNA base sequence proved effective in the most stable sites of the foot and mouth virus genes 2B and 3C, and inserted into the adenovirus to be expressed A prepared viral vector and a foot-and-mouth virus vaccine comprising the same are disclosed (Patent Publication No. 10-2011-0135532).

In addition, a recombinant foot-and-mouth vaccine virus using the foot-and-mouth virus O Manisa obtained by cloning the entire gene of the foot-and-mouth virus O Manisa and then deleting some genes is disclosed (Patent Publication No. 10-2014-0083129).

However, since the conventional technology alone has a limitation in efficiently providing a foot-and-mouth disease vaccine, there is a lot of existing information and a vaccine vaccine that is needed by using a vaccine virus that has already been proved. There is an urgent need to be made in a form that can be manufactured.

In order to solve the above problems of the prior art, the present inventors used a basic vector composed of viral genes based on pathogenic attenuated viruses, already known as foot-and-mouth disease vaccine strains, to prevalence in China and Southeast Asian regions of type O. It was found that a new recombinant foot-and-mouth virus can be produced that can produce a vaccine capable of protecting against the virus, and completed the present invention.

Accordingly, an object of the present invention is to provide a recombinant foot-and-mouth virus that can be usefully used as a vaccine poison by simultaneously having a wide range of defense against other regional types, such as Cathay, ME-SA, SEA regional type of foot-and-mouth virus O-type virus It is.

Another object of the present invention is to provide a recombinant vector for producing the recombinant foot-and-mouth virus.

Still another object of the present invention is to provide a method for producing the recombinant foot-and-mouth virus.

Still another object of the present invention is to provide a vaccine for foot-and-mouth disease prevention comprising the recombinant foot-and-mouth virus as an active ingredient.

Another object of the present invention to provide a method for preventing foot and mouth disease using the vaccine composition.

In order to achieve the above object, the P1 gene region of the foot-and-mouth disease O type Manisa genome is substituted with the foot-and-mouth type O Thi60 gene, and the 3B12 portion of the foot-and-mouth disease O type Manisa genome is replaced by the 3B12 region, and the foot-and-mouth disease O Among the P1 genes of the type Manisa genome, cysteine, the 142th amino acid of the 3C gene, provides a recombinant vector substituted with threonine.

In addition, the present invention provides a recombinant foot-and-mouth virus produced using the recombinant vector.

In addition, the present invention (a) inserting the gene of foot-and-mouth type O Manisa into a recombinant vector, (b) in the recombinant vector obtained in step (a), replacing the 3B12 site of foot-and-mouth type O Manisa, (c ) In the recombinant vector obtained in step (b), replacing cysteine, which is the 142th amino acid of the 3C gene of the foot-and-mouth type O, with threonine, and (d) in the recombinant vector obtained in step (c), the foot-and-mouth disease It provides a method for producing a recombinant vector comprising the step of replacing the P1 gene region of O-type Manisa with the P1 gene of foot-and-mouth type O60 Thi60 strain.

The present invention also provides a method for producing a recombinant foot-and-mouth virus, comprising the step of introducing and propagating a recombinant vector prepared by the above method into a cell.

The present invention also provides a vaccine for foot-and-mouth disease prevention comprising the recombinant foot-and-mouth virus as an active ingredient.

Recombinant foot-and-mouth virus according to the present invention has the advantage that can be used more safely than the pathogenic virus to handle in the laboratory, such as disinfectant experiments or antiviral experiments by manipulating the gene part of the foot-and-mouth virus O virus.

In addition, by producing a vaccine using the recombinant foot-and-mouth virus according to the present invention as an active ingredient, there is an effect that can protect the virus occurring in the region around Korea, including China and Southeast Asia.

On the other hand, the recombinant foot-and-mouth virus according to the present invention can also be differentially diagnosed with the outdoor strain can be effectively used in vaccine production.

Figure 1 shows a genomic schematic of the recombinant foot-and-mouth virus that expresses the protective antigen of foot-and-mouth disease O serotype O-Thi60 strain (Cathay regional type, hereinafter referred to as "O THI").
Figure 2 is a recombinant vector (plasmid) inserted with the nucleotide sequence of the Cathay region type (O-Thi60) gene (Genbank KM243030) by replacing the VP2, VP3, VP4 and VP1 protective antigen proteins with O-Thi60 in the foot-and-mouth type O vaccine strain Manisa ) Shows a schematic diagram.
Figure 3 shows the virus particles confirmed through the electron micrograph of the recombinant foot-and-mouth virus O-Thi-R prepared from the recombinant vector of FIG.
Figure 4 shows the results confirmed that the pathogenicity in the mouse is reduced.
Figure 5 shows the expression of antigens in cells infected with the identified O-Thi-R foot and mouth virus.
6A and 6B show the survival rate (FIG. 6A) and weight loss (FIG. 6B) of mice through challenge experiments (ME-SA regional type, O / VN / 2013) after 7 days immunization by antigen dose in mice. The results of the investigation are shown.
Figure 7 shows the results of the ELISA antibody level for the antibodies immunized with serum obtained through the immunization test (week 0 and 4 weeks inoculation) in cattle (n = 5).

In one embodiment of the present invention, the P1 gene region of the foot-and-mouth disease O type Manisa genome is substituted with the foot-and-mouth type O Thi60 gene, and the 3B12 portion of the 3B portion of the foot-and-mouth disease O-type Manisa genome is substituted, and the P1 of the foot-and-mouth disease O type Manisa genome is The gene relates to a recombinant vector in which the cysteine, the 142th amino acid of the 3C gene, is substituted with threonine.

In the present invention, "P1 gene" is a base sequence encoding the P1 protein, may include VP1, VP2, VP3 and VP4 sites, in the present invention, the site is a base sequence encoding the protein, the base without the protein coding Used as a concept involving sequences and genes.

As used herein, the term "vector" refers to a DNA preparation containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing the DNA in a suitable host.

The vector can be a plasmid, phage particles or simply a potential genomic insert. Once transformed into the appropriate host, the vector can replicate and function independently of the host genome, or in some cases can be integrated into the genome itself. Since plasmids are the most commonly used form of current vectors, "plasmid" and "vector" are sometimes used interchangeably in the context of the present invention.

For the purposes of the present invention, it is preferred to use plasmid vectors. Typical plasmid vectors that can be used for this purpose include (a) a replication initiation point that allows for efficient replication to include hundreds of plasmid vectors per host cell, and (b) host cells transformed with the plasmid vector. It has a structure comprising a screening label and (c) a restriction enzyme cleavage site into which foreign DNA fragments can be inserted.

Although no appropriate restriction enzyme cleavage site is present, the use of synthetic oligonucleotide adapters or linkers according to conventional methods facilitates ligation of the vector and foreign DNA.

In the present invention, "foot-and-mouth virus O type Cathay regional type Thi 60 weeks" is a vaccine antigen type widely used in type O vaccines, an antigen capable of a wide range of defense against type O viruses, including the Cathay local type among the O type.

In the recombinant vector of the present invention, the gene of the foot-and-mouth type O virus is characterized in that the entire gene of the foot-and-mouth type O vaccine strain Manisa. Part of the 3B1 region and 3B2 region may be substituted for the purpose of differential diagnosis with the outdoor strain among the entire gene region. Substitution sites of the 3B1 and 3B2 is 6,482 to 6,625bp of the recombinant plasmid of the present invention represented by the nucleotide sequence of SEQ ID NO: 1 The site is preferred, but is not limited thereto.

In the recombinant vector of the present invention, the 142th amino acid cysteine of the 3C region in the foot-and-mouth type O Manisa genome may be substituted with threonine (C142T).

The recombinant vector of the present invention may be pO-THI having a cleavage map of FIG.

The recombinant vector pO-THI of the present invention may be composed of the nucleotide sequence of SEQ ID NO: 1.

Another embodiment of the present invention relates to a recombinant foot and mouth virus produced using the recombinant vector.

Recombinant foot-and-mouth virus of the present invention is characterized in that the protective antigen of foot-and-mouth disease O type Thi 60 strain is expressed.

Another embodiment of the present invention (a) inserting the gene of foot-and-mouth type O Manisa into a recombinant vector, (b) in the production vector obtained in step (a), P1 of the P1 gene of the foot-and-mouth type O Manisa Substituting the site with the P1 gene of foot-and-mouth cathay, (c) In the recombinant vector obtained in the step (b), replacing the 142th amino acid cysteine of the 3C site of the foot-and-mouth disease O-type Manisa genome with threonine (C142T) And, and (d) in the recombinant vector obtained in step (c), relates to a method for producing a recombinant vector comprising the step of replacing the 3B12 site of foot-and-mouth type O Manisa.

Another embodiment of the present invention relates to a method for producing a recombinant foot-and-mouth virus, comprising the step of introducing and propagating a recombinant vector prepared by the method.

Recombinant vectors and recombinant foot-and-mouth virus of the present invention can be prepared by conventional genetic engineering, transformation method, it is possible to obtain an appropriate amount of virus in a continuous passage through the cell culture of the virus formed in a small amount.

In the method for producing the recombinant foot-and-mouth virus of the present invention, the cell is a canine animal, a feline animal, a boar animal, a bovine animal, a deer animal, a giraffe animal, a pecker animal, a camel animal, a hippopotamus animal, a horse animal, a mac It may be derived from one or more cells selected from the group consisting of cells of the family of animals, rhinoceros, weasels, rabbits, rodents and primates, preferably goat tongue cells (ZZ-R) and hamster kidney cells (BHK-21). ), Black goat kidney cells (BGK), pig kidney cells (IBRS-2) and bovine kidney cells (LF-BK) can be used at least one selected from the group consisting of.

In the method of producing the recombinant foot-and-mouth virus of the present invention, the cells may be more preferably any one or more selected from goat fetal tongue cells (ZZ-R) and hamster kidney cells (BHK-21).

Another embodiment of the present invention relates to a vaccine for foot-and-mouth disease prevention comprising the recombinant foot-and-mouth virus as an active ingredient.

In the vaccine for foot-and-mouth disease prevention of the present invention, the vaccine may be a live vaccine, an attenuated vaccine, or a dead vaccine.

The foot-and-mouth disease vaccine composition of the present invention may contain one or more known active ingredients with excellent preventive effect against foot-and-mouth disease with recombinant foot-and-mouth virus.

The vaccine composition of the present invention may be prepared by further including one or more pharmaceutically acceptable carriers in addition to the above-described active ingredients for administration.

The pharmaceutically acceptable carrier may be used in combination with saline, sterile water, Ringer's solution, buffered saline, dextrose solution, sucrose solution, glycerol, ethanol and one or more of these components, and antioxidants and buffers as necessary. And other conventional additives such as bacteriostatic agents can be added.

Vaccine compositions of the invention can also be formulated into injectable formulations, pills, capsules, granules or tablets, such as aqueous solutions, suspensions, emulsions, etc., with the addition of diluents, dispersants, surfactants, binders and lubricants additionally.

The vaccine composition of the present invention may be administered orally or parenterally (eg, applied intravenously, subcutaneously, intraperitoneally or topically) according to the desired method, and the dosage is based on the weight, age, sex, health of the individual. The range varies depending on the condition, diet, administration time, administration method, excretion rate and severity of the disease.

Another embodiment of the present invention relates to a method for preventing foot-and-mouth disease comprising administering the recombinant foot-and-mouth virus to a subject other than a human.

Hereinafter, the content of the present invention will be described in detail through experimental examples. However, the following experimental examples are intended to explain the present invention in more detail, and the scope of the present invention is not limited thereto.

Example 1 Genetic Manipulation for Differential Diagnosis of Foot-and-mouth Disease Outdoor Cells

The foot-and-mouth virus virus gene (Genbank Accession No. AY593823.1) was amplified by PCR, and the O_Manisa gene was inserted into the plasmid (pBluescript SK II) (pO-Manisa). Based on this, the P1 site was manipulated, and the method is as follows.

The 3B region (3B333) of the already obtained O1 Manisa infectious plasmid, the synthesized sequence corresponding to the positions 6,482-6,625 in SEQ ID NO: 1 (GGACCTTACGAGGGACCGGTGAAGAAGCCTGTCGCTTTGAAAGTGAAAGCTAAGAACTTGATTGTCACTGAGGGGCCATATGAAGGACCAGGAGAGAGACCAACCGATCGCTGCTGCT) Was synthesized and inserted into 3B3 and 3B3 of the SAT type.

In general, based on the cloning of the entire gene after cDNA preparation for the O-Manisa virus using a random primer used for cDNA synthesis, the end gene of 3A and the start region gene of 3B3 using O-Manisa virus gene information. PCR was performed by preparing specific primers capable of amplification (corresponding to 20 mers of 5 'and 3' genes based on GenBank Accession No. AY593823.1).

Conditions for the PCR are 5X buffer (FINNZYMES, 10μl), 10mM dNTPs (1μl), Phusion enzyme (2U / μl, 0.5μl), sterile distilled water (35.5μl) 98 ℃ 30 seconds after 98 ℃ 10 The reaction was carried out at 25 cycles for 2 seconds, 65 ° C for 30 seconds, 72 ° C for 2 minutes and 30 seconds, and final 72 ° C for 10 minutes.

The ligation reaction of the generated vector with the synthesized gene (TAKARA Long Ligation kit) was performed, and it was confirmed that it was properly cloned through the entire sequencing analysis.

Table 1 below shows amino acid sequences in which 3B1 and 3B2 were removed and AB 3B3 and SAT 3B3 were replaced.

Example 2 Pathogenicity Reduction Genetic Engineering

Attempts were first made to make infectious plasmids to produce pathogenic reduced foot and mouth virus. Example In the pO-Mansia-3B plasmids prepared in 1, that the vector NEW ENGLAND BIOLABS ^® Inc. of Gibson Assembly ^® Master Mix using a pO-Manisa-3B 3C C142T of the gene (7121-7122 bp position, tg → ac).

After amplification using PCR and self ligation, gene replacement plasmids were obtained using a method of self ligation.

Example 3 Construction of Recombinant Plasmid pO-THI

The foot-and-mouth virus virus gene (Genbank Accession No. AY593823.1) was amplified by PCR, and the O_Manisa gene was inserted into the plasmid (pBluescript SK II) (pO-Manisa). Based on this, the P1 site was manipulated and the method is as follows.

On the basis of the plasmid (pO-Manisa), it was operated using the NEW ENGLAND BIOLABS ^® Inc. of Gibson Assembly ^® Master Mix.

PCR for P1 manipulation was performed using plasmid (30 ng / μl, 1 μl), Thi Primer F (AGGTCCAGAAAAGGCTCAAGGGAGCTGGGCAATCCAGTCC, 10 pmole / μl, 1 μl) of SEQ ID NO: 5 and Thi Primer R (AGCAGGTCAAAATTTAGAAGCTGTTTTGCGGGTGCCACl), 10 pm μl / 10 μl, 10 pm It was.

PCR for vector site manipulation was based on plasmid (O1 manisa), plasmid (30 ng / μl, 1 μl), Primer F of SEQ ID NO: 7 (CTTCTAAATTTTGACCTGCT, 10 pmole / μl, 1 μl) and Primer R (CTTGAGCCTTTTCTGGACCT) of SEQ ID NO: 8 , 10 pmole / μl, 1μl) was used for synthesis.

Conditions for the PCR are 5X buffer (FINNZYMES, 10μl), 10mM dNTPs (1μl), Phusion enzyme (2U / μl, 0.5μl), sterile distilled water (35.5μl) at 98 ℃ 30 seconds, 98 ℃ 10 seconds, The reaction was carried out at 25 cycles of 65 ° C for 30 seconds, 72 ° C for 2 minutes 30 seconds, and final 72 ° C for 10 minutes.

Thereafter, self ligation (Self ligation, Gibson Assembly ^® Master Mix) was performed. The method was ligation was performed at 50 ℃ for 30 minutes by combining the PCR products (200ng) with the master mix (5μl).

After ligation was performed, plasmids (5 μl) ligated to OmniMAX ™ (Thermo Fisher) were treated for 30 minutes on ice, 30 seconds at 42 ° C., and 2 minutes on ice to propagate plasmids.

S.O.C. The medium (300μl) was added and shaken for 1 hour at a temperature of 37 ℃. The plate was agar plate containing ampicillin and then overnight at 37 ° C. Plasmids were obtained using midi prep and the sequence was confirmed to confirm that P1 was replaced with O Thi60.

Example 4 Construction of Recombinant Foot and Mouth Virus

Recovery of recombinant foot-and-mouth virus was achieved by the recombinant plasmid (pO-THI)

To prepare a single fragment of the gene by the restriction enzyme and transduce the purified DNA to BHKT7-9 cells (cell line expressing T7 RNA polymerase) using lipofectamine transformation reagent (Life Technology). After incubation for 3 to 3 days, the formed recombinant virus was obtained.

Thereafter, the secured virus was inoculated via serial passage in ZZ-R (goat fetal tongue) cells or BHK-21 (young hamster kidney) cells to propagate the virus.

Figure 3 shows the virus particles confirmed by the electron micrograph of the recombinant foot-and-mouth virus O-Thi-R newly prepared from the recombinant plasmid pO-THI.

Example 5 Immunogenicity in Animals of Produced Vaccines

For animal experiments using recombinant foot-and-mouth virus, the recombinant foot-and-mouth virus produced in Example 3 was mixed using 0.5 ml of adjuvants containing 0.5 ml oil-adjuvant antigen (15 μg / dose) and an adjuvant ISA206. Written in double oil.

The vaccine was prepared using mice (C57BL / 6) and animals without foot-and-mouth antibodies, such as cattle 6 months of age or older, inoculated with 0.1ml of mice and 1ml of cattle. Survival was observed, blood was collected for pigs and cattle at each time for antibody measurement, and neutralization test using O-type SP-ELISA (Prionic kit itself manual) and vaccine strain for O-type antibody measurement (OIE manual standard test method). Criteria) to determine antibody levels.

Figure 4 confirms the result of reduced pathogenicity in the mouse, inoculated with the same type (O Thi-naive form) and 3C engineered vaccine strain (O-Thi-R) of the wild type strain in mammalian mice The mortality was then tested.

Fig. 5 shows that the antigens are expressed in cells infected with the identified O-Thi-R foot-and-mouth disease virus (PBM kit, USA; structural protein (SP) band is band formation, non-structural protein (NSP) is band not formed) As confirmed by), the NSP band is not formed, and antigen and serologically can be distinguished from the outdoor strain, it is possible to detect up to 375 ng (1/40 dose).

6A and 6B are 7 days after immunization by antigen dose in mice (experimental experiments divided into 3.0 to 1/80 doses based on 45 to 0.187 μg, that is, 15 μg of cattle and pigs as 1 dose). (ME-SA regional type, O / VN / 2013) shows the results of the survival rate (Fig. 6a) and weight loss (Fig. 6b) of the mouse, according to the results inoculated 15 μg (1 dose) vaccine It was found that complete defense against ME-SA local open-air foot and mouth virus was possible.

Figure 7 shows the results of the ELISA antibody level for the antibodies immunized with serum obtained through the immunization test (week 0 and 4 weeks inoculation) in cattle (n = 5).

Although described with reference to the preferred embodiment of the present invention as described above, those skilled in the art without departing from the spirit and scope of the present invention described in the claims below It will be appreciated that various modifications and variations can be made in the present invention.

According to the present invention, since it is possible to contribute to the treatment and / or prevention of foot-and-mouth disease by providing a foot-and-mouth vaccine using a recombinant foot-and-mouth virus having a wide range of protective antigen expression of foot-and-mouth type O serotypes, It can be usefully applied.

<110> Republic of Korea (Animal and Plant Quarantine Agency) <120> Recombinant foot-and-mouth disease virus expressing protective          antigen of type O-Thi60 <130> 10923 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 11095 <212> DNA <213> Artificial Sequence <220> <223> full DNA gene of pO-Thi <400> 1 ctaaattgta agcgttaata ttttgttaaa attcgcgtta aatttttgtt aaatcagctc 60 attttttaac caataggccg aaatcggcaa aatcccttat aaatcaaaag aatagaccga 120 gatagggttg agtgttgttc cagtttggaa caagagtcca ctattaaaga acgtggactc 180 caacgtcaaa gggcgaaaaa ccgtctatca gggcgatggc ccactacgtg aaccatcacc 240 ctaatcaagt tttttggggt cgaggtgccg taaagcacta aatcggaacc ctaaagggag 300 cccccgattt agagcttgac ggggaaagcc ggcgaacgtg gcgagaaagg aagggaagaa 360 agcgaaagga gcgggcgcta gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac 420 cacacccgcc gcgcttaatg cgccgctaca gggcgcgtcc cattcgccat tcaggctgcg 480 caactgttgg gaagggcgat cggtgcgggc ctcttcgcta ttacgccagc tggcgaaagg 540 gggatgtgct gcaaggcgat taagttgggt aacgccaggg ttttcccagt cacgacgttg 600 taaaacgacg gccagtgagc atatgtaata cgactcacta tagggttgaa agggggcgct 660 agggtctcac ccctagcatg ccaacgacag ctcctacgtc gcactccaca ctaacgtttg 720 tgtgcgcgcg ggaaccgatg gacttttgtt cacccaccta cagttggact cacggcaccg 780 cgtggccatt ttagctgggt tgtgcggacg aacactgctt gcgcatctcg cgtgaccggt 840 tagtactctt accactatcc gcctacttgg tcgttagcgc tgtcctgggc actcttgttg 900 ggggctgttc aacgctctac ggtctcccct gcgtaacaga ctacggtgtt ggggccgctt 960 cgtgcgagcc gatcgcttgg tgtgcctcgg ctgtcgcccg aagcccgcct ttcacccccc 1020 cccccccccc ctaggtttta ccgtcgttcc cgacgttaat ggggaaacaa ccacaagctt 1080 aacaccgtct tgcccgacgt aaaagggctg caaccaaaaa gcttgtgccg cctttcccgg 1140 cgttaatggg aggtaaccac aagacaaacc ttcacccgga agtaaaacgg caacttcaca 1200 cagttttgcc cgttttcgtg agaaatgggc cgtcaacgca cgaaacgcgc cgtcgcttga 1260 ggaggacttg tacaaacacg atctatgcag gtttccacaa ctgacacaaa ccgtgcaact 1320 tgaaaccccg cctggtcttt ccaggtctag aggggcgaca ttttgtactg tgcttgactc 1380 cacgctcggt ccactagcga gtgttagtag tagcactgtt gcttcgtagc ggagcatgat 1440 ggccgtggga gcttcccctt ggtaacaagg acccacgggg ccaaaagcca cgtcctaccg 1500 gacccatcat gtgtgcaaac ccagcacggc aactttactg cgaaaaccac tttaaggtga 1560 cactgatact ggtactcaat cactggtgac aggctaagga tgcccttcag gtaccccgag 1620 gtaacacgcg acactcggga tctgagaagg ggactggggc ttctttaaaa gtgcccagtt 1680 taaaaagctt ctatgcctga ataggcgacc ggaggccggc gccttttcac tgttttacta 1740 ctgttttcat gaatacaact gactgtttca ccgccctgtt acacgctctc agagagatca 1800 aaacactgtt tcttttacgg acacaaggaa agatggaatt cacactttac aacggtgaga 1860 agaaaacctt ctactccaga cccaacaacc acgacaactg ctggcttaac accattctcc 1920 agttgttcag gtatgttgat gagcctttct ttgactgggt ctacgactcg cctgaaaacc 1980 tcactcttga ggcaatcaaa cagttggaag agacaaccgg tcttgagctg cacgagggtg 2040 gaccacccgc tctcgtcatc tggaacatca aacacttgct tcacaccgga atcggcactg 2100 cctcacgccc tagcgaggtg tgtatggtgg acggaacgga catgtgttta gctgattttc 2160 atgctggcat tttcctgaaa ggacaggaac atgctgtgtt cgcctgtgtc acctccaacg 2220 ggtggtacgc gattgatgac gaggactttt acccttggac accggacccg tccgacgttc 2280 tggtgtttgt cccgtacgat caagaaccgc ttaacggaga gtggaaaaca aaggtccaga 2340 aaaggctcaa gggagctggg caatccagtc cggcaactgg gtcgcagaac caatcaggca 2400 acactggaag catcattaac aactactaca tgcaacagta ccagaactcc atggacacgc 2460 aacttggtga caacgctatt agcggtggct ccaacgaggg ttccacggat accacctcca 2520 cacacacaaa caacacccaa aacaatgact ggttctcaaa gttggccagt tccgctctca 2580 gcggtctttt cggtgctctt ctcgccgaca aaaagacgga ggaaaccacc ctcctcgaag 2640 accgcatcct caccacccgc aacggacaca cgacctcgac aacccagtcg agtgtcgggg 2700 taacgtacgg gtatgcaaca gctgaggact ttgtgagcgg acccaacacc tctggtctcg 2760 agaccagggt tgttcaggca gaacggttct ttaaaaccca tttgttcgac tgggtcacca 2820 gtgacccgtt tggacgatgc cacctgttgg aacttccgac tgaccacaaa ggtgtctacg 2880 gcagcctgac cgactcgtat gcatatatga ggaacggttg ggacgttgaa gtcaccgcgg 2940 tgggaaacca gttcaacgga ggttgtttgc tggtggccat ggtgccagag ctttgttcca 3000 ttaacaagag agagctgtac cagctcacgc ttttccccca ccagttcatc aacccacgga 3060 cgaacatgac agcgcacatc accgtgccct ttgttggcgt caacaggtac gaccagtaca 3120 aggtacacaa accctggacc cttgtggtta tggtcgtagc ccctttgacg gtcaacaatg 3180 aaggtgcccc acaaatcaag gtgtatgcta acattgcccc caccaacgtt cacgttgcgg 3240 gtgagttccc ttccaaggag gggatcttcc ccgtggcctg cagtgacggt tacggtggtc 3300 tggtgaccac ggacccaaag acggctgacc ccgtctacgg gaaagtgttc aacccccccc 3360 gcaacctgtt gccagggcga tttacaaacc tccttgatgt ggccgaggcg tgccctacgt 3420 tcctacgctt cgaaggtggc gtaccgtacg tgaccacgaa gacggactcg gataggatga 3480 tggctcagtt cgacctgtct ttggcagcaa agcacatgtc gaacaccttc cttgcaggtc 3540 ttgcccagta ctacgcgcag tacagcggca ccatcaacct gcacttcatg ttcacagggc 3600 ccactgacgc gaaggcgcgt tacatgattg cgtatgcccc cccgggcatg gagccgccga 3660 aaacgcctga agcggccgca cactgcattc atgctgagtg ggacacagga ctgaattcaa 3720 agtttacatt ttcaatcccc tacctctcgg ctgctgacta cgcgtacacc gcgtctgaca 3780 ctgctgaaac cacaaacgtg cagggatggg tctgcctgtt tcagataaca cacgggaaag 3840 ccgacggcga cgctctggtt gtgttagcta gcgctggcaa ggactttgag ctacgcttac 3900 cggttgacgc ccgtacccaa ccacctctgc gggtgagtct gcagaccccg taaccgccac 3960 tgttgaaaac tacggcggtg agacacaggt ccagagacgc caacacacgg acgtctcatt 4020 catattagac agattcgtga aagtcacacc aaaagaccaa attaatgtgt tggacctgat 4080 gcaaattcct gctcacacct tggtaggggc gctccttcga gcggccactt actacttctc 4140 tgacttggag ctggctgtta aacatgaagg cgatctcact tgggtcccga acggagcccc 4200 tgagacagcg ctggacaaca ccaccaatcc aacagcctac cacaaagcac cacttacgcg 4260 actggccttg ccttacacgg ccccgcaccg tgtcttggcg accgtgtaca acggaagttg 4320 caggtacagc aacagtcatg tgagtaacgt gagaggtgat ctccaagtgt tggctcagaa 4380 ggcagcgaga gcgctgccca cctccttcaa ctacggtgcc atcaaggcaa ctcgggtgac 4440 tgaactgctc taccgcatga agagagccga gacatactgt cctaggcccc ttcttgccat 4500 tcacccgagt gaggctagac acaagcagaa gattgtggca cccgcaaaac agcttctaaa 4560 ttttgacctg ctcaaattgg cgggagatgt ggagtccaac cctgggccct tcttcttctc 4620 cgacgtcagg tcaaatttct caaaactggt agaaaccatc aatcagatgc aggaggacat 4680 gtcaacaaaa cacgggcctg actttaaccg gttggtgtcc gcatttgagg aattggccac 4740 tggagtgaag gctatcaggg ccggtctcga cgaggccaaa ccctggtaca aactcatcaa 4800 gctcctgagc cgcttgtcgt gcatggccgc tgtagcagca cggtcaaagg acccagtcct 4860 tgtggccatc atgctggctg acaccggtct tgagattctg gacagcacct ttgtcgtgaa 4920 gaagatctcc gactcgctct ccagtctctt tcacgtgccg gcccccgtct tcagtttcgg 4980 agccccgatt ctgttggccg ggttggtcaa agtcgcctcg agtttcttcc ggtccacacc 5040 cgaagacctt gagagagcag aaaaacagct caaagcacgt gacattaacg acatattcgc 5100 cattctcaag aacggcgagt ggctggtcaa gctgatcctt gccatccgcg actggatcaa 5160 agcgtggatc gcctcagaag aaaagtttgt caccatgacg gacttggtgc ctggtatcct 5220 tgaaaagcag cgggatctca acgacccgag taagtacaag gaagccaagg agtggctcga 5280 caacgcgcgc caggcgtgtt tgaagagcgg gaacgttcac attgccaatt tgtgcaaagt 5340 ggtcgccccg gcacccagca agtcgagacc cgaacccgtg gtcgtttgcc tccgcggcaa 5400 atccggccag gggaagagtt tccttgcgaa cgtgctcgcg caagcaatct ccacccactt 5460 caccggcaga actgattcgg tttggtactg cccgcctgac cctgaccact tcgacggtta 5520 caaccagcag accgttgtcg tgatggacga tttgggccag aaccccgatg gcaaggactt 5580 caagtacttc gcccagatgg tttcgaccac ggggttcatc ccgcccatgg cctcgcttga 5640 ggacaaaggc aagcctttca acagcaaagt catcattgct accaccaacc tgtactcggg 5700 tttcaccccg agaacaatgg tgtgtcctga cgcgctgaac cggaggttcc actttgacat 5760 cgacgtgagt gccaaggacg ggtacaaagt taacaacaaa ttggacataa tcaaagctct 5820 tgaagacacc cacaccaacc cagtggcgat gttccaatac gactgtgccc ttctaaacgg 5880 tatggcagtt gaaatgaaga gaatgcaaca ggatatgttc aagcctcaac cacccctcca 5940 gaacgtgtac caactcgttc acgaggtgat tgaacgggtc gagctccacg agaaggtgtc 6000 gagccacccg attttcaaac agatatcaat tccttcccaa aagtctgtgt tgtacttcct 6060 cattgagaaa ggccaacacg aagcagcaat tgaattcttt gagggaatgg tgcatgactc 6120 catcaaggaa gagctccggc ccctcatcca acagacctca tttgtgaaac gcgcttttaa 6180 gcgcctgaag gaaaactttg agactgttgc cctgtgtttg actcttttgg caaacatagt 6240 gatcatgatc cgcgagactc gcaagagaca acagatggtg gacgatgcag tgaatgacta 6300 cattgagaag gcaaacatca ccacagatga caagactctt gacgaggcgg aaaagaaccc 6360 tctagagacc agcggtgcca gcactattgg tttcagagag agaactctcc cggggcacaa 6420 ggcgagcgat gacgtgagct ccgagcccgc caaacccgtg gaggaccgac cacaagctga 6480 aggaccttac gagggaccgg tgaagaagcc tgtcgctttg aaagtgaaag ctaagaactt 6540 gattgtcact gaggggccat atgaaggacc agtgaagaaa cctgtcgctt tgaaagtgaa 6600 agcaaaagcc ccgattgtca ctgaaggacc ctacgaggga ccggtgaaga agcctgtcgc 6660 tttgaaagtg aaagccaaga acttgattgt cactgagagt ggtgccccac cgaccgactt 6720 gcagaagatg gtcatgggca acactaagcc tgttgagctc atcctcgacg ggaagacggt 6780 agccatctgc tgtgctaccg gagtgtttgg cactgcctac ctcgtacctc gtcacctctt 6840 cgcggagaag tacgacaaga taatgttgga cggtagagcc atgacagaca gtgactacag 6900 agtgtttgag tttgagatta aagtaaaagg acaggacatg ctctcagacg ctgcactcat 6960 ggtgcttcac cgtgggaacc gcgtgagaga catcacgaaa cattttcgtg acacagcaag 7020 aatgaagaaa ggcacccccg ttgtcggtgt gatcaacaac gccgacgttg ggagactgat 7080 tttctctgga gaggccctta cctacaaaga cattgtagtg accatggatg gagacaccat 7140 gccgggcctg tttgcctaca gagccgccac caaggctggt tactgcgggg gagccgttct 7200 cgccaaggac ggagccgaca cattcatcgt tggcacccac tccgcaggtg gtaacggagt 7260 tggatactgc tcgtgcgtgt ccaggtccat gctcctgaaa atgaaggcac acattgaccc 7320 tgaaccacac cacgaggggt tgattgttga taccagagat gtggaagagc gcgtgcatgt 7380 catgcgtaaa accaagcttg cacccaccgt ggcacacggt gtgtttaacc ctgaatttgg 7440 tcccgctgcc ttgtccaaca aggacccgcg gctgaacgaa ggggttgtcc tcgatgaagt 7500 catcttctcc aaacacaagg gagacacgaa aatgtctgag gaggacaaag cgctgttccg 7560 ccgctgcgct gccgactacg cgtcgcactt gcacagcgtg ctggggacgg caaatgcccc 7620 attgagcatc tatgaggcca tcaaaggcgt cgacgggctc gatgccatgg agccggacac 7680 cgcgcccggc ctcccctggg ccctccaggg gaaacgccgt ggtgcgttga ttgacttcga 7740 gaacggcacg gtcggacccg aagtcgaggc tgccctaaag ctcatggaga aaagagagta 7800 caaatttgct tgccagacct tcctgaaaga cgagattcgt ccgatggaaa aagtacgtgc 7860 tggcaagact cgcattgtcg acgttttgcc cgtggaacac attctttaca ccaggatgat 7920 gattggcaga ttctgtgctc aaatgcacac aaacaatgga ccgcagattg gctcagcggt 7980 cggttgcaat cctgatgttg attggcaaag atttggcaca cattttgctc agtacagaaa 8040 cgtgtgggat gtggactatt cggcctttga tgctaaccac tgcagtgacg caatgaacat 8100 catgtttgag gaggtatttc gcacagactt cggtttccac ccaaatgctg agtggattct 8160 gaagactctt gtgaacacgg agcacgccta tgagaacaaa cgtatcactg ttgagggcgg 8220 gatgccgtct ggctgttccg cgacaagcat catcaacaca attttgaaca acatttatgt 8280 gctctacgct cttcgtagac actatgaggg agttgagctg gacacctaca ccatgatctc 8340 ctacggagat gacatcgtgg ttgcaagtga ctacgatctg gattttgagg ctctcaaacc 8400 ccacttcaaa tctcttggtc aaaccatcac tccagctgac aaaagcgaca aaggttttgt 8460 tcttggtcac tccattaccg atgtcacttt cctcaaaaga cacttccaca tggactatgg 8520 aactgggttt tacaaacctg tgatggcctc aaagaccctc gaggccattc tctcctttgc 8580 acgccgtggg accatacagg agaagttgat ctccgtggca ggactcgccg tccactcagg 8640 acctgacgag taccggcgtc tctttgagcc cttccagggt ctcttcgaga ttccaagcta 8700 cagatcactt tacctgcgtt gggtgaacgc cgtgtgcggt gacgcataat ccctcagatg 8760 tcacaattgg cagaaagact ctgaggcgag cgacgccgta ggagtgaaaa gcccgaaagg 8820 gcttttcccg cttcctattc caaaaaaaaa aaaaaaaaac tagttctaga gcggccgcca 8880 ccgcggtgga gctccagctt ttgttccctt tagtgagggt taattgcgcg cttggcgtaa 8940 tcatggtcat agctgtttcc tgtgtgaaat tgttatccgc tcacaattcc acacaacata 9000 cgagccggaa gcataaagtg taaagcctgg ggtgcctaat gagtgagcta actcacatta 9060 attgcgttgc gctcactgcc cgctttccag tcgggaaacc tgtcgtgcca gctgcattaa 9120 tgaatcggcc aacgcgcggg gagaggcggt ttgcgtattg ggcgctcttc cgcttcctcg 9180 ctcactgact cgctgcgctc ggtcgttcgg ctgcggcgag cggtatcagc tcactcaaag 9240 gcggtaatac ggttatccac agaatcaggg gataacgcag gaaagaacat gtgagcaaaa 9300 ggccagcaaa aggccaggaa ccgtaaaaag gccgcgttgc tggcgttttt ccataggctc 9360 cgcccccctg acgagcatca caaaaatcga cgctcaagtc agaggtggcg aaacccgaca 9420 ggactataaa gataccaggc gtttccccct ggaagctccc tcgtgcgctc tcctgttccg 9480 accctgccgc ttaccggata cctgtccgcc tttctccctt cgggaagcgt ggcgctttct 9540 catagctcac gctgtaggta tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt 9600 gtgcacgaac cccccgttca gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag 9660 tccaacccgg taagacacga cttatcgcca ctggcagcag ccactggtaa caggattagc 9720 agagcgaggt atgtaggcgg tgctacagag ttcttgaagt ggtggcctaa ctacggctac 9780 actagaagga cagtatttgg tatctgcgct ctgctgaagc cagttacctt cggaaaaaga 9840 gttggtagct cttgatccgg caaacaaacc accgctggta gcggtggttt ttttgtttgc 9900 aagcagcaga ttacgcgcag aaaaaaagga tctcaagaag atcctttgat cttttctacg 9960 gggtctgacg ctcagtggaa cgaaaactca cgttaaggga ttttggtcat gagattatca 10020 aaaaggatct tcacctagat ccttttaaat taaaaatgaa gttttaaatc aatctaaagt 10080 atatatgagt aaacttggtc tgacagttac caatgcttaa tcagtgaggc acctatctca 10140 gcgatctgtc tatttcgttc atccatagtt gcctgactcc ccgtcgtgta gataactacg 10200 atacgggagg gcttaccatc tggccccagt gctgcaatga taccgcgaga cccacgctca 10260 ccggctccag atttatcagc aataaaccag ccagccggaa gggccgagcg cagaagtggt 10320 cctgcaactt tatccgcctc catccagtct attaattgtt gccgggaagc tagagtaagt 10380 agttcgccag ttaatagttt gcgcaacgtt gttgccattg ctacaggcat cgtggtgtca 10440 cgctcgtcgt ttggtatggc ttcattcagc tccggttccc aacgatcaag gcgagttaca 10500 tgatccccca tgttgtgcaa aaaagcggtt agctccttcg gtcctccgat cgttgtcaga 10560 agtaagttgg ccgcagtgtt atcactcatg gttatggcag cactgcataa ttctcttact 10620 gtcatgccat ccgtaagatg cttttctgtg actggtgagt actcaaccaa gtcattctga 10680 gaatagtgta tgcggcgacc gagttgctct tgcccggcgt caatacggga taataccgcg 10740 ccacatagca gaactttaaa agtgctcatc attggaaaac gttcttcggg gcgaaaactc 10800 tcaaggatct taccgctgtt gagatccagt tcgatgtaac ccactcgtgc acccaactga 10860 tcttcagcat cttttacttt caccagcgtt tctgggtgag caaaaacagg aaggcaaaat 10920 gccgcaaaaa agggaataag ggcgacacgg aaatgttgaa tactcatact cttccttttt 10980 caatattatt gaagcattta tcagggttat tgtctcatga gcggatacat atttgaatgt 11040 atttagaaaa ataaacaaat aggggttccg cgcacatttc cccgaaaagt gccac 11095 <210> 2 <211> 144 <212> DNA <213> Artificial Sequence <220> <223> gene of 3B333 <400> 2 ggaccttacg agggaccggt gaagaagcct gtcgctttga aagtgaaagc taagaacttg 60 attgtcactg aggggccata tgaaggacca gtgaagaaac ctgtcgcttt gaaagtgaaa 120 gcaaaagccc cgattgtcac tgaa 144 <210> 3 <211> 47 <212> PRT <213> Artificial Sequence <220> <223> amino acids of 3B12 deletion <400> 3 Gly Pro Tyr Ala Gly Pro Leu Glu Arg Gln Lys Pro Leu Arg Val Lys   1 5 10 15 Thr Lys Leu Pro Gln Gln Glu Gly Pro Tyr Ala Gly Pro Met Asp Arg              20 25 30 Gln Lys Pro Leu Lys Val Arg Ala Arg Ala Pro Val Val Lys Glu          35 40 45 <210> 4 <211> 48 <212> PRT <213> Artificial Sequence <220> <223> amino acids of 3B33 addition <400> 4 Gly Pro Tyr Glu Gly Pro Val Lys Lys Pro Val Ala Leu Lys Val Lys   1 5 10 15 Ala Lys Asn Leu Ile Val Thr Glu Gly Pro Tyr Glu Gly Pro Val Lys              20 25 30 Lys Pro Val Ala Leu Lys Val Lys Ala Lys Ala Pro Ile Val Thr Glu          35 40 45 <210> 5 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> forward primer of p1 recombination <400> 5 aggtccagaa aaggctcaag ggagctgggc aatccagtcc 40 <210> 6 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of p1 recombination <400> 6 agcaggtcaa aatttagaag ctgttttgcg ggtgccacaa 40 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer of vector recombination <400> 7 cttctaaatt ttgacctgct 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of vector recombination <400> 8 cttgagcctt ttctggacct 20

Claims (11)

The P1 gene region of the foot-and-mouth disease O type Manisa genome is replaced with the P1 gene of the foot-and-mouth disease O type Thi60 gene, and the 3B1 and 3B2 sites of the foot-and-mouth disease O type Manisa genome 3B3 contain the foot-and-mouth type A 3B3 and foot-and-mouth SAT 3B3 sequences. As a recombinant vector substituted with the synthesized sequence of SEQ ID NO: 2, cysteine, which is the 142th amino acid of the 3C gene, in the P1 gene of the foot-and-mouth disease O type Manisa genome is substituted with threonine,
The recombinant vector is pO-THI having a cleavage map of Figure 2,
The recombinant vector pO-THI consists of the nucleotide sequence of SEQ ID NO: 1,
P1 gene of the Thi60 gene is a recombinant vector consisting of the 2352 to 4552 nucleotide sequence in SEQ ID NO: 1.
[Figure 2]

delete delete Recombinant foot-and-mouth virus produced using the recombinant vector of claim 1. 5. The recombinant foot-and-mouth virus according to claim 4, wherein the virus expresses a defensive antigen of O-Thi60 strain, which is a foot-and-mouth cathay region type. (a) inserting a gene of foot-and-mouth type O Manisa into a recombinant vector;
(b) replacing the 3B1 and 3B2 sites of foot-and-mouth disease O type Manisa with the sequence of SEQ ID NO: 2 synthesized from the foot-and-mouth disease type A 3B3 and foot-and-mouth disease SAT 3B3 sequences in the recombinant vector obtained in step (a);
(c) replacing cysteine, which is the 142th amino acid of the 3C gene of the foot-and-mouth disease O type Manisa, with threonine in the recombinant vector obtained in step (b); And
(d) a method of producing a recombinant vector comprising the step of replacing the P1 gene region of the foot-and-mouth disease O type Thi60 strain in the recombinant vector obtained in step (c),
The recombinant vector is pO-THI having a cleavage map of Figure 2,
The recombinant vector pO-THI consists of the nucleotide sequence of SEQ ID NO: 1,
The P1 gene of the Thi60 gene consists of the 2352-4552 nucleotide sequence in SEQ ID NO: 1, a method for producing a recombinant vector.
[Figure 2]

A method for producing a recombinant foot-and-mouth virus, comprising introducing and propagating a recombinant vector prepared by the method of claim 6 into a cell. The method of claim 7, wherein the cells are any one or more selected from goat fetal tongue cells and hamster kidney cells. The foot-and-mouth disease vaccine composition comprising the recombinant foot-and-mouth virus of claim 4 as an active ingredient. The vaccine composition for preventing foot-and-mouth disease according to claim 9, wherein the vaccine is a live vaccine, an attenuated vaccine or a dead vaccine. A method for preventing foot-and-mouth disease comprising administering the recombinant foot-and-mouth virus of claim 4 to a subject other than a human.

Images