KR20190056656A - Recombinant foot-and-mouth disease virus expressing protective antigen of type O-Thi60 - Google Patents

Abstract

The present invention relates to a recombinant virus expressing a protective antigen of type O-Thi60, capable of maximizing protective effects in a wider range, and to a preparing method thereof, and a use as a vaccine thereof. The recombinant virus is prepared by using a recombinant vector pO-THI consisting of the base sequence of SEQ ID NO: 1.

Description

Recombinant foot-and-mouth disease virus expressing protective antigen (O-Thi60)

The present invention relates to a recombinant virus expressing a defensive antigen of foot-and-mouth disease O-Thi60. More specifically, the present invention relates to a recombinant vector, a recombinant vector prepared using the recombinant vector, a Thi60 strain (O THI) , A method for producing the recombinant virus, and a use thereof as a vaccine.

Foot and mouth disease (FMD) is a viral vesicular disease that infects animals with split hoofs and is characterized by rapid replication and rapid spreading. Due to its economic importance, this disease is classified as a very important animal disease by the World Animal Health Organization (OIE) and it is the most important factor in the trade of livestock products because it is impossible to trade between countries at the time of occurrence.

The foot-and-mouth disease pathogens are single-stranded bipolar RNA viruses belonging to the genus Piconaviridae and Aphthovirus and have seven different serotypes (A, O, C, Asia 1, SAT 1, SAT 2 and SAT 3) Being classified.

In addition, there are more than 10 types of foot and mouth disease virus (O) type O. Therefore, if strictly developed, vaccines for these local types should be developed and used as vaccines. However, in order to develop all the vaccine strains, it is necessary to cultivate the open field continuously into the cells to have adequate proliferation power, and this method is time consuming and does not guarantee that the result will be good.

In order to solve this problem, as a conventional technique in which the present inventors participated, three siRNA nucleotide sequences proven to be effective in 2B and 3C regions, which are the most stable regions of foot-and-mouth disease virus, were selected and inserted into adenovirus The prepared viral vectors and foot-and-mouth disease virus vaccines containing them have been disclosed (Japanese Patent Application Laid-Open No. 10-2011-0135532).

In addition, a recombinant foot-and-mouth disease vaccine virus using a foot-and-mouth disease virus O Manisa obtained by cloning a whole gene of foot-and-mouth disease virus O Manisa and then deleting some genes has been disclosed (Laid-open Patent Publication No. 10-2014-0083129).

However, since the above-described conventional techniques are limited in efficiently providing a vaccine against foot-and-mouth disease, there is a limit to efficiently providing a vaccine for vaccination against foot-and-mouth disease, There is an urgent need to be made in a form that can be manufactured.

In order to solve the problems of the prior art as described above, the inventors of the present invention have found that, by using a basic vector composed of a viral gene based on a pathogenic weak virus, which is already known as a foot and mouth vaccine, Which is capable of producing a vaccine capable of protecting against the virus that is caused by the virus, and thus the present invention has been completed.

Therefore, it is an object of the present invention to provide a recombinant foot-and-mouth disease virus which can be usefully used as a vaccine herbicide by simultaneously providing a wide range of defense against other local types such as Cathay, ME-SA, .

Another object of the present invention is to provide a recombinant vector for producing the recombinant FMDV.

It is another object of the present invention to provide a method for producing the recombinant FMD virus.

It is still another object of the present invention to provide a vaccine composition for preventing foot-and-mouth disease comprising the recombinant FMDV as an active ingredient.

It is yet another object of the present invention to provide a method for preventing foot-and-mouth disease using the vaccine composition.

In order to achieve the above-mentioned object, the present invention provides a method for producing a recombinant human O-type Manisa genome comprising the steps of: replacing the P1 gene region of the foot-and-mouth type O type Manisa genome with the foot-and-mouth type O type Thi60 gene; Among the P1 genes of the type Manisa genome, the 142th amino acid of the 3C gene, cytosine, provides a recombinant vector substituted with threonine.

In addition, the present invention provides a recombinant foot-and-mouth disease virus produced using the above recombinant vector.

(B) inserting the recombinant vector obtained in step (a) into the 3B12 region of foot-and-mouth disease type O-Manisa; (c) ) Replacing the 142 th amino acid cysteine of the 3C gene of the foot-and-mouth disease type O Manisa with threonine in the recombinant vector obtained in step (b); and (d) replacing the recombinant vector obtained in step (c) And replacing the P1 gene region of the O type Manisa with the P1 gene of the foot-and-mouth type O type Thi60.

In addition, the present invention provides a method for preparing recombinant foot-and-mouth virus including the step of introducing a recombinant vector produced by the above method into a cell to proliferate.

In addition, the present invention provides a vaccine composition for preventing foot-and-mouth disease comprising the recombinant foot-and-mouth virus as an active ingredient.

The recombinant foot-and-mouth disease virus according to the present invention has an advantage that it can be used more safely than a pathogenic virus because it is treated in a laboratory such as a disinfectant experiment or an antiviral experiment by weakening the pathogenicity of an animal by manipulating a part of a gene of foot-

In addition, by producing the vaccine using the recombinant foot-and-mouth disease virus according to the present invention as an effective ingredient, it is possible to protect viruses in the vicinity of Korea including China and Southeast Asia.

Meanwhile, the recombinant foot-and-mouth disease virus according to the present invention can be used for vaccine production because it can be diagnosed differently from open field.

1 shows a genomic diagram of a recombinant FMDV virus expressing a protective antigen of a foot-and-mouth disease O serotype O-Thi60 strain (Cathay regional type, hereinafter referred to as "O THI").
FIG. 2 shows a recombinant vector (plasmid) inserted with the nucleotide sequence of the Cathay region type (O-Thi60) gene (Genbank KM243030) by replacing the VP2, VP3, VP4 and VP1 protective antigen protein with O- Thi60 in the foot- ). ≪ / RTI >
FIG. 3 shows viral particles identified by electron microscope photographs of the recombinant FMD virus O-Thi-R prepared from the recombinant vector of FIG. 2.
Fig. 4 shows the results of confirming that the pathogenicity in the mice is reduced.
Figure 5 shows that the identified O-Thi-R foot-and-mouth disease virus is antigen expressed in infected cells.
6A and 6B show mouse survival (FIG. 6A) and weight loss (FIG. 6B) after immunization for 7 days according to the antigen dose in mice, through an inoculation experiment (ME-SA type, O / VN / 2013) The results are as follows.
Figure 7 shows the results of ELISA antibody levels assayed for antibodies immunized with sera obtained through immunoassays (0 week and 4 week inoculation) in cattle (n = 5).

In one embodiment of the present invention, the P1 gene region of the foot-and-mouth type Manisa genome is substituted with the foot-and-mouth type Thi60 gene, the 3B12 site is substituted in the 3B region of the foot-and-mouth type O type Manisa genome, Which is the 142nd amino acid of the 3C gene, is substituted with threonine.

In the present invention, " P1 gene " is a nucleotide sequence encoding a P1 protein and may include VP1, VP2, VP3 and VP4 regions. In the present invention, the region includes a nucleotide sequence encoding a protein, It is used as a concept involving sequences and genes.

As used herein, the term " vector " means a DNA product containing a DNA sequence operably linked to an appropriate regulatory sequence capable of expressing the DNA in the appropriate host.

The vector may be a plasmid, phage particle or simply a potential genome insert. Once transformed into the appropriate host, the vector may replicate and function independently of the host genome, or, in some cases, integrate into the genome itself. Because the plasmid is the most commonly used form of the current vector, the terms " plasmid " and " vector " are sometimes used interchangeably in the context of the present invention.

For the purpose of the present invention, it is preferable to use a plasmid vector. Typical plasmid vectors that can be used for this purpose include (a) a cloning start point that allows replication to be efficiently made to include several hundred plasmid vectors per host cell, (b) a host cell transformed with the plasmid vector And (c) a restriction enzyme cleavage site into which the foreign DNA fragment can be inserted.

Even if an appropriate restriction enzyme cleavage site is not present, using a synthetic oligonucleotide adapter or a linker according to a conventional method can easily ligate the vector and the foreign DNA.

In the present invention, " FM virus type O Cathay area type Thi 60 strain " is an antigen that is widely used in O vaccine, and can be widely protected against O type virus including Cathay type in O type.

In the recombinant vector of the present invention, the gene of the foot-and-mouth disease type O virus is a whole gene of the foot-and-mouth type O-type vaccine strain Manisa. The 3B1 region and the 3B2 region can be partially substituted for the purpose of differential diagnosis with the open field among the whole gene regions. The substitution sites of 3B1 and 3B2 are 6,482-6,625 bp in the recombinant plasmid of the present invention represented by the nucleotide sequence of SEQ ID NO: But is not limited thereto.

The recombinant vector of the present invention may be one in which the 142th amino acid cytosine in the 3C region of the foot-and-mouth type O-type Manisa genome is replaced with threonine (C142T).

The recombinant vector of the present invention may be pO-THI having the cleavage map of Fig.

The recombinant vector pO-THI of the present invention may comprise the nucleotide sequence of SEQ ID NO: 1.

Another embodiment of the present invention relates to a recombinant foot-and-mouth virus produced using said recombinant vector.

The recombinant foot-and-mouth disease virus of the present invention is characterized in that a defensive antigen of foot-and-mouth disease type O type Thi 60 is expressed.

In another embodiment of the present invention, there is provided a method for preparing a recombinant vector comprising the steps of: (a) inserting a gene of foot-and-mouth disease type O Manisa into a recombinant vector; (b) (C) replacing the 142 th amino acid cytosine in the 3C region of the foot-and-mouth disease type O-type Manisa genome with threonine (C142T) in the recombinant vector obtained in the step (b) , And (d) replacing the 3B12 region of foot-and-mouth disease type O-Manisa in the recombinant vector obtained in the step (c).

Another embodiment of the present invention relates to a method for producing recombinant foot-and-mouth virus including the step of introducing a recombinant vector produced by the above-described method into a cell to proliferate.

The recombinant vector of the present invention and the recombinant foot-and-mouth disease virus can be produced by conventional gene manipulation and transformation methods, and a virus having a small amount can be obtained in an appropriate amount in a continuous passage through cell culture.

In the method for producing the recombinant foot-and-mouth disease virus of the present invention, the cell may be a canine animal, a feline animal, a wild boar and an animal, a bovine animal, a deer and an animal, a giraffe and an animal, a curry animal, a camel animal, (ZZ-R) and a hamster kidney cell (BHK-21 (R)), and preferably one or more cells selected from the group consisting of an animal, a rhinoceros and an animal, a weasel, a rabbit, ), Black goat kidney cells (BGK), pig kidney cells (IBRS-2), and small intestine cells (LF-BK).

In the method for producing recombinant foot-and-mouth disease virus of the present invention, the cell may more preferably be any one or more selected from fetal goat fetal tongue (ZZ-R) and hamster kidney (BHK-21) cells.

Another embodiment of the present invention relates to a vaccine composition for preventing foot-and-mouth disease comprising the recombinant FMDV as an active ingredient.

In the foot-and-mouth disease vaccine composition of the present invention, the vaccine may be a live vaccine, an attenuated vaccine, or a vaccine.

The foot-and-mouth spreading vaccine composition of the present invention may contain one or more known active ingredients that are excellent in preventing foot-and-mouth disease infections together with the recombinant foot-and-mouth disease virus.

The vaccine composition of the present invention may further comprise at least one pharmaceutically acceptable carrier in addition to the above-described effective ingredients for administration.

The pharmaceutically acceptable carrier may be a mixture of saline, sterilized water, Ringer's solution, buffered saline, dextrose solution, sucrose solution, glycerol, ethanol and one or more of these components. If necessary, an antioxidant, , And other conventional additives such as a bacteriostatic agent may be added.

The vaccine composition of the present invention may also be formulated into injectable formulations, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like by additionally adding diluents, dispersants, surfactants, binders and lubricants.

The vaccine composition of the present invention may be administered orally or parenterally (for example, intravenously, subcutaneously, intraperitoneally or topically) according to the desired method, and the dose may vary depending on the weight, age, The range varies depending on the condition, diet, administration time, method of administration, excretion rate, and severity of the disease.

Another embodiment of the present invention relates to a method for preventing foot-and-mouth disease comprising administering the recombinant foot-and-mouth disease virus to a subject other than a human.

Hereinafter, the content of the present invention will be described in detail through experimental examples. However, the following experimental examples are intended to illustrate the present invention in more detail, and the scope of the present invention is not limited thereto.

Example 1 Genetic manipulation for differential diagnosis with foot-and-mouth disease outbreaks

The whole foot-and-mouth virus gene (Genbank Accession No. AY593823.1) was amplified by PCR, and the O_Manisa gene was inserted into a plasmid (pBluescript SK II) (pO-Manisa). Based on this, the P1 site was manipulated and the method is as follows.

3B portion of O1 Manisa infectious plasmid that has already been secured (3B333), the synthesized sequence corresponding to 6482-6625 position in SEQ ID NO: 1; After removal of the a (GGACCTTACGAGGGACCGGTGAAGAAGCCTGTCGCTTTGAAAGTGAAAGCTAAGAACTTGATTGTCACTGAGGGGCCATATGAAGGACCAGTGAAGAAACCTGTCGCTTTGAAAGTGAAAGCAAAAGCCCCGATTGTCACTGAA, 144 bps SEQ ID NO: 2) 3B1 and 3B2 region, A-type 3B3 of SAT and 3B3 of SAT type.

Generally, cDNA of O-Manisa virus is generated using a random primer used in cDNA synthesis. Based on the cloning of the entire gene, O-Manisa virus gene information is used to generate the end gene of 3A and the start gene of 3B3 Specific primers capable of amplification (corresponding to 20 mers of 5 'and 3' genes on the basis of GenBank Accession No. AY593823.1) were prepared and PCR was performed.

The conditions for the PCR were 98 ° C for 30 seconds at a volume of 5X buffer (FINNZYMES, 10 μl), 10 mM dNTPs (1 μl), Phusion enzyme (2 U / μl, 0.5 μl) and sterilized distilled water 25 seconds at 65 캜 for 30 seconds, 72 캜 for 2 minutes and 30 seconds, and final 72 캜 for 10 minutes.

(TAKARA Long Ligation Kit) was performed between the vector prepared above and the synthesized gene, and it was confirmed that the cloning was properly performed through the whole base sequence analysis.

Table 1 below shows the amino acid sequences inserted with 3B1 and 3B2 removed and 3B3 of type A and 3B3 of SAT type interchanged.

Example 2: Pathogenicity reduction gene manipulation

Attempts have been made to produce infectious plasmids to produce pathogenic reduced foot-and-mouth disease viruses. In the pO-Mansia-3B plasmid prepared in Example 1, the vector was inserted into the 3C C142T (position 7121-7122 bp, tg →) of the pO-Manisa-3B gene using the Gibson Assembly ^® Master Mix of NEW ENGLAND BIOLABS ^® Inc. ac).

After amplification using PCR, a self-ligation method was used to obtain a replacement plasmid for the gene.

Example 3 Production of Recombinant Plasmid pO-THI

The whole foot-and-mouth virus gene (Genbank Accession No. AY593823.1) was amplified by PCR, and the O_Manisa gene was inserted into a plasmid (pBluescript SK II) (pO-Manisa). Based on this, the P1 site was manipulated and the method is as follows.

Based on the plasmid (pO-Manisa), it was manipulated using Gibson Assembly ^® Master Mix from NEW ENGLAND BIOLABS ^® Inc.

PCR for P1 manipulation was performed using plasmid (30 ng / μl, 1 μl), Thi Primer F (AGGTCCAGAAAAGGCTCAAGGGAGCTGGCAATCCAGTCC, 10 pmole / μl, 1 μl) of SEQ ID NO: 5 and Thi Primer R Respectively.

Primer F (CTTCTAAATTTTGACCTGCT, 10 pmole / mu l, 1 mu l) of SEQ ID NO: 7 and Primer R (CTTGAGCCTTTTCTGGACCT, SEQ ID NO: 8) of plasmid (30 ng / , 10 pmole / μl, 1 μl) were synthesized and used.

The conditions for the PCR were 98 ° C for 30 seconds at 98 ° C for 10 seconds, 5 minutes at 98 ° C in the capacity of 5 × buffer (FINNZYMES, 10 μl), 10 mM dNTPs (1 μl), Phusion enzyme (2 U / μl, 0.5 μl) and sterilized distilled water The reaction was carried out at 65 ° C for 30 seconds, at 72 ° C for 2 minutes and 30 seconds for 25 cycles, and finally at 72 ° C for 10 minutes.

After that, self ligating (Gibson Assembly ^® Master Mix) was performed. The method involved ligation of PCR products (200 ng) in combination with a master mix (5 μl) at 50 ° C for 30 min.

After ligation, plasmids (5 μl) ligation on OmniMAX ™ (Thermo Fisher) were processed for 30 min on ice, 30 sec on 42 ° C and 2 min on ice to amplify the plasmid.

S.O.C. The medium (300 μl) was added and cultured at 37 ° C for 1 hour with shaking. After being plated on agar plates containing ampicillin, they were over-kneaded at 37 < 0 > C. A plasmid was obtained using Midi prep and the sequence was confirmed, confirming that P1 was replaced with O Thi60.

Example 4 Production of recombinant foot-and-mouth disease virus

Recovered recombinant foot-and-mouth disease virus was recovered from the obtained recombinant plasmid (pO-THI)

Were reacted with restriction enzymes to prepare a single fragment. The purified DNA was transfected into BHKT7-9 cells (a cell line expressing T7 RNA polymerase) using lipofectamine transfection reagent (Life Technologies) To < RTI ID = 0.0 > 3 < / RTI > days.

Thereafter, the obtained virus was inoculated through a continuous passage in ZZ-R (fetal tongue) cells or BHK-21 (young hamster kidney) cells to proliferate the virus.

FIG. 3 shows virus particles obtained by electron microscope photographs of recombinant foot-and-mouth disease virus O-Thi-R newly prepared from the recombinant plasmid pO-THI.

Example 5: Immunogenicity in animals of the manufactured vaccine

For the animal experiment using recombinant foot-and-mouth disease virus, the recombinant foot-and-mouth viruses prepared in Example 3 were mixed with 0.5 ml of adjuvant containing 0.5 ml of crude foot-and-mouth viral antigen (15 μg / dose) oil adjuvant ISA206 It was made with double oil.

The animals were immunized with mice vaccinated with 0.1 ml and 1 ml of cows vaccinated for 7 days, and then immunized for 7 days with mice. C57BL / 6, The O-type SP-ELISA (Prionic kit self-manual) and the neutralization test (OIE manual standard test method) were used for the measurement of the antibody of each type in pigs and cows. Standard) was performed to determine antibody levels.

FIG. 4 shows the results of a decrease in the pathogenicity in mice. In the case of o-Thi-naive form having the same gene configuration as that of the wild type strain in mammalian mice and inoculation with the prepared 3C-treated vaccine strain (O-Thi-R) The results are shown in Fig.

FIG. 5 shows that the expression of the antigen in the cells infected with the identified O-Thi-R foot-and mouth disease virus was expressed using a simple antigen kit (PBM kit, USA, band structure of the structural protein (SP) band, ), And it is possible to distinguish the antigen from the open field by antigen and serologically through the unformed NSP band, and it is possible to detect up to 375 ng (1/40 dose).

Figures 6a and 6b show the results of immunization after 7 days of immunization (45 ~ 0.187 占 퐂, i.e., 3.0 ~ 1/80 dose, based on 1 dose of 15 占 퐂 of cow and pig) (FIG. 6A) and weight loss (FIG. 6B) of the mouse through a single dose (ME-SA type, O / VN / 2013) ME-SA confirmed that it is possible to fully defend against local foot-and-mouth disease virus.

Figure 7 shows the results of ELISA antibody levels assayed for antibodies immunized with sera obtained through immunoassays (0 week and 4 week inoculation) in cattle (n = 5).

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. It will be understood that the invention can be variously modified and changed.

According to the present invention, it is possible to contribute to the treatment and / or prevention of foot-and-mouth disease by providing foot-and-mouth disease vaccine using recombinant foot-and-mouth disease virus having broad- Can be usefully applied.

<110> Republic of Korea (Animal and Plant Quarantine Agency) <120> Recombinant foot-and-mouth disease virus expressing protective          antigen of type O-Thi60 <130> 10923 <160> 8 <170> KoPatentin 3.0 <210> 1 <211> 11095 <212> DNA <213> Artificial Sequence <220> <223> full DNA gene of pO-Thi <400> 1 ctaaattgta agcgttaata ttttgttaaa attcgcgtta aatttttgtt aaatcagctc 60 attttttaac caataggccg aaatcggcaa aatcccttat aaatcaaaag aatagaccga 120 gatagggttg agtgttgttc cagtttggaa caagagtcca ctattaaaga acgtggactc 180 caacgtcaaa gggcgaaaaa ccgtctatca gggcgatggc ccactacgtg aaccatcacc 240 ctaatcaagt tttttggggt cgaggtgccg taaagcacta aatcggaacc ctaaagggag 300 cccccgattt agagcttgac ggggaaagcc ggcgaacgtg gcgagaaagg aagggaagaa 360 agcgaaagga gcgggcgcta gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac 420 cacacccgcc gcgcttaatg cgccgctaca gggcgcgtcc cattcgccat tcaggctgcg 480 caactgttgg gaagggcgat cggtgcgggc ctcttcgcta ttacgccagc tggcgaaagg 540 gggatgtgct gcaaggcgat taagttgggt aacgccaggg ttttcccagt cacgacgttg 600 taaaacgacg gccagtgagc atatgtaata cgactcacta tagggttgaa agggggcgct 660 agggtctcac ccctagcatg ccaacgacag ctcctacgtc gcactccaca ctaacgtttg 720 tgtgcgcgcg ggaaccgatg gacttttgtt cacccaccta cagttggact cacggcaccg 780 cgtggccatt ttagctgggt tgtgcggacg aacactgctt gcgcatctcg cgtgaccggt 840 tagtactctt accactatcc gcctacttgg tcgttagcgc tgtcctgggc actcttgttg 900 ggggctgttc aacgctctac ggtctcccct gcgtaacaga ctacggtgtt ggggccgctt 960 cgtgcgagcc gatcgcttgg tgtgcctcgg ctgtcgcccg aagcccgcct ttcacccccc 1020 cccccccccc ctaggtttta ccgtcgttcc cgacgttaat ggggaaacaa ccacaagctt 1080 aacaccgtct tgcccgacgt aaaagggctg caaccaaaaa gcttgtgccg cctttcccgg 1140 cgttaatggg aggtaaccac aagacaaacc ttcacccgga agtaaaacgg caacttcaca 1200 cagttttgcc cgttttcgtg agaaatgggc cgtcaacgca cgaaacgcgc cgtcgcttga 1260 ggaggacttg tacaaacacg atctatgcag gtttccacaa ctgacacaaa ccgtgcaact 1320 tgaaaccccg cctggtcttt ccaggtctag aggggcgaca ttttgtactg tgcttgactc 1380 cacgctcggt ccactagcga gtgttagtag tagcactgtt gcttcgtagc ggagcatgat 1440 ggccgtggga gcttcccctt ggtaacaagg acccacgggg ccaaaagcca cgtcctaccg 1500 gacccatcat gtgtgcaaac ccagcacggc aactttactg cgaaaaccac tttaaggtga 1560 cactgatact ggtactcaat cactggtgac aggctaagga tgcccttcag gtaccccgag 1620 gtaacacgcg acactcggga tctgagaagg ggactggggc ttctttaaaa gtgcccagtt 1680 taaaaagctt ctatgcctga ataggcgacc ggaggccggc gccttttcac tgttttacta 1740 ctgttttcat gaatacaact gactgtttca ccgccctgtt acacgctctc agagagatca 1800 aaacactgtt tcttttacgg acacaaggaa agatggaatt cacactttac aacggtgaga 1860 agaaaacctt ctactccaga cccaacaacc acgacaactg ctggcttaac accattctcc 1920 agttgttcag gtatgttgat gagcctttct ttgactgggt ctacgactcg cctgaaaacc 1980 tcactcttga ggcaatcaaa cagttggaag agacaaccgg tcttgagctg cacgagggtg 2040 gaccacccgc tctcgtcatc tggaacatca aacacttgct tcacaccgga atcggcactg 2100 cctcacgccc tagcgaggtg tgtatggtgg acggaacgga catgtgttta gctgattttc 2160 atgctggcat tttcctgaaa ggacaggaac atgctgtgtt cgcctgtgtc acctccaacg 2220 ggtggtacgc gattgatgac gaggactttt acccttggac accggacccg tccgacgttc 2280 tggtgtttgt cccgtacgat caagaaccgc ttaacggaga gtggaaaaca aaggtccaga 2340 aaaggctcaa gggagctggg caatccagtc cggcaactgg gtcgcagaac caatcaggca 2400 acactggaag catcattaac aactactaca tgcaacagta ccagaactcc atggacacgc 2460 aacttggtga caacgctatt agcggtggct ccaacgaggg ttccacggat accacctcca 2520 cacacacaaa caacacccaa aacaatgact ggttctcaaa gttggccagt tccgctctca 2580 gcggtctttt cggtgctctt ctcgccgaca aaaagacgga ggaaaccacc ctcctcgaag 2640 accgcatcct caccacccgc aacggacaca cgacctcgac aacccagtcg agtgtcgggg 2700 taacgtacgg gtatgcaaca gctgaggact ttgtgagcgg acccaacacc tctggtctcg 2760 agaccagggt tgttcaggca gaacggttct ttaaaaccca tttgttcgac tgggtcacca 2820 gtgacccgtt tggacgatgc cacctgttgg aacttccgac tgaccacaaa ggtgtctacg 2880 gcagcctgac cgactcgtat gcatatatga ggaacggttg ggacgttgaa gtcaccgcgg 2940 tgggaaacca gttcaacgga ggttgtttgc tggtggccat ggtgccagag ctttgttcca 3000 ttaacaagag agagctgtac cagctcacgc ttttccccca ccagttcatc aacccacgga 3060 cgaacatgac agcgcacatc accgtgccct ttgttggcgt caacaggtac gaccagtaca 3120 aggtacacaa accctggacc cttgtggtta tggtcgtagc ccctttgacg gtcaacaatg 3180 aaggtgcccc acaaatcaag gtgtatgcta acattgcccc caccaacgtt cacgttgcgg 3240 gtgagttccc ttccaaggag gggatcttcc ccgtggcctg cagtgacggt tacggtggtc 3300 tggtgaccac ggacccaaag acggctgacc ccgtctacgg gaaagtgttc aacccccccc 3360 gcaacctgtt gccagggcga tttacaaacc tccttgatgt ggccgaggcg tgccctacgt 3420 tcctacgctt cgaaggtggc gtaccgtacg tgaccacgaa gacggactcg gataggatga 3480 tggctcagtt cgacctgtct ttggcagcaa agcacatgtc gaacaccttc cttgcaggtc 3540 ttgcccagta ctacgcgcag tacagcggca ccatcaacct gcacttcatg ttcacagggc 3600 ccactgacgc gaaggcgcgt tacatgattg cgtatgcccc cccgggcatg gagccgccga 3660 aaacgcctga agcggccgca cactgcattc atgctgagtg ggacacagga ctgaattcaa 3720 agtttacatt ttcaatcccc tacctctcgg ctgctgacta cgcgtacacc gcgtctgaca 3780 ctgctgaaac cacaaacgtg cagggatggg tctgcctgtt tcagataaca cacgggaaag 3840 ccgacggcga cgctctggtt gtgttagcta gcgctggcaa ggactttgag ctacgcttac 3900 cggttgacgc ccgtacccaa ccacctctgc gggtgagtct gcagaccccg taaccgccac 3960 tgttgaaaac tacggcggtg agacacaggt ccagagacgc caacacacgg acgtctcatt 4020 catattagac agattcgtga aagtcacacc aaaagaccaa attaatgtgt tggacctgat 4080 gcaaattcct gctcacacct tggtaggggc gctccttcga gcggccactt actacttctc 4140 tgacttggag ctggctgtta aacatgaagg cgatctcact tgggtcccga acggagcccc 4200 tgagacagcg ctggacaaca ccaccaatcc aacagcctac cacaaagcac cacttacgcg 4260 actggccttg ccttacacgg ccccgcaccg tgtcttggcg accgtgtaca acggaagttg 4320 caggtacagc aacagtcatg tgagtaacgt gagaggtgat ctccaagtgt tggctcagaa 4380 ggcagcgaga gcgctgccca cctccttcaa ctacggtgcc atcaaggcaa ctcgggtgac 4440 tgaactgctc taccgcatga agagagccga gacatactgt cctaggcccc ttcttgccat 4500 tcacccgagt gaggctagac acaagcagaa gattgtggca cccgcaaaac agcttctaaa 4560 ttttgacctg ctcaaattgg cgggagatgt ggagtccaac cctgggccct tcttcttctc 4620 cgacgtcagg tcaaatttct caaaactggt agaaaccatc aatcagatgc aggaggacat 4680 gtcaacaaaa cacgggcctg actttaaccg gttggtgtcc gcatttgagg aattggccac 4740 tggagtgaag gctatcaggg ccggtctcga cgaggccaaa ccctggtaca aactcatcaa 4800 gctcctgagc cgcttgtcgt gcatggccgc tgtagcagca cggtcaaagg acccagtcct 4860 tgtggccatc atgctggctg acaccggtct tgagattctg gacagcacct ttgtcgtgaa 4920 gaagatctcc gactcgctct ccagtctctt tcacgtgccg gcccccgtct tcagtttcgg 4980 agccccgatt ctgttggccg ggttggtcaa agtcgcctcg agtttcttcc ggtccacacc 5040 cgaagacctt gagagagcag aaaaacagct caaagcacgt gacattaacg acatattcgc 5100 cattctcaag aacggcgagt ggctggtcaa gctgatcctt gccatccgcg actggatcaa 5160 agcgtggatc gcctcagaag aaaagtttgt caccatgacg gacttggtgc ctggtatcct 5220 tgaaaagcag cgggatctca acgacccgag taagtacaag gaagccaagg agtggctcga 5280 caacgcgcgc caggcgtgtt tgaagagcgg gaacgttcac attgccaatt tgtgcaaagt 5340 ggtcgccccg gcacccagca agtcgagacc cgaacccgtg gtcgtttgcc tccgcggcaa 5400 atccggccag gggaagagtt tccttgcgaa cgtgctcgcg caagcaatct ccacccactt 5460 caccggcaga actgattcgg tttggtactg cccgcctgac cctgaccact tcgacggtta 5520 caaccagcag accgttgtcg tgatggacga tttgggccag aaccccgatg gcaaggactt 5580 caagtacttc gcccagatgg tttcgaccac ggggttcatc ccgcccatgg cctcgcttga 5640 ggacaaaggc aagcctttca acagcaaagt catcattgct accaccaacc tgtactcggg 5700 tttcaccccg agaacaatgg tgtgtcctga cgcgctgaac cggaggttcc actttgacat 5760 cgacgtgagt gccaaggacg ggtacaaagt taacaacaaa ttggacataa tcaaagctct 5820 tgaagacacc cacaccaacc cagtggcgat gttccaatac gactgtgccc ttctaaacgg 5880 tatggcagtt gaaatgaaga gaatgcaaca ggatatgttc aagcctcaac cacccctcca 5940 gaacgtgtac caactcgttc acgaggtgat tgaacgggtc gagctccacg agaaggtgtc 6000 gagccacccg attttcaaac agatatcaat tccttcccaa aagtctgtgt tgtacttcct 6060 cattgagaaa ggccaacacg aagcagcaat tgaattcttt gagggaatgg tgcatgactc 6120 catcaaggaa gagctccggc ccctcatcca acagacctca tttgtgaaac gcgcttttaa 6180 gcgcctgaag gaaaactttg agactgttgc cctgtgtttg actcttttgg caaacatagt 6240 gatcatgatc cgcgagactc gcaagagaca acagatggtg gacgatgcag tgaatgacta 6300 cattgagaag gcaaacatca ccacagatga caagactctt gacgaggcgg aaaagaaccc 6360 tctagagacc agcggtgcca gcactattgg tttcagagag agaactctcc cggggcacaa 6420 ggcgagcgat gacgtgagct ccgagcccgc caaacccgtg gaggaccgac cacaagctga 6480 aggaccttac gagggaccgg tgaagaagcc tgtcgctttg aaagtgaaag ctaagaactt 6540 gattgtcact gaggggccat atgaaggacc agtgaagaaa cctgtcgctt tgaaagtgaa 6600 agcaaaagcc ccgattgtca ctgaaggacc ctacgaggga ccggtgaaga agcctgtcgc 6660 tttgaaagtg aaagccaaga acttgattgt cactgagagt ggtgccccac cgaccgactt 6720 gcagaagatg gtcatgggca acactaagcc tgttgagctc atcctcgacg ggaagacggt 6780 agccatctgc tgtgctaccg gagtgtttgg cactgcctac ctcgtacctc gtcacctctt 6840 cgcggagaag tacgacaaga taatgttgga cggtagagcc atgacagaca gtgactacag 6900 agtgtttgag tttgagatta aagtaaaagg acaggacatg ctctcagacg ctgcactcat 6960 ggtgcttcac cgtgggaacc gcgtgagaga catcacgaaa cattttcgtg acacagcaag 7020 aatgaagaaa ggcacccccg ttgtcggtgt gatcaacaac gccgacgttg ggagactgat 7080 tttctctgga gaggccctta cctacaaaga cattgtagtg accatggatg gagacaccat 7140 gccgggcctg tttgcctaca gagccgccac caaggctggt tactgcgggg gagccgttct 7200 cgccaaggac ggagccgaca cattcatcgt tggcacccac tccgcaggtg gtaacggagt 7260 tggatactgc tcgtgcgtgt ccaggtccat gctcctgaaa atgaaggcac acattgaccc 7320 tgaaccacac cacgaggggt tgattgttga taccagagat gtggaagagc gcgtgcatgt 7380 catgcgtaaa accaagcttg cacccaccgt ggcacacggt gtgtttaacc ctgaatttgg 7440 tcccgctgcc ttgtccaaca aggacccgcg gctgaacgaa ggggttgtcc tcgatgaagt 7500 catcttctcc aaacacaagg gagacacgaa aatgtctgag gaggacaaag cgctgttccg 7560 ccgctgcgct gccgactacg cgtcgcactt gcacagcgtg ctggggacgg caaatgcccc 7620 attgagcatc tatgaggcca tcaaaggcgt cgacgggctc gatgccatgg agccggacac 7680 cgcgcccggc ctcccctggg ccctccaggg gaaacgccgt ggtgcgttga ttgacttcga 7740 gaacggcacg gtcggacccg aagtcgaggc tgccctaaag ctcatggaga aaagagagta 7800 caaatttgct tgccagacct tcctgaaaga cgagattcgt ccgatggaaa aagtacgtgc 7860 tggcaagact cgcattgtcg acgttttgcc cgtggaacac attctttaca ccaggatgat 7920 gattggcaga ttctgtgctc aaatgcacac aaacaatgga ccgcagattg gctcagcggt 7980 cggttgcaat cctgatgttg attggcaaag atttggcaca cattttgctc agtacagaaa 8040 cgtgtgggat gtggactatt cggcctttga tgctaaccac tgcagtgacg caatgaacat 8100 catgtttgag gaggtatttc gcacagactt cggtttccac ccaaatgctg agtggattct 8160 gaagactctt gtgaacacgg agcacgccta tgagaacaaa cgtatcactg ttgagggcgg 8220 gatgccgtct ggctgttccg cgacaagcat catcaacaca attttgaaca acatttatgt 8280 gctctacgct cttcgtagac actatgaggg agttgagctg gacacctaca ccatgatctc 8340 ctacggagat gacatcgtgg ttgcaagtga ctacgatctg gattttgagg ctctcaaacc 8400 ccacttcaaa tctcttggtc aaaccatcac tccagctgac aaaagcgaca aaggttttgt 8460 tcttggtcac tccattaccg atgtcacttt cctcaaaaga cacttccaca tggactatgg 8520 aactgggttt tacaaacctg tgatggcctc aaagaccctc gaggccattc tctcctttgc 8580 acgccgtggg accatacagg agaagttgat ctccgtggca ggactcgccg tccactcagg 8640 acctgacgag taccggcgtc tctttgagcc cttccagggt ctcttcgaga ttccaagcta 8700 cagatcactt tacctgcgtt gggtgaacgc cgtgtgcggt gacgcataat ccctcagatg 8760 tcacaattgg cagaaagact ctgaggcgag cgacgccgta ggagtgaaaa gcccgaaagg 8820 gcttttcccg cttcctattc caaaaaaaaa aaaaaaaaac tagttctaga gcggccgcca 8880 ccgcggtgga gctccagctt ttgttccctt tagtgagggt taattgcgcg cttggcgtaa 8940 tcatggtcat agctgtttcc tgtgtgaaat tgttatccgc tcacaattcc acacaacata 9000 cgagccggaa gcataaagtg taaagcctgg ggtgcctaat gagtgagcta actcacatta 9060 attgcgttgc gctcactgcc cgctttccag tcgggaaacc tgtcgtgcca gctgcattaa 9120 tgaatcggcc aacgcgcggg gagaggcggt ttgcgtattg ggcgctcttc cgcttcctcg 9180 ctcactgact cgctgcgctc ggtcgttcgg ctgcggcgag cggtatcagc tcactcaaag 9240 gcggtaatac ggttatccac agaatcaggg gataacgcag gaaagaacat gtgagcaaaa 9300 ggccagcaaa aggccaggaa ccgtaaaaag gccgcgttgc tggcgttttt ccataggctc 9360 cgcccccctg acgagcatca caaaaatcga cgctcaagtc agaggtggcg aaacccgaca 9420 gt; accctgccgc ttaccggata cctgtccgcc tttctccctt cgggaagcgt ggcgctttct 9540 catagctcac gctgtaggta tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt 9600 gtgcacgaac cccccgttca gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag 9660 tccaacccgg taagacacga cttatcgcca ctggcagcag ccactggtaa caggattagc 9720 agagcgaggt atgtaggcgg tgctacagag ttcttgaagt ggtggcctaa ctacggctac 9780 actagaagga cagtatttgg tatctgcgct ctgctgaagc cagttacctt cggaaaaaga 9840 gttggtagct cttgatccgg caaacaaacc accgctggta gcggtggttt ttttgtttgc 9900 aagcagcaga ttacgcgcag aaaaaaagga tctcaagaag atcctttgat cttttctacg 9960 gggtctgacg ctcagtggaa cgaaaactca cgttaaggga ttttggtcat gagattatca 10020 aaaaggatct tcacctagat ccttttaaat taaaaatgaa gttttaaatc aatctaaagt 10080 atatatgagt aaacttggtc tgacagttac caatgcttaa tcagtgaggc acctatctca 10140 gcgatctgtc tatttcgttc atccatagtt gcctgactcc ccgtcgtgta gataactacg 10200 atacgggagg gcttaccatc tggccccagt gctgcaatga taccgcgaga cccacgctca 10260 ccggctccag atttatcagc aataaaccag ccagccggaa gggccgagcg cagaagtggt 10320 cctgcaactt tatccgcctc catccagtct attaattgtt gccgggaagc tagagtaagt 10380 agttcgccag ttaatagttt gcgcaacgtt gttgccattg ctacaggcat cgtggtgtca 10440 cgctcgtcgt ttggtatggc ttcattcagc tccggttccc aacgatcaag gcgagttaca 10500 tgatccccca tgttgtgcaa aaaagcggtt agctccttcg gtcctccgat cgttgtcaga 10560 agtaagttgg ccgcagtgtt atcactcatg gttatggcag cactgcataa ttctcttact 10620 gtcatgccat ccgtaagatg cttttctgtg actggtgagt actcaaccaa gtcattctga 10680 gaatagtgta tgcggcgacc gagttgctct tgcccggcgt caatacggga taataccgcg 10740 ccacatagca gaactttaaa agtgctcatc attggaaaac gttcttcggg gcgaaaactc 10800 tcaaggatct taccgctgtt gagatccagt tcgatgtaac ccactcgtgc acccaactga 10860 tcttcagcat cttttacttt caccagcgtt tctgggtgag caaaaacagg aaggcaaaat 10920 gccgcaaaaa agggaataag ggcgacacgg aaatgttgaa tactcatact cttccttttt 10980 caatattatt gaagcattta tcagggttat tgtctcatga gcggatacat atttgaatgt 11040 atttagaaaa ataaacaaat aggggttccg cgcacatttc cccgaaaagt gccac 11095 <210> 2 <211> 144 <212> DNA <213> Artificial Sequence <220> <223> gene of 3B333 <400> 2 ggaccttacg agggaccggt gaagaagcct gtcgctttga aagtgaaagc taagaacttg 60 attgtcactg aggggccata tgaaggacca gtgaagaaac ctgtcgcttt gaaagtgaaa 120 gcaaaagccc cgattgtcac tgaa 144 <210> 3 <211> 47 <212> PRT <213> Artificial Sequence <220> <223> amino acids of 3B12 deletion <400> 3 Gly Pro Tyr Ala Gly Pro Leu Glu Arg Gln Lys Pro Leu Arg Val Lys   1 5 10 15 Thr Lys Leu Pro Gln Gln Glu Gly Pro Tyr Ala Gly Pro Met Asp Arg              20 25 30 Gln Lys Pro Leu Lys Val Arg Ala Arg Ala Pro Val Val Lys Glu          35 40 45 <210> 4 <211> 48 <212> PRT <213> Artificial Sequence <220> <223> amino acids of 3B33 addition <400> 4 Gly Pro Tyr Glu Gly Pro Val Lys Lys Pro Val Ala Leu Lys Val Lys   1 5 10 15 Ala Lys Asn Leu Ile Val Thr Glu Gly Pro Tyr Glu Gly Pro Val Lys              20 25 30 Lys Pro Val Ala Leu Lys Val Lys Ala Lys Ala Pro Ile Val Thr Glu          35 40 45 <210> 5 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> forward primer of p1 recombination <400> 5 aggtccagaa aaggctcaag ggagctgggc aatccagtcc 40 <210> 6 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of p1 recombination <400> 6 agcaggtcaa aatttagaag ctgttttgcg ggtgccacaa 40 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer of vector recombination <400> 7 cttctaaatt ttgacctgct 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of vector recombination <400> 8 cttgagcctt ttctggacct 20

Claims (11)

Type Manisa genome is substituted with the foot-and-mouth type O-type Thi60 gene, the 3B12 site is substituted in the 3B region of the foot-and-mouth type O-type Manisa genome, and the 142th A recombinant vector in which the amino acid cytosine is substituted with threonine. 2. The recombinant vector according to claim 1, wherein the recombinant vector is pO-THI having a cleavage map of Fig. 3. The recombinant vector according to claim 2, wherein the recombinant vector pO-THI comprises the nucleotide sequence of SEQ ID NO: 1. A recombinant foot-and-mouth disease virus produced using the recombinant vector of any one of claims 1 to 3. The recombinant foot-and-mouth disease virus according to claim 4, wherein the virus expresses the protective antigen of O-Thi60 in the foot-and-mouth disease Cathay district type. (a) inserting the gene of foot-and-mouth disease type O-Manisa into a recombinant vector;
(b) replacing the 3B12 region of foot-and-mouth disease type O-type Manisa in the recombinant vector obtained in the step (a);
(c) replacing the 142 th amino acid cysteine of the 3C gene of the foot-and-mouth disease type O type Manisa with threonine in the recombinant vector obtained in step (b); And
(d) replacing the P1 gene region of the foot-and-mouth disease type O-type Manisa with the P1 gene of the foot-and-mouth type O-type Thi60 in the recombinant vector obtained in the step (c). A method for producing recombinant foot-and mouth virus comprising the step of introducing a recombinant vector produced by the method of claim 6 into a cell to proliferate. [9] The method according to claim 7, wherein the cell is at least one selected from the group consisting of fetal tongue (ZZ-R) and hamster kidney (BHK-21) cells. A vaccine composition for preventing foot-and-mouth disease comprising the recombinant foot-and-mouth disease virus of claim 4 as an active ingredient. 10. The vaccine composition according to claim 9, wherein the vaccine is a live vaccine, an attenuated vaccine or a vaccine. A method for preventing foot-and-mouth disease comprising administering the recombinant foot-and-mouth disease virus of claim 4 to a subject other than a human.

Images