CN109652380A - The CAR-T cell and its preparation method and application of LewisY is targeted based on base editor - Google Patents

The CAR-T cell and its preparation method and application of LewisY is targeted based on base editor Download PDF

Info

Publication number
CN109652380A
CN109652380A CN201910075913.2A CN201910075913A CN109652380A CN 109652380 A CN109652380 A CN 109652380A CN 201910075913 A CN201910075913 A CN 201910075913A CN 109652380 A CN109652380 A CN 109652380A
Authority
CN
China
Prior art keywords
cell
car
lewisy
seq
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201910075913.2A
Other languages
Chinese (zh)
Other versions
CN109652380B (en
Inventor
王丹
尚小云
徐凡丽
蒋海娟
赵丹
辛雨
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Suzhou Maximum Bio Tech Co ltd
Original Assignee
Suzhou Mao Hang Bio Technology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Suzhou Mao Hang Bio Technology Co Ltd filed Critical Suzhou Mao Hang Bio Technology Co Ltd
Priority to CN201910075913.2A priority Critical patent/CN109652380B/en
Publication of CN109652380A publication Critical patent/CN109652380A/en
Application granted granted Critical
Publication of CN109652380B publication Critical patent/CN109652380B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/70521—CD28, CD152
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14—Blood; Artificial blood
    • A61K35/17—Lymphocytes; B-cells; T-cells; Natural killer cells; Interferon-activated or cytokine-activated lymphocytes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/7051—T-cell receptor (TcR)-CD3 complex
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2896—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against molecules with a "CD"-designation, not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0636—T lymphocytes
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/33—Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/50—Cell markers; Cell surface determinants
    • C12N2501/515—CD3, T-cell receptor complex
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Cell Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Plant Pathology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Hematology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Virology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention belongs to immunotherapy fields, it discloses a kind of PD-1 gene knockout and targets the CAR-T cell of Lewis Y, and disclose the preparation method and the CAR-T cell application in preparation of anti-tumor drugs that the plasmid vector for expressing LewisY-CAR is imported to T cell while carrying out gene knockout by BE-Plus system.PD-1 gene knockout disclosed by the invention and the CAR-T cell for targeting Lewis Y can release the inhibition access of PD-1/PD-L1, the effect of facilitating the CAR-T cell of improvement targeting LewisY, and preparation process is simple, and higher application value is possessed in the cell therapy of tumour.

Description

The CAR-T cell and its preparation method and application of LewisY is targeted based on base editor
Technical field
The present invention relates to field of immunology, and in particular to immunotherapy field more particularly to a kind of PD-1 gene knockout and Express T cell of LewisY-CAR and preparation method thereof and its application.
Background technique
Immunotherapy of tumors is that recovery body is normally antitumor to exempt from by restarting and maintaining the immune circulation of tumour- Epidemic disease reaction, thus control and a kind for the treatment of method for removing tumour.Due to its brilliant curative effect and innovative, in quilt in 2013 " science " magazine is chosen as year most important scientific breakthrough.The immunotherapy of tumour has become current cancer therapies in recent years Hot spot.Wherein Chimeric antigen receptor T cell technology (Cheimetic Antigen Receptors-T cell, CAR-T) is one The novel adoptive cell therapy (Adoptive cell transfer therapy, ACT) of kind, the therapy is thin by the T of patient Born of the same parents feed back to patient's body after modifying proliferation in vitro, the specific receptor expressed by T cell, and the identification tumour of targeting is thin Born of the same parents, and CAR-T cell can show stronger killing activity and persistence in vivo.
Lewis Y antigen is the tetrose structure in conjunction with II type blood group oligonucleotide chain, and Lewis Y antigen is mainly expressed in embryo's hair The raw phase, in adult, its surface expression is then limited to granulocyte and epithelial surface.Research is found: thin in the cancer of the epithelial tissue of 70-90% The overexpression of Lewis Y is had found in born of the same parents.The advantages of Lewis Y is as target structure is thin for the T for expressing anti-Lewis Y Chimerical receptor The extensive malignant tumour of the possible potential targeted expression Lewis Y of born of the same parents.Some researches show that using Lewis Y as the LewisY- of target spot The T cell of CAR transduction goes out the proliferation killing activity of specificity to RPMI 8226-13 cell and primary MM cells show.S The research of Peinert (2010) further demonstrate expression anti-Lewis Y Chimerical receptor T cell in vitro specificity and Its internal anti-tumor activity shows another prospect of CAR-T cell-targeting treatment tumour.
The composition of CAR-T cell includes antigen binding domain, cross-film hinge area and three, intracellular signal area part.Extracellular region master If the single-stranded variable region sequences (scFv) of monoclonal antibody, tumour specific antigen can recognize；Intracellular region be mainly T cell by The γ chain (FcR γ) of the ζ chain of body CD3 either immunoglobulin Fc receptor, to the signal of the extracellular identification of endocellular transduction.Generally By electroporation or viral transduction, so that Chimeric antigen receptor developed by molecule is formed CAR-T cell on T cell surface, allow to The antigen of specific recognition and combination tumor cell surface simultaneously cracks tumour cell.
Although CAR-T cell shows good curative effect in hematologic malignancies, in answering for solid tumor direction With still having bigger limitation, for example lack tumour specific antigen, or be difficult to reach tumor locus, and vulnerable to Tumor microenvironment influences loss of function or activity.The Immune escaping mechanism of tumor microenvironment is mainly inhibited by PD-1/PD-L1 Access causes T cell to be unable to killing tumor cell.By targeting knockout PD-1 gene, the inhibition of PD-1/PD-L1 can be released Access facilitates the effect of improvement targets the CAR-T cell of Lewis Y.In addition, CAR-T cell is subjected to PD-1 gene knockout, The inhibition of tumor microenvironment is protected it from, target killing ability may be improved.
Chinese patent CN201410077474.6 provides a kind of quick, easy, efficient, selectively targeted knockout gene, SgRNA by providing precisely selectively targeted PD-1 gene reaches specific knockdown PD-1 using CRISPR-Cas9 technology The purpose of gene.But the gene editing that CRISPR-Cas9 is mediated makes it in clinical application there are serious undershooting-effect There are some potential safety problemss.
In order to solve the defects and limitations gone out shown by CRISPR-Cas9, the present invention provides a kind of more accurate special The stronger method and its application for T cell PD-1 gene knockout of property, and corresponding technical solution is provided, reach preparation purpose The technical solution of the T cell of immunocyte PD-1 gene knockout and expression LewisY-CAR.
Summary of the invention
One of the technical problem to be solved in the present invention is to provide PD-1 gene knockout and expresses the T cell of LewisY-CAR, The immunosupress that the CAR-T cell can be mediated from the inhibition of tumor microenvironment, especially PD-1 access, and have and surmount one As target Lewis Y CAR-T cell killing ability.
The second technical problem to be solved by the present invention is to provide a kind of PD-1 gene knockout and expresses the T of LewisY-CAR The preparation method of cell, and corresponding technical solution is provided, the preparation process is simple, and editorial efficiency is high.
The third technical problem to be solved by the present invention is to provide PD-1 gene knockout and expresses the T cell of LewisY-CAR Preparing the application in antitumor cellular therapeutic agent.
In order to solve the above problem, the present invention adopts the following technical scheme:
In order to improve gene editing efficiency to realize that, in body gene editing, the present invention uses the list based on CRISPR/Cas9 technology Base editing machine (base editor, BE).BE-PlUS system advantage is, first, compared with CRISPR-Cas9, and BE- PLUS has higher editorial efficiency, lower insertion mutation rate and lower off-target rate；Second, it is nuclease-mediated with Cas9 Gene editing compare, BEs can efficient modifying point mutated gene, be the good tool in body gene editing.The bis- matter of BE-Plus Grain system (scfv-APOBEC-UGI, GCN4-D10A), meets 10 GCN4 in the N-terminal of D10A, APOBEC N-terminal meets a scFv. GCN4-D10A in this way can recruit 10 scFv-APOBEC, increase the probability of mutation.It is 4- that Work window is expanded by 4-8 16, make more efficient.
BE-Plus double-mass model system basic principle is that BE Plus system carries rat cytosine deaminase APOBEC1's Cytimidine (C) can be changed into uracil (U) by Cas9, and ura DNA glycosyl enzyme inhibitor UDI inhibits base excision repair machine System retains UG pairing, and during subsequent duplicate, U is substituted for T, and variants are theoretically up to 50%.Pass through again DCas9 and MMR mechanism repairs UG replacement at UA, subsequent duplicate becomes TA, and yield is 15% ~ 75% using the U in UG as template Between.The gene knockout method used is Istop, to be to terminate by normal amino acid codon mutation in gene coding region Codon terminates translation process in advance.The rite-directed mutagenesis that PD-1 gene is carried out to CAR-T cell, protects it from tumour micro-loop The inhibition in border may improve target killing ability.
The present invention uses the PiggyBac transposons from lepidopterous insects, and activity is higher in mammalian hosts, And it is larger to carry segment.In addition, the pUC pUC used, preparation process is relatively easy, by transposase that foreign gene is whole It is incorporated into genome, easy to operate and integration efficiency is relatively high.
The first aspect of the present invention provides PD-1 gene knockout and expresses the T cell of LewisY-CAR.
As currently preferred technical solution, the PD-1 gene knockout and the T cell for expressing LewisY-CAR are used Gene knockout method be to be realized by BE-Plus system or Cas9, ZFN, TALEN gene knockout method.
As currently preferred technical solution, the gene knockout method is realized by BE-Plus system, The design and building of PD1-sgRNA oligonucleotides, specific steps in BE-Plus system are as follows: the 1. coding clearly to PD-1 gene Area's (CDs) 20bp-NGG target sequence (PAM sequence), makes that it includes complete target codon CAA, CAG, CGA；2. target list Base C is located at (left end) 1-16 of target sequence, and efficiency is different, and preferably 4-16；And target codon Upstream close to base preferably cannot be G；3. target single base T is located at (left end) 1-16 of target sequence, efficiency is different, Preferably 4-16；And the upstream of target codon close to base preferably cannot be G；4. according to selected specific target sequence Column are respectively synthesized positive with 5 '-N20The oligonucleotide chain of-NGG-3 ' feature and the reverse oligonucleotide chain being complementary lead to It crosses annealing and obtains complementary oligonucleotide double-stranded segment；5. being linearized to pGL3-U6-sgRNA plasmid, and into reaction system I restriction endonuclease of Bsa is added and carries out endonuclease reaction；6. by step 4. and 5. obtained in double-strand sgRNA oligonucleotides and linearisation PGL3-U6-sgRNA plasmid is mixed, and T4 DNA ligase is added into system, is attached；7. by step 6. in institute The connection product conversion DH5 α competent cell of acquisition simultaneously applies Amp+Plate (50 μ g/ml), and picked clones are sequenced.By to people PD-1 gene order is analyzed, and the code area of PD-1 to be knocked out is selected, and is designed target sequence sgRNA, is designed 3 target spots altogether Sequence, particular sequence are as follows:
SgRNA1-F:5 '-GGGGTTCCAGGG CCTGTCTG-3 ' (SEQ ID NO.2)
SgRNA1-R:5 '-CAG ACAGGCCCTGGA ACCCC-3 ' (SEQ ID NO.3)
SgRNA2-F:5 '-CGACTGGCCAGGGCGCCTGT-3 ' (SEQ ID NO.4)
SgRNA2-R:5 '-ACAGGCGCCCTGGCCAGTCG-3 ' (SEQ ID NO.5)
SgRNA3-F:5 '-ACCGCCCAGACGACTGGCCA-3 ' (SEQ ID NO.6)
SgRNA3-R:5 '-TGGCCAGTCGTCTGGGCGGT-3 ' (SEQ ID NO.7)
As currently preferred technical solution, target sequence is preferably sgRNA1, such as SEQ ID NO.2 and SEQ ID NO.3 It is shown.
The nucleotide sequence sgRNA obtained can be used on plasmid vector, on Lentiviral, or be used for reverse transcription disease On malicious expression vector, adenovirus expression carrier, glandular associated virus expression vector or other types expression vector.
In the present invention, term LewisY-CAR refers to LewisY Chimeric antigen receptor, includes the scFv for targeting Lewis Y Sequence.
ScFv: full name single-chain antibody fragment, i.e. single chain antibody fragments.
In the present invention, term LewisY-scFv refers to anti-Lewis Y single chain antibody fragments, after carrying out codon optimization Nucleotide sequence is as shown in SEQ ID NO.1；
The second aspect of the present invention provides a kind of PD-1 gene knockout and expresses the preparation method of the T cell of LewisY-CAR, The following steps are included:
(1) sgRNA design, building and its functional verification；
(2) separating peripheral blood mononuclear cells (the perpheral blood mononuclear from the peripheral blood that donor provides Cell, PBMC)；
(3) codon optimization, prepares Lewis Y Chimeric antigen receptor (CAR), i.e. LewisY-CAR delivers public affairs to scFv segment Department carry out codon optimization, be allowed to be easier to express in human body cell, after codon optimization sequence be SEQ ID NO.1 institute The nucleotide sequence shown；
(4) prepare or prepare the plasmid vector, transposase plasmids, BE Plus double-mass model, targeting of expression LewisY-CAR respectively The sgRNA plasmid of PD-1；
(5) transfection system is utilized, by plasmid vector, transposase plasmids, the BE of the resulting expression LewisY-CAR of step (4) Plus double-mass model, the sgRNA plasmid for targeting PD-1 transfect jointly imports PBMC cell, the cell after being transfected.
(6) cell after transfection is subjected in vitro culture and massive amplification；
(7) cell obtained with CD3 antibody stimulation step (6) is thin with the T for obtaining PD-1 gene knockout and expression LewisY-CAR Born of the same parents；
(8) it collects PD-1 gene knockout and expresses the T cell of LewisY-CAR, and it is detected.
As currently preferred technical solution, the plasmid vector of expression LewisY-CAR is preferably PB- in step (4) LewisY CAR-BBZ-puro plasmid is sequentially connected in series people EF1 α promoter, signal for PiggyBac-transposon carrier The resistant gene puromycin preparation that peptide, after birth exoantigen combined area, hinge area, intracellular signal transduction area are connected with T2A small peptide Made of.
As currently preferred technical solution, wherein after birth exoantigen combined area is preferably codon optimization , in combination with the Lewis Y single-chain antibody of Lewis Y albumen, it is sequentially connected in series flag Epitope tag, CD8 Hinge Chimerical receptor Hinge, CD8 Transmembrane Chimerical receptor transmembrane region.
Wherein LewisY-ScFv sequence is the nucleotide sequence after step (3) optimization: as shown in SEQ ID NO.1.
As currently preferred technical solution, the preparation of the sgRNA plasmid of PD1 is targeted in step (4) are as follows: will be of the invention SgRNA described in first aspect content imports pGL3-U6-PD1-sgR BE plasmid obtained by pGL3-U6-sgRNA plasmid.
Letter intracellular as currently preferred technical solution, in step (3) in the plasmid vector of expression LewisY-CAR Number conducting region includes coding costimulating factor region, the costimulating factor region be selected from 4-1BB, CD28, CD27, OX40, CD30, CD40, PD-1, ICOS, LIGHT, B7-H3, ligand, ICAM-1, the HVEM (LIGHTR), CD160, leaching for specifically binding CD83 Bar relevant antigen -1(LFA-1 of cell function), IL2R α, CD103, CD11b, CD11c, TRANCE/RANKL, SLAMF4 One of (CD244,2B4), CD69, SLAM (SLAMF1, CD150, IPO-3) or a variety of any combination, preferably CD28- 4-1BB；The intracellular signal transduction area is preferably CD28-4-1BB-CD3 ζ.Intracellular signal transduction area can mediate foreign gene exist High effective integration in host cell, and high efficiency stable expression.
The mode transfected in the present invention can be turned by electricity and lipo2000, lipo3000 liposome transfection.
As currently preferred technical solution, transfection described in step (5) is preferably that electricity turns mode, i.e., being turned by electricity will Ready plasmid imports in the PBMC cell sub-elected.
The third aspect of the present invention, provide PD-1 gene knockout and express LewisY-CAR T cell prepare it is antitumor Cellular therapeutic agent in application.
PD-1 immunologic test point blocking treatment tumour is utilized compared with the prior art, the present invention has the advantages that
(1) T that PD-1 gene knockout and expression LewisY-CAR are prepared based on single base mutation is utilized the present invention provides a kind of The method of cell.Using the base editing technique by growing up on the basis of CRISPR-Cas9 in the present invention, pass through accurately CT Or GA single base mutation creates terminator codon, thus establish it is more more efficient than CRISPR-Cas9, it is more accurate and less de- The gene knockout strategy of targeted effect.
(2) present invention selection PiggyBac Transposon System improves expression efficiency and the reduction of transfection efficiency and transgenosis Time simplifies the preparation procedure of CAR-T, enhances the load capacity of system, safer relative to retroviral systems.
(3) present invention uses pUC pUC, and preparation process is relatively easy, and exogenous origin gene integrator is entered gene by transposase Group, easy to operate and integration efficiency are relatively high.
Detailed description of the invention
Illustrate case study on implementation of the present invention or technical solution in the prior art in order to clearer, below will to implementation column or The required attached drawing used makees brief introduction in description of the prior art.
Fig. 1 is the gene structure figure of pGL3-U6-PD1sgRNA BE expression vector in the embodiment of the present invention 1；
Fig. 2 is pST1374-N-NLS-GCN4-D10A gene structure figure in embodiment 4 in the present invention；
Fig. 3 is pST1374-scfv-APOBEC-UGI-GB1 gene structure figure in embodiment 4 in the present invention；
Fig. 4 is the plasmid schematic diagram in the present invention in embodiment 4 after the optimization of LewisY-scFv stream cipher；
Fig. 5 is super piggybac transposase transposase gene structure chart used in the present invention；
Fig. 6 is the knockout efficiencies figure of flow cytometer detection PD-1 gene in embodiment 4 in the present invention；
Fig. 7 is real for the T cell Cytotoxicity in vitro of PD-1 gene knockout obtained in embodiment 5 in the present invention and expression LewisY-CAR It tests.
Specific embodiment
The present invention relates to field of immunology, and in particular to immunotherapy field more particularly to a kind of PD-1 gene knockout and Express T cell of LewisY-CAR and preparation method thereof and its application.
The present invention is described further with attached drawing with reference to embodiments, and the embodiment for illustrating invention should not solve It is interpreted as this clearly demarcated range of limitation.Present disclosure can be improved from material, method and reaction condition simultaneously, All these improvement should all be fallen within spirit and scope of the invention.
The experimental method of detailed conditions is not specified in the following example, usually according to condition proposed by manufacturer.Unless It is otherwise noted, otherwise percentage is calculated by weight.Experimental material used in following embodiment and reagent are equal unless otherwise instructed It can be obtained from commercially available channel.
Although can be used in an embodiment of the present invention to of the present invention similar or of equal value any method and material, Preferred material and method are enumerated by place herein.
Embodiment 1 targets the preparation of the sgRNA plasmid of PD-1
One, the sgRNA plasmid of preparation targeting PD-1
(1) sgRNA design and building
T cell PD-1 gene target region of DNA domain is specified, according to selected target sequence, has synthesized a pair of of sgRNA, sequence is as follows:
PD-1-sgRNA-F:5 '-ggggttccagggcctgtctg-3 '
PD-1-sgRNA-R:5 '-cagacaggccctggaacccc-3 '
(2) by sgRNA denaturation annealing in (1):
Annealing system are as follows:
2μl Up oligo (100μM)
2μl Down oligo (100μM)
2μl Vazyme T7EN1 reaction buffer
14μl DdH2O
It is run in PCR instrument according to following touch down program: 95 DEG C, 5min；95-85℃ at-2℃/s；85-25℃ at-0.1℃/s；hold at 4℃.
(3) pGL3-U6-sgRNA plasmid linearization.
Digestion system and condition are as follows:
8 μ g pGL3-U6-sgRNA(400 ng/ μ l)；
5µl CutSmart Buffer；
5 μ l BsaI (NEB, R0535L)；
To 50 μ l, 37 DEG C are incubated for 3 ~ 4 hours for moisturizing, are vibrated and are centrifuged at regular intervals and are evaporated to pipe to prevent drop It covers.It is gone out after the completion of digestion with AxyPrep PCR Clean up Kit(AP-PCR-250) purification and recovery to 20 ~ 40 μ l In bacterium water.
(4) by the pGL3-U6-sgRNA of the double-strand sgRNA oligonucleotide obtained and linearisation after denaturation, annealing Plasmid is connected, conversion.
Linked system is as follows:
3 μ l annealed products
The pGL3-U6-sgRNA plasmid (25 ng/ μ l) of 1 μ l linearisation
1µl T4 ligation Buffer
0.5 μ l T4 DNA ligase (NEB, M0202S)
4.5 μ l aqua sterilisas
16 DEG C connect 1 hour, and connection product is converted DH5 α competent cell and is applied Amp+ plate (50 μ g/ml), and Picked clones sequencing.Sequencing identification primer: it is obtained with assembly For:cgattagtgaacggatctcgacg sequencing identification Obtain positive colony.
(5) 37 DEG C of shaking tables shake bacterium (250ml) and are incubated overnight positive colony, and with kit (Invitrogen, K210015) Plasmid is extracted, plasmid concentration is controlled in 1.5-2 μ g/ μ l.
Two, sgRNA functional verification
(1) cell culture and transfection
1. HEK293T cell inoculation is incubated in the sugared culture solution of DMEM high (HyClone, SH30022.01B), wherein containing 10% FBS, penicillin(100 U/ml) and streptomycin(100 μ g/ml).
2. before transfection by HEK293T cell inoculation in 12 orifice plates, when cell grows to 70% ~ 80% density, It changes antibiotic-free culture medium into, prepares transfection
3. turning operating instruction according to electricity, by 2 μ g pGL3-U6-PD1sgRNA BE plasmid (see figure 1), 2.0 μ g PST1374-N-NLS-GCN4-D10A(is as shown in Figure 2), 2 μ g pST1374-scfv-APOBEC-UGI-GB1(see Fig. 3 institute Show) turn liquid mixing with electricity, cotransfection changes liquid, and Blasticidin is added into every hole cell after 6 ~ 8 hours (invitrigen, ant-bl-1) and Puromycin(invitrigen, ant-pr-1) medicine sieve, cell is collected after 48 hours.
(2) T7EN1 digestion detects
1. the cell of collection is carried out DNA extraction, and in the site sgRNA upstream and downstream design primer F, R, with F, R to extracted After DNA progress PCR amplification and purification and recovery is carried out to PCR product.
2. take 200 ng purification and recovery products to be uniformly diluted to 20 μ l to be denaturalized, annealed, program such as: 95 DEG C, 5 min；95–85℃at −2℃/s；85–25℃at −0.1℃/s；hold at 4℃.
3. 0.3 μ l of T7EN1 is added in 20 μ l systems, 2 μ l are added in 37 DEG C digestion 30 minutes after mixing 10 × Loading Buffer is detected with 3% agarose gel electrophoresis.
(3) TA cloning and sequencing
The PCR recovery product that T7EN1 digestion detecting step c is obtained is carried out with rTaq plus A reacts.A is added to react System are as follows:
700 ~ 800 ng PCR recovery products
5 µl 10 ×Buffer (Mg2+ free)
3 µl Mg2+
4 µl dNTP
0.5 µl rTaq
Moisturizing is to 50 μ l systems.
After 37 °C incubate 30 minutes, takes 1 μ l product to connect with pMD19-T vector and convert DH5 α impression State cell, picking monoclonal are sequenced with universal primer M13F.
The preparation of 2 PBMC of embodiment
Healthy human peripheral blood is acquired with anticoagulant tube, is rocked in acquisition so that peripheral blood is sufficiently mixed with anti-coagulants；
Anticoagulation is slowly added in the 50ml centrifuge tube equipped with isometric lymphocyte separation medium (Ficoll), 450g, slowly Slow drop centrifugation 25min is risen, centre cannot stop being centrifuged；After centrifugation, the careful tunica albuginea drawn above lymphocyte separation medium Confluent monolayer cells are transferred in a new 50ml centrifuge tube, and PBS, 300g is added, slow to rise slow drop centrifugation 10min, abandon supernatant, retain from The cell precipitation of heart bottom of the tube；PBS, 160g are added again, it is slow to rise slow drop centrifugation 15min, abandon supernatant；PBS is eventually adding, 300g, it is slow to rise slow drop centrifugation 10min, supernatant is abandoned to get PBMC is arrived.
Embodiment 3 constructs PB-LewisY-puro carrier.
Specific step is as follows:
(1) prepare Lewis Y Chimeric antigen receptor (CAR), i.e. LewisY-CAR delivers company to scFv segment and carries out codon Optimization, be allowed to be easier to express in human body cell, after codon optimization sequence be SEQ ID NO.1 shown in nucleotides sequence Column.
(2) target fragment is synthesized, segment will be synthesized using In-Fusion technology and be fused to PB-LewisYCAR-puro load On body, make PB-LewisY-CAR-BBZ-puro plasmid (as shown in Figure 4).
Synthetic primer Primer-F:CGGCGCCTACTCTAGAGCCACCGAAGTGAAGCTGG and Primer-R:GGGG ACGAACAGATCTCTTGATCTCGAACTTGGTGCCG.The LewisY optimization synthesized using PCR amplification recycles LewisY PCR product；
Using Xba and the original PB-CD19CAR-puro carrier of II restriction enzymes double zyme cutting of Bgl, according to TaKaRa In- The step of Fusion kit, template are the carrier and LewisY PCR recovery product after digestion, are attached experiment.
Connection product converts DH5 α competent cell, and coated plate chooses single colonie sequencing, correct connection product bacterium is selected to carry out Massive amplification, and Plasmid DNA is extracted, obtain PB-LewisY-CAR-BBZ-puro plasmid.
Embodiment 4 utilizes BE-Plus system preparation targeting Lewis Y and the CAR-T cell of knockout PD-1 gene.
PBMC is cultivated with the AIM-V culture medium (cell factor containing IL-12) containing 10%FBS.To one section of cell-stimulating Cell number reaches 2-3 × 10 after time6It is a.
The sgRNA of the carrier of specific knockdown people PD-1 gene as shown in Figure 1, selectively targeted PD-1 gene is connected to On linear pGL3-U6-sgRNA plasmid (excellent precious biology, Cat:VT8203), with pST1374-scfv-APOBEC-UGI- GB1, pST1374-N-NLS-GCN4-D10A plasmid, PB-LewisY-puro plasmid, super piggybac PD-1 gene can be realized in Successful transfection CD3 positive T cell to transposase plasmid (vast spirit biology, Cat:P0179) together It knocks out.
Specific steps are as follows: above-mentioned each 4 μ g of 5 kinds of plasmids with Amaxa electricity is turned the electricity in kit turn reagent to mix, be wrapped The 100 μ l electricity containing 5 kinds of plasmids turn mixed liquor, wherein original plasmid pGL3-U6-sgRNA, pST1374-scfv-APOBEC- 3 plasmids of UGI-GB1 and pST1374-N-NLS-GCN4-D10A are as control；Two groups of electricity are turned into mixed liquor, 2-3 is added ×106Electricity is carried out using Lonza AMAXA 2B electroporation in a PBMC cell to turn；Liquid is changed after cell transfecting 2h, using coupling The enrichment with magnetic bead CD3 positive T cell of CD3/CD28 antibody；The puromycin of 0.5 μ g/ml is added in transfection after 5-6 days, screening is simultaneously T cell after culture amplification transfection, and obtain PD-1 gene knockout and express the CAR-T cell of LewisY-CAR.Take part thin Born of the same parents' suspension, the knockout efficiency of flow cytomery PD-1 gene reach 80% or more (Fig. 6).
Embodiment 5 prepares PD-1 gene knockout and expresses the CAR-T cells in vitro killing verifying of LewisY
It cultivates Raji cell and effector cell PD-1 gene knockout respectively and expresses the CAR-T cell of LewisY-CAR, and expression The CAR-T cell of LewisY-CAR.
Collect target cell Raji4 × 105Cells and effector cell's (CAR-T cell) each 3 × 106Cells, 300g, from Heart 10min, it is slow to rise slow drop, abandon supernatant；Target cell and effector cell are resuspended respectively with 1ml PBS solution, 300g is centrifuged 10min, It is slow to rise slow drop, abandon supernatant；It is repeated once；Effector cell is resuspended with 700 μ l culture mediums (AIM-V culture medium+10%FBS), uses 2ml Target cell is resuspended in culture medium (1640 culture medium+10%FBS).
Effect target is set than the experimental port for 1:1,5:1,10:1,20:1, and control group is set, every group of 3 multiple holes, 37 DEG C 5% CO22h is cultivated in incubator；500g is centrifuged 5min, slow to rise slow drop plate centrifugation；Take the 20 μ l supernatants in each hole to new 96 In orifice plate, and 50 μ l substrate solutions (being protected from light operation) are added in every hole, and room temperature, which is protected from light, is incubated for 15min；Every hole is added 50 μ l and terminates Liquid, microplate reader detect 490nm absorbance.As a result as shown in figure 5, the CAR-T of PD-1 gene knockout and expression LewisY-CAR are thin Killing-efficiency is significantly stronger than the CAR-T cell of expression LewisY-CAR to born of the same parents under the conditions of different effect target ratios in Raji target cell, when When effect target ratio is 20:1, the CAR-T cell tumour killing ability of PD-1 gene knockout of the present invention and expression LewisY-CAR are 66% (see figure 7).
Sequence table
<110>Suzhou Mao Hang Biotechnology Co., Ltd
<120>the CAR-T cell and its preparation method and application of Lewis Y is targeted based on base editor
<160> 11
<170> SIPOSequenceListing 1.0
<210> 1
<211> 795
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
atggagttcg ggctgagatg ggtgtttctg gtggccatcc tgaaggacgt gcagtgcgag 60
gtgcagctgg tggagagcgg ggggggagtg gtgcagcctg gaaggagcct gagactgagc 120
tgtagcacaa gcggctttac cttttctgat tattacatgt actgggtgag gcaggccccc 180
ggaaagggcc tggagtgggt ggcttatatg tccaacgtgg gcgccattac agactacccc 240
gacacagtga agggcagatt caccattagc cgggacaaca gcaaaaacac actgttcctg 300
cagatggaca gcctgagacc cgaggacacc ggcgtgtact tctgcgccag aggcaccaga 360
gacggcagct ggttcgccta ctggggccag ggaacacccg tgaccgtgag cagcggcggc 420
ggaggaagcg gaggaggagg aagcggcgga ggaggcagcg acatccagat gacccagagc 480
cctagcagtc tgagtgccag cgtgggcgac agagtgacca tcacctgcag aagcagtcag 540
agaatcgtgc acagcaacgg aaatacatac ctggagtggt accagcagac acccggcaaa 600
gcccccaaac tgctgatcta caaggtgagc aatagattca gcggcgtgcc cagcagattc 660
agcggaagcg gaagcggcac cgacttcacc ttcactatca gcagcctgca gcccgaagat 720
atcgcaacct actactgctt ccaggggagc cacgtgccat tcaccttcgg ccagggaacc 780
aagctgcaga tcacc 795
<210> 2
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
ggggttccag ggcctgtctg 20
<210> 3
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
cagacaggcc ctggaacccc 20
<210> 4
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
cgactggcca gggcgcctgt 20
<210> 5
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
acaggcgccc tggccagtcg 20
<210> 6
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
accgcccaga cgactggcca 20
<210> 7
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
tggccagtcg tctgggcggt 20
<210> 8
<211> 249
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
ttcgtccccg tgttcctgcc tgccaagcca acaactaccc ctgctccacg accacctact 60
ccagcaccta ccatcgcaag tcagcccctg tcactgcgac ctgaggcttg ccggccagca 120
gctggaggag cagtgcacac ccgaggcctg gacttcgcat gcgatatcta catttgggca 180
ccactggctg gaacctgtgg ggtcctgctg ctgagcctgg tcatcaccct gtattgtaac 240
cacagaaat 249
<210> 9
<211> 123
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
aggagcaaac gctcccgact gctgcattcc gactacatga acatgacacc tcggagacca 60
ggccccacta gaaagcatta ccagccatat gccccaccca gggatttcgc agcctatcgg 120
agc 123
<210> 10
<211> 141
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
cggttcagcg tcgtgaaaag ggggcgcaag aaactgctgt acatcttcaa gcagcctttt 60
atgcgcccag tgcagacaac tcaggaggaa gacggatgct cttgtcggtt cccagaggag 120
gaggaaggag gctgcgagct g 141
<210> 11
<211> 339
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
agagtgaagt tcagccggag cgccgatgca ccagcatatc agcagggaca gaatcagctg 60
tacaacgagc tgaatctggg caggcgcgag gaatatgacg tgctggataa gcgacgagga 120
cgggaccccg aaatgggagg aaaacccaga aggaagaacc ctcaggaggg gctgtataat 180
gaactgcaga aagacaagat ggctgaggca tacagcgaaa ttggaatgaa aggagagcgc 240
cgacggggga agggacacga tgggctgtac cagggactgt caaccgccac taaagatacc 300
tacgacgcac tgcacatgca ggctctgccc ccaagatga 339

Claims (11)

1. a kind of CAR-T cell that PD-1 gene is knocked, which is characterized in that PD-1 gene knockout and express LewisY-CAR T cell, the gene knockout of use are realized by BE-Plus system or Cas9, ZFN, TALEN gene knockout method.
2. CAR-T cell as described in claim 1, which is characterized in that the gene knockout is by BE-Plus system come real It is existing, specifically: the site that selected genes knock out designs target sequence sgRNA, then filters out target sequence, institute specific as follows Show:
SgRNA1-F: as shown in SEQ ID NO.2；
SgRNA1-R: as shown in SEQ ID NO.3；
SgRNA2-F: as shown in SEQ ID NO.4；
SgRNA2-R: as shown in SEQ ID NO.5；
SgRNA3-F: as shown in SEQ ID NO.6；
SgRNA3-R: as shown in SEQ ID NO.7；
The target sequence can be used on plasmid vector, on slow virus carrier, or be used for retroviral vector, adenovirus vector , on gland relevant viral vector or other kinds of carrier.
3. CAR-T cell as claimed in claim 2, which is characterized in that the target sequence selected is following sequence:
SgRNA1-F: as shown in SEQ ID NO.2；
SgRNA1-R: as shown in SEQ ID NO.3.
4. LewisY-CAR as described in any one of claims 1-3 includes LewisY-scFv, LewisY-scFv is for identification Lewis Y antigen, the LewisY-scFv sequence are as shown in SEQ ID NO.1.
5. the preparation method of the T cell for the expression LewisY-CAR that PD-1 gene as claimed in claim 4 is knocked, feature It is, includes the following steps:
(1) PBMC is separated from the peripheral blood that donor provides；
(2) in rotaring redyeing system, plasmid, transposase plasmids, BE Plus double-mass model, the targeting PD-1 of LewisY-CAR will be expressed The common transfection procedure of sgRNA plasmid (1) PBMC cell, the cell after being transfected, and carry out in vitro culture, massive amplification；
(3) cell obtained with CD3 antibody stimulation step (2) is thin with the T for obtaining PD-1 gene knockout and expression LewisY-CAR Born of the same parents, and subsequent detection is carried out to obtained T cell.
6. method as claimed in claim 5, which is characterized in that in step (2), the plasmid for expressing LewisY-CAR is PiggyBac-transposon carrier is sequentially connected in series promoter, signal peptide, LewisY-scFv sequence, hinge area, transmembrane region, born of the same parents What the resistant gene puromycin that interior signal transduction area is connected with T2A small peptide was prepared, wherein LewisY-scFv sequence is Nucleotide sequence after optimization, as shown in SEQ ID NO.1.
7. method as claimed in claim 6, which is characterized in that the intracellular signal transduction area includes coding costimulating factor area Domain, the costimulating factor region be selected from 4-1BB, CD28, CD27, OX40, CD30, CD40, PD-1, ICOS, LIGHT, B7-H3, Specifically bind ligand, ICAM-1, HVEM (LIGHTR), CD160, the relevant antigen -1(LFA- of lymphocyte function of CD83 1), IL2R α, CD103, CD11b, CD11c, TRANCE/RANKL, SLAMF4 (CD244,2B4), CD69, SLAM (SLAMF1, CD150, IPO-3) one of or a variety of any combination.
8. method as claimed in claim 6, which is characterized in that the promoter behaviour EF1 α promoter, the intracellular signal Conducting region is CD28-4-1BB-CD3 ζ, and hinge area is CD8 Hinge Chimerical receptor hinge, transmembrane region CD8 Transmembrane Chimerical receptor transmembrane region.
9. method as claimed in claim 5, which is characterized in that in its step (2), the transfection method is that electricity is walked around the side of dye Formula, by the multiple plasmids built by electricity turn in the way of be transfected into sorting cell in.
10. method as claimed in claim 5, which is characterized in that in step (2), the sgRNA plasmid of the targeting PD-1 is logical It crosses and imports the complementary oligonucleotide double-stranded segment that target sequence annealing obtains obtained by pGL3-U6-sgRNA plasmid.
11. the purposes for the CAR-T cell that PD-1 gene as described in any one of claims 1-3 is knocked, which is characterized in that use In preparing antitumor cellular therapeutic agent, it is especially targeted the cellular therapeutic agent of the tumor stem cell of the Lewis Y positive.
CN201910075913.2A 2019-01-25 2019-01-25 CAR-T cell based on base editing targeting Lewis Y and preparation method and application thereof Active CN109652380B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910075913.2A CN109652380B (en) 2019-01-25 2019-01-25 CAR-T cell based on base editing targeting Lewis Y and preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910075913.2A CN109652380B (en) 2019-01-25 2019-01-25 CAR-T cell based on base editing targeting Lewis Y and preparation method and application thereof

Publications (2)

Publication Number Publication Date
CN109652380A true CN109652380A (en) 2019-04-19
CN109652380B CN109652380B (en) 2023-04-28

Family

ID=66121575

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910075913.2A Active CN109652380B (en) 2019-01-25 2019-01-25 CAR-T cell based on base editing targeting Lewis Y and preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN109652380B (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112239769A (en) * 2019-07-19 2021-01-19 华东师范大学 sgRNA for guiding PD1 gene cutting to realize high-efficiency integration of exogenous sequence
WO2022052877A1 (en) * 2020-09-10 2022-03-17 上海邦耀生物科技有限公司 Method for performing gene editing on target site in cell
CN114231559A (en) * 2020-09-09 2022-03-25 广西医科大学 Expression plasmid containing CAR nucleic acid fragment, CD 105-targeted CAR-T cell containing expression plasmid, and preparation method and application thereof
CN114807155A (en) * 2021-01-18 2022-07-29 华东师范大学 Compositions for gene editing and uses thereof

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107119021A (en) * 2017-07-04 2017-09-01 王小平 PD 1 knocks out the preparation of CD19CAR T cells
WO2017193107A2 (en) * 2016-05-06 2017-11-09 Juno Therapeutics, Inc. Genetically engineered cells and methods of making the same
CN107338224A (en) * 2017-07-04 2017-11-10 成都克里斯博生物科技有限公司 PD 1 knocks out the preparation of EGFRvIIICAR T cells
CN107586777A (en) * 2016-07-08 2018-01-16 上海吉倍生物技术有限公司 People's PDCD1 genes sgRNA purposes and its related drugs
CN108913718A (en) * 2018-07-20 2018-11-30 苏州茂行生物科技有限公司 A kind of preparation method and application of the CAR-T cell of targeting EGFR v III

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017193107A2 (en) * 2016-05-06 2017-11-09 Juno Therapeutics, Inc. Genetically engineered cells and methods of making the same
CN107586777A (en) * 2016-07-08 2018-01-16 上海吉倍生物技术有限公司 People's PDCD1 genes sgRNA purposes and its related drugs
CN107119021A (en) * 2017-07-04 2017-09-01 王小平 PD 1 knocks out the preparation of CD19CAR T cells
CN107338224A (en) * 2017-07-04 2017-11-10 成都克里斯博生物科技有限公司 PD 1 knocks out the preparation of EGFRvIIICAR T cells
CN108913718A (en) * 2018-07-20 2018-11-30 苏州茂行生物科技有限公司 A kind of preparation method and application of the CAR-T cell of targeting EGFR v III

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
FAN ET AL.: "Chimeric antigen receptors for adoptive T cell therapy in acute myeloid leukemia", 《JOURNAL OF HEMATOLOGY & ONCOLOGY》 *
NEESON ET AL.: "Ex vivo culture of chimeric antigen receptor T cells generates functional CD8+ T cells with effector and central memory-like phenotype", 《GENE THERAPY》 *
PEINERT ET AL.: "Gene-modified T cells as immunotherapy for multiple myeloma and acute myeloid leukemia expressing the Lewis Y antigen", 《GENE THERAPY》 *
RITCHIE ET AL.: "Persistence and Efficacy of Second Generation CAR T Cell Against the LeY Antigen in Acute Myeloid Leukemia", 《THE AMERICAN SOCIETY OF GENE & CELL THERAPY》 *
RUPP ET AL.: "CRISPR/Cas9-mediated PD-1 disruption enhances anti-tumor efficacy of human chimeric antigen receptor T cells", 《SCIENTIFIC REPORTS》 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112239769A (en) * 2019-07-19 2021-01-19 华东师范大学 sgRNA for guiding PD1 gene cutting to realize high-efficiency integration of exogenous sequence
CN112239769B (en) * 2019-07-19 2023-11-07 上海邦耀生物科技有限公司 sgRNA for guiding PD1 gene cutting to realize efficient integration of exogenous sequences
CN114231559A (en) * 2020-09-09 2022-03-25 广西医科大学 Expression plasmid containing CAR nucleic acid fragment, CD 105-targeted CAR-T cell containing expression plasmid, and preparation method and application thereof
WO2022052877A1 (en) * 2020-09-10 2022-03-17 上海邦耀生物科技有限公司 Method for performing gene editing on target site in cell
CN114807155A (en) * 2021-01-18 2022-07-29 华东师范大学 Compositions for gene editing and uses thereof

Also Published As

Publication number Publication date
CN109652380B (en) 2023-04-28

Similar Documents

Publication Publication Date Title
CN109652380A (en) The CAR-T cell and its preparation method and application of LewisY is targeted based on base editor
CN106544321B (en) Universal CAR-T cell and its preparation method and application
CN109706121A (en) A kind of universal CAR-T cell and its preparation method and application based on base editor
CN111194350A (en) Gene editing T cell and application thereof
CN108531457A (en) A kind of method that Cas9/RNP knocks out T cell PD-1 and LAG3 gene and prepares CAR-T cells
CN109750035B (en) sgRNA for targeting and guiding Cas9 protein to efficiently cleave TCR and B2M gene locus
CN109735500A (en) A kind of CAR-T cell and its preparation method and application of secreting type targeting CD133
CN109678965A (en) The T cell and its application of Chimeric antigen receptor and its gene and recombinant expression carrier, the bis- targetings of CD22-CD19
CN109136248A (en) Multiple target point editor carrier and its construction method and application
WO2022078153A1 (en) Dna template for modifying primary cell using gene editing, and site-specific insertion method
CN114085841B (en) Site for stably expressing protein in CHO cell gene NW _003614092.1 and application thereof
CN108103105A (en) A kind of preparation method of CAR-T cells, CAR-T cells obtained and its application
KR20220097984A (en) Manufacturing method for making T cells expressing chimeric antigen receptor
CN113122504A (en) Method for purifying UCART cells and application
JP2023541028A (en) How to gene edit target sites within cells
CN113122503A (en) Universal CAR-T of targeted T cell lymphoma cell and preparation method and application thereof
CN114058625A (en) Site for stably expressing protein in CHO cell gene NW _003613781.1 and application thereof
CN109666651B (en) Secretory Lewis-Y targeting CAR-T cell
CN101245106B (en) Anti-VRGF acceptor monoclone antibody, preparation method and application thereof
CN108467864A (en) A kind of ICAM-1 gene knockouts tumor cell line and its application
CN112105720A (en) Genetically engineered immune lymphocyte and preparation method thereof
CN111983218A (en) Kit for detecting interaction of living cell-living cell surface receptor-ligand
CN114107253B (en) System and method for gene editing by using engineering cells
US20230054266A1 (en) Method for purifying ucart cell and use thereof
CN106636155A (en) Application of CD19-CAR gene sequence to malignant B cell tumors

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CP03 Change of name, title or address

Address after: Room 127, Building 3, No. 6 Kecheng Road, Suzhou Industrial Park, Suzhou City, Jiangsu Province, 215000

Patentee after: SUZHOU MAXIMUM BIO-TECH Co.,Ltd.

Address before: Unit 304, A4 Building, Biomedical Industrial Park, 218 Xinghu Street, Suzhou Industrial Park, Jiangsu Province, 215000

Patentee before: SUZHOU MAXIMUM BIO-TECH Co.,Ltd.

CP03 Change of name, title or address
CP03 Change of name, title or address

Address after: Room 202 and Room 203, Unit 201, Building 4, Zone B, Phase III, Biopharmaceutical Industry Park, No. 99 Jingu Road, Suzhou Area, China (Jiangsu) Pilot Free Trade Zone, Suzhou City, Jiangsu Province, 215024

Patentee after: SUZHOU MAXIMUM BIO-TECH Co.,Ltd.

Country or region after: China

Address before: Room 127, Building 3, No. 6 Kecheng Road, Suzhou Industrial Park, Suzhou City, Jiangsu Province, 215000

Patentee before: SUZHOU MAXIMUM BIO-TECH Co.,Ltd.

Country or region before: China

CP03 Change of name, title or address