CN112813101B - Gene editing system for constructing high-quality pig nuclear transplantation donor cells with high lean meat percentage and rapid growth and application thereof - Google Patents

Abstract

The invention discloses a gene editing system for constructing high-quality pig nuclear transplantation donor cells with high lean meat percentage and fast growth and application thereof. A CRISPR/Cas9 system for pig SST-MSTN gene editing comprises a Cas9 expression vector, a gRNA expression vector aiming at a pig MSTN gene and a gRNA expression vector aiming at a pig SST gene. The invention designs corresponding gRNA expression vectors aiming at different target points of MSTN gene and SST gene respectively, and obtains gRNA with higher editing efficiency and the expression vector thereof by screening. The modified Cas9 high-efficiency expression vector is matched for gene editing, and the editing efficiency is obviously improved compared with that of the original vector.

Description

Gene editing system for constructing high-quality pig nuclear transplantation donor cells with high lean meat percentage and fast growth and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a CRISPR/Cas9 system for MSTN and SST double-gene editing and application thereof in constructing high-quality porcine nuclear transplantation donor cells with high lean meat percentage and rapid growth.

Background

The pig is one of the first domesticated domestic animals in China, and is always an important meat animal for human beings in the historical long river. Chinese people like to eat pork, which is related to the diet culture of thousands of years. Since 2000 years, pork accounts for over 70% of the meat consumption in China, and is the most important meat consumed in China. At present, the price of the lean meat in cities in China is nearly 1 time higher than that of fat meat, lean meat type pigs with the lean meat percentage of more than 60% are favored, and the lean meat percentage character has a space for further improving. On the other hand, the weight of the fattening pigs in China at present is about 120kg, and the pigs only need 180 days from birth to slaughter, so that the slaughter time of the fattening pigs can be shortened if the growth speed of the pigs is increased. Therefore, the pig strain with higher lean meat percentage and higher growth speed can provide more economic benefits for pig production.

Myostatin (MSTN) belongs to TGF- β superfamily, is a negative regulator of skeletal muscle growth, and is involved in regulation of muscle fiber proliferation and hypertrophy, and its deletion or mutation can cause double muscle phenomenon. The discovery of the gene has great significance for the animal husbandry and the medical field. Somatostatin (SST) is a protein that inhibits the release of hormones such as pituitary growth hormone, thyroid stimulating hormone, adrenocorticotropic hormone, and the like, and is capable of inhibiting growth by inhibiting a range of growth-related hormones. The existing research shows that the inhibition of the expression of MSTN can increase muscle deposition and the lean meat percentage of pigs to a certain extent, while the inhibition of the expression of SST can accelerate the growth speed of the pigs to a certain extent and reduce the feed-meat ratio.

Gene editing is a biotechnology that has been greatly developed in recent years, and includes editing technologies from homologous recombination-based gene editing to nuclease-based ZFNs, TALENs, CRISPR/Cas9, and the like, wherein CRISPR/Cas9 technology is currently the most advanced gene editing technology. Therefore, the invention adopts CRISPR/cas9 technology to carry out MSTN and SST double gene mutation, obtains double gene combined knockout single cell clone, and lays a foundation for cultivating high-quality pig breeds with high lean meat percentage, fast growth and high production performance by somatic cell nuclear transfer animal cloning technology in the later period. The loss of the function of MSTN and SST can effectively improve the lean meat percentage and the growth speed of pigs, thereby improving the economic benefit of the pig industry.

Disclosure of Invention

The invention aims to provide a CRISPR/Cas9 system for pig SST-MSTN gene editing aiming at the defects of the prior art.

It is another object of the invention to provide an application of the CRISPR/Cas9 system.

It is still another object of the present invention to provide a recombinant cell and uses thereof.

The purpose of the invention can be realized by the following technical scheme:

a CRISPR/Cas9 system for pig SST-MSTN gene editing comprises a Cas9 expression vector, a gRNA expression vector aiming at a pig MSTN gene and a gRNA expression vector aiming at a pig SST gene; the Cas9 expression vector is a pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO vector with a complete plasmid sequence shown as SEQ ID No. 2.

As a preferred choice of the invention, vector skeletons of a gRNA expression vector aiming at the pig MSTN gene and a gRNA expression vector aiming at the pig SST gene are both pKG-U6gRNA, and the whole sequence of the plasmid is shown in SEQ ID NO. 3.

As further optimization of the invention, the gRNA shown in SEQ ID No.32 is expressed by a gRNA expression vector of the pig MSTN gene, and a target point of the gRNA is shown in SEQ ID No. 20; the gRNA expression vector aiming at the pig SST gene expresses gRNA shown in SEQ ID NO.51, and the target point is shown in SEQ ID NO. 39.

As a further preferred aspect of the present invention, the gRNA expression vector for porcine MSTN gene consists of SEQ ID NO:25 and SEQ ID NO:26 into a vector backbone pKG-U6 gRNA; the gRNA expression vector for the pig SST gene consists of a nucleotide sequence shown in SEQ ID NO:43 and SEQ ID NO.44, and a vector backbone pKG-U6gRNA into which a double strand is inserted.

The CRISPR/Cas9 system disclosed by the invention is applied to construction of MSTN and SST gene mutation porcine recombinant cells.

A recombinant cell is obtained by carrying out cotransfection on a primary pig fibroblast by using the CRISPR/Cas9 system disclosed by the invention through verification.

The recombinant cell disclosed by the invention is applied to construction of MSTN and SST double-gene knockout cloned pigs.

A gRNA expression vector for pig MSTN gene is disclosed, which expresses gRNA shown in SEQ ID NO.32, and the vector skeleton of the expression vector is pKG-U6gRNA, and the whole sequence of the plasmid is shown in SEQ ID NO. 3.

A gRNA expression vector aiming at a pig SST gene expresses a gRNA shown by SEQ ID No.51, the vector framework of the expression vector is pKG-U6gRNA, and the whole sequence of a plasmid is shown as SEQ ID No. 3.

Compared with the prior art, the invention has at least the following beneficial effects:

(1) The subject of the invention (pig) has better applicability than other animals (rat, primate).

Rodents such as rats and mice have great differences from humans in body types, organ sizes, physiology, pathology and the like, and cannot truly simulate normal physiological and pathological states of humans. Studies have shown that over 95% of drugs validated to be effective in large mice are not effective in human clinical trials. In large animals, primates are animals that have a close relationship with humans, but are small in size, late in sexual maturity (mating starts at age 6-7), and are single-birth animals, and the population propagation speed is extremely slow, and the raising cost is high. In addition, primate cloning efficiency is low, difficulty is high, and cost is high.

However, pigs are animals that have been closely related to humans except primates, and have body shapes, body weights, organ sizes, and the like similar to those of humans, and are very similar to those of humans in terms of anatomy, physiology, immunology, nutritional metabolism, disease pathogenesis, and the like. Meanwhile, the pigs have early sexual maturity (4-6 months), high reproductive capacity and multiple piglets, and can form a large group within 2-3 years. In addition, the cloning technology of the pig is very mature, and the cloning and feeding cost is much lower than that of a primate. Pigs are therefore very suitable animals as models for human diseases.

(2) Experiments prove that compared with a pX330 vector before modification, the modified pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO vector replaces a stronger promoter and adds a protein translation enhancing element, so that the expression of Cas9 is improved, the number of nuclear localization signals is increased, the nuclear localization capability of Cas9 protein is improved, and the gene editing efficiency is higher. The invention also adds fluorescent mark and resistance mark in the carrier, which is more convenient to be applied to the screening and enrichment of the positive transformation cell of the carrier. The editing efficiency of the Cas9 high-efficiency expression vector jointly modified by the gRNA screened by the invention is improved by more than 100 percent compared with the original vector.

(3) The invention designs corresponding expression vectors aiming at different target spots gRNAs of MSTN gene and SST gene respectively, and obtains gRNAs with higher editing efficiency and expression vectors thereof by screening. The modified Cas9 high-efficiency expression vector is matched for gene editing, the genotype of the obtained cells can be analyzed through the sequencing result of the target gene PCR product, the probability of obtaining the target gene mutation is 20-40%, and the probability is greatly superior to the probability of obtaining the mutation in a gene editing and delivering method (namely injecting a gene editing material by using fertilized eggs) by using an embryo injection technology.

(4) The obtained mutant unicellular clone strain is used for somatic cell nuclear transfer animal cloning to directly obtain the cloned pig containing target gene mutation, and the mutation can be stably inherited.

The invention adopts the method of primary cell in vitro editing with great technical difficulty and high challenge and screening positive editing single cell clone, and directly obtains the corresponding gene editing pig through somatic cell nuclear transfer animal cloning technology at the later stage, thereby greatly shortening the manufacturing period of the gene editing pig and saving manpower, material resources and financial resources.

Drawings

FIG. 1 is a schematic diagram of the structure of plasmid pX 330.

Fig. 2 is a schematic structural diagram of plasmid pU6gRNACas 9.

FIG. 3 is a structural map of pU6gRNA-eEF1a Cas9 vector.

FIG. 4 is a pU6gRNA-eEF1a Cas9+ nNLS vector map.

FIG. 5 is a schematic diagram of the structure of plasmid pKG-GE3.

FIG. 6 is a schematic structural diagram of plasmid pKG-U6 gRNA.

FIG. 7 is a schematic diagram showing the insertion of a DNA molecule of about 20bp (a target sequence binding region for transcription to form a gRNA) into a plasmid pKG-U6 gRNA.

FIG. 8 is a graph of the sequencing peaks of step 2.3.3 in example 2.

FIG. 9 is a graph of the sequencing peaks of step 2.4.3 in example 2.

FIG. 10 is an electrophoretogram of 18 swine genomic DNA as a template and PCR amplified using a primer pair consisting of MSTN-JDF102/MSTN-JDR429 in step 3.1 of example 3.

FIG. 11 is a graph of the sequencing peaks in step 3.4 of example 3.

FIG. 12 is an electrophoretogram obtained after PCR amplification of 18 pig genomic DNAs as templates and a primer pair of SST-JDF290/SST-JDR689 in step 4.1 of example 4. I.C. A

FIG. 13 is a graph of the sequencing peaks in step 4.4 of example 4.

FIG. 14 is an electrophoretogram obtained after PCR amplification using a primer pair consisting of MSTN-JDF102/MSTN-JDR429 and genomic DNA as a template in step 5.4.4 of example 5.

FIG. 15 is an electrophoretogram after PCR amplification using a primer pair composed of SST-JDF290/SST-JDR689 with genomic DNA as a template in step 5.4.4 of example 5.

FIG. 16 is an exemplary sequencing peak plot for the determination of the target gene as wild-type at step 5.4.5.1 in example 5.

FIG. 17 is a diagram of an exemplary sequencing peak for determining that the target I gene is a heterozygous mutant type at step 5.4.5.1 in example 5.

FIG. 18 is a graph of exemplary sequencing peaks for homozygous mutants determined to have biallelic identity variations in the target gene at step 5.4.5.1 of example 5.

FIG. 19 is a graph of exemplary sequencing peaks for determining homozygous mutant forms with biallelic variant target genes at step 5.4.5.1 of example 5.

FIG. 20 is an exemplary sequencing peak plot for the determination of the target gene as wild-type at step 5.4.5.2 in example 5.

FIG. 21 is a diagram of exemplary sequencing peaks for determining that the target gene is a hybrid mutant type at step 5.4.5.2 in example 5.

FIG. 22 is a graph of exemplary sequencing peaks for homozygous mutants determined to have biallelic identity variations in the target gene at step 5.4.5.2 of example 5.

FIG. 23 is a graph of exemplary sequencing peaks for homozygous mutants determined to have biallelic variant in step 5.4.5.2 of example 5.

Detailed Description

Example 1 construction of plasmids

1.1 construction of plasmid pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO (plasmid pKG-GE3 for short)

The original plasmid pX330-U6-Chimeric _ BB-CBh-hSpCas9 (plasmid pX330 for short) has a sequence shown in SEQ ID NO:1 is shown. The structure of plasmid pX330 is schematically shown in FIG. 1.SEQ ID NO:1, the 440 th to 725 th nucleotides form CMV enhancer, the 727 th to 1208 th nucleotides form chicken beta-actin promoter, the 1304 th to 1324 th nucleotides encode SV40 Nuclear Localization Signal (NLS), the 1325 th to 5449 th nucleotides encode Cas9 protein, and the 5450 th to 5497 th nucleotides encode nucleoplasmin Nuclear Localization Signal (NLS).

Plasmid pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO (figure 5), which is called plasmid pKG-GE3 for short, and the nucleotide is shown in SEQ ID NO:2, respectively. Compared with plasmid pX330, plasmid pKG-GE3 was mainly modified as follows: (1) removing residual gRNA framework sequence (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTTT) to reduce interference; (2) the original chicken beta-actin promoter is transformed into an EF1a promoter with higher expression activity, so that the protein expression capacity of the Cas9 gene is increased; (3) a nuclear localization signal coding gene (NLS) is added at the upstream and the downstream of the Cas9 gene, and the nuclear localization capacity of the Cas9 protein is increased; (4) the original plasmid does not have any eukaryotic cell screening marker, is not beneficial to screening and enriching of positive transformed cells, and is sequentially inserted with a P2A-EGFP-T2A-PURO coding gene at the downstream of a Cas9 gene to endow a carrier with fluorescence and eukaryotic cell resistance screening capacity; (5) WPRE element and 3' LTR sequence element are inserted to enhance protein translation capability of Cas9 gene.

The pKG-GE3 plasmid was constructed as follows:

(1) Removal of redundant null sequences in the gRNA backbone

Plasmid pX330 was digested with BbsI and XbaI, the vector fragment (about 8313 bp) was recovered, an insert 175bp (SEQ ID NO: 4) was synthesized by a multi-fragment recombination method, and the recovered vector fragment was recombined to obtain the pU6gRNAcas9 vector (FIG. 2).

(2) Engineering promoters and enhancers

For the constructed pU6gRNAcas9 vector, xbaI and AgeI endonuclease are used to remove promoter (chicken beta-actin promoter) and enhancer sequence (CMV enhancer), linear vector sequence is recovered about 7650bp, 554bp sequence containing CMV enhancer and EF1a promoter (SEQ ID NO: 5) is synthesized by a multi-fragment recombination method, and the sequence is recombined with the vector pU6gRNAcas9 after enzyme digestion to obtain pU6gRNA-eEF1a Cas9 vector (figure 3).

(3) Cas9 gene N-terminal added NLS sequence

The constructed vector pU6gRNA-eEF1a Cas9 is subjected to enzyme digestion by AgeI and BglII, a 7786bp vector sequence is recovered, a sequence with increased NLS is supplemented to an enzyme digestion site, namely a 447bp Cas9 coding sequence (SEQ ID NO: 6) comprising 2 nuclear localization signals and partial excision is synthesized by a multi-fragment recombination method, and a pU6gRNA-eEF1a Cas9+ nNLS vector is obtained by recombination (figure 4).

(4) Adding NLS, P2A-EGFP-T2A-PURO and WPRE-3' LTR-bGH polyA signal into the C end of Cas9 gene

The constructed vector is named as pU6gRNA-eEF1a Cas9+ nNLS, fseI and SbfI are used for enzyme digestion, a vector sequence 7781bp is recovered, and 2727bp vector containing SbfI is synthesized by a multi-fragment recombination method

NLS-P2A-EGFP-T2A-PURO-WPRE-3' LTR-bGH polyA signal fragment (SEQ ID NO: 7), and the vector fragment are recombined to obtain a vector pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO, pKG-GE3 for short, wherein the plasmid map is shown in figure 5, and the nucleotide sequence (SEQ ID NO: 2) is obtained.

SEQ ID NO:2, the nucleotide at positions 395 to 680 constitutes CMV enhancer, the nucleotide at positions 682 to 890 constitutes EF1a promoter, the nucleotide at positions 986 to 1006 encodes a Nuclear Localization Signal (NLS), the nucleotide at positions 1016 to 1036 encodes a Nuclear Localization Signal (NLS), the nucleotide at positions 1037 to 5161 encodes Cas9 protein, the nucleotide at positions 5162 to 5209 encodes a Nuclear Localization Signal (NLS), the nucleotide at positions 5219 to 5266 encodes a Nuclear Localization Signal (NLS), the nucleotide at positions 5276 to 5332 encodes self-cleaving polypeptide P2A (the amino acid sequence of self-cleaving polypeptide P2A is "ATNFSLSLLKKQAKGDAKGDVEENPGP", the position of self-cleaving is between the first and second amino acid residues from the C-terminus of the sequence), the nucleotide at positions 5333 to 6046 encodes EGFP protein, the nucleotide at positions 6056 to 539 encodes self-cleaving polypeptide T2A (the amino acid sequence of self-cleaving polypeptide T2A is "EGSLRGSLRGPLGVEGDVEGFENP", the nucleotide at positions 73610739 and the nucleotide at positions 7373769 to 677647), the nucleotide at positions WPBYb 6747 encodes the nucleotide sequence (the nucleotide sequence of the nucleotide at positions WPSbSLRGBW 679) and the nucleotide sequence of the nucleotide at positions 677610 to 677647), and the nucleotide sequence of WPSbRGSLRG 677610 to 677647, the sequence (WPSbRG 679). The amino acid sequence of SEQ ID NO: in 2, 911-6706 form a fusion gene, expressing the fusion protein. Due to the presence of the self-cleaving polypeptide P2A and the self-cleaving polypeptide T2A, the fusion protein spontaneously forms the following three proteins: proteins with Cas9 protein, proteins with EGFP protein and proteins with Puro protein.

1.2 construction of pKG-U6gRNA vector

A pUC57 vector is derived, a pKG-U6gRNA insertion sequence (a DNA fragment containing a U6 promoter, a BbsI enzyme cutting site and a sgRNA framework sequence, the sequence is shown in SEQ ID NO: 8) is connected through an EcoRV enzyme cutting site, and the pKG-U6gRNA insertion sequence is reversely inserted into the pUC57 vector to obtain a pKG-U6gRNA vector complete sequence (SEQ ID NO: 3), SEQ ID NO:3, the 2280 th to 2539 th nucleotides form the hU6 promoter, and the 2558 th to 2637 th nucleotides are used for transcription to form a gRNA framework. In use, a DNA molecule of about 20bp (target sequence binding region for transcription to form a gRNA) (fig. 7) is inserted into a plasmid pKG-U6gRNA (fig. 6) to form a recombinant plasmid, and the recombinant plasmid is transcribed in a cell to obtain a gRNA.

Example 2 plasmid proportioning optimization and comparison of the Effect of plasmid pX330 and plasmid pKG-GE3

2.1 target gRNA design and construction

2.1.1 target gRNA design of RAG1 Gene Using Benchling

RAG1-g4：AGTTATGGCAGAACTCAGTG(SEQ ID NO.9)

The synthesis of the insertion sequence complementary DNA Oligo for the RAG1 gene target is as follows:

RAG1-gRNA4S：caccgAGTTATGGCAGAACTCAGTG(SEQ ID NO.10)

RAG1-gRNA4A：aaacCACTGAGTTCTGCCATAACTc(SEQ ID NO.11)

RAG1-gRNA4S and RAG1-gRNA4A are single-stranded DNA molecules.

2.1.2 primers designed for amplification and detection of fragments containing the target of RAG1 gRNA

RAG1-nF126：CCCCATCCAAAGTTTTTAAAGGA(SEQ ID NO.12)

RAG1-nR525：TGTGGCAGATGTCACAGTTTAGG(SEQ ID NO.13)

2.1.3 Construction and cloning of gRNA recombinant vector

1) Digesting 1ug pKG-U6gRNA plasmid by using restriction enzyme BbsI;

2) Separating the digested pKG-U6gRNA plasmid by agarose gel (agarose gel concentration is 1%, namely 1g of agarose gel is added into 100mL of electrophoresis buffer solution), and purifying and recovering the digested product by a gel recovery kit (Vazyme);

3) 2 complementary DNA oligos synthesized from the target of 2.1.1 are annealed to form a DNA double strand complementary to the cleaved sticky end of pKG-U6gRNA vector BbsI, as shown in FIG. 7:

95 ℃ for 5min and then reducing the temperature to 25 ℃ at the speed of 5 ℃/min;

4) The ligation reaction was initiated as follows: reacting at room temperature for 10min

50ng of BbsI enzyme-digested pKG-U6gRNA plasmid recovered in step 2

mu.L of 5' phosphorylated oligonucleotide annealed in step 3 (1

10X T4 Buffer 2μL

1 μ L of T4 DNA ligase

ddH2O filled system to 20. Mu.L

Reacting at 37 ℃ for 60min;

5) Transformation of

The procedure was followed in accordance with the instructions for competent cells (Vazyme).

2.1.4 gRNA vector construction

1) The synthesized RAG1-gRNA4S and RAG1-gRNA4A were mixed and annealed to obtain a double-stranded DNA molecule having a cohesive end. The double-stranded DNA molecule having the cohesive ends was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (RAG 1-gRNA 4). Plasmid pKG-U6gRNA (RAG 1-gRNA 4) will express the RAG1-gRNA4 shown in SEQ ID No. 14.

2.1.5 gRNA vector identification

Picking a single clone from an LB flat plate, placing the single clone into an LB culture solution added with corresponding antibiotics, culturing the single clone in a constant temperature shaking table at 37 ℃ for 12-16h, sending the small upgraded grains to a general company for sequencing, and confirming that the RAG1-gRNA4 vector is successfully constructed through sequence comparison.

2.2 preparation of Primary pig fibroblasts

2.2.1 taking 0.5g of ear tissues of newborn juniperus domestica, removing hair and bone tissues, and soaking in 75% alcohol for 30-40s;

2.2.2 washing 5 times with PBS containing 5% P/S (Gibco Penicillin-Streptomyces), once with PBS without P/S;

wherein 5% P/S PBS formulation is: 5% P/S (Gibco Penicillin-Streptomyces) +95% PBS,5%, 95% in% by volume.

2.2.3 cutting the tissue with scissors, adding 5mL of 0.1% collagenase (Sigma) solution, digesting with a shaker at 37 ℃ for 1h;

2.2.4 500g centrifugation for 5min, supernatant removed, pellet resuspended in 1mL complete medium, plated into 10cm cell culture dish containing 10mL complete medium and sealed with 0.2% gelatin (VWR).

Wherein, the formula of the complete cell culture medium is as follows: 15% fetal bovine serum (Gibco) +83% DMEM Medium

(Gibco) +1%P/S (Gibco Penicillin-Streptomyces) +1%HEPES (Solambio), 15%, 83%, 1% being the percentage by volume.

2.2.5 in a constant temperature incubator at 37 ℃,5% CO2 (vol.%), 5% O2 (vol.%);

2.2.6 culturing the cells to about 60% of the bottom of the dish, digesting the cells by using 0.25% (Gibco) trypsin, adding a complete culture medium to stop digestion, transferring the cell suspension into a 15mL centrifuge tube, centrifuging for 4min at 400g, discarding the supernatant to obtain cell precipitates for the next cell transfection experiment

2.3 plasmid proportioning optimization

2.3.1 Co-transfection grouping

A first group: plasmid pKG-U6gRNA (RAG 1-gRNA 4) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.44 μ g plasmid pKG-U6gRNA (RAG 1-gRNA 4): 1.56. Mu.g of plasmid pKG-GE3. Namely, the molar ratio of the plasmid pKG-U6gRNA (RAG 1-gRNA 4) to the plasmid pKG-GE3 is 1:1.

second group: the plasmid pKG-U6gRNA (RAG 1-gRNA 4) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.72 μ g plasmid pKG-U6gRNA (RAG 1-gRNA 4): 1.28. Mu.g of plasmid pKG-GE3. Namely, the molar ratio of the plasmid pKG-U6gRNA (RAG 1-gRNA 4) to the plasmid pKG-GE3 is 2:1.

third group: plasmid pKG-U6gRNA (RAG 1-gRNA 4) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (RAG 1-gRNA 4): 1.08. Mu.g of plasmid pKG-GE3. Namely, the molar ratio of the plasmid pKG-U6gRNA (RAG 1-gRNA 4) to the plasmid pKG-GE3 is 3:1.

and a fourth group: plasmid pKG-U6gRNA (RAG 1-gRNA 4) was transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: mu.g of plasmid pKG-U6gRNA (RAG 1-gRNA 4).

2.3.2 Co-transfection procedure

Transfection experiments were performed using a mammalian fibroblast cell nuclear transfection kit (Neon kit) with a Neon TM transfection system electrotransfer.

1) Preparing electrotransformation DNA solution according to the above groups, and deliberately not generating bubbles in the process of uniformly mixing;

2) Washing the cell precipitate prepared in the 2.2.6 step by using 1ml of PBS phosphate buffer (Solarbio), transferring the cell precipitate into a 1.5ml centrifuge tube, centrifuging the cell precipitate for 6min at 600g, discarding the supernatant, and resuspending the cells by using 11 mu L of electric transfer basic solution Opti-MEM, wherein bubbles are prevented from being generated in the process of resuspension;

3) Sucking 10 mu L of cell suspension, adding the cell suspension into the electrotransfer DNA solution obtained in the step 1), and uniformly mixing, wherein no bubbles are generated in the uniformly mixing process;

4) Placing the electric rotating cup of the reagent cassette in a cup groove of a Neon (TM) transformation system electric rotating instrument, and adding 3mL of Buffer E;

5) Sucking 10 μ L of the mixed solution obtained in step 3) with an electric rotary gun, inserting into a click cup, selecting an electric rotary program (1450V 10ms3pulse), transferring the mixed solution in the electric rotary gun into 6-well plates in a super clean bench immediately after electric shock transfection, wherein each well contains 3mL of complete culture solution (15% fetal bovine serum (Gibco) +83 DMEM medium (Gibco) + 1) P/S (Gibco penilligin-Streptomycin) +1 HEPES (Solarbio));

6) Mixing, and culturing in constant temperature incubator at 37 deg.C, 5% CO2, 5% O2;

7) After 12-18h of electrotransformation, the solution was changed, and 36-48h were digested with 0.25% (Gibco) trypsin and the cells were collected in a 1.5mL centrifuge tube.

2.3.3 Gene editing efficiency analysis

Extracting the cellular genomic DNA collected in 2.3.2, performing PCR amplification by using a primer pair consisting of RAG1-nF126 and RAG1-nR525, and sequencing the product. The sequencing result utilizes a webpage version synthgo ICE tool to analyze the sequencing peak map to obtain that the editing efficiency of the first group, the second group and the third group is 9%, 53% and 66% in sequence, and an exemplary peak map of the sequencing result is shown in figure 8. Analyzing and determining that the gene editing efficiency of the third group is highest, namely determining that the optimal dosage of the gRNA plasmid and the Cas9 plasmid is 3:1, the actual amount of plasmid is 0.92. Mu.g: 1.08. Mu.g.

2.4 comparison of the Effect of plasmid pX330 and plasmid pKG-GE3

2.4.1 Co-transfection grouping

RAG1-330 groups: plasmid pKG-U6gRNA (RAG 1-gRNA 4) and plasmid pX330 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (RAG 1-gRNA 4): 1.08 μ g of plasmid pX330, wherein pKG-U6gRNA (RAG 1-gRNA 4) is present in a molar ratio to pX330 of 3.

Group RAG 1-KG: plasmid pKG-U6gRNA (RAG 1-gRNA 4) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (RAG 1-gRNA 4): 1.08 μ g plasmid pKG-GE3, wherein pKG-U6gRNA (RAG 1-gRNA 4) is present in a molar ratio of 3 to pKG-GE3.

RAG1-B group: plasmid pKG-U6gRNA (RAG 1-gRNA 4) was transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92. Mu.g of plasmid pKG-U6gRNA (RAG 1-gRNA 4).

2.4.2 Co-transfection procedure

As in this example 2.3.2.

2.4.3 Gene editing efficiency analysis

Extracting the cellular genomic DNA collected in 2.4.2, performing PCR amplification by using a primer pair consisting of RAG1-nF126 and RAG1-nR525, and sequencing the product. The editing efficiencies of a RAG1-330 group and a RAG1-KG group obtained by analyzing a sequencing peak map by utilizing a webpage version Synthego ICE tool in a sequencing result are respectively 28% and 68%, an exemplary peak map of the sequencing result is shown in figure 9, and the result shows that compared with the plasmid pX330, the gene editing efficiency is obviously improved by adopting the plasmid pKG-GE3.

Example 3 screening of efficient MSTN Gene gRNA target

Pig MSTN gene information: encoding a myostatin protein; is located on pig chromosome 15; geneID 399534, sus scrofa. The protein encoded by the pig MSTN gene is shown as GENBANK ACCESSION NO. NP-999600.2 (linear CON 12-JAN-2018), and the amino acid sequence is shown as SEQ ID NO:15, respectively. In the genome DNA, the swine MSTN gene has 3 exons, wherein the 1 st exon and the downstream 200bp sequences thereof are shown as SEQ ID NO: shown at 16.

3.1 Conservation analysis of MSTN gene knockout preset target and adjacent genome sequence

18 newborn Jiangxiang pigs, 10 females (named 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, respectively) and 8 males (named A, B, C, D, E, F, G, H, respectively).

The genomic DNA of 18 pigs was used as templates, PCR amplification was performed using primer pairs (the target sequence of the primer pair includes exon 1 of the pig MSTN gene), and electrophoresis was performed. And recovering PCR amplification products, sequencing, and comparing and analyzing a sequencing result with an MSTN gene sequence in a public database. Based on the alignment, primers for detecting mutations were designed (the primers themselves avoid potential mutation sites). Primers designed to detect mutations were: MSTN-JDF102/MSTN-JDR429. The electrophoretogram of 18 porcine genomic DNAs after PCR amplification using the primer set MSTN-JDF102/MSTN-JDR429 is shown in FIG. 10.

MSTN-JDF102：5’-AAAAGAGGGGCTGTGTAATGC-3’(SEQ ID NO：17)；

MSTN-JDR429：5’-AAACACTGGAACAACAGTCAGC-3’(SEQ ID NO：18)。

3.2 target gRNA design and construction

And primarily screening a plurality of targets by screening NGG (avoiding possible mutation sites), and further screening 4 targets from the NGG through a preliminary experiment.

The 4 targets were as follows:

sgRNA _MSTN-E1-g1 and (3) target point: 5 'TGATGATTATCACCGCTACGA-3' (SEQ ID NO: 19);

sgRNA _MSTN-E1-g2 and (3) target point: 5 'TGATCAATCAGTTCCCCGGAG-3' (SEQ ID NO: 20);

sgRNA _MSTN-E1-g3 and (3) target spot: 5 'GTGATAATCACTTTCCA-3' (SEQ ID NO: 21);

sgRNA _MSTN-E1-g4 and (3) target point: 5 'TTTCCAGGCGAAGTTTACTG-3' (SEQ ID NO: 22).

The synthetic MSTN gene has 4 targets of the complementary DNA Oligo with the insert sequence as follows:

MSTN-E1-gRNA1-S：5’-caccgTGATGATTATCACGCTACGA-3’(SEQ ID NO：23)；

MSTN-E1-gRNA1-A：5’-aaacTCGTAGCGTGATAATCATCAc-3’(SEQ ID NO：24)；

MSTN-E1-gRNA2-S：5’-caccgTGATCAATCAGTTCCCGGAG-3’(SEQ ID NO：25)；

MSTN-E1-gRNA2-A：5’-aaacCTCCGGGAACTGATTGATCAc-3’(SEQ ID NO：26)；

MSTN-E1-gRNA3-S：5’-caccGTGATAATCATCATCTTCCA-3’(SEQ ID NO：27)；

MSTN-E1-gRNA3-A：5’-aaacTGGAAGATGATGATTATCAC-3’(SEQ ID NO：28)；

MSTN-E1-gRNA4-S：5’-caccgTTTCCAGGCGAAGTTTACTG-3’(SEQ ID NO：29)；

MSTN-E1-gRNA4-A：5’-aaacCAGTAAACTTCGCCTGGAAAc-3’(SEQ ID NO：30)。

MSTN-E1-gRNA1-S, MSTN-E1-gRNA1-A, MSTN-E1-gRNA2-S, MSTN-E1-gRNA2-A, MSTN-E1-gRNA3-S, MSTN-E1-gRNA3-A, MSTN-E1-gRNA4-S, MSTN-E1-gRNA4-A are single-stranded DNA molecules.

3.3 preparation of recombinant plasmid gRNA

The plasmid pKG-U6gRNA was digested with the restriction enzyme BbsI, and the vector backbone (approximately 3kb linear large fragment) was recovered.

MSTN-E1-gRNA1-S and MSTN-E1-gRNA1-A are respectively synthesized, and then are mixed and annealed to obtain a double-stranded DNA molecule with a viscous tail end. The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (MSTN-E1-g 1). Plasmid pKG-U6gRNA (MSTN-E1-g 1) expresses the nucleic acid sequence of SEQ ID NO: sgRNA shown in 31 _MSTN-E1-g1 。

MSTN-E1-gRNA2-S and MSTN-E1-gRNA2-A are synthesized respectively, and then mixed and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (MSTN-E1-g 2). Plasmid pKG-U6gRNA (MSTN-E1-g 2) expresses the plasmid SEQ ID NO:32 of sgRNA _MSTN-E1-g2 。

MSTN-E1-gRNA3-S and MSTN-E1-gRNA3-A are synthesized respectively, and then mixed and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecule with the cohesive end is connected with a vector framework to obtain a plasmid pKG-U6gRNA (MSTN-E1-g 3). Plasmid pKG-U6gRNA (MSTN-E1-g 3) express SEQ ID NO:33 sgRNA _MSTN-E1-g3 。

MSTN-E1-gRNA4-S and MSTN-E1-gRNA4-A are synthesized respectively, and then mixed and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecule with the cohesive end is connected with a vector framework to obtain a plasmid pKG-U6gRNA (MSTN-E1-g 4). Plasmid pKG-U6gRNA (MSTN-E1-g 4) expresses the nucleic acid sequence of SEQ ID NO:34 sgRNA _MSTN-E1-g4 。

3.4 Comparison of editing efficiency of gRNAs of different target spots of MSTN gene

Porcine primary fibroblasts were prepared from ear tissue of newborn Jiangxiang pigs (female, blood group AO).

1. Cotransfection

A first group: the plasmid pKG-U6gRNA (MSTN-E1-g 1) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.92. Mu.g of plasmid pKG-U6gRNA (MSTN-E1-g 1): 1.08. Mu.g of plasmid pKG-GE3. Wherein the molar ratio of pKG-U6gRNA (MSTN-E1-g 1) to pKG-GE3 is 3.

Second group: the plasmid pKG-U6gRNA (MSTN-E1-g 2) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92. Mu.g of plasmid pKG-U6gRNA (MSTN-E1-g 2): 1.08. Mu.g of plasmid pKG-GE3. Wherein the molar ratio of pKG-U6gRNA (MSTN-E1-g 1) to pKG-GE3 is 3.

Third group: the plasmid pKG-U6gRNA (MSTN-E1-g 3) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92. Mu.g of plasmid pKG-U6gRNA (MSTN-E1-g 3): 1.08. Mu.g of plasmid pKG-GE3. Wherein the molar ratio of pKG-U6gRNA (MSTN-E1-g 1) to pKG-GE3 is 3.

And a fourth group: the plasmid pKG-U6gRNA (MSTN-E1-g 4) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.92. Mu.g of plasmid pKG-U6gRNA (MSTN-E1-g 4): 1.08. Mu.g of plasmid pKG-GE3. Wherein the molar ratio of pKG-U6gRNA (MSTN-E1-g 1) to pKG-GE3 is 3.

And a fifth group: the pig primary fibroblast is subjected to electrotransfection operation without adding plasmid under the same electrotransformation parameters.

Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, thermofeisher) and a Neon TM transfection system electrotransfer instrument (parameters set at 1450V, 10ms, 3 pulses).

2. After the completion of step 1, the culture is carried out for 16 to 18 hours by using the complete culture solution, and then the culture is carried out by replacing with a new complete culture solution. The total time of incubation was 48 hours.

3. After completion of step 2, the cells were digested and collected with trypsin, then lysed and genomic DNA extracted, PCR amplified using a primer pair consisting of MSTN-JDF102 and MSTN-JDR429, and then subjected to 1% agarose gel electrophoresis. The target fragment was recovered and sequenced, and the peak pattern of the sequencing is shown in FIG. 11. Analyzing the sequencing peak map by using a syntheo ICE tool to obtain the gene editing efficiency of different targets. The gene editing efficiencies of the first group to the fourth group were 3%, 32%, 15%, and 19% in this order. No gene editing occurred in the fifth group. The result shows that the editing efficiency of the second group is highest, and sgRNA _MSTN-E1-g2 The target point of (2) is the optimal target point.

Example 4 screening of efficient SST Gene gRNA targets

Porcine SST gene information: encoding a somastatin protein; is located on pig chromosome 13; geneID is 39386, sus scrofa. The protein coded by the pig SST gene is shown as GENBANK ACCESSION NO. NP-001009583.1 (linear CON 12-JAN-2018), and the amino acid sequence is shown as SEQ ID NO: shown at 35. In the genome DNA, the porcine SST gene has 2 exons, wherein the 1 st exon and the 400bp sequences of the exon and the upstream and the downstream thereof are shown as SEQ ID NO: shown at 36.

4.1 Conservation analysis of preset target point of SST gene knockout and adjacent genome sequence

18 newborn Jiangxiang pigs, 10 females (named 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, respectively) and 8 males (named A, B, C, D, E, F, G, H, respectively).

The genomic DNA of 18 pigs is taken as a template, a primer pair (the target sequence of the primer pair comprises the No.1 exon of the pig SST gene) is adopted for PCR amplification, and then electrophoresis is carried out. And recovering PCR amplification products, sequencing, and comparing and analyzing the sequencing result with an SST gene sequence in a public database. Based on the alignment, primers for detecting mutations were designed (the primers themselves avoid potential mutation sites). Primers designed to detect mutations were: SST-JDF290/SST-JDR689. The electrophoretogram of 18 porcine genomic DNAs amplified by PCR using the primer pair SST-JDF290/SST-JDR689 is shown in FIG. 12.

SST-JDF290：5’-CACGAGGGTAATGGTGCGTA-3’(SEQ ID NO：37)；

SST-JDR689：5’-GGTTAGGGGATTCGCGAGAG-3’(SEQ ID NO：38)。

4.2 target gRNA design and construction

And primarily screening a plurality of targets by screening NGG (avoiding possible mutation sites), and further screening 4 targets from the NGG through a preliminary experiment.

The 4 targets were as follows:

sgRNA _SST-E1-g1 and (3) target point: 5 'TCCATCGTCCCTGGCTCTGGG-3' (SEQ ID NO: 39);

sgRNA _SST-E1-g2 and (3) target point: 5 'GGGACTTCTGCAGAAACTGA-3' (SEQ ID NO: 40);

sgRNA _SST-E1-g3 and (3) target point: 5 'TGACGGAGTCGGGATCCGA-3' (SEQ ID NO: 41);

sgRNA _SST-E1-g4 and (3) target point: 5 '-TgcAGAACTGACGGAGTCG-3' (SEQ ID NO: 42).

The insert complementary DNA Oligo of the synthesized SST gene with 4 targets is as follows:

SST-E1-gRNA1-S：5’-caccgTCCATCGTCCTGGCTCTGGG-3’(SEQ ID NO：43)；

SST-E1-gRNA1-A：5’-aaacCCCAGAGCCAGGACGATGGAc-3’(SEQ ID NO：44)；

SST-E1-gRNA2-S：5’-caccGGGACTTCTGCAGAAACTGA-3’(SEQ ID NO：45)；

SST-E1-gRNA2-A：5’-aaacTCAGTTTCTGCAGAAGTCCC-3’(SEQ ID NO：46)；

SST-E1-gRNA3-S：5’-caccgTGACGGAGTCGGGGATCCGA-3’(SEQ ID NO：47)；

SST-E1-gRNA3-A：5’-aaacTCGGATCCCCGACTCCGTCAc-3’(SEQ ID NO：48)；

SST-E1-gRNA4-S：5’-caccgTGCAGAAACTGACGGAGTCG-3’(SEQ ID NO：49)；

SST-E1-gRNA4-A：5’-aaacCGACTCCGTCAGTTTCTGCAc-3’(SEQ ID NO：50)。

SST-E1-gRNA1-S, SST-E1-gRNA1-A, SST-E1-gRNA2-S, SST-E1-gRNA2-A, SST-E1-gRNA3-S, SST-E1-gRNA3-A, SST-E1-gRNA4-S, SST-E1-gRNA4-A are single-stranded DNA molecules.

4.3 preparation of gRNA recombinant plasmids

The plasmid pKG-U6gRNA was digested with the restriction enzyme BbsI, and the vector backbone (approximately 3kb linear large fragment) was recovered.

SST-E1-gRNA1-S and SST-E1-gRNA1-A are respectively synthesized, and then are mixed and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecule with the cohesive end is connected with a vector framework to obtain a plasmid pKG-U6gRNA (SST-E1-g 1). Plasmid pKG-U6gRNA (SST-E1-g 1) expresses the nucleic acid sequence of SEQ ID NO: 51A sgRNA _SST-E1-g1 。

SST-E1-gRNA2-S and SST-E1-gRNA2-A are respectively synthesized, and then are mixed and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecule with the cohesive end is connected with a vector framework to obtain a plasmid pKG-U6gRNA (SST-E1-g 2). Plasmid pKG-U6gRNA (SST-E1-g 2) expresses the nucleic acid sequence of SEQ ID NO: sgRNA shown in 52 _SST-E1-g2 。

SST-E1-gRNA3-S and SST-E1-gRNA3-A are synthesized respectively, and then mixed and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecule with cohesive ends is connected with a vector framework to obtain a plasmid pKG-U6gRNA (SST-E1-g 3). Plasmid pKG-U6gRNA (SST-E1-g 3) expresses the nucleic acid sequence of SEQ ID NO: sgRNA shown in 53 _SST-E1-g3 。

SST-E1-gRNA4-S and SST-E1-gRNA4-A are synthesized respectively, and then mixed and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecule with cohesive ends is connected with a vector framework to obtain a plasmid pKG-U6gRNA (SST-E1-g 4). Plasmid pKG-U6gRNA (SST-E1-g 4) expresses the nucleic acid sequence of SEQ ID NO:54 of an sgRNA _SST-E1-g4 。

4.4 Comparison of editing efficiency of gRNAs of different target points of SST gene

Porcine primary fibroblasts were prepared from ear tissue of a newborn Jiangxiang pig (female, blood group AO).

1. Cotransfection

A first group: the plasmid pKG-U6gRNA (SST-E1-g 1) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92. Mu.g of plasmid pKG-U6gRNA (SST-E1-g 1): 1.08. Mu.g of plasmid pKG-GE3. Wherein the molar ratio of pKG-U6gRNA (SST-E1-g 1) to pKG-GE3 is 3.

Second group: the plasmid pKG-U6gRNA (SST-E1-g 2) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.92. Mu.g of plasmid pKG-U6gRNA (SST-E1-g 2): 1.08. Mu.g of plasmid pKG-GE3. Wherein the molar ratio of pKG-U6gRNA (SST-E1-g 1) to pKG-GE3 is 3.

Third group: the plasmid pKG-U6gRNA (SST-E1-g 3) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.92. Mu.g of plasmid pKG-U6gRNA (SST-E1-g 3): 1.08. Mu.g of plasmid pKG-GE3. Wherein the molar ratio of pKG-U6gRNA (SST-E1-g 1) to pKG-GE3 is 3.

And a fourth group: the plasmid pKG-U6gRNA (SST-E1-g 4) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92. Mu.g of plasmid pKG-U6gRNA (SST-E1-g 4): 1.08. Mu.g of plasmid pKG-GE3. Wherein the molar ratio of pKG-U6gRNA (SST-E1-g 1) to pKG-GE3 is 3.

A fifth group: the pig primary fibroblast is subjected to electrotransfection operation without adding plasmid under the same electrotransformation parameters.

Co-transfection was performed by electroporation using a mammalian Nuclear transfection kit (Neon kit, thermofisiher) with a Neon TM transfection system electrotransfer instrument (parameters set at 1450V, 10ms, 3 pulses).

2. After step 1, the culture is carried out for 16 to 18 hours by using the complete culture solution, and then the culture is carried out by replacing the complete culture solution with a new one. The total time of incubation was 48 hours.

3. After completion of step 2, cells were digested and collected with trypsin, then lysed and genomic DNA extracted, PCR amplified with a primer pair consisting of SST-JDF290 and SST-JDR689, and then subjected to 1% agarose gel electrophoresis. Recovering the target fragment and performingThe sequencing peak is shown in FIG. 13. Analyzing the sequencing peak map by using a syntheo ICE tool to obtain the gene editing efficiency of different targets. The gene editing efficiencies of the first group to the fourth group were 47%, 26%, 22%, and 11% in this order. No gene editing occurred in the fifth group. The result shows that the editing efficiency of the first group is highest, and the sgRNA _SST-E1-g1 The target point of (2) is the optimal target point.

Example 5 construction of MSTN and SST double Gene knockout Single cell clone from Jiangxiang pig

5.1 preparation of Primary pig fibroblasts

Same as 2.2 in example 2.

5.2 Co-transfecting primary pig fibroblasts with the constructed pKG-U6gRNA (MSTN-E1-g 2) plasmid, pKG-U6gRNA (SST-E1-g 1) plasmid and pKG-GE3 plasmid

5.2.1 transfection of the plasmids pKG-U6gRNA (MSTN-E1-g 2), pKG-U6gRNA (SST-E1-g 1), pKG-GE3 into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.47. Mu.g of plasmid pKG-U6gRNA (MSTN-E1-g 2): 0.47. Mu.g of plasmid pKG-U6gRNA (SST-E1-g 1): 1.06. Mu.g of plasmid pKG-GE3.

5.2.2 Co-transfection procedure

The cells were digested as in 2.3.2 of example 2, but without 0.25% (Gibco) trypsin and collected in a 1.5mL centrifuge tube.

5.3 Screening of MSTN and SST double-gene knockout single-cell clone strain

5.3.1 digesting the population cells obtained in the step 5.2 after being electrically transferred for 48h by using trypsin, neutralizing the complete culture medium, centrifuging for 5min at 500g, removing supernatant, re-suspending the precipitate by using 200 mu L of complete culture medium, appropriately diluting, picking and transferring the single cells by using a suction tube into a 96-well plate containing 100 mu L of complete culture medium in each well, and placing one cell in each well;

5.3.2 37 ℃ in a constant temperature incubator, 5% CO2, 5% O2, changing the cell culture medium every 2 to 3 days, during which the growth of cells per well is observed with a microscope, excluding wells without cells and non-single cell clones;

5.3.3 after the cells in the wells of the 96-well plate have grown to the well bottom, trypsinize and collect the cells, 2/3 of which are seeded into a 6-well plate containing complete medium, and the remaining 1/3 of which are collected in a 1.5mL centrifuge tube for subsequent genotyping;

5.3.4 cells were digested and harvested with 0.25% (Gibco) trypsin when the 6-well plates were up to 80% confluency, and frozen using cell freezing medium (90% complete medium +10% DMSO, vol.).

5.4 MSTN and SST double-gene knockout single cell clone identification

5.4.1 to the cells collected in step 5.3.3 in a 1.5mL centrifuge tube, 10. Mu.L of KAPA2G lysate was added to lyse the cells, resulting in a lysate of cells that released genomic DNA.

The KAPA2G lysate preparation system is as follows:

10X extract Buffer 1μL

Enzyme 0.2μL

ddH2O 8.8μL

preserving cell lysate at-20 ℃ after the reaction is finished at 75 ℃ for 15 min-95 ℃ for 5 min-4 ℃;

5.4.2 the target region of the MSTN gene and the SST gene is respectively amplified by PCR by using the cell lysate as a DNA template and the primer pair (MSTN-JDF 102/MSTN-JDR 429) aiming at the MSTN gene E1 and the primer pair (SST-JDF 290/SST-JDR 689) aiming at the SST gene E1, and the target gene mutation condition of the single-cell clone is detected. The length of a target PCR product of the MSTN gene is 327bp, and the length of a target PCR product of the SST gene is 399bp;

5.4.3 amplifying MSTN gene and SST gene target region by PCR general reaction;

5.4.4 electrophoresis was performed on the PCR reaction products, the electrophoresis results are shown in FIG. 14 (MSTN) and FIG. 15 (SST), respectively, and the lane numbers are consistent with the single cell clone numbers. The PCR amplification product was recovered and sequenced.

And 5.4.5, comparing the sequencing result with MSTN gene and SST gene target point information so as to judge whether the single cell clone is the MSTN and SST double gene knockout.

5.4.5.1 for the MSTN gene, the genotypes of the single-cell clones numbered 1, 7, 11, 19, 34, 36, 39 are homozygous mutants with the same variation in biallelic genes; the genotype of the single cell clone numbered 18 is homozygous mutant for the biallelic different variation; the genotypes of the single-cell clones numbered 6, 24 and 40 are heterozygous mutant types; the genotypes of the single cell clones with other numbers are wild types; the rate of resulting MSTN gene-edited single cell clones was 28%.

Exemplary sequencing alignments are shown in fig. 16-19, where fig. 16 is an alignment of clone No.2 with a wild-type reference sequence, and is judged wild-type; FIG. 17 shows the result of alignment of the clone No. 40 with the wild-type reference sequence, which was judged as the heterozygous mutant; FIG. 18 shows the result of alignment of the sequencing result of clone No. 19 with the wild-type reference sequence, and it was judged as a homozygous mutant having the same variation in biallelic genes; FIG. 19 shows the results of alignment of the sequencing result of clone No. 18 with the wild-type reference sequence, and it was judged as a homozygous mutant type having different biallelic variations.

Through the analysis of specific sequences, the genotype of each single-cell clone is shown in table 1:

TABLE 1 identification of MSTN gene knockout single cell clone genotype

5.4.5.2 genotype of single-cell clones numbered 7, 9, 11, 19, 27, 32, 34, 39 for SST gene is homozygous mutant for biallelic identity variation; the genotypes of the single-cell clones with the numbers of 18 and 30 are homozygous mutant types of different variation of double alleles; the genotypes of the single-cell clones numbered 3, 13, 16, 21 and 36 are heterozygous mutant types; the genotypes of the other numbered single cell clones are wild types; the rate of single cell clones resulting from editing of the SST gene was 38%.

Exemplary sequencing alignments are shown in fig. 20-23, where fig. 20 is an alignment of clone No.1 with a wild-type reference sequence, and is judged wild-type; FIG. 21 shows the result of comparison of the sequencing result of clone No.3 with the wild-type reference sequence, and it was judged as the heterozygous mutant; FIG. 22 shows the result of comparison of the sequencing result of clone No. 7 with the wild-type reference sequence, and it was judged as a homozygous mutant having the same variation in biallelic genes; FIG. 23 shows the results of alignment of the sequencing result of clone No. 18 with the wild-type reference sequence, and it was judged as homozygous mutant with different variation in biallelic genes.

Through the analysis of specific sequences, the clone genotypes of each single cell are shown in the table 2:

TABLE 2 identification of SST Gene knockout Single cell clone genotypes

5.4.6 through analysis, the single clone cells with the numbers of 7, 11, 18, 19, 34 and 39 are single clone with MSTN gene homozygous knockout and SST gene homozygous knockout, and the homozygous knockout rate of the two genes is 15 percent.

The heterozygous mutant and the homozygous mutant single-cell clone strains can be used for cloning and producing the gene editing pig.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Sequence listing

<110> Nanjing King Gene engineering Co., ltd

<120> a gene editing system for constructing high-quality pig nuclear transplantation donor cells with high lean meat percentage and fast growth and application thereof

<160> 54

<170> SIPOSequenceListing 1.0

<210> 1

<211> 8484

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaaataag 300

gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttg ttttagagct 360

agaaatagca agttaaaata aggctagtcc gtttttagcg cgtgcgccaa ttctgcagac 420

aaatggctct agaggtaccc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 480

ccaacgaccc ccgcccattg acgtcaatag taacgccaat agggactttc cattgacgtc 540

aatgggtgga gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc 600

caagtacgcc ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tgtgcccagt 660

acatgacctt atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta 720

ccatggtcga ggtgagcccc acgttctgct tcactctccc catctccccc ccctccccac 780

ccccaatttt gtatttattt attttttaat tattttgtgc agcgatgggg gcgggggggg 840

ggggggggcg gggcgagggg cggggcgggg cgaggcggag aggtgcggcg gcagccaatc 900

agagcggcgc gctccgaaag tttcctttta tggcgaggcg gcggcggcgg cggccctata 960

aaaagcgaag cgcgcggcgg gcgggagtcg ctgcgcgctg ccttcgcccc gtgccccgct 1020

ccgccgccgc ctcgcgccgc ccgccccggc tctgactgac cgcgttactc ccacaggtga 1080

gcgggcggga cggcccttct cctccgggct gtaattagct gagcaagagg taagggttta 1140

agggatggtt ggttggtggg gtattaatgt ttaattacct ggagcacctg cctgaaatca 1200

ctttttttca ggttggaccg gtgccaccat ggactataag gaccacgacg gagactacaa 1260

ggatcatgat attgattaca aagacgatga cgataagatg gccccaaaga agaagcggaa 1320

ggtcggtatc cacggagtcc cagcagccga caagaagtac agcatcggcc tggacatcgg 1380

caccaactct gtgggctggg ccgtgatcac cgacgagtac aaggtgccca gcaagaaatt 1440

caaggtgctg ggcaacaccg accggcacag catcaagaag aacctgatcg gagccctgct 1500

gttcgacagc ggcgaaacag ccgaggccac ccggctgaag agaaccgcca gaagaagata 1560

caccagacgg aagaaccgga tctgctatct gcaagagatc ttcagcaacg agatggccaa 1620

ggtggacgac agcttcttcc acagactgga agagtccttc ctggtggaag aggataagaa 1680

gcacgagcgg caccccatct tcggcaacat cgtggacgag gtggcctacc acgagaagta 1740

ccccaccatc taccacctga gaaagaaact ggtggacagc accgacaagg ccgacctgcg 1800

gctgatctat ctggccctgg cccacatgat caagttccgg ggccacttcc tgatcgaggg 1860

cgacctgaac cccgacaaca gcgacgtgga caagctgttc atccagctgg tgcagaccta 1920

caaccagctg ttcgaggaaa accccatcaa cgccagcggc gtggacgcca aggccatcct 1980

gtctgccaga ctgagcaaga gcagacggct ggaaaatctg atcgcccagc tgcccggcga 2040

gaagaagaat ggcctgttcg gaaacctgat tgccctgagc ctgggcctga cccccaactt 2100

caagagcaac ttcgacctgg ccgaggatgc caaactgcag ctgagcaagg acacctacga 2160

cgacgacctg gacaacctgc tggcccagat cggcgaccag tacgccgacc tgtttctggc 2220

cgccaagaac ctgtccgacg ccatcctgct gagcgacatc ctgagagtga acaccgagat 2280

caccaaggcc cccctgagcg cctctatgat caagagatac gacgagcacc accaggacct 2340

gaccctgctg aaagctctcg tgcggcagca gctgcctgag aagtacaaag agattttctt 2400

cgaccagagc aagaacggct acgccggcta cattgacggc ggagccagcc aggaagagtt 2460

ctacaagttc atcaagccca tcctggaaaa gatggacggc accgaggaac tgctcgtgaa 2520

gctgaacaga gaggacctgc tgcggaagca gcggaccttc gacaacggca gcatccccca 2580

ccagatccac ctgggagagc tgcacgccat tctgcggcgg caggaagatt tttacccatt 2640

cctgaaggac aaccgggaaa agatcgagaa gatcctgacc ttccgcatcc cctactacgt 2700

gggccctctg gccaggggaa acagcagatt cgcctggatg accagaaaga gcgaggaaac 2760

catcaccccc tggaacttcg aggaagtggt ggacaagggc gcttccgccc agagcttcat 2820

cgagcggatg accaacttcg ataagaacct gcccaacgag aaggtgctgc ccaagcacag 2880

cctgctgtac gagtacttca ccgtgtataa cgagctgacc aaagtgaaat acgtgaccga 2940

gggaatgaga aagcccgcct tcctgagcgg cgagcagaaa aaggccatcg tggacctgct 3000

gttcaagacc aaccggaaag tgaccgtgaa gcagctgaaa gaggactact tcaagaaaat 3060

cgagtgcttc gactccgtgg aaatctccgg cgtggaagat cggttcaacg cctccctggg 3120

cacataccac gatctgctga aaattatcaa ggacaaggac ttcctggaca atgaggaaaa 3180

cgaggacatt ctggaagata tcgtgctgac cctgacactg tttgaggaca gagagatgat 3240

cgaggaacgg ctgaaaacct atgcccacct gttcgacgac aaagtgatga agcagctgaa 3300

gcggcggaga tacaccggct ggggcaggct gagccggaag ctgatcaacg gcatccggga 3360

caagcagtcc ggcaagacaa tcctggattt cctgaagtcc gacggcttcg ccaacagaaa 3420

cttcatgcag ctgatccacg acgacagcct gacctttaaa gaggacatcc agaaagccca 3480

ggtgtccggc cagggcgata gcctgcacga gcacattgcc aatctggccg gcagccccgc 3540

cattaagaag ggcatcctgc agacagtgaa ggtggtggac gagctcgtga aagtgatggg 3600

ccggcacaag cccgagaaca tcgtgatcga aatggccaga gagaaccaga ccacccagaa 3660

gggacagaag aacagccgcg agagaatgaa gcggatcgaa gagggcatca aagagctggg 3720

cagccagatc ctgaaagaac accccgtgga aaacacccag ctgcagaacg agaagctgta 3780

cctgtactac ctgcagaatg ggcgggatat gtacgtggac caggaactgg acatcaaccg 3840

gctgtccgac tacgatgtgg accatatcgt gcctcagagc tttctgaagg acgactccat 3900

cgacaacaag gtgctgacca gaagcgacaa gaaccggggc aagagcgaca acgtgccctc 3960

cgaagaggtc gtgaagaaga tgaagaacta ctggcggcag ctgctgaacg ccaagctgat 4020

tacccagaga aagttcgaca atctgaccaa ggccgagaga ggcggcctga gcgaactgga 4080

taaggccggc ttcatcaaga gacagctggt ggaaacccgg cagatcacaa agcacgtggc 4140

acagatcctg gactcccgga tgaacactaa gtacgacgag aatgacaagc tgatccggga 4200

agtgaaagtg atcaccctga agtccaagct ggtgtccgat ttccggaagg atttccagtt 4260

ttacaaagtg cgcgagatca acaactacca ccacgcccac gacgcctacc tgaacgccgt 4320

cgtgggaacc gccctgatca aaaagtaccc taagctggaa agcgagttcg tgtacggcga 4380

ctacaaggtg tacgacgtgc ggaagatgat cgccaagagc gagcaggaaa tcggcaaggc 4440

taccgccaag tacttcttct acagcaacat catgaacttt ttcaagaccg agattaccct 4500

ggccaacggc gagatccgga agcggcctct gatcgagaca aacggcgaaa ccggggagat 4560

cgtgtgggat aagggccggg attttgccac cgtgcggaaa gtgctgagca tgccccaagt 4620

gaatatcgtg aaaaagaccg aggtgcagac aggcggcttc agcaaagagt ctatcctgcc 4680

caagaggaac agcgataagc tgatcgccag aaagaaggac tgggacccta agaagtacgg 4740

cggcttcgac agccccaccg tggcctattc tgtgctggtg gtggccaaag tggaaaaggg 4800

caagtccaag aaactgaaga gtgtgaaaga gctgctgggg atcaccatca tggaaagaag 4860

cagcttcgag aagaatccca tcgactttct ggaagccaag ggctacaaag aagtgaaaaa 4920

ggacctgatc atcaagctgc ctaagtactc cctgttcgag ctggaaaacg gccggaagag 4980

aatgctggcc tctgccggcg aactgcagaa gggaaacgaa ctggccctgc cctccaaata 5040

tgtgaacttc ctgtacctgg ccagccacta tgagaagctg aagggctccc ccgaggataa 5100

tgagcagaaa cagctgtttg tggaacagca caagcactac ctggacgaga tcatcgagca 5160

gatcagcgag ttctccaaga gagtgatcct ggccgacgct aatctggaca aagtgctgtc 5220

cgcctacaac aagcaccggg ataagcccat cagagagcag gccgagaata tcatccacct 5280

gtttaccctg accaatctgg gagcccctgc cgccttcaag tactttgaca ccaccatcga 5340

ccggaagagg tacaccagca ccaaagaggt gctggacgcc accctgatcc accagagcat 5400

caccggcctg tacgagacac ggatcgacct gtctcagctg ggaggcgaca aaaggccggc 5460

ggccacgaaa aaggccggcc aggcaaaaaa gaaaaagtaa gaattcctag agctcgctga 5520

tcagcctcga ctgtgccttc tagttgccag ccatctgttg tttgcccctc ccccgtgcct 5580

tccttgaccc tggaaggtgc cactcccact gtcctttcct aataaaatga ggaaattgca 5640

tcgcattgtc tgagtaggtg tcattctatt ctggggggtg gggtggggca ggacagcaag 5700

ggggaggatt gggaagagaa tagcaggcat gctggggagc ggccgcagga acccctagtg 5760

atggagttgg ccactccctc tctgcgcgct cgctcgctca ctgaggccgg gcgaccaaag 5820

gtcgcccgac gcccgggctt tgcccgggcg gcctcagtga gcgagcgagc gcgcagctgc 5880

ctgcaggggc gcctgatgcg gtattttctc cttacgcatc tgtgcggtat ttcacaccgc 5940

atacgtcaaa gcaaccatag tacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg 6000

tggttacgcg cagcgtgacc gctacacttg ccagcgcctt agcgcccgct cctttcgctt 6060

tcttcccttc ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc 6120

tccctttagg gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgatttgg 6180

gtgatggttc acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg 6240

agtccacgtt ctttaatagt ggactcttgt tccaaactgg aacaacactc aactctatct 6300

cgggctattc ttttgattta taagggattt tgccgatttc ggtctattgg ttaaaaaatg 6360

agctgattta acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaattttat 6420

ggtgcactct cagtacaatc tgctctgatg ccgcatagtt aagccagccc cgacacccgc 6480

caacacccgc tgacgcgccc tgacgggctt gtctgctccc ggcatccgct tacagacaag 6540

ctgtgaccgt ctccgggagc tgcatgtgtc agaggttttc accgtcatca ccgaaacgcg 6600

cgagacgaaa gggcctcgtg atacgcctat ttttataggt taatgtcatg ataataatgg 6660

tttcttagac gtcaggtggc acttttcggg gaaatgtgcg cggaacccct atttgtttat 6720

ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga taaatgcttc 6780

aataatattg aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc cttattccct 6840

tttttgcggc attttgcctt cctgtttttg ctcacccaga aacgctggtg aaagtaaaag 6900

atgctgaaga tcagttgggt gcacgagtgg gttacatcga actggatctc aacagcggta 6960

agatccttga gagttttcgc cccgaagaac gttttccaat gatgagcact tttaaagttc 7020

tgctatgtgg cgcggtatta tcccgtattg acgccgggca agagcaactc ggtcgccgca 7080

tacactattc tcagaatgac ttggttgagt actcaccagt cacagaaaag catcttacgg 7140

atggcatgac agtaagagaa ttatgcagtg ctgccataac catgagtgat aacactgcgg 7200

ccaacttact tctgacaacg atcggaggac cgaaggagct aaccgctttt ttgcacaaca 7260

tgggggatca tgtaactcgc cttgatcgtt gggaaccgga gctgaatgaa gccataccaa 7320

acgacgagcg tgacaccacg atgcctgtag caatggcaac aacgttgcgc aaactattaa 7380

ctggcgaact acttactcta gcttcccggc aacaattaat agactggatg gaggcggata 7440

aagttgcagg accacttctg cgctcggccc ttccggctgg ctggtttatt gctgataaat 7500

ctggagccgg tgagcgtgga agccgcggta tcattgcagc actggggcca gatggtaagc 7560

cctcccgtat cgtagttatc tacacgacgg ggagtcaggc aactatggat gaacgaaata 7620

gacagatcgc tgagataggt gcctcactga ttaagcattg gtaactgtca gaccaagttt 7680

actcatatat actttagatt gatttaaaac ttcattttta atttaaaagg atctaggtga 7740

agatcctttt tgataatctc atgaccaaaa tcccttaacg tgagttttcg ttccactgag 7800

cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa 7860

tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg ccggatcaag 7920

agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata ccaaatactg 7980

ttcttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca ccgcctacat 8040

acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag tcgtgtctta 8100

ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc tgaacggggg 8160

gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga tacctacagc 8220

gtgagctatg agaaagcgcc acgcttcccg aagggagaaa ggcggacagg tatccggtaa 8280

gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac gcctggtatc 8340

tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg tgatgctcgt 8400

caggggggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct 8460

tttgctggcc ttttgctcac atgt 8484

<210> 2

<211> 10476

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaaataag 300

gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttc tagcgcgtgc 360

gccaattctg cagacaaatg gctctagagg tacccgttac ataacttacg gtaaatggcc 420

cgcctggctg accgcccaac gacccccgcc cattgacgtc aatagtaacg ccaataggga 480

ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc 540

aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 600

ggcattgtgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 660

tagtcatcgc tattaccatg ggggcagagc gcacatcgcc cacagtcccc gagaagttgg 720

ggggaggggt cggcaattga tccggtgcct agagaaggtg gcgcggggta aactgggaaa 780

gtgatgtcgt gtactggctc cgcctttttc ccgagggtgg gggagaaccg tatataagtg 840

cagtagtcgc cgtgaacgtt ctttttcgca acgggtttgc cgccagaaca caggttggac 900

cggtgccacc atggactata aggaccacga cggagactac aaggatcatg atattgatta 960

caaagacgat gacgataaga tggcccccaa aaagaaacga aaggtgggtg ggtccccaaa 1020

gaagaagcgg aaggtcggta tccacggagt cccagcagcc gacaagaagt acagcatcgg 1080

cctggacatc ggcaccaact ctgtgggctg ggccgtgatc accgacgagt acaaggtgcc 1140

cagcaagaaa ttcaaggtgc tgggcaacac cgaccggcac agcatcaaga agaacctgat 1200

cggagccctg ctgttcgaca gcggcgaaac agccgaggcc acccggctga agagaaccgc 1260

cagaagaaga tacaccagac ggaagaaccg gatctgctat ctgcaagaga tcttcagcaa 1320

cgagatggcc aaggtggacg acagcttctt ccacagactg gaagagtcct tcctggtgga 1380

agaggataag aagcacgagc ggcaccccat cttcggcaac atcgtggacg aggtggccta 1440

ccacgagaag taccccacca tctaccacct gagaaagaaa ctggtggaca gcaccgacaa 1500

ggccgacctg cggctgatct atctggccct ggcccacatg atcaagttcc ggggccactt 1560

cctgatcgag ggcgacctga accccgacaa cagcgacgtg gacaagctgt tcatccagct 1620

ggtgcagacc tacaaccagc tgttcgagga aaaccccatc aacgccagcg gcgtggacgc 1680

caaggccatc ctgtctgcca gactgagcaa gagcagacgg ctggaaaatc tgatcgccca 1740

gctgcccggc gagaagaaga atggcctgtt cggaaacctg attgccctga gcctgggcct 1800

gacccccaac ttcaagagca acttcgacct ggccgaggat gccaaactgc agctgagcaa 1860

ggacacctac gacgacgacc tggacaacct gctggcccag atcggcgacc agtacgccga 1920

cctgtttctg gccgccaaga acctgtccga cgccatcctg ctgagcgaca tcctgagagt 1980

gaacaccgag atcaccaagg cccccctgag cgcctctatg atcaagagat acgacgagca 2040

ccaccaggac ctgaccctgc tgaaagctct cgtgcggcag cagctgcctg agaagtacaa 2100

agagattttc ttcgaccaga gcaagaacgg ctacgccggc tacattgacg gcggagccag 2160

ccaggaagag ttctacaagt tcatcaagcc catcctggaa aagatggacg gcaccgagga 2220

actgctcgtg aagctgaaca gagaggacct gctgcggaag cagcggacct tcgacaacgg 2280

cagcatcccc caccagatcc acctgggaga gctgcacgcc attctgcggc ggcaggaaga 2340

tttttaccca ttcctgaagg acaaccggga aaagatcgag aagatcctga ccttccgcat 2400

cccctactac gtgggccctc tggccagggg aaacagcaga ttcgcctgga tgaccagaaa 2460

gagcgaggaa accatcaccc cctggaactt cgaggaagtg gtggacaagg gcgcttccgc 2520

ccagagcttc atcgagcgga tgaccaactt cgataagaac ctgcccaacg agaaggtgct 2580

gcccaagcac agcctgctgt acgagtactt caccgtgtat aacgagctga ccaaagtgaa 2640

atacgtgacc gagggaatga gaaagcccgc cttcctgagc ggcgagcaga aaaaggccat 2700

cgtggacctg ctgttcaaga ccaaccggaa agtgaccgtg aagcagctga aagaggacta 2760

cttcaagaaa atcgagtgct tcgactccgt ggaaatctcc ggcgtggaag atcggttcaa 2820

cgcctccctg ggcacatacc acgatctgct gaaaattatc aaggacaagg acttcctgga 2880

caatgaggaa aacgaggaca ttctggaaga tatcgtgctg accctgacac tgtttgagga 2940

cagagagatg atcgaggaac ggctgaaaac ctatgcccac ctgttcgacg acaaagtgat 3000

gaagcagctg aagcggcgga gatacaccgg ctggggcagg ctgagccgga agctgatcaa 3060

cggcatccgg gacaagcagt ccggcaagac aatcctggat ttcctgaagt ccgacggctt 3120

cgccaacaga aacttcatgc agctgatcca cgacgacagc ctgaccttta aagaggacat 3180

ccagaaagcc caggtgtccg gccagggcga tagcctgcac gagcacattg ccaatctggc 3240

cggcagcccc gccattaaga agggcatcct gcagacagtg aaggtggtgg acgagctcgt 3300

gaaagtgatg ggccggcaca agcccgagaa catcgtgatc gaaatggcca gagagaacca 3360

gaccacccag aagggacaga agaacagccg cgagagaatg aagcggatcg aagagggcat 3420

caaagagctg ggcagccaga tcctgaaaga acaccccgtg gaaaacaccc agctgcagaa 3480

cgagaagctg tacctgtact acctgcagaa tgggcgggat atgtacgtgg accaggaact 3540

ggacatcaac cggctgtccg actacgatgt ggaccatatc gtgcctcaga gctttctgaa 3600

ggacgactcc atcgacaaca aggtgctgac cagaagcgac aagaaccggg gcaagagcga 3660

caacgtgccc tccgaagagg tcgtgaagaa gatgaagaac tactggcggc agctgctgaa 3720

cgccaagctg attacccaga gaaagttcga caatctgacc aaggccgaga gaggcggcct 3780

gagcgaactg gataaggccg gcttcatcaa gagacagctg gtggaaaccc ggcagatcac 3840

aaagcacgtg gcacagatcc tggactcccg gatgaacact aagtacgacg agaatgacaa 3900

gctgatccgg gaagtgaaag tgatcaccct gaagtccaag ctggtgtccg atttccggaa 3960

ggatttccag ttttacaaag tgcgcgagat caacaactac caccacgccc acgacgccta 4020

cctgaacgcc gtcgtgggaa ccgccctgat caaaaagtac cctaagctgg aaagcgagtt 4080

cgtgtacggc gactacaagg tgtacgacgt gcggaagatg atcgccaaga gcgagcagga 4140

aatcggcaag gctaccgcca agtacttctt ctacagcaac atcatgaact ttttcaagac 4200

cgagattacc ctggccaacg gcgagatccg gaagcggcct ctgatcgaga caaacggcga 4260

aaccggggag atcgtgtggg ataagggccg ggattttgcc accgtgcgga aagtgctgag 4320

catgccccaa gtgaatatcg tgaaaaagac cgaggtgcag acaggcggct tcagcaaaga 4380

gtctatcctg cccaagagga acagcgataa gctgatcgcc agaaagaagg actgggaccc 4440

taagaagtac ggcggcttcg acagccccac cgtggcctat tctgtgctgg tggtggccaa 4500

agtggaaaag ggcaagtcca agaaactgaa gagtgtgaaa gagctgctgg ggatcaccat 4560

catggaaaga agcagcttcg agaagaatcc catcgacttt ctggaagcca agggctacaa 4620

agaagtgaaa aaggacctga tcatcaagct gcctaagtac tccctgttcg agctggaaaa 4680

cggccggaag agaatgctgg cctctgccgg cgaactgcag aagggaaacg aactggccct 4740

gccctccaaa tatgtgaact tcctgtacct ggccagccac tatgagaagc tgaagggctc 4800

ccccgaggat aatgagcaga aacagctgtt tgtggaacag cacaagcact acctggacga 4860

gatcatcgag cagatcagcg agttctccaa gagagtgatc ctggccgacg ctaatctgga 4920

caaagtgctg tccgcctaca acaagcaccg ggataagccc atcagagagc aggccgagaa 4980

tatcatccac ctgtttaccc tgaccaatct gggagcccct gccgccttca agtactttga 5040

caccaccatc gaccggaaga ggtacaccag caccaaagag gtgctggacg ccaccctgat 5100

ccaccagagc atcaccggcc tgtacgagac acggatcgac ctgtctcagc tgggaggcga 5160

caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa aagaaaaagg gcggctccaa 5220

gcggcctgcc gcgacgaaga aagcgggaca ggccaagaaa aagaaaggat ccggcgcaac 5280

aaacttctct ctgctgaaac aagccggaga tgtcgaagag aatcctggac cggtgagcaa 5340

gggcgaggag ctgttcaccg gggtggtgcc catcctggtc gagctggacg gcgacgtaaa 5400

cggccacaag ttcagcgtgt ccggcgaggg cgagggcgat gccacctacg gcaagctgac 5460

cctgaagttc atctgcacca ccggcaagct gcccgtgccc tggcccaccc tcgtgaccac 5520

cctgacctac ggcgtgcagt gcttcagccg ctaccccgac cacatgaagc agcacgactt 5580

cttcaagtcc gccatgcccg aaggctacgt ccaggagcgc accatcttct tcaaggacga 5640

cggcaactac aagacccgcg ccgaggtgaa gttcgagggc gacaccctgg tgaaccgcat 5700

cgagctgaag ggcatcgact tcaaggagga cggcaacatc ctggggcaca agctggagta 5760

caactacaac agccacaacg tctatatcat ggccgacaag cagaagaacg gcatcaaggt 5820

gaacttcaag atccgccaca acatcgagga cggcagcgtg cagctcgccg accactacca 5880

gcagaacacc cccatcggcg acggccccgt gctgctgccc gacaaccact acctgagcac 5940

ccagtccgcc ctgagcaaag accccaacga gaagcgcgat cacatggtcc tgctggagtt 6000

cgtgaccgcc gccgggatca ctctcggcat ggacgagctg tacaagggct ccggcgaggg 6060

caggggaagt cttctaacat gcggggacgt ggaggaaaat cccggcccaa ccgagtacaa 6120

gcccacggtg cgcctcgcca cccgcgacga cgtccccagg gccgtacgca ccctcgccgc 6180

cgcgttcgcc gactaccccg ccacgcgcca caccgtcgat ccggaccgcc acatcgagcg 6240

ggtcaccgag ctgcaagaac tcttcctcac gcgcgtcggg ctcgacatcg gcaaggtgtg 6300

ggtcgcggac gacggcgccg cggtggcggt ctggaccacg ccggagagcg tcgaagcggg 6360

ggcggtgttc gccgagatcg gcccgcgcat ggccgagttg agcggttccc ggctggccgc 6420

gcagcaacag atggaaggcc tcctggcgcc gcaccggccc aaggagcccg cgtggttcct 6480

ggccaccgtc ggagtctcgc ccgaccacca gggcaagggt ctgggcagcg ccgtcgtgct 6540

ccccggagtg gaggcggccg agcgcgccgg ggtgcccgcc ttcctggaga cctccgcgcc 6600

ccgcaacctc cccttctacg agcggctcgg cttcaccgtc accgccgacg tcgaggtgcc 6660

cgaaggaccg cgcacctggt gcatgacccg caagcccggt gcctgaacgc gttaagtcga 6720

caatcaacct ctggattaca aaatttgtga aagattgact ggtattctta actatgttgc 6780

tccttttacg ctatgtggat acgctgcttt aatgcctttg tatcatgcta ttgcttcccg 6840

tatggctttc attttctcct ccttgtataa atcctggttg ctgtctcttt atgaggagtt 6900

gtggcccgtt gtcaggcaac gtggcgtggt gtgcactgtg tttgctgacg caacccccac 6960

tggttggggc attgccacca cctgtcagct cctttccggg actttcgctt tccccctccc 7020

tattgccacg gcggaactca tcgccgcctg ccttgcccgc tgctggacag gggctcggct 7080

gttgggcact gacaattccg tggtgttgtc ggggaaatca tcgtcctttc cttggctgct 7140

cgcctgtgtt gccacctgga ttctgcgcgg gacgtccttc tgctacgtcc cttcggccct 7200

caatccagcg gaccttcctt cccgcggcct gctgccggct ctgcggcctc ttccgcgtct 7260

tcgccttcgc cctcagacga gtcggatctc cctttgggcc gcctccccgc gtcgacttta 7320

agaccaatga cttacaaggc agctgtagat cttagccact ttttaaaaga aaagggggga 7380

ctggaagggc taattcactc ccaacgaaga caagatctgc tttttgcttg tactgggtct 7440

ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt 7500

aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac 7560

tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagggcc 7620

cgtttaaacc cgctgatcag cctcgactgt gccttctagt tgccagccat ctgttgtttg 7680

cccctccccc gtgccttcct tgaccctgga aggtgccact cccactgtcc tttcctaata 7740

aaatgaggaa attgcatcgc attgtctgag taggtgtcat tctattctgg ggggtggggt 7800

ggggcaggac agcaaggggg aggattggga agacaatagc aggcatgctg gggatgcggt 7860

gggctctatg gcctgcaggg gcgcctgatg cggtattttc tccttacgca tctgtgcggt 7920

atttcacacc gcatacgtca aagcaaccat agtacgcgcc ctgtagcggc gcattaagcg 7980

cggcgggtgt ggtggttacg cgcagcgtga ccgctacact tgccagcgcc ttagcgcccg 8040

ctcctttcgc tttcttccct tcctttctcg ccacgttcgc cggctttccc cgtcaagctc 8100

taaatcgggg gctcccttta gggttccgat ttagtgcttt acggcacctc gaccccaaaa 8160

aacttgattt gggtgatggt tcacgtagtg ggccatcgcc ctgatagacg gtttttcgcc 8220

ctttgacgtt ggagtccacg ttctttaata gtggactctt gttccaaact ggaacaacac 8280

tcaactctat ctcgggctat tcttttgatt tataagggat tttgccgatt tcggtctatt 8340

ggttaaaaaa tgagctgatt taacaaaaat ttaacgcgaa ttttaacaaa atattaacgt 8400

ttacaatttt atggtgcact ctcagtacaa tctgctctga tgccgcatag ttaagccagc 8460

cccgacaccc gccaacaccc gctgacgcgc cctgacgggc ttgtctgctc ccggcatccg 8520

cttacagaca agctgtgacc gtctccggga gctgcatgtg tcagaggttt tcaccgtcat 8580

caccgaaacg cgcgagacga aagggcctcg tgatacgcct atttttatag gttaatgtca 8640

tgataataat ggtttcttag acgtcaggtg gcacttttcg gggaaatgtg cgcggaaccc 8700

ctatttgttt atttttctaa atacattcaa atatgtatcc gctcatgaga caataaccct 8760

gataaatgct tcaataatat tgaaaaagga agagtatgag tattcaacat ttccgtgtcg 8820

cccttattcc cttttttgcg gcattttgcc ttcctgtttt tgctcaccca gaaacgctgg 8880

tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt gggttacatc gaactggatc 8940

tcaacagcgg taagatcctt gagagttttc gccccgaaga acgttttcca atgatgagca 9000

cttttaaagt tctgctatgt ggcgcggtat tatcccgtat tgacgccggg caagagcaac 9060

tcggtcgccg catacactat tctcagaatg acttggttga gtactcacca gtcacagaaa 9120

agcatcttac ggatggcatg acagtaagag aattatgcag tgctgccata accatgagtg 9180

ataacactgc ggccaactta cttctgacaa cgatcggagg accgaaggag ctaaccgctt 9240

ttttgcacaa catgggggat catgtaactc gccttgatcg ttgggaaccg gagctgaatg 9300

aagccatacc aaacgacgag cgtgacacca cgatgcctgt agcaatggca acaacgttgc 9360

gcaaactatt aactggcgaa ctacttactc tagcttcccg gcaacaatta atagactgga 9420

tggaggcgga taaagttgca ggaccacttc tgcgctcggc ccttccggct ggctggttta 9480

ttgctgataa atctggagcc ggtgagcgtg gaagccgcgg tatcattgca gcactggggc 9540

cagatggtaa gccctcccgt atcgtagtta tctacacgac ggggagtcag gcaactatgg 9600

atgaacgaaa tagacagatc gctgagatag gtgcctcact gattaagcat tggtaactgt 9660

cagaccaagt ttactcatat atactttaga ttgatttaaa acttcatttt taatttaaaa 9720

ggatctaggt gaagatcctt tttgataatc tcatgaccaa aatcccttaa cgtgagtttt 9780

cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga gatccttttt 9840

ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt 9900

tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc agagcgcaga 9960

taccaaatac tgttcttcta gtgtagccgt agttaggcca ccacttcaag aactctgtag 10020

caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc agtggcgata 10080

agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg cagcggtcgg 10140

gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac accgaactga 10200

gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca 10260

ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt ccagggggaa 10320

acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt 10380

tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg gcctttttac 10440

ggttcctggc cttttgctgg ccttttgctc acatgt 10476

<210> 3

<211> 3120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 60

cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt 120

tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 180

aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt 240

ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg 300

ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga 360

tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc 420

tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac 480

actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg 540

gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca 600

acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg 660

gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg 720

acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg 780

gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag 840

ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg 900

gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct 960

cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac 1020

agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact 1080

catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga 1140

tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 1200

cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct 1260

gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 1320

taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgttc 1380

ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 1440

tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 1500

ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 1560

cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 1620

agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 1680

gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 1740

atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 1800

gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1860

gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 1920

ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 1980

cagtgagcga ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 2040

cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca 2100

acgcaattaa tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc 2160

cggctcgtat gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg 2220

accatgatta cgccaagctt gcatgcaggc ctctgcagtc gacgggcccg ggatccgatg 2280

ataaacatgt gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc 2340

tgttagagag ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac 2400

gtgacgtaga aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat 2460

ggactatcat atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt 2520

gtggaaagga cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag 2580

ttaaaataag gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttc 2640

tagcgcgtgc gccaattctg cagacaaatg gctctagagg tacccataga tctagatgca 2700

ttcgcgaggt accgagctcg aattcactgg ccgtcgtttt acaacgtcgt gactgggaaa 2760

accctggcgt tacccaactt aatcgccttg cagcacatcc ccctttcgcc agctggcgta 2820

atagcgaaga ggcccgcacc gatcgccctt cccaacagtt gcgcagcctg aatggcgaat 2880

ggcgcctgat gcggtatttt ctccttacgc atctgtgcgg tatttcacac cgcatatggt 2940

gcactctcag tacaatctgc tctgatgccg catagttaag ccagccccga cacccgccaa 3000

cacccgctga cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg 3060

tgaccgtctc cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga 3120

<210> 4

<211> 175

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tgtggaaagg acgaaacacc gggtcttcga gaagacctgt tttagagcta gaaatagcaa 60

gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg gtgctttttt 120

ctagcgcgtg cgccaattct gcagacaaat ggctctagag gtacccgtta cataa 175

<210> 5

<211> 554

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tctgcagaca aatggctcta gaggtacccg ttacataact tacggtaaat ggcccgcctg 60

gctgaccgcc caacgacccc cgcccattga cgtcaatagt aacgccaata gggactttcc 120

attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 180

atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 240

gtgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 300

tcgctattac catgggggca gagcgcacat cgcccacagt ccccgagaag ttggggggag 360

gggtcggcaa ttgatccggt gcctagagaa ggtggcgcgg ggtaaactgg gaaagtgatg 420

tcgtgtactg gctccgcctt tttcccgagg gtgggggaga accgtatata agtgcagtag 480

tcgccgtgaa cgttcttttt cgcaacgggt ttgccgccag aacacaggtt ggaccggtgc 540

caccatggac tata 554

<210> 6

<211> 447

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ccagaacaca ggttggaccg gtgccaccat ggactataag gaccacgacg gagactacaa 60

ggatcatgat attgattaca aagacgatga cgataagatg gcccccaaaa agaaacgaaa 120

ggtgggtggg tccccaaaga agaagcggaa ggtcggtatc cacggagtcc cagcagccga 180

caagaagtac agcatcggcc tggacatcgg caccaactct gtgggctggg ccgtgatcac 240

cgacgagtac aaggtgccca gcaagaaatt caaggtgctg ggcaacaccg accggcacag 300

catcaagaag aacctgatcg gagccctgct gttcgacagc ggcgaaacag ccgaggccac 360

ccggctgaag agaaccgcca gaagaagata caccagacgg aagaaccgga tctgctatct 420

gcaagagatc ttcagcaacg agatggc 447

<210> 7

<211> 2727

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cggcggccac gaaaaaggcc ggccaggcaa aaaagaaaaa gggcggctcc aagcggcctg 60

ccgcgacgaa gaaagcggga caggccaaga aaaagaaagg atccggcgca acaaacttct 120

ctctgctgaa acaagccgga gatgtcgaag agaatcctgg accggtgagc aagggcgagg 180

agctgttcac cggggtggtg cccatcctgg tcgagctgga cggcgacgta aacggccaca 240

agttcagcgt gtccggcgag ggcgagggcg atgccaccta cggcaagctg accctgaagt 300

tcatctgcac caccggcaag ctgcccgtgc cctggcccac cctcgtgacc accctgacct 360

acggcgtgca gtgcttcagc cgctaccccg accacatgaa gcagcacgac ttcttcaagt 420

ccgccatgcc cgaaggctac gtccaggagc gcaccatctt cttcaaggac gacggcaact 480

acaagacccg cgccgaggtg aagttcgagg gcgacaccct ggtgaaccgc atcgagctga 540

agggcatcga cttcaaggag gacggcaaca tcctggggca caagctggag tacaactaca 600

acagccacaa cgtctatatc atggccgaca agcagaagaa cggcatcaag gtgaacttca 660

agatccgcca caacatcgag gacggcagcg tgcagctcgc cgaccactac cagcagaaca 720

cccccatcgg cgacggcccc gtgctgctgc ccgacaacca ctacctgagc acccagtccg 780

ccctgagcaa agaccccaac gagaagcgcg atcacatggt cctgctggag ttcgtgaccg 840

ccgccgggat cactctcggc atggacgagc tgtacaaggg ctccggcgag ggcaggggaa 900

gtcttctaac atgcggggac gtggaggaaa atcccggccc aaccgagtac aagcccacgg 960

tgcgcctcgc cacccgcgac gacgtcccca gggccgtacg caccctcgcc gccgcgttcg 1020

ccgactaccc cgccacgcgc cacaccgtcg atccggaccg ccacatcgag cgggtcaccg 1080

agctgcaaga actcttcctc acgcgcgtcg ggctcgacat cggcaaggtg tgggtcgcgg 1140

acgacggcgc cgcggtggcg gtctggacca cgccggagag cgtcgaagcg ggggcggtgt 1200

tcgccgagat cggcccgcgc atggccgagt tgagcggttc ccggctggcc gcgcagcaac 1260

agatggaagg cctcctggcg ccgcaccggc ccaaggagcc cgcgtggttc ctggccaccg 1320

tcggagtctc gcccgaccac cagggcaagg gtctgggcag cgccgtcgtg ctccccggag 1380

tggaggcggc cgagcgcgcc ggggtgcccg ccttcctgga gacctccgcg ccccgcaacc 1440

tccccttcta cgagcggctc ggcttcaccg tcaccgccga cgtcgaggtg cccgaaggac 1500

cgcgcacctg gtgcatgacc cgcaagcccg gtgcctgaac gcgttaagtc gacaatcaac 1560

ctctggatta caaaatttgt gaaagattga ctggtattct taactatgtt gctcctttta 1620

cgctatgtgg atacgctgct ttaatgcctt tgtatcatgc tattgcttcc cgtatggctt 1680

tcattttctc ctccttgtat aaatcctggt tgctgtctct ttatgaggag ttgtggcccg 1740

ttgtcaggca acgtggcgtg gtgtgcactg tgtttgctga cgcaaccccc actggttggg 1800

gcattgccac cacctgtcag ctcctttccg ggactttcgc tttccccctc cctattgcca 1860

cggcggaact catcgccgcc tgccttgccc gctgctggac aggggctcgg ctgttgggca 1920

ctgacaattc cgtggtgttg tcggggaaat catcgtcctt tccttggctg ctcgcctgtg 1980

ttgccacctg gattctgcgc gggacgtcct tctgctacgt cccttcggcc ctcaatccag 2040

cggaccttcc ttcccgcggc ctgctgccgg ctctgcggcc tcttccgcgt cttcgccttc 2100

gccctcagac gagtcggatc tccctttggg ccgcctcccc gcgtcgactt taagaccaat 2160

gacttacaag gcagctgtag atcttagcca ctttttaaaa gaaaaggggg gactggaagg 2220

gctaattcac tcccaacgaa gacaagatct gctttttgct tgtactgggt ctctctggtt 2280

agaccagatc tgagcctggg agctctctgg ctaactaggg aacccactgc ttaagcctca 2340

ataaagcttg ccttgagtgc ttcaagtagt gtgtgcccgt ctgttgtgtg actctggtaa 2400

ctagagatcc ctcagaccct tttagtcagt gtggaaaatc tctagcaggg cccgtttaaa 2460

cccgctgatc agcctcgact gtgccttcta gttgccagcc atctgttgtt tgcccctccc 2520

ccgtgccttc cttgaccctg gaaggtgcca ctcccactgt cctttcctaa taaaatgagg 2580

aaattgcatc gcattgtctg agtaggtgtc attctattct ggggggtggg gtggggcagg 2640

acagcaaggg ggaggattgg gaagacaata gcaggcatgc tggggatgcg gtgggctcta 2700

tggcctgcag gggcgcctga tgcggta 2727

<210> 8

<211> 410

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gataaacatg tgagggccta tttcccatga ttccttcata tttgcatata cgatacaagg 60

ctgttagaga gataattgga attaatttga ctgtaaacac aaagatatta gtacaaaata 120

cgtgacgtag aaagtaataa tttcttgggt agtttgcagt tttaaaatta tgttttaaaa 180

tggactatca tatgcttacc gtaacttgaa agtatttcga tttcttggct ttatatatct 240

tgtggaaagg acgaaacacc gggtcttcga gaagacctgt tttagagcta gaaatagcaa 300

gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg gtgctttttt 360

ctagcgcgtg cgccaattct gcagacaaat ggctctagag gtacccatag 410

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

agttatggca gaactcagtg 20

<210> 10

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

caccgagtta tggcagaact cagtg 25

<210> 11

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

aaaccactga gttctgccat aactc 25

<210> 12

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ccccatccaa agtttttaaa gga 23

<210> 13

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

tgtggcagat gtcacagttt agg 23

<210> 14

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

aguuauggca gaacucagug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 15

<211> 375

<212> PRT

<213> pig (Sus \8194; scrofa)

<400> 15

Met Gln Lys Leu Gln Ile Tyr Val Tyr Ile Tyr Leu Phe Met Leu Ile

1 5 10 15

Val Ala Gly Pro Val Asp Leu Asn Glu Asn Ser Glu Gln Lys Glu Asn

20 25 30

Val Glu Lys Glu Gly Leu Cys Asn Ala Cys Met Trp Arg Gln Asn Thr

35 40 45

Lys Ser Ser Arg Leu Glu Ala Ile Lys Ile Gln Ile Leu Ser Lys Leu

50 55 60

Arg Leu Glu Thr Ala Pro Asn Ile Ser Lys Asp Ala Ile Arg Gln Leu

65 70 75 80

Leu Pro Lys Ala Pro Pro Leu Arg Glu Leu Ile Asp Gln Tyr Asp Val

85 90 95

Gln Arg Asp Asp Ser Ser Asp Gly Ser Leu Glu Asp Asp Asp Tyr His

100 105 110

Ala Thr Thr Glu Thr Ile Ile Thr Met Pro Thr Glu Ser Asp Leu Leu

115 120 125

Met Gln Val Glu Gly Lys Pro Lys Cys Cys Phe Phe Lys Phe Ser Ser

130 135 140

Lys Ile Gln Tyr Asn Lys Val Val Lys Ala Gln Leu Trp Ile Tyr Leu

145 150 155 160

Arg Pro Val Lys Thr Pro Thr Thr Val Phe Val Gln Ile Leu Arg Leu

165 170 175

Ile Lys Pro Met Lys Asp Gly Thr Arg Tyr Thr Gly Ile Arg Ser Leu

180 185 190

Lys Leu Asp Met Asn Pro Gly Thr Gly Ile Trp Gln Ser Ile Asp Val

195 200 205

Lys Thr Val Leu Gln Asn Trp Leu Lys Gln Pro Glu Ser Asn Leu Gly

210 215 220

Ile Glu Ile Lys Ala Leu Asp Glu Asn Gly His Asp Leu Ala Val Thr

225 230 235 240

Phe Pro Gly Pro Gly Glu Asp Gly Leu Asn Pro Phe Leu Glu Val Lys

245 250 255

Val Thr Asp Thr Pro Lys Arg Ser Arg Arg Asp Phe Gly Leu Asp Cys

260 265 270

Asp Glu His Ser Thr Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val

275 280 285

Asp Phe Glu Ala Phe Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr

290 295 300

Lys Ala Ser Tyr Cys Ser Gly Glu Cys Glu Phe Val Phe Leu Gln Lys

305 310 315 320

Tyr Pro His Thr His Leu Val His Gln Ala Asn Pro Arg Gly Ser Ala

325 330 335

Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr

340 345 350

Phe Asn Gly Lys Glu Gln Ile Ile Tyr Gly Lys Ile Pro Ala Met Val

355 360 365

Val Asp Arg Cys Gly Cys Ser

370 375

<210> 16

<211> 573

<212> DNA

<213> pig (Sus \8194; scrofa)

<400> 16

atgcaaaaac tgcaaatcta tgtttatatt tacctgttta tgctgattgt tgctggtccc 60

gtggatctga atgagaacag cgagcaaaag gaaaatgtgg aaaaagaggg gctgtgtaat 120

gcatgtatgt ggagacaaaa cactaaatct tcaagactag aagccataaa aattcaaatc 180

ctcagtaaac ttcgcctgga aacagctcct aacattagca aagatgctat aagacaactt 240

ttgcccaaag ctcctccact ccgggaactg attgatcagt acgatgtcca gagagatgac 300

agcagtgatg gctccttgga agatgatgat tatcacgcta cgacggaaac gatcattacc 360

atgcctacag agtgtaagta gtcctattag tgtatatcaa caattctgct gactgttgtt 420

ccagtgttta tgagaaacag atctattttc aggctctttt aacaagctgt tggcttgtac 480

gtaagtagga gggaaaagag tttctttttt caagatttca tgagaaataa actaatgaga 540

ctgaaagctg ctgtattatt gttttcctta gct 573

<210> 17

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

aaaagagggg ctgtgtaatg c 21

<210> 18

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

aaacactgga acaacagtca gc 22

<210> 19

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

tgatgattat cacgctacga 20

<210> 20

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

tgatcaatca gttcccggag 20

<210> 21

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

gtgataatca tcatcttcca 20

<210> 22

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

tttccaggcg aagtttactg 20

<210> 23

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

caccgtgatg attatcacgc tacga 25

<210> 24

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

aaactcgtag cgtgataatc atcac 25

<210> 25

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

caccgtgatc aatcagttcc cggag 25

<210> 26

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

aaacctccgg gaactgattg atcac 25

<210> 27

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

caccgtgata atcatcatct tcca 24

<210> 28

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

aaactggaag atgatgatta tcac 24

<210> 29

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

caccgtttcc aggcgaagtt tactg 25

<210> 30

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

aaaccagtaa acttcgcctg gaaac 25

<210> 31

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 31

ugaugauuau cacgcuacga guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 32

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

ugaucaauca guucccggag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 33

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 33

gugauaauca ucaucuucca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 34

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 34

uuuccaggcg aaguuuacug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 35

<211> 116

<212> PRT

<213> pig (Sus \8194; scrofa)

<400> 35

Met Leu Ser Cys Arg Leu Gln Cys Ala Leu Ala Ala Leu Ser Ile Val

1 5 10 15

Leu Ala Leu Gly Gly Val Thr Gly Ala Pro Ser Asp Pro Arg Leu Arg

20 25 30

Gln Phe Leu Gln Lys Ser Leu Ala Ala Ala Ala Gly Lys Gln Glu Leu

35 40 45

Ala Lys Tyr Phe Leu Ala Glu Leu Leu Ser Glu Pro Asn Gln Thr Glu

50 55 60

Asn Asp Ala Leu Glu Pro Glu Asp Leu Ser Gln Ala Ala Glu Gln Asp

65 70 75 80

Glu Met Arg Leu Glu Leu Gln Arg Ser Ala Asn Ser Asn Pro Ala Met

85 90 95

Ala Pro Arg Glu Arg Lys Ala Gly Cys Lys Asn Phe Phe Trp Lys Thr

100 105 110

Phe Thr Ser Cys

115

<210> 36

<211> 938

<212> DNA

<213> pig (Sus \8194; scrofa)

<400> 36

taactggtgt gcacatgtgt gagtgaaatt atggaatgtg tatgtgcata gcactgagtg 60

aatataaaaa gattgtgtag atggtgtggc acgtggggga attgtgtggg cctgtgtgca 120

ggatttattt atttcttaat aagctacttt tgattgtgta gagcctcctc tcacttcggt 180

gattgatttc acgagggtaa tggtgcgtaa aagcgctggt gagatctggg ggcgcctcct 240

agtctgacgt cagagagaga gtttaaaaag ggggagacgg tggcgagcgc acaagccgct 300

tcaggagtcg cgaggttcag agccgtcgct gctgcctgca aatcgactcc tagagtttga 360

ccaaccgcgc tctagctcgg cttctctggc cgctgccgag atgctgtcct gccgcctcca 420

gtgcgcgctg gccgcgctct ccatcgtcct ggctctgggc ggtgtcactg gcgcgccctc 480

ggatccccga ctccgtcagt ttctgcagaa gtccctggct gctgccgctg ggaagcaggt 540

aaggagactc cctcgacgcc ttctttcccc tctcgcgaat cccctaacct taccttagcc 600

ttgcccctcc tcccttgggt ggacttagga ggtggtccca aagagtatcg gtgcttttct 660

gggtccctta ggcaccaaat ctctcaggaa aactttcaaa gtccagaatt cctttttacc 720

tctttgtttt ttccctcttt gatcagcgca gtaggtcaca gttcaggtga gttctttggc 780

tttcaagaaa attctaagat ctggggaact gagctcgagg ggatgatggc atctatccgc 840

ggtgctgacc atgggaggtg ctgacccagg tgctgaaagc gcggacctct gaagcttcct 900

aagcagtacc tcccacccat gcagcagggc tgggggct 938

<210> 37

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 37

cacgagggta atggtgcgta 20

<210> 38

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 38

ggttagggga ttcgcgagag 20

<210> 39

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 39

tccatcgtcc tggctctggg 20

<210> 40

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 40

gggacttctg cagaaactga 20

<210> 41

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 41

tgacggagtc ggggatccga 20

<210> 42

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 42

tgcagaaact gacggagtcg 20

<210> 43

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 43

caccgtccat cgtcctggct ctggg 25

<210> 44

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 44

aaaccccaga gccaggacga tggac 25

<210> 45

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 45

caccgggact tctgcagaaa ctga 24

<210> 46

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 46

aaactcagtt tctgcagaag tccc 24

<210> 47

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 47

caccgtgacg gagtcgggga tccga 25

<210> 48

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 48

aaactcggat ccccgactcc gtcac 25

<210> 49

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 49

caccgtgcag aaactgacgg agtcg 25

<210> 50

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 50

aaaccgactc cgtcagtttc tgcac 25

<210> 51

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 51

uccaucgucc uggcucuggg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 52

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 52

gggacuucug cagaaacuga guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 53

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 53

ugacggaguc ggggauccga guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 54

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 54

ugcagaaacu gacggagucg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

Claims (4)

1. A CRISPR/Cas9 system for pig MSTN and SST gene editing is characterized by comprising a Cas9 expression vector, a gRNA expression vector aiming at pig MSTN genes and a gRNA expression vector aiming at pig SST genes; the Cas9 expression vector is a pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO vector with a complete plasmid sequence shown as SEQ ID No. 2; the gRNA expression vector for the pig MSTN gene expresses gRNA shown in SEQ ID No.32, the target point of the gRNA is shown in SEQ ID No.20, and the expression vector is obtained by inserting a double chain formed by annealing single-chain DNA shown in SEQ ID No.25 and SEQ ID No.26 into a vector skeleton pKG-U6 gRNA; the gRNA expression vector for the pig SST gene expresses gRNA shown in SEQ ID No.51, the target point of the gRNA is shown in SEQ ID No.39, and the expression vector is obtained by inserting a double chain formed by annealing single-chain DNA shown in SEQ ID No.43 and SEQ ID No.44 into a vector framework pKG-U6 gRNA; the whole plasmid sequence of the vector framework pKG-U6gRNA is shown in SEQ ID No. 3.

2. Use of the CRISPR/Cas9 system of claim 1 to construct MSTN and SST gene knockout porcine recombinant cells.

3. A swine recombinant cell with MSTN and SST gene knockout, which is characterized in that a swine primary fibroblast is cotransfected by the CRISPR/Cas9 system of claim 1 and is obtained after verification.

4. Use of the recombinant cell of claim 3 for the construction of MSTN and SST double knockout cloned pigs.

Images