CN112522258B

CN112522258B - Recombinant cell with IL2RG gene and ADA gene knocked out in combined mode and application of recombinant cell in preparation of immunodeficiency pig model

Info

Publication number: CN112522258B
Application number: CN202010971715.7A
Authority: CN
Inventors: 牛冬; 汪滔; 马翔; 曾为俊; 王磊; 程锐; 赵泽英
Original assignee: Nanjing Qizhen Genetic Engineering Co Ltd
Current assignee: Nanjing Qizhen Genetic Engineering Co Ltd
Priority date: 2020-09-16
Filing date: 2020-09-16
Publication date: 2023-08-22
Anticipated expiration: 2040-09-16
Also published as: CN112522258A

Abstract

The invention discloses a recombinant cell with IL2RG gene and ADA gene knocked out in a combined way and application thereof in preparation of an immunodeficiency pig model. The invention provides a method for preparing a polypeptide from sgRNA _IL2RG‑g7 And sgRNA _ADA‑g7 Use of a composed sgRNA combination in the preparation of a kit. The invention also provides a sgRNA combination, which consists of the sgRNA _IL2RG‑g7 And sgRNA _ADA‑g7 Composition is prepared. The sgRNA _IL2RG‑g7 The target sequence binding region of (a) is as set forth in SEQ ID NO:12 from nucleotide 1 to nucleotide 20; the sgRNA _ADA‑g7 The target sequence binding region of (a) is as set forth in SEQ ID NO:22 from nucleotide 1 to nucleotide 20. The invention also protects the application of the sgRNA combination in preparing recombinant cells and in preparing an immunodeficiency animal model. The invention lays a solid foundation for the preparation of the severe immunodeficiency pig model, and has great application value for the research and development of severe immunodeficiency medicines.

Description

Recombinant cell with IL2RG gene and ADA gene knocked out in combined mode and application of recombinant cell in preparation of immunodeficiency pig model

Technical Field

The invention belongs to the technical field of biology, and relates to a recombinant cell for combined knockout of IL2RG genes and ADA genes and application thereof in preparation of an immunodeficiency pig model.

Background

Severe combined immunodeficiency (severe combined immunodeficiency, SCID) is the most severe phenotype in primary immunodeficiency disease, and refers to the simultaneous development, differentiation, proliferation, metabolism or dysfunction of T cells, B cells and NK cells due to genetic, developmental or infectious factors. In 1950, glanzmann and Riniker reported SCID disease in human infants for the first time. Worldwide, the neonatal morbidity of SCID is about 1/50000, the disease is early in onset, the clinical manifestation is heavy, and the mortality rate is high. Most SCIDs are caused by abnormalities in immune-related genes, and the primary genetic means of SCIDs include both X-linked recessive inheritance and autosomal recessive inheritance. The disease has a certain regional and blood-related nature, and is frequently seen in male patients due to the characteristic of X-linked recessive inheritance. Currently, therapies aimed at SCID mainly include bone marrow or hematopoietic stem cell transplantation and gene therapy. Bone marrow or stem cell transplantation is the best approach to treat SCID, but finding a donor of the appropriate ligand to the patient is quite difficult.

As large animals, pigs are main meat source animals for a long time, are easy to breed and raise on a large scale, have lower requirements on ethical morals, animal protection and the like, have similar body sizes and organ functions to human beings, and are ideal human disease model animals. In addition, in the study of the effects of bioactive macromolecule or cell therapy, the use of heterologous animals will result in immune rejection, and thus, effective animal testing is not possible. The severe combined immunodeficiency model animals avoid the problem of immunological rejection between xenogeneics. Therefore, the human SCID pig model is developed for carrying out the researches of drug (especially bioactive molecules) screening, drug effect detection, disease pathology, gene and cell therapy, and the like, can provide effective experimental data for further clinical application, and also provides a powerful experimental means for successfully treating human SCID diseases.

SCID caused by X-linked recessive inheritance is one of the most common types, and the pathogenic mutation is that IL2RG gene encoding IL-2 Rgamma chain is mutated, thereby causing dysfunction of IL-2 Rgamma chain. The IL-2 Rgamma chain is also called a common gamma chain (common gamma chain), and is a signal transduction molecule commonly used when a plurality of cytokine receptors such as IL-2, IL-4, IL-7 and the like involved in regulating the differentiation, development and maturation processes of immune cells are combined with corresponding ligands thereof, and then signals are transduced into the immune cells. Thus, dysfunction of the consensus gamma chain can lead to dysfunction or dysplasia of immune cells, thereby eliciting SCID.

SCID caused by autosomal recessive inheritance. Defects in the purine nucleoside nuclease-related gene ADA in the nucleotide metabolism-related enzyme can result in a substantial enrichment of the intracellular nucleotide metabolites dATP or dGTP, which have selective toxic effects on lymphocytes, resulting in dysfunction, damage or death of the lymphocytes, which in turn triggers SCID.

Disclosure of Invention

The invention aims to provide a recombinant cell with IL2RG gene and ADA gene knocked out in a combined way and application thereof in preparation of an immunodeficiency pig model.

The invention provides a method for preparing a polypeptide from sgRNA _IL2RG-g7 And sgRNA _ADA-g7 Use of a composed sgRNA combination in the preparation of a kit.

The invention also provides application of a plasmid combination consisting of the plasmid pKG-U6gRNA (IL 2RG-g 7) and the plasmid pKG-U6gRNA (ADA-g 7) in preparation of a kit. .

The invention also provides a plasmid combination and application of the plasmid pKG-GE3 in preparation of the kit. The plasmid combination consists of plasmid pKG-U6gRNA (IL 2RG-g 7) and plasmid pKG-U6gRNA (ADA-g 7).

The invention also provides a sgRNA combination, which consists of the sgRNA _IL2RG-g7 And sgRNA _ADA-g7 Composition is prepared.

The invention also provides a plasmid combination which consists of the plasmid pKG-U6gRNA (IL 2RG-g 7) and the plasmid pKG-U6gRNA (ADA-g 7).

The invention also provides a kit comprising the sgRNA combination.

The invention also provides a kit comprising the plasmid combination. The kit also comprises plasmid pKG-GE3.

The invention also protects the application of the sgRNA combination in preparing a kit.

The invention also protects the application of the plasmid combination in preparing a kit.

The invention also protects the plasmid combination and the application of the plasmid pKG-GE3 in the preparation of the kit.

The use of any of the above kits is as follows (a) or (b): (a) preparing a recombinant cell; (b) preparing an immunodeficiency animal model. When the immunodeficiency animal model is prepared, the recombinant cells are prepared first, and then the recombinant cells are used as donor cells to obtain cloned animals by adopting a somatic cell cloning technology, namely the immunodeficiency animal model. An immunodeficiency cell model can also be prepared by using the immunodeficiency animal model, namely, corresponding cells of the immunodeficiency animal model are separated to be used as the immunodeficiency cell model. The animal may specifically be a pig. The animal model is a pig model. The cell model is a pig cell model. The recombinant cells are porcine recombinant cells. The transformed recipient cell of the recombinant cell is a porcine cell. The porcine cells may be porcine fibroblasts. The porcine cells may specifically be porcine primary fibroblasts. The pig may be a river fragrant pig.

The invention also protects the application of any one of the sgRNA combinations or any one of the plasmid combinations or any one of the kits in preparing recombinant cells. The recombinant cells are porcine recombinant cells. The transformed recipient cell of the recombinant cell is a porcine cell. The porcine cells may be porcine fibroblasts. The porcine cells may specifically be porcine primary fibroblasts. The pig may be a river fragrant pig.

The invention also protects the application of any one of the sgRNA combinations or any one of the plasmid combinations or any one of the kits in preparing an immunodeficiency animal model. When the method is applied, the recombinant cells are prepared first, and then the recombinant cells are used as donor cells to obtain cloned animals by adopting a somatic cell cloning technology, namely the immunodeficiency animal model. An immunodeficiency cell model can also be prepared by using the immunodeficiency animal model, namely, corresponding cells of the immunodeficiency animal model are separated to be used as the immunodeficiency cell model. The animal model is a pig model. The cell model is a pig cell model. The animal may specifically be a pig. The recombinant cells are porcine recombinant cells. The transformed recipient cell of the recombinant cell is a porcine cell. The porcine cells may be porcine fibroblasts. The porcine cells may specifically be porcine primary fibroblasts. The pig may be a river fragrant pig.

The invention also provides a method for preparing recombinant cells, comprising the following steps: the plasmid pKG-U6gRNA (IL 2RG-g 7), the plasmid pKG-U6gRNA (ADA-g 7) and the plasmid pKG-GE3 are co-transfected into pig cells to obtain recombinant cells with mutated IL2RG genes and ADA genes. The porcine cells may be porcine fibroblasts. The porcine cells may specifically be porcine primary fibroblasts. The pig may be a river fragrant pig.

The recombinant cells prepared by the method also belong to the protection scope of the invention.

Specifically, the recombinant cell may be any one of the following: monoclonal cell lines numbered 7, 15, 19, 20, 21, 26, 28, 30, 31, 35, 49 in tables 1 to 2.

The invention also protects the application of the recombinant cells in preparing an immunodeficiency animal model. When the immunodeficiency animal model is prepared, the recombinant cells are used as donor cells, and a somatic cell cloning technology is adopted to obtain cloned animals, namely the immunodeficiency animal model. An immunodeficiency cell model can also be prepared by using the immunodeficiency animal model, namely, corresponding cells of the immunodeficiency animal model are separated to be used as the immunodeficiency cell model. The animal model is a pig model. The cell model is a pig cell model.

The recombinant cell is a cell defective in both IL2RG gene and ADA gene.

The recombinant cell is a recombinant cell in which both IL2RG gene and ADA gene are mutated. The mutation may be a heterozygous mutation (corresponding genotype is heterozygous mutant) or a homozygous mutation (corresponding genotype is biallelic identical mutant or biallelic different mutant).

The plasmid pKG-U6gRNA (IL 2RG-g 7) is transcribed to give sgRNA _IL2RG-g7 。

The plasmid pKG-U6gRNA (ADA-g 7) was transcribed to give sgRNA _ADA-g7 。

sgRNA _IL2RG-g7 Target point: 5'-TCCCTTCAGAGAATAGATAG-3'.

sgRNA _ADA-g7 Target point: 5'-GGAGGGCGTGGTGTACGTGG-3'.

sgRNA _IL2RG-g7 The target sequence binding region of (a) is as set forth in SEQ ID NO:12 from nucleotide 1 to nucleotide 20;

sgRNA _ADA-g7 the target sequence binding region of (a) is as set forth in SEQ ID NO:22 from nucleotide 1 to nucleotide 20.

The sgRNA _IL2RG-g7 As set forth in SEQ ID NO: shown at 12.

The sgRNA _ADA-g7 As set forth in SEQ ID NO: shown at 22.

Specifically, the present invention relates to a method for manufacturing a semiconductor device. The plasmid pKG-U6gRNA (IL 2RG-g 7) was obtained by introducing the sgRNA with the aid of the restriction enzyme BbsI _IL2RG-g7 Is inserted into a pKG-U6gRNA vector.

Specifically, the plasmid pKG-U6gRNA (ADA-g 7) converts the sgRNA by means of the restriction enzyme BbsI _ADA-g7 Is inserted into a pKG-U6gRNA vector.

The plasmid pKG-GE3 has a specific fusion gene; the specific fusion gene codes for a specific fusion protein;

the specific fusion protein sequentially comprises the following elements from the N end to the C end: two Nuclear Localization Signals (NLS), cas9 protein, two nuclear localization signals, self-cleaving polypeptide P2A, fluorescent reporter protein, self-cleaving polypeptide T2A, resistance selection marker protein;

in the plasmid pKG-GE3, the EF1a promoter is used for promoting the expression of the specific fusion gene;

in plasmid pKG-GE3, the specific fusion gene has downstream a WPRE sequence element, a 3' LTR sequence element and a bGH poly (A) signal sequence element.

The plasmid pKG-GE3 has the following elements in this order: CMV enhancer, EF1a promoter, the specific fusion gene, WPRE sequence element, 3' LTR sequence element, bGH poly (A) signal sequence element.

In the specific fusion protein, two nuclear localization signals at the upstream of the Cas9 protein are SV40 nuclear localization signals, and two nuclear localization signals at the downstream of the Cas9 protein are nucleoplasin nuclear localization signals.

In the specific fusion protein, the fluorescent reporter protein can be EGFP protein.

In the specific fusion protein, the resistance screening marker protein can be a Puromycin protein.

The amino acid sequence of the self-cleaving polypeptide P2A is "ATNFSLLKQAGDVEENPGP" (the cleavage site where self-cleavage occurs is between the first amino acid residue and the second amino acid residue from the C-terminus).

The amino acid sequence of the self-cleaving polypeptide T2A is "EGRGSLLTCGDVEENPGP" (the cleavage site where self-cleavage occurs is between the first amino acid residue and the second amino acid residue from the C-terminus).

Specific fusion genes are specifically shown as SEQ ID NO:2 from nucleotide numbers 911-6706.

CMV enhancer as set forth in SEQ ID NO:2 from nucleotide 395 to 680.

The EF1a promoter is shown in SEQ ID NO:2 from nucleotide 682 to nucleotide 890.

WPRE sequence element is shown as SEQ ID NO:2 from nucleotide 6722 to nucleotide 7310.

The 3' LTR sequence element is shown in SEQ ID NO:2 from nucleotide 7382 to nucleotide 7615.

The bGH poly (A) signal sequence element is shown as SEQ ID NO:2 from nucleotide 7647 to nucleotide 7871.

Plasmid pKG-GE3 is specifically shown in SEQ ID NO: 2.

Plasmid pKG-U6gRNA has the sequence of SEQ ID NO:3 from nucleotide 2280 to nucleotide 2637.

The plasmid pKG-U6gRNA is specifically shown as SEQ ID NO: 3.

Porcine IL2RG gene information: encoding an interleukin 2receptor subunit gamma; located on the X chromosome; geneID is 397156,Sus scrofa. The protein coded by the pig IL2RG gene is shown as SEQ ID NO: 4. In the genome DNA, the pig IL2RG gene has 9 exons, wherein the 4 th exon and 500bp sequences of the 4 th exon and the upstream and downstream thereof are shown in SEQ ID NO:5 place Shown. Pig IL2RG gene has sgRNA _IL2RG-g7 Is a target gene of (a). The pig DRA gene is a gene with SEQ ID NO:5, and a gene having a region shown in FIG. 5.

Pig ADA gene information: encoding adenosine deaminase; chromosome 17; geneID is 100625920,Sus scrofa. The protein coded by the pig ADA gene is shown as SEQ ID NO: 15. In the genome DNA, the pig ADA gene has 12 exons, wherein the 4 th exon and 500bp sequences respectively at the upstream and downstream thereof are shown in SEQ ID NO: shown at 16. The pig ADA gene is sgRNA _ADA-g7 Is a target gene of (a). The porcine ADA gene is a gene having SEQ ID NO:16, and a gene of the region indicated by 16.

Any of the above immunodeficiency may be specifically a severe immunodeficiency.

The invention can be used for obtaining the severe immunodeficiency pig model by a gene editing means, is used for carrying out researches such as drug screening, drug effect detection, disease pathology, gene therapy and cell therapy, can provide effective experimental data for further clinical application, and lays a solid foundation for curing the severe immunodeficiency of human in the future.

Compared with the prior art, the invention has at least the following beneficial effects:

(1) The subject (pig) of the invention has better applicability than other animals (rats, mice, primates). At present, no severe immunodeficiency model of large animals is successfully developed. Rodents such as rats and mice have great differences from humans in terms of body type, organ size, physiology, pathology and the like, and cannot truly simulate normal physiological and pathological states of humans. Studies have shown that more than 95% of drugs that are validated in mice are ineffective in human clinical trials. In the case of large animals, primates are animals with the closest relationship to humans, but are small in size, late in sexual maturity (mating begins at 6-7 years old), and single animals, the population expansion rate is extremely slow, and the raising cost is also high. In addition, primate cloning is inefficient, difficult and costly. The pig is an animal which has the closest relationship with human except primate, and has the similar body shape, weight, organ size and the like as human, and has the similar anatomy, physiology, nutrition metabolism, disease pathogenesis and the like as human. Meanwhile, the pig has early sexual maturity (4-6 months), high fertility and multiple fetuses in one litter, and can form a larger group within 2-3 years. In addition, the cloning technology of pigs is very mature, and the cloning and feeding cost is much lower than that of primates; and pigs are taken as meat animals of human beings for a long time, and the resistance of the pigs taken as disease model animals in animal protection, ethics and the like is relatively small.

(2) The cas9 high-efficiency expression vector modified by the invention is adopted for gene editing, and the editing efficiency is obviously improved compared with the original vector.

(3) The gene editing is carried out with the Cas9 high-efficiency expression vector modified by the invention, the genotype of the obtained cell (homozygous mutation comprises identical mutation of double alleles and different mutation of double alleles, heterozygous mutation or wild type) can be analyzed according to the sequencing result of the target gene PCR product, and the probability of obtaining the homozygous mutation is 10% -20%; in addition, the obtained homozygous mutant monoclonal cell strain is used for somatic cell nuclear transfer to directly obtain the cloned pig containing the homozygous mutation of the target gene, and the homozygous mutation can be stably inherited.

The invention lays a solid foundation for the preparation of the severe immunodeficiency pig model, and has great application value for the research and development of severe immunodeficiency medicines.

Drawings

FIG. 1 is a schematic diagram of the structure of plasmid pX 330.

FIG. 2 is a schematic diagram of the structure of plasmid pKG-GE 3.

FIG. 3 is a schematic diagram of the structure of plasmid pKG-U6 gRNA.

FIG. 4 is a schematic representation of the insertion of a DNA molecule of about 20bp (target sequence binding region for transcription to form gRNA) into plasmid pKG-U6 gRNA.

FIG. 5 is an electrophoretogram of three groups of MSTN in step three of example 2.

FIG. 6 is an electrophoretogram of three sets of FNDC5 in step three of example 2.

FIG. 7 is an electrophoretogram of example 3 after PCR amplification using 8 pig genomic DNAs as templates and a primer set of IL2RG-GT-F4543/IL2 RG-GT-R5180.

FIG. 8 shows various double-stranded DNA molecules having cohesive ends in step three of example 3.

FIG. 9 is a plot of sequencing peaks in step four of example 3.

FIG. 10 is an electrophoretogram of example 4 after PCR amplification using 8 pig genomic DNAs as templates and primer pairs of ADA-GT-F259/ADA-GT-R1005.

FIG. 11 shows various double-stranded DNA molecules having cohesive ends in step three of example 4.

FIG. 12 is a plot of sequencing peaks in step four of example 4.

FIG. 13 is a graph showing the peak sequencing of the target gene of a part of the monoclonal cells in Table 1.

FIG. 14 is a graph showing the peak sequencing of the target gene of a part of the monoclonal cells in Table 2.

Detailed Description

The following detailed description of the invention is provided in connection with the accompanying drawings that are presented to illustrate the invention and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the invention in any way.

The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified. Unless otherwise indicated, the quantitative tests in the examples below were all performed in triplicate, and the results averaged. Complete culture solution (% by volume): 15% fetal bovine serum (Gibco) +83% DMEM medium (Gibco) +1% Penicillin-Streptomycin (Gibco) +1% HEPES (Solarbio). Cell culture conditions: 37 ℃,5% CO ₂ 、5％O ₂ Is a constant temperature incubator.

8 pigs in example 3 and example 4 were all from the birth river of the fragrant pigs, of which 4 females (named 1, 2, 3, 4 respectively) and 4 males (named A, B, C, D respectively).

A method of preparing porcine primary fibroblasts: (1) taking 0.5g of pig ear tissue, removing hair, soaking in 75% alcohol for 30-40s, washing with PBS buffer solution containing 5% (volume ratio) Penicillin-Streptomycin (Gibco) for 5 times, and washing with PBS buffer solution for one time; (2) shearing the tissue with scissors, digesting with 5mL 1% collagenase solution (Sigma) at 37deg.C for 1h, centrifuging 500g for 5min, and discarding the supernatant; (3) the pellet was resuspended in 1mL of complete medium, then plated into a 9cm diameter cell culture dish containing 10mL of complete medium and capped with 0.2% gelatin (VWR), and cultured until the cells grew to about 60% of the bottom of the dish; (4) after step (3) is completed, cells are digested with trypsin and collected, and frozen using cell frozen stock (90% complete medium+10% dmso, volume ratio).

The porcine primary fibroblasts used in examples 2 to 5 were obtained from the above-described swine designated 2 (female, blood group AO).

Example 1 preparation of plasmids

Preparing a plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9, as shown in SEQ ID NO: 1. Plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9, abbreviated as plasmid pX330.

Preparing a plasmid pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO, and performing the following steps: 2. Plasmid pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO, abbreviated as plasmid pKG-GE3.

Plasmid pKG-U6gRNA was prepared as shown in SEQ ID NO: 3.

Plasmid pX330, plasmid pKG-GE3, plasmid pKG-U6gRNA are all circular plasmids.

The schematic structure of plasmid pX330 is shown in fig. 1.SEQ ID NO:1, nucleotides 440-725 constitute the CMV enhancer, nucleotides 727-1208 constitute the chicken β -actin promoter, nucleotides 1304-1324 encode the SV40 Nuclear Localization Signal (NLS), nucleotides 1325-5449 encode the Cas9 protein, and nucleotides 5450-5497 encode the nucleoplasin Nuclear Localization Signal (NLS).

The schematic structure of plasmid pKG-GE3 is shown in FIG. 2.SEQ ID NO:2, nucleotides 395 to 680 comprising the CMV enhancer, nucleotides 682 to 890 comprising the EF1a promoter, nucleotides 986 to 1006 comprising the Nuclear Localization Signal (NLS), nucleotides 1016 to 1036 comprising the Nuclear Localization Signal (NLS), nucleotides 1037 to 5161 comprising the Cas9 protein, nucleotides 5162 to 5209 comprising the Nuclear Localization Signal (NLS), nucleotides 5219 to 5266 comprising the Nuclear Localization Signal (NLS), nucleotides 5276 to 5332 comprising the self-cleaving polypeptide P2A (the amino acid sequence of the self-cleaving polypeptide P2A is "ATNFSLLKQAGDVEENPGP", the cleavage site for the self-cleaving is between the first amino acid residue and the second amino acid residue from the C-terminus), nucleotide numbers 5333-6046 encode EGFP protein, nucleotide numbers 6056-6109 encode self-cleaving polypeptide T2A (the amino acid sequence of self-cleaving polypeptide T2A is EGRGSLLTCGDVEENPGP, the cleavage site where self-cleavage occurs is between the first amino acid residue and the second amino acid residue from the C-terminus), nucleotide numbers 6110-6703 encode Puromycin protein (called Puro protein for short), nucleotide numbers 6722-7310 constitute WPRE sequence element, nucleotide numbers 7382-7615 constitute 3' LTR sequence element, and nucleotide numbers 7647-7871 constitute bGH poly (A) signal sequence element. SEQ ID NO:2, 911-6706 form a fusion gene, expressing a fusion protein. Due to the presence of self-cleaving polypeptide P2A and self-cleaving polypeptide T2A, the fusion protein spontaneously forms three proteins: proteins with Cas9 protein, proteins with EGFP protein, and proteins with Puro protein.

Compared with plasmid pX330, plasmid pKG-GE3 was mainly modified as follows: (1) removing residual gRNA backbone sequences (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTTT), reducing interference; (2) the original chicken beta-actin promoter is modified into an EF1a promoter with higher expression activity, so that the protein expression capacity of the Cas9 gene is increased; (3) adding nuclear localization signal coding genes (NLS) at the upstream and downstream of the Cas9 gene, and increasing the nuclear localization capability of the Cas9 protein; (4) the original plasmid has no eukaryotic cell screening mark, is not beneficial to screening and enrichment of positive transformed cells, and is sequentially inserted with P2A-EGFP-T2A-PURO coding genes at the downstream of Cas9 genes, so that the carrier fluorescence and eukaryotic cell resistance screening capability are endowed; (5) the insertion of the WPRE element and the 3' ltr sequence element enhances the protein translation capacity of the Cas9 gene.

The schematic structure of plasmid pKG-U6gRNA is shown in FIG. 3.SEQ ID NO:3, nucleotides 2280 to 2539 constitute the hU6 promoter and nucleotides 2558 to 2637 are used for transcription to form the gRNA backbone. When in use, a DNA molecule (target sequence binding region for transcription to form gRNA) of about 20bp is inserted into plasmid pKG-U6gRNA to form a recombinant plasmid, the schematic diagram is shown in FIG. 4, and the recombinant plasmid is transcribed in cells to obtain gRNA.

Example 2 comparison of the effects of plasmid pX330 and plasmid pKG-GE3

Two gRNA targets located at the MSTN gene were selected:

target of MSTN-gRNA 1: 5'-GCTGATTGTTGCTGGTCCCG-3';

target of MSTN-gRNA 2: 5'-TTTCCAGGCGAAGTTTACTG-3'.

Two gRNA targets located at the FNDC5 gene were selected:

target for FNDC5-gRNA 1: 5'-TGTACTCAGTGTCCTCCTCC-3';

target for FNDC5-gRNA 2: 5'-GCTCTTCAAGACGCCTCGCG-3'.

Primers used to amplify fragments containing the target were:

MSTN-F896：5’-TCTCTCAGACAGTGCAGGCATTA-3’；

MSTN-R1351：5’-CGTTTCCGTCGTAGCGTGATAAT-3’。

FNDC5-F209：5’-CAGTTCTCACTTGATGGCCTTGG-3’；

FNDC5-R718：5’-AGGGGTCTGGGGAGGAATGG-3’。

1. preparation of recombinant plasmids

Plasmid pKG-U6gRNA was taken and digested with restriction enzyme BbsI, and the vector backbone (about 3kb linear fragment) was recovered.

MSTN-1S and MSTN-1A were synthesized separately, and then mixed and annealed to obtain double-stranded DNA molecules having cohesive ends. The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (MSTN-1).

MSTN-2S and MSTN-2A were synthesized separately, and then mixed and annealed to obtain double-stranded DNA molecules having cohesive ends. The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (MSTN-2).

FNDC5-1S and FNDC5-1A were synthesized separately, and then mixed and annealed to obtain double-stranded DNA molecules having cohesive ends. The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (FNDC 5-1).

FNDC5-2S and FNDC5-2A were synthesized separately, and then mixed and annealed to obtain double-stranded DNA molecules having cohesive ends. The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (FNDC 5-2).

MSTN-1S：5’-caccGCTGATTGTTGCTGGTCCCG-3’；

MSTN-1A：5’-aaacCGGGACCAGCAACAATCAGC-3’。

MSTN-2S：5’-caccgTTTCCAGGCGAAGTTTACTG-3’；

MSTN-2A：5’-aaacCAGTAAACTTCGCCTGGAAAc-3’。

FNDC5-1S：5’-caccgTGTACTCAGTGTCCTCCTCC-3’；

FNDC5-1A：5’-aaacGGAGGAGGACACTGAGTACAc-3’。

FNDC5-2S：5’-caccGCTCTTCAAGACGCCTCGCG-3’；

FNDC5-2A：5’-aaacCGCGAGGCGTCTTGAAGAGC-3’。

2. Comparison of the effects of plasmid pX330 and plasmid pKG-GE3

1. Co-transfection

MSTN-B group: plasmid pKG-U6gRNA (MSTN-1) and plasmid pKG-U6gRNA (MSTN-2) were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.46. Mu.g of plasmid pKG-U6gRNA (MSTN-1): 0.46. Mu.g of plasmid pKG-U6gRNA (MSTN-2).

MSTN-330 group: plasmid pKG-U6gRNA (MSTN-1), plasmid pKG-U6gRNA (MSTN-2) and plasmid pX330 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.46. Mu.g of plasmid pKG-U6gRNA (MSTN-1): 0.46. Mu.g of plasmid pKG-U6gRNA (MSTN-2): 1.08 μg of plasmid pX330.

MSTN-KG group: the plasmid pKG-U6gRNA (MSTN-1), plasmid pKG-U6gRNA (MSTN-2) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.46. Mu.g of plasmid pKG-U6gRNA (MSTN-1): plasmid 0.46. Mu.g pKG-U6gRNA (MSTN-2): 1.08 μg of plasmid pKG-GE3.

FNDC5-B group: the plasmid pKG-U6gRNA (FNDC 5-1) and the plasmid pKG-U6gRNA (FNDC 5-2) were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.46. Mu.g of plasmid pKG-U6gRNA (FNDC 5-1): 0.46. Mu.g of plasmid pKG-U6gRNA (FNDC 5-2).

FNDC5-330 group: the plasmid pKG-U6gRNA (FNDC 5-1), plasmid pKG-U6gRNA (FNDC 5-2) and plasmid pX330 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.46. Mu.g of plasmid pKG-U6gRNA (FNDC 5-1): 0.46. Mu.g of plasmid pKG-U6gRNA (FNDC 5-2): 1.08 μg of plasmid pX330.

FNDC5-KG group: the plasmid pKG-U6gRNA (FNDC 5-1), plasmid pKG-U6gRNA (FNDC 5-2) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.46. Mu.g of plasmid pKG-U6gRNA (FNDC 5-1): 0.46. Mu.g of plasmid pKG-U6gRNA (FNDC 5-2): 1.08 μg of plasmid pKG-GE3.

Co-transfection was performed by electric shock transfection using a mammalian nuclear transfection kit (Neon kit, thermofiser) and a Neon TM transfection system electrotransfection apparatus (parameters set to 1450V, 10ms, 3 pulses).

2. After the step 1 is completed, the culture is carried out for 16 to 18 hours by adopting the complete culture solution, and then the culture is carried out by replacing the new complete culture solution. The total incubation time was 48 hours.

3. After step 2 was completed, cells were digested with trypsin and collected, genomic DNA was extracted, PCR amplification was performed using a primer pair (three sets of MSTN) composed of MSTN-F896 and MSTN-R1351, or PCR amplification was performed using a primer pair (three sets of FNDC 5) composed of FNDC5-F209 and FNDC5-R718, followed by electrophoresis.

The results of three groups of MSTNs are shown in FIG. 5.

The results of three groups of FNDC5 are shown in FIG. 6.

The deletion mutation efficiency of the MSTN-330 group gene is 27.6%, and the deletion mutation efficiency of the MSTN-KG group gene is 86.5%. The deletion mutation efficiency of the gene of the FNDC5-330 group is 18.6%, and the deletion mutation efficiency of the gene of the FNDC5-KG group is 81.7%. The results show that the use of plasmid pKG-GE3 results in a significant increase in gene editing efficiency compared to the use of plasmid pX 330.

EXAMPLE 3 screening of targets for IL2RG Gene knockout

1. IL2RG gene knockout preset target point and adjacent genome sequence conservation analysis

Porcine IL2RG gene information: encoding an interleukin 2receptor subunit gamma; located on the X chromosome; geneID is 397156,Sus scrofa. The protein coded by the pig IL2RG gene is shown as SEQ ID NO: 4. In the genome DNA, the pig IL2RG gene has 9 exons, wherein the 4 th exon and 500bp sequences of the 4 th exon and the upstream and downstream thereof are shown in SEQ ID NO: shown at 5.

The PCR amplification was performed using 8 pig genomic DNAs as templates, respectively, and primer pairs consisting of primers IL2RG-GT-F4543/IL2RG-GT-R5180, followed by electrophoresis, as shown in FIG. 7. And (3) recovering PCR amplification products, sequencing, and comparing the sequencing results with IL2RG gene sequences in a public database for analysis. Based on the results of the alignment, primers for detecting the mutation (the primers themselves avoid possible mutation sites) were designed. The primers designed for mutation detection were: IL2RG-nF33/IL2RG-nR460.

IL2RG-GT-F4543：5’-ATATAGCACAGGGGAGGGAGGAA-3’；

IL2RG-GT-R5180：5’-AGGGTGCGAAGGGTCAGATTC-3’；

IL2RG-nF33：5’-CCCAGGCTTCCCACTATATTCTC-3’；

IL2RG-nR460：5’-CCATTGGATCCCTCACTTCTTCT-3’。

2. Screening target

Several targets were initially screened by screening NGG (avoiding possible mutation sites), from which 9 targets were further screened by pre-experiments.

The 9 targets were as follows:

sgRNA _IL2RG-g1 target point: 5'-CCTGTAGTTTTAGCGTCTGT-3';

sgRNA _IL2RG-g2 target point: 5'-CAACAAATGTTTGGTAGAGG-3';

sgRNA _IL2RG-g3 target point: 5'-GATGATAAAGTCCAGGAGTG-3';

sgRNA _IL2RG-g4 target point: 5'-CTGGACTTTATCATCATTAG-3';

sgRNA _IL2RG-g5 target point: 5' -TTGTCCAGCTCCAGGACCCA-3’；

sgRNA _IL2RG-g6 Target point: 5'-GGCCACTATCTATTCTCTGA-3';

sgRNA _IL2RG-g7 target point: 5'-TCCCTTCAGAGAATAGATAG-3';

sgRNA _IL2RG-g8 target point: 5'-AACATTTGTTGTCCAGCTCC-3';

sgRNA _IL2RG-g9 target point: 5'-TGTCCAGCTCCAGGACCCAC-3'.

3. Preparation of recombinant plasmids

IL2RG-g1S and IL2RG-g1A were synthesized separately, and then mixed and annealed to give double-stranded DNA molecules having cohesive ends (FIG. 8A). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to obtain plasmid pKG-U6gRNA (IL 2RG-g 1). Plasmid pKG-U6gRNA (IL 2RG-g 1) expresses the sequence of SEQ ID NO: 6. SgRNA as shown in FIG. 6 _IL2RG-g1 。

SEQ ID NO：6：

CCUGUAGUUUUAGCGUCUGUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaa aaguggcaccgagucggugcuuuu

IL2RG-g2S and IL2RG-g2A were synthesized separately, and then mixed and annealed to give double-stranded DNA molecules having cohesive ends (FIG. 8B). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to obtain plasmid pKG-U6gRNA (IL 2RG-g 2). Plasmid pKG-U6gRNA (IL 2RG-g 2) expresses the sequence of SEQ ID NO: 7. SgRNA _IL2RG-g2 。

SEQ ID NO：7：

CAACAAAUGUUUGGUAGAGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaa aaguggcaccgagucggugcuuuu

IL2RG-g3S and IL2RG-g3A were synthesized separately, and then mixed and annealed to give double-stranded DNA molecules having cohesive ends (FIG. 8C). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to obtain plasmid pKG-U6gRNA (IL 2RG-g 3). Plasmid pKG-U6gRNA (IL 2RG-g 3) expresses the sequence of SEQ ID NO:8, sgRNA shown in FIG. 8 _IL2RG-g3 。

SEQ ID NO：8：

GAUGAUAAAGUCCAGGAGUGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaa aaguggcaccgagucggugcuuuu

IL2RG-g4S and IL2RG-g4A were synthesized separately, and then mixed and annealed to give double-stranded DNA molecules having cohesive ends (FIG. 8D). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to obtain plasmid pKG-U6gRNA (IL 2RG-g 4). Plasmid pKG-U6gRNA (IL 2RG-g 4) expresses the sequence of SEQ ID NO: 9. SgRNA as shown in FIG. 9 _IL2RG-g4 。

SEQ ID NO：9：

CUGGACUUUAUCAUCAUUAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaa aaguggcaccgagucggugcuuuu

IL2RG-g5S and IL2RG-g5A were synthesized separately, and then mixed and annealed to give double-stranded DNA molecules having cohesive ends (FIG. 8E). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to obtain plasmid pKG-U6gRNA (IL 2RG-g 5). Plasmid pKG-U6gRNA (IL 2RG-g 5) expresses the sequence of SEQ ID NO:10, sgRNA shown in FIG. 10 _IL2RG-g5 。

SEQ ID NO：10：

UUGUCCAGCUCCAGGACCCAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaa aaguggcaccgagucggugcuuuu

IL2RG-g6S and IL2RG-g6A were synthesized separately, and then mixed and annealed to give double-stranded DNA molecules having cohesive ends (FIG. 8F). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to obtain plasmid pKG-U6gRNA (IL 2RG-g 6). Plasmid pKG-U6gRNA (IL 2RG-g 6) expresses the sequence of SEQ ID NO:11, sgRNA shown in FIG. 11 _IL2RG-g6 。

SEQ ID NO：11：

GGCCACUAUCUAUUCUCUGAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaa aaguggcaccgagucggugcuuuu

IL2RG-G7S and IL2RG-G7A were synthesized separately, and then mixed and annealed to give double-stranded DNA molecules having cohesive ends (FIG. 8G). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to obtain plasmid pKG-U6gRNA (IL 2RG-g 7). Plasmid pKG-U6gRNA (IL 2RG-g 7) expresses the sequence of SEQ ID NO:12, sgRNA shown in FIG. 12 _IL2RG-g7 。

SEQ ID NO：12：

UCCCUUCAGAGAAUAGAUAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaa aaguggcaccgagucggugcuuuu

IL2RG-g8S and IL2RG-g8A were synthesized separately, and then mixed and annealed to give double-stranded DNA molecules having cohesive ends (FIG. 8H). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to obtain plasmid pKG-U6gRNA (IL 2RG-g 8). Plasmid pKG-U6gRNA (IL 2RG-g 8) expresses the sequence of SEQ ID NO:13, sgRNA shown in FIG. 13 _IL2RG-g8 。

SEQ ID NO：13：

AACAUUUGUUGUCCAGCUCCguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaa aaguggcaccgagucggugcuuuu

IL2RG-g9S and IL2RG-g9A were synthesized separately, and then mixed and annealed to give double-stranded DNA molecules having cohesive ends (FIG. 8I). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to obtain plasmid pKG-U6gRNA (IL 2RG-g 9). Plasmid pKG-U6gRNA (IL 2RG-g 9) expresses the sequence of SEQ ID NO:14, sgRNA shown in FIG. 14 _IL2RG-g9 。

SEQ ID NO：14：

UGUCCAGCUCCAGGACCCACguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaa aaguggcaccgagucggugcuuuu

sgRNA-IL2RG-1S：5’-caccgCCTGTAGTTTTAGCGTCTGT-3’；

sgRNA-IL2RG-1A：5’-aaacACAGACGCTAAAACTACAGGc-3’。

sgRNA-IL2RG-2S：5’-caccgCAACAAATGTTTGGTAGAGG-3’；

sgRNA-IL2RG-2A：5’-aaacCCTCTACCAAACATTTGTTGc-3’。

sgRNA-IL2RG-3S：5’-caccGATGATAAAGTCCAGGAGTG-3’；

sgRNA-IL2RG-3A：5’-aaacCACTCCTGGACTTTATCATC-3’。

sgRNA-IL2RG-4S：5’-caccgCTGGACTTTATCATCATTAG-3’；

sgRNA-IL2RG-4A：5’-aaacCTAATGATGATAAAGTCCAGc-3’。

sgRNA-IL2RG-5S：5’-caccgTTGTCCAGCTCCAGGACCCA-3’；

sgRNA-IL2RG-5A：5’-aaacTGGGTCCTGGAGCTGGACAAc-3’。

sgRNA-IL2RG-6S：5’-caccgGGCCACTATCTATTCTCTGA-3’；

sgRNA-IL2RG-6A：5’-aaacTCAGAGAATAGATAGTGGCCc-3’。

sgRNA-IL2RG-7S：5’-caccgTCCCTTCAGAGAATAGATAG-3’；

sgRNA-IL2RG-7A：5’-aaacCTATCTATTCTCTGAAGGGAc-3’。

sgRNA-IL2RG-8S：5’-caccgAACATTTGTTGTCCAGCTCC-3’；

sgRNA-IL2RG-8A：5’-aaacGGAGCTGGACAACAAATGTTc-3’。

sgRNA-IL2RG-9S：5’-caccgTGTCCAGCTCCAGGACCCAC-3’；

sgRNA-IL2RG-9A：5’-aaacGTGGGTCCTGGAGCTGGACAc-3’。

The sgRNA-IL2RG-1S, sgRNA-IL2RG-1A, sgRNA-IL2RG-2S, sgRNA-IL2RG-2A, sgRNA-IL2RG-3S, sgRNA-IL2RG-3A, sgRNA-IL2RG-4S, sgRNA-IL2RG-4A, sgRNA-IL2RG-5S, sgRNA-IL2RG-5A, sgRNA-IL2RG-6S, sgRNA-IL2RG-6A, sgRNA-IL2RG-7S, sgRNA-IL2RG-7A, sgRNA-IL2RG-8S, sgRNA-IL2RG-8A, sgRNA-IL2RG-9S, sgRNA-IL2RG-9A are single-stranded DNA molecules.

4. Editing efficiency comparison of different targets

1. Co-transfection

A first group: the plasmid pKG-U6gRNA (IL 2RG-g 1) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (IL 2RG-g 1): 1.238. Mu.g of plasmid pKG-GE3.

Second group: the plasmid pKG-U6gRNA (IL 2RG-g 2) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (IL 2RG-g 2): 1.238. Mu.g of plasmid pKG-GE3.

Third group: the plasmid pKG-U6gRNA (IL 2RG-g 3) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (IL 2RG-g 3): 1.238. Mu.g of plasmid pKG-GE3.

Fourth group: the plasmid pKG-U6gRNA (IL 2RG-g 4) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (IL 2RG-g 4): 1.238. Mu.g of plasmid pKG-GE3.

Fifth group: the plasmid pKG-U6gRNA (IL 2RG-g 5) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (IL 2RG-g 5): 1.238. Mu.g of plasmid pKG-GE3.

Sixth group: the plasmid pKG-U6gRNA (IL 2RG-g 6) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (IL 2RG-g 6): 1.238. Mu.g of plasmid pKG-GE3.

Seventh group: the plasmid pKG-U6gRNA (IL 2RG-g 7) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (IL 2RG-g 7): 1.238. Mu.g of plasmid pKG-GE3.

Eighth group: the plasmid pKG-U6gRNA (IL 2RG-g 8) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (IL 2RG-g 8): 1.238. Mu.g of plasmid pKG-GE3.

Ninth group: the plasmid pKG-U6gRNA (IL 2RG-g 9) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (IL 2RG-g 9): 1.238. Mu.g of plasmid pKG-GE3.

Tenth group: pig primary fibroblasts were not subjected to any transfection procedure.

3. After step 2 was completed, cells were digested with trypsin and collected, genomic DNA was extracted, PCR amplification was performed using a primer set consisting of IL2RG-nF33 and IL2RG-nR460, followed by electrophoresis and sequencing, and the results are shown in FIG. 9.

The efficiency of editing of different targets was obtained by analyzing the sequencing peak plots using the synthetic ICE tool. The editing efficiency of the first to tenth sets of different targets was 1%, 0%, 3%, 5%, 0%, 46%, 65%, 18%, 34% and 0% in this order. The results showed that the seventh set of editing was most efficient, sgRNA _IL2RG-g7 Is an optimal target point.

Example 4 screening of target sites for ADA Gene knockout

1. ADA gene knockout preset target spot and adjacent genome sequence conservation analysis

Pig ADA gene information: encoding adenosine deaminase; chromosome 17;

GeneID is 100625920,Sus scrofa. The protein coded by the pig ADA gene is shown as SEQ ID NO: 15. In the genome DNA, the pig ADA gene has 12 exons, wherein the 4 th exon and 500bp sequences respectively at the upstream and downstream thereof are shown in SEQ ID NO: shown at 16.

The genomic DNA of 8 pigs was used as a template, and PCR amplification was performed using a primer pair consisting of primers ADA-GT-F259/ADA-GT-R1005, followed by electrophoresis, see FIG. 10. And (3) recovering PCR amplified products, sequencing, and comparing the sequencing results with ADA gene sequences in a public database for analysis. Based on the results of the alignment, primers for detecting the mutation (the primers themselves avoid possible mutation sites) were designed. The primers designed for mutation detection were: ADA-nnF229/ADA-nnR456.

ADA-GT-F259：5’-GTTAAGGATCTGGTGTTGCGGTG-3’；

ADA-GT-R1005：5’-GTTCACACTCCTAGACTCCAGCC-3’。

ADA-nnF229：5’-GAGGCCGTCAAAAGGATTGC-3’；

ADA-nnR456：5’-CAAAGTCTCTCTTGGGTCAGGG-3’。

2. Screening target

Several targets were initially screened by screening NGG (avoiding possible mutation sites), from which 8 targets were further screened by pre-experiments.

The 8 targets were as follows:

sgRNA _ADA-g1 target point: 5'-AAGGATTGCCTACGAGTTTG-3';

sgRNA _ADA-g2 target point: 5'-TTGGAGTTGGCCAGCAGGTG-3';

sgRNA _ADA-g3 target point: 5'-TTTCATCTCCACAAACTCGT-3';

sgRNA _ADA-g4 target point: 5'-TCAGCCTGGTTCCAGGGGAT-3';

sgRNA _ADA-g6 target point: 5'-CCTGCTGGCCAACTCCAAAG-3';

sgRNA _ADA-g7 target point: 5'-GGAGGGCGTGGTGTACGTGG-3';

sgRNA _ADA-g8 target point: 5'-CAAGGAGGGCGTGGTGTACG-3';

sgRNA _ADA-g9 target point: 5'-TGTGGAGATGAAAGCCAAGG-3'.

3. Preparation of recombinant plasmids

ADA-g1S and ADA-g1A were synthesized separately, and then mixed and annealed to obtain double-stranded DNA molecules having cohesive ends (FIG. 11A). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to obtain plasmid pKG-U6gRNA (ADA-g 1). Plasmid pKG-U6gRNA (ADA-g 1)) expresses the sequence of SEQ ID NO:17, sgRNA as shown in FIG. 17 _ADA-g1 。

SEQ ID NO：17：

AAGGAUUGCCUACGAGUUUGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaa aaguggcaccgagucggugcuuuu

ADA-g2S and ADA-g2A were synthesized separately, and then mixed and annealed to obtain double-stranded DNA molecules having cohesive ends (FIG. 11B). The double-stranded DNA molecule having a cohesive end and the vector backbone were ligated to obtain plasmid pKG-U6gRNA (ADA-g 2). Plasmid pKG-U6gRNA (ADA-g 2) expresses the sequence of SEQ ID NO:18, sgRNA shown in FIG. 18 _ADA-g2 。

SEQ ID NO：18：

UUGGAGUUGGCCAGCAGGUGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaa aaguggcaccgagucggugcuuuu

ADA-g3S and ADA-g3A were synthesized separately, and then mixed and annealed to obtain double-stranded DNA molecules having cohesive ends (FIG. 11C). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to obtain plasmid pKG-U6gRNA (ADA-g 3). Plasmid pKG-U6gRNA (ADA-g 3) expresses the sequence of SEQ ID NO:19, sgRNA shown in FIG. 19 _ADA-g3 。

SEQ ID NO：19：

UUUCAUCUCCACAAACUCGUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaa aaguggcaccgagucggugcuuuu

ADA-g4S and ADA-g4A were synthesized separately, and then mixed and annealed to obtain double-stranded DNA molecules having cohesive ends (FIG. 11D). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to obtain plasmid pKG-U6gRNA (ADA-g 4). Plasmid pKG-U6gRNA (ADA-g 4) expresses the sequence of SEQ ID NO:20, sgRNA shown in FIG. 20 _ADA-g4 。

SEQ ID NO：20：

UCAGCCUGGUUCCAGGGGAUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaa aaguggcaccgagucggugcuuuu

ADA-g6S and ADA-g6A were synthesized separately, and then mixed and annealed to give double-stranded DNA molecules having cohesive ends (FIG. 11E). The double-stranded DNA molecule having a cohesive end and the vector backbone were ligated to obtain plasmid pKG-U6gRNA (ADA-g 6). Plasmid pKG-U6gRNA (ADA-g 6) expresses the sequence of SEQ ID NO:21, sgRNA as indicated in FIG. 21 _ADA-g6 。

SEQ ID NO：21：

CCUGCUGGCCAACUCCAAAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaa aaguggcaccgagucggugcuuuu

ADA-g7S and ADA-g7A were synthesized separately, and then mixed and annealed to obtain double-stranded DNA molecules having cohesive ends (FIG. 11F). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to obtain plasmid pKG-U6gRNA (ADA-g 7). Plasmid pKG-U6gRNA (ADA-g 7) expresses the sequence of SEQ ID NO:22, sgrnas as shown _ADA-g7 。

SEQ ID NO：22：

GGAGGGCGUGGUGUACGUGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaa aaguggcaccgagucggugcuuuu

ADA-G8S and ADA-G8A were synthesized separately, and then mixed and annealed to obtain double-stranded DNA molecules having cohesive ends (FIG. 11G). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to obtain plasmid pKG-U6gRNA (ADA-g 8). Plasmid pKG-U6gRNA (ADA-g 8) expresses the sequence of SEQ ID NO:23, sgRNA shown in FIG. 23 _ADA-g8 。

SEQ ID NO：23：

CAAGGAGGGCGUGGUGUACGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaa aaguggcaccgagucggugcuuuu

ADA-g9S and ADA-g9A were synthesized separately, and then mixed and annealed to obtain double-stranded DNA molecules having cohesive ends (FIG. 11H). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to obtain plasmid pKG-U6gRNA (ADA-g 9). Plasmid pKG-U6gRNA (ADA-g 9) expresses the sequence of SEQ ID NO:24, sgRNA shown in FIG. 24 _ADA-g9 。

SEQ ID NO：24：

UGUGGAGAUGAAAGCCAAGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaa aaguggcaccgagucggugcuuuu

sgRNA-ADA-1S：5’-caccgAAGGATTGCCTACGAGTTTG-3’；

sgRNA-ADA-1A：5’-aaacCAAACTCGTAGGCAATCCTTc-3’。

sgRNA-ADA-2S：5’-caccgTTGGAGTTGGCCAGCAGGTG-3’；

sgRNA-ADA-2A：5’-aaacCACCTGCTGGCCAACTCCAAc-3’。

sgRNA-ADA-3S：5’-caccgTTTCATCTCCACAAACTCGT-3’；

sgRNA-ADA-3A：5’-aaacACGAGTTTGTGGAGATGAAAc-3’。

sgRNA-ADA-4S：5’-caccgTCAGCCTGGTTCCAGGGGAT-3’；

sgRNA-ADA-4A：5’-aaacATCCCCTGGAACCAGGCTGAc-3’。

sgRNA-ADA-6S：5’-caccgCCTGCTGGCCAACTCCAAAG-3’；

sgRNA-ADA-6A：5’-aaacCTTTGGAGTTGGCCAGCAGGc-3’。

sgRNA-ADA-7S：5’-caccGGAGGGCGTGGTGTACGTGG-3’；

sgRNA-ADA-7A：5’-aaacCCACGTACACCACGCCCTCC-3’。

sgRNA-ADA-8S：5’-caccgCAAGGAGGGCGTGGTGTACG-3’；

sgRNA-ADA-8A：5’-aaacCGTACACCACGCCCTCCTTGc-3’。

sgRNA-ADA-9S：5’-caccgTGTGGAGATGAAAGCCAAGG-3’；

sgRNA-ADA-9A：5’-aaacCCTTGGCTTTCATCTCCACAc-3’。

The sgRNA-ADA-1S, sgRNA-ADA-1A, sgRNA-ADA-2S, sgRNA-ADA-2A, sgRNA-ADA-3S, sgRNA-ADA-3A, sgRNA-ADA-4S, sgRNA-ADA-4A, sgRNA-ADA-6S, sgRNA-ADA-6A, sgRNA-ADA-7S, sgRNA-ADA-7A, sgRNA-ADA-8S, sgRNA-ADA-8A, sgRNA-ADA-9S, sgRNA-ADA-9A are all single-stranded DNA molecules.

4. Editing efficiency comparison of different targets

1. Co-transfection

A first group: plasmid pKG-U6gRNA (ADA-g 1) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g plasmid pKG-U6gRNA (ADA-g 1): 1.238. Mu.g of plasmid pKG-GE3.

Second group: plasmid pKG-U6gRNA (ADA-g 2) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g plasmid pKG-U6gRNA (ADA-g 2): 1.238. Mu.g of plasmid pKG-GE3.

Third group: plasmid pKG-U6gRNA (ADA-g 3) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g plasmid pKG-U6gRNA (ADA-g 3): 1.238. Mu.g of plasmid pKG-GE3.

Fourth group: plasmid pKG-U6gRNA (ADA-g 4) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g plasmid pKG-U6gRNA (ADA-g 4): 1.238. Mu.g of plasmid pKG-GE3.

Fifth group: plasmid pKG-U6gRNA (ADA-g 6) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g plasmid pKG-U6gRNA (ADA-g 6): 1.238. Mu.g of plasmid pKG-GE3.

Sixth group: plasmid pKG-U6gRNA (ADA-g 7) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g plasmid pKG-U6gRNA (ADA-g 7): 1.238. Mu.g of plasmid pKG-GE3.

Seventh group: plasmid pKG-U6gRNA (ADA-g 8) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g plasmid pKG-U6gRNA (ADA-g 8): 1.238. Mu.g of plasmid pKG-GE3.

Eighth group: plasmid pKG-U6gRNA (ADA-g 9) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g plasmid pKG-U6gRNA (ADA-g 9): 1.238. Mu.g of plasmid pKG-GE3.

Ninth group: pig primary fibroblasts were not subjected to any transfection procedure.

3. After completion of step 2, cells were digested with trypsin and collected, genomic DNA was extracted, PCR amplification was performed using a primer set consisting of ADA-nnF229 and ADA-nnR456, followed by electrophoresis and sequencing, and the results are shown in FIG. 12.

The efficiency of editing of different targets was obtained by analyzing the sequencing peak plots using the synthetic ICE tool. The editing efficiency of the first to ninth sets of different targets was 19%, 17%, 9%, 0%, 2%, 35%, 29%, 20% and 0% in this order. The results showed that the sixth set of editing was most efficient, sgRNA _ADA-g7 Is an optimal target point.

EXAMPLE 5 preparation of IL2RG and ADA Gene-edited monoclonal cells

1. Co-transfection

The plasmid pKG-U6gRNA (IL 2RG-g 7), plasmid pKG-U6gRNA (ADA-g 7) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.44. Mu.g plasmid pKG-U6gRNA (IL 2RG-g 7): 0.44. Mu.g plasmid pKG-U6gRNA (ADA-g 7): 2.12. Mu.g of plasmid pKG-GE3.

3. After completion of step 2, the cells were digested with trypsin and collected, then washed with complete medium, then resuspended with complete medium, and then each individual monoclonal was individually picked and transferred to 96-well plates (1 cell per well, 200. Mu.l of complete medium per well) and cultured for 2 weeks (new complete medium was changed every 2-3 days).

4. After completion of step 3, cells were digested with trypsin and collected (about 2/3 of the resulting cells per well were inoculated into 6-well plates filled with complete culture medium, and the remaining 1/3 were collected in 1.5mL centrifuge tubes).

5. Taking the 6-hole plate in the step 4, culturing until the cells grow to 50% plumpness, digesting and collecting the cells by trypsin, and freezing the cells by using cell freezing solution (90% complete culture medium+10% DMSO, volume ratio).

6. Taking the centrifuge tube in the step 4, taking cells, extracting genome DNA, performing PCR amplification (respectively adopting a primer pair consisting of IL2RG-nF33 and IL2RG-nR460 and a primer pair consisting of ADA-nnF229 and ADA-nnR 456), and then performing electrophoresis. Porcine primary fibroblasts were used as wild-type controls.

7. After step 6 is completed, the PCR amplification product is recovered and sequenced.

The sequencing result of the primary fibroblast of the pig is only one, and the genotype of the primary fibroblast is homozygous wild type. If there are two kinds of sequencing results of a certain monoclonal cell, one kind is consistent with the sequencing result of the primary fibroblast of the pig, the other kind is mutated (mutation comprises deletion, insertion or substitution of one or more nucleotides) compared with the sequencing result of the primary fibroblast of the pig, the genotype of the monoclonal cell is heterozygous; if the sequencing result of a certain monoclonal cell is two, compared with the sequencing result of a primary fibroblast of a pig, the mutation (the mutation comprises deletion, insertion or replacement of one or more nucleotides) is generated, and the genotype of the monoclonal cell is a double-allele different mutant type; if the sequencing result of a monoclonal cell is one and a mutation (mutation includes deletion, insertion or substitution of one or more nucleotides) is generated compared with the sequencing result of a swine primary fibroblast, the genotype of the monoclonal cell is the same mutant type of the double allele; if the sequencing result of a certain monoclonal cell is one and is consistent with the sequencing result of a primary fibroblast of a pig, the genotype of the monoclonal cell is homozygous wild type.

The results of editing IL2RG gene are shown in Table 1. The genotypes of the monoclonal cells numbered 7, 26, 30 and 35 are the different mutants of the bi-allele. The genotypes of the monoclonal cells numbered 14, 21, 39 are heterozygous. The monoclonal cells numbered 15, 16, 19, 20, 28, 31, 49 all showed complex sets of peaks, and therefore, an effective sequence could not be obtained, and the genotype and specific form could not be determined, but it could be judged that gene editing occurred. The ratio of IL2RG gene editing monoclonal cells obtained was 14/53. Exemplary IL2RG sequencing peaks are shown in FIG. 13.

TABLE 1

The results of editing ADA genes are shown in Table 2. The genotypes of the monoclonal cells numbered 19, 26 are identical mutants of the bi-allele. The genotypes of the monoclonal cells numbered 35, 49 are the different mutants of the bi-allele. The genotype of the monoclonal cell numbered 5 is heterozygous. The monoclonal cells numbered 7, 9, 12, 15, 20, 21, 28, 30, 31, 45 all showed complex sets of peaks, and therefore, an effective sequence could not be obtained, and the genotype and specific form could not be determined, but it could be judged that gene editing occurred. The ratio of the obtained ADA gene editing monoclonal cells was 15/53. Exemplary peak sequencing patterns for ADA are shown in FIG. 14.

TABLE 2

8. After step 7 is completed, monoclonal cells from which IL2RG and ADA genes are knocked out simultaneously are selected.

By analysis, the monoclonal cells numbered 7, 15, 19, 20, 21, 26, 28, 30, 31, 35, 49 were monoclonal cells in which the IL2RG and ADA genes were knocked out simultaneously.

The present application is described in detail above. It will be apparent to those skilled in the art that the present application can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the application and without undue experimentation. While the application has been described with respect to specific embodiments, it will be appreciated that the application may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the application following, in general, the principles of the application and including such departures from the present disclosure as come within known or customary practice within the art to which the application pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.

SEQUENCE LISTING

<110> Nanjing Kidney Gene engineering Co., ltd

<120> recombinant cell with IL2RG gene and ADA gene being knocked out in combination and application thereof in preparation of immunodeficiency pig model

<130> GNCYX202101

<160> 24

<170> PatentIn version 3.5

<210> 1

<211> 8484

<212> DNA

<213> Artificial sequence

<400> 1

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaaataag 300

gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttg ttttagagct 360

agaaatagca agttaaaata aggctagtcc gtttttagcg cgtgcgccaa ttctgcagac 420

aaatggctct agaggtaccc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 480

ccaacgaccc ccgcccattg acgtcaatag taacgccaat agggactttc cattgacgtc 540

aatgggtgga gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc 600

caagtacgcc ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tgtgcccagt 660

acatgacctt atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta 720

ccatggtcga ggtgagcccc acgttctgct tcactctccc catctccccc ccctccccac 780

ccccaatttt gtatttattt attttttaat tattttgtgc agcgatgggg gcgggggggg 840

ggggggggcg gggcgagggg cggggcgggg cgaggcggag aggtgcggcg gcagccaatc 900

agagcggcgc gctccgaaag tttcctttta tggcgaggcg gcggcggcgg cggccctata 960

aaaagcgaag cgcgcggcgg gcgggagtcg ctgcgcgctg ccttcgcccc gtgccccgct 1020

ccgccgccgc ctcgcgccgc ccgccccggc tctgactgac cgcgttactc ccacaggtga 1080

gcgggcggga cggcccttct cctccgggct gtaattagct gagcaagagg taagggttta 1140

agggatggtt ggttggtggg gtattaatgt ttaattacct ggagcacctg cctgaaatca 1200

ctttttttca ggttggaccg gtgccaccat ggactataag gaccacgacg gagactacaa 1260

ggatcatgat attgattaca aagacgatga cgataagatg gccccaaaga agaagcggaa 1320

ggtcggtatc cacggagtcc cagcagccga caagaagtac agcatcggcc tggacatcgg 1380

caccaactct gtgggctggg ccgtgatcac cgacgagtac aaggtgccca gcaagaaatt 1440

caaggtgctg ggcaacaccg accggcacag catcaagaag aacctgatcg gagccctgct 1500

gttcgacagc ggcgaaacag ccgaggccac ccggctgaag agaaccgcca gaagaagata 1560

caccagacgg aagaaccgga tctgctatct gcaagagatc ttcagcaacg agatggccaa 1620

ggtggacgac agcttcttcc acagactgga agagtccttc ctggtggaag aggataagaa 1680

gcacgagcgg caccccatct tcggcaacat cgtggacgag gtggcctacc acgagaagta 1740

ccccaccatc taccacctga gaaagaaact ggtggacagc accgacaagg ccgacctgcg 1800

gctgatctat ctggccctgg cccacatgat caagttccgg ggccacttcc tgatcgaggg 1860

cgacctgaac cccgacaaca gcgacgtgga caagctgttc atccagctgg tgcagaccta 1920

caaccagctg ttcgaggaaa accccatcaa cgccagcggc gtggacgcca aggccatcct 1980

gtctgccaga ctgagcaaga gcagacggct ggaaaatctg atcgcccagc tgcccggcga 2040

gaagaagaat ggcctgttcg gaaacctgat tgccctgagc ctgggcctga cccccaactt 2100

caagagcaac ttcgacctgg ccgaggatgc caaactgcag ctgagcaagg acacctacga 2160

cgacgacctg gacaacctgc tggcccagat cggcgaccag tacgccgacc tgtttctggc 2220

cgccaagaac ctgtccgacg ccatcctgct gagcgacatc ctgagagtga acaccgagat 2280

caccaaggcc cccctgagcg cctctatgat caagagatac gacgagcacc accaggacct 2340

gaccctgctg aaagctctcg tgcggcagca gctgcctgag aagtacaaag agattttctt 2400

cgaccagagc aagaacggct acgccggcta cattgacggc ggagccagcc aggaagagtt 2460

ctacaagttc atcaagccca tcctggaaaa gatggacggc accgaggaac tgctcgtgaa 2520

gctgaacaga gaggacctgc tgcggaagca gcggaccttc gacaacggca gcatccccca 2580

ccagatccac ctgggagagc tgcacgccat tctgcggcgg caggaagatt tttacccatt 2640

cctgaaggac aaccgggaaa agatcgagaa gatcctgacc ttccgcatcc cctactacgt 2700

gggccctctg gccaggggaa acagcagatt cgcctggatg accagaaaga gcgaggaaac 2760

catcaccccc tggaacttcg aggaagtggt ggacaagggc gcttccgccc agagcttcat 2820

cgagcggatg accaacttcg ataagaacct gcccaacgag aaggtgctgc ccaagcacag 2880

cctgctgtac gagtacttca ccgtgtataa cgagctgacc aaagtgaaat acgtgaccga 2940

gggaatgaga aagcccgcct tcctgagcgg cgagcagaaa aaggccatcg tggacctgct 3000

gttcaagacc aaccggaaag tgaccgtgaa gcagctgaaa gaggactact tcaagaaaat 3060

cgagtgcttc gactccgtgg aaatctccgg cgtggaagat cggttcaacg cctccctggg 3120

cacataccac gatctgctga aaattatcaa ggacaaggac ttcctggaca atgaggaaaa 3180

cgaggacatt ctggaagata tcgtgctgac cctgacactg tttgaggaca gagagatgat 3240

cgaggaacgg ctgaaaacct atgcccacct gttcgacgac aaagtgatga agcagctgaa 3300

gcggcggaga tacaccggct ggggcaggct gagccggaag ctgatcaacg gcatccggga 3360

caagcagtcc ggcaagacaa tcctggattt cctgaagtcc gacggcttcg ccaacagaaa 3420

cttcatgcag ctgatccacg acgacagcct gacctttaaa gaggacatcc agaaagccca 3480

ggtgtccggc cagggcgata gcctgcacga gcacattgcc aatctggccg gcagccccgc 3540

cattaagaag ggcatcctgc agacagtgaa ggtggtggac gagctcgtga aagtgatggg 3600

ccggcacaag cccgagaaca tcgtgatcga aatggccaga gagaaccaga ccacccagaa 3660

gggacagaag aacagccgcg agagaatgaa gcggatcgaa gagggcatca aagagctggg 3720

cagccagatc ctgaaagaac accccgtgga aaacacccag ctgcagaacg agaagctgta 3780

cctgtactac ctgcagaatg ggcgggatat gtacgtggac caggaactgg acatcaaccg 3840

gctgtccgac tacgatgtgg accatatcgt gcctcagagc tttctgaagg acgactccat 3900

cgacaacaag gtgctgacca gaagcgacaa gaaccggggc aagagcgaca acgtgccctc 3960

cgaagaggtc gtgaagaaga tgaagaacta ctggcggcag ctgctgaacg ccaagctgat 4020

tacccagaga aagttcgaca atctgaccaa ggccgagaga ggcggcctga gcgaactgga 4080

taaggccggc ttcatcaaga gacagctggt ggaaacccgg cagatcacaa agcacgtggc 4140

acagatcctg gactcccgga tgaacactaa gtacgacgag aatgacaagc tgatccggga 4200

agtgaaagtg atcaccctga agtccaagct ggtgtccgat ttccggaagg atttccagtt 4260

ttacaaagtg cgcgagatca acaactacca ccacgcccac gacgcctacc tgaacgccgt 4320

cgtgggaacc gccctgatca aaaagtaccc taagctggaa agcgagttcg tgtacggcga 4380

ctacaaggtg tacgacgtgc ggaagatgat cgccaagagc gagcaggaaa tcggcaaggc 4440

taccgccaag tacttcttct acagcaacat catgaacttt ttcaagaccg agattaccct 4500

ggccaacggc gagatccgga agcggcctct gatcgagaca aacggcgaaa ccggggagat 4560

cgtgtgggat aagggccggg attttgccac cgtgcggaaa gtgctgagca tgccccaagt 4620

gaatatcgtg aaaaagaccg aggtgcagac aggcggcttc agcaaagagt ctatcctgcc 4680

caagaggaac agcgataagc tgatcgccag aaagaaggac tgggacccta agaagtacgg 4740

cggcttcgac agccccaccg tggcctattc tgtgctggtg gtggccaaag tggaaaaggg 4800

caagtccaag aaactgaaga gtgtgaaaga gctgctgggg atcaccatca tggaaagaag 4860

cagcttcgag aagaatccca tcgactttct ggaagccaag ggctacaaag aagtgaaaaa 4920

ggacctgatc atcaagctgc ctaagtactc cctgttcgag ctggaaaacg gccggaagag 4980

aatgctggcc tctgccggcg aactgcagaa gggaaacgaa ctggccctgc cctccaaata 5040

tgtgaacttc ctgtacctgg ccagccacta tgagaagctg aagggctccc ccgaggataa 5100

tgagcagaaa cagctgtttg tggaacagca caagcactac ctggacgaga tcatcgagca 5160

gatcagcgag ttctccaaga gagtgatcct ggccgacgct aatctggaca aagtgctgtc 5220

cgcctacaac aagcaccggg ataagcccat cagagagcag gccgagaata tcatccacct 5280

gtttaccctg accaatctgg gagcccctgc cgccttcaag tactttgaca ccaccatcga 5340

ccggaagagg tacaccagca ccaaagaggt gctggacgcc accctgatcc accagagcat 5400

caccggcctg tacgagacac ggatcgacct gtctcagctg ggaggcgaca aaaggccggc 5460

ggccacgaaa aaggccggcc aggcaaaaaa gaaaaagtaa gaattcctag agctcgctga 5520

tcagcctcga ctgtgccttc tagttgccag ccatctgttg tttgcccctc ccccgtgcct 5580

tccttgaccc tggaaggtgc cactcccact gtcctttcct aataaaatga ggaaattgca 5640

tcgcattgtc tgagtaggtg tcattctatt ctggggggtg gggtggggca ggacagcaag 5700

ggggaggatt gggaagagaa tagcaggcat gctggggagc ggccgcagga acccctagtg 5760

atggagttgg ccactccctc tctgcgcgct cgctcgctca ctgaggccgg gcgaccaaag 5820

gtcgcccgac gcccgggctt tgcccgggcg gcctcagtga gcgagcgagc gcgcagctgc 5880

ctgcaggggc gcctgatgcg gtattttctc cttacgcatc tgtgcggtat ttcacaccgc 5940

atacgtcaaa gcaaccatag tacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg 6000

tggttacgcg cagcgtgacc gctacacttg ccagcgcctt agcgcccgct cctttcgctt 6060

tcttcccttc ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc 6120

tccctttagg gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgatttgg 6180

gtgatggttc acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg 6240

agtccacgtt ctttaatagt ggactcttgt tccaaactgg aacaacactc aactctatct 6300

cgggctattc ttttgattta taagggattt tgccgatttc ggtctattgg ttaaaaaatg 6360

agctgattta acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaattttat 6420

ggtgcactct cagtacaatc tgctctgatg ccgcatagtt aagccagccc cgacacccgc 6480

caacacccgc tgacgcgccc tgacgggctt gtctgctccc ggcatccgct tacagacaag 6540

ctgtgaccgt ctccgggagc tgcatgtgtc agaggttttc accgtcatca ccgaaacgcg 6600

cgagacgaaa gggcctcgtg atacgcctat ttttataggt taatgtcatg ataataatgg 6660

tttcttagac gtcaggtggc acttttcggg gaaatgtgcg cggaacccct atttgtttat 6720

ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga taaatgcttc 6780

aataatattg aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc cttattccct 6840

tttttgcggc attttgcctt cctgtttttg ctcacccaga aacgctggtg aaagtaaaag 6900

atgctgaaga tcagttgggt gcacgagtgg gttacatcga actggatctc aacagcggta 6960

agatccttga gagttttcgc cccgaagaac gttttccaat gatgagcact tttaaagttc 7020

tgctatgtgg cgcggtatta tcccgtattg acgccgggca agagcaactc ggtcgccgca 7080

tacactattc tcagaatgac ttggttgagt actcaccagt cacagaaaag catcttacgg 7140

atggcatgac agtaagagaa ttatgcagtg ctgccataac catgagtgat aacactgcgg 7200

ccaacttact tctgacaacg atcggaggac cgaaggagct aaccgctttt ttgcacaaca 7260

tgggggatca tgtaactcgc cttgatcgtt gggaaccgga gctgaatgaa gccataccaa 7320

acgacgagcg tgacaccacg atgcctgtag caatggcaac aacgttgcgc aaactattaa 7380

ctggcgaact acttactcta gcttcccggc aacaattaat agactggatg gaggcggata 7440

aagttgcagg accacttctg cgctcggccc ttccggctgg ctggtttatt gctgataaat 7500

ctggagccgg tgagcgtgga agccgcggta tcattgcagc actggggcca gatggtaagc 7560

cctcccgtat cgtagttatc tacacgacgg ggagtcaggc aactatggat gaacgaaata 7620

gacagatcgc tgagataggt gcctcactga ttaagcattg gtaactgtca gaccaagttt 7680

actcatatat actttagatt gatttaaaac ttcattttta atttaaaagg atctaggtga 7740

agatcctttt tgataatctc atgaccaaaa tcccttaacg tgagttttcg ttccactgag 7800

cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa 7860

tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg ccggatcaag 7920

agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata ccaaatactg 7980

ttcttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca ccgcctacat 8040

acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag tcgtgtctta 8100

ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc tgaacggggg 8160

gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga tacctacagc 8220

gtgagctatg agaaagcgcc acgcttcccg aagggagaaa ggcggacagg tatccggtaa 8280

gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac gcctggtatc 8340

tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg tgatgctcgt 8400

caggggggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct 8460

tttgctggcc ttttgctcac atgt 8484

<210> 2

<211> 10476

<212> DNA

<213> Artificial sequence

<400> 2

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaaataag 300

gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttc tagcgcgtgc 360

gccaattctg cagacaaatg gctctagagg tacccgttac ataacttacg gtaaatggcc 420

cgcctggctg accgcccaac gacccccgcc cattgacgtc aatagtaacg ccaataggga 480

ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc 540

aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 600

ggcattgtgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 660

tagtcatcgc tattaccatg ggggcagagc gcacatcgcc cacagtcccc gagaagttgg 720

ggggaggggt cggcaattga tccggtgcct agagaaggtg gcgcggggta aactgggaaa 780

gtgatgtcgt gtactggctc cgcctttttc ccgagggtgg gggagaaccg tatataagtg 840

cagtagtcgc cgtgaacgtt ctttttcgca acgggtttgc cgccagaaca caggttggac 900

cggtgccacc atggactata aggaccacga cggagactac aaggatcatg atattgatta 960

caaagacgat gacgataaga tggcccccaa aaagaaacga aaggtgggtg ggtccccaaa 1020

gaagaagcgg aaggtcggta tccacggagt cccagcagcc gacaagaagt acagcatcgg 1080

cctggacatc ggcaccaact ctgtgggctg ggccgtgatc accgacgagt acaaggtgcc 1140

cagcaagaaa ttcaaggtgc tgggcaacac cgaccggcac agcatcaaga agaacctgat 1200

cggagccctg ctgttcgaca gcggcgaaac agccgaggcc acccggctga agagaaccgc 1260

cagaagaaga tacaccagac ggaagaaccg gatctgctat ctgcaagaga tcttcagcaa 1320

cgagatggcc aaggtggacg acagcttctt ccacagactg gaagagtcct tcctggtgga 1380

agaggataag aagcacgagc ggcaccccat cttcggcaac atcgtggacg aggtggccta 1440

ccacgagaag taccccacca tctaccacct gagaaagaaa ctggtggaca gcaccgacaa 1500

ggccgacctg cggctgatct atctggccct ggcccacatg atcaagttcc ggggccactt 1560

cctgatcgag ggcgacctga accccgacaa cagcgacgtg gacaagctgt tcatccagct 1620

ggtgcagacc tacaaccagc tgttcgagga aaaccccatc aacgccagcg gcgtggacgc 1680

caaggccatc ctgtctgcca gactgagcaa gagcagacgg ctggaaaatc tgatcgccca 1740

gctgcccggc gagaagaaga atggcctgtt cggaaacctg attgccctga gcctgggcct 1800

gacccccaac ttcaagagca acttcgacct ggccgaggat gccaaactgc agctgagcaa 1860

ggacacctac gacgacgacc tggacaacct gctggcccag atcggcgacc agtacgccga 1920

cctgtttctg gccgccaaga acctgtccga cgccatcctg ctgagcgaca tcctgagagt 1980

gaacaccgag atcaccaagg cccccctgag cgcctctatg atcaagagat acgacgagca 2040

ccaccaggac ctgaccctgc tgaaagctct cgtgcggcag cagctgcctg agaagtacaa 2100

agagattttc ttcgaccaga gcaagaacgg ctacgccggc tacattgacg gcggagccag 2160

ccaggaagag ttctacaagt tcatcaagcc catcctggaa aagatggacg gcaccgagga 2220

actgctcgtg aagctgaaca gagaggacct gctgcggaag cagcggacct tcgacaacgg 2280

cagcatcccc caccagatcc acctgggaga gctgcacgcc attctgcggc ggcaggaaga 2340

tttttaccca ttcctgaagg acaaccggga aaagatcgag aagatcctga ccttccgcat 2400

cccctactac gtgggccctc tggccagggg aaacagcaga ttcgcctgga tgaccagaaa 2460

gagcgaggaa accatcaccc cctggaactt cgaggaagtg gtggacaagg gcgcttccgc 2520

ccagagcttc atcgagcgga tgaccaactt cgataagaac ctgcccaacg agaaggtgct 2580

gcccaagcac agcctgctgt acgagtactt caccgtgtat aacgagctga ccaaagtgaa 2640

atacgtgacc gagggaatga gaaagcccgc cttcctgagc ggcgagcaga aaaaggccat 2700

cgtggacctg ctgttcaaga ccaaccggaa agtgaccgtg aagcagctga aagaggacta 2760

cttcaagaaa atcgagtgct tcgactccgt ggaaatctcc ggcgtggaag atcggttcaa 2820

cgcctccctg ggcacatacc acgatctgct gaaaattatc aaggacaagg acttcctgga 2880

caatgaggaa aacgaggaca ttctggaaga tatcgtgctg accctgacac tgtttgagga 2940

cagagagatg atcgaggaac ggctgaaaac ctatgcccac ctgttcgacg acaaagtgat 3000

gaagcagctg aagcggcgga gatacaccgg ctggggcagg ctgagccgga agctgatcaa 3060

cggcatccgg gacaagcagt ccggcaagac aatcctggat ttcctgaagt ccgacggctt 3120

cgccaacaga aacttcatgc agctgatcca cgacgacagc ctgaccttta aagaggacat 3180

ccagaaagcc caggtgtccg gccagggcga tagcctgcac gagcacattg ccaatctggc 3240

cggcagcccc gccattaaga agggcatcct gcagacagtg aaggtggtgg acgagctcgt 3300

gaaagtgatg ggccggcaca agcccgagaa catcgtgatc gaaatggcca gagagaacca 3360

gaccacccag aagggacaga agaacagccg cgagagaatg aagcggatcg aagagggcat 3420

caaagagctg ggcagccaga tcctgaaaga acaccccgtg gaaaacaccc agctgcagaa 3480

cgagaagctg tacctgtact acctgcagaa tgggcgggat atgtacgtgg accaggaact 3540

ggacatcaac cggctgtccg actacgatgt ggaccatatc gtgcctcaga gctttctgaa 3600

ggacgactcc atcgacaaca aggtgctgac cagaagcgac aagaaccggg gcaagagcga 3660

caacgtgccc tccgaagagg tcgtgaagaa gatgaagaac tactggcggc agctgctgaa 3720

cgccaagctg attacccaga gaaagttcga caatctgacc aaggccgaga gaggcggcct 3780

gagcgaactg gataaggccg gcttcatcaa gagacagctg gtggaaaccc ggcagatcac 3840

aaagcacgtg gcacagatcc tggactcccg gatgaacact aagtacgacg agaatgacaa 3900

gctgatccgg gaagtgaaag tgatcaccct gaagtccaag ctggtgtccg atttccggaa 3960

ggatttccag ttttacaaag tgcgcgagat caacaactac caccacgccc acgacgccta 4020

cctgaacgcc gtcgtgggaa ccgccctgat caaaaagtac cctaagctgg aaagcgagtt 4080

cgtgtacggc gactacaagg tgtacgacgt gcggaagatg atcgccaaga gcgagcagga 4140

aatcggcaag gctaccgcca agtacttctt ctacagcaac atcatgaact ttttcaagac 4200

cgagattacc ctggccaacg gcgagatccg gaagcggcct ctgatcgaga caaacggcga 4260

aaccggggag atcgtgtggg ataagggccg ggattttgcc accgtgcgga aagtgctgag 4320

catgccccaa gtgaatatcg tgaaaaagac cgaggtgcag acaggcggct tcagcaaaga 4380

gtctatcctg cccaagagga acagcgataa gctgatcgcc agaaagaagg actgggaccc 4440

taagaagtac ggcggcttcg acagccccac cgtggcctat tctgtgctgg tggtggccaa 4500

agtggaaaag ggcaagtcca agaaactgaa gagtgtgaaa gagctgctgg ggatcaccat 4560

catggaaaga agcagcttcg agaagaatcc catcgacttt ctggaagcca agggctacaa 4620

agaagtgaaa aaggacctga tcatcaagct gcctaagtac tccctgttcg agctggaaaa 4680

cggccggaag agaatgctgg cctctgccgg cgaactgcag aagggaaacg aactggccct 4740

gccctccaaa tatgtgaact tcctgtacct ggccagccac tatgagaagc tgaagggctc 4800

ccccgaggat aatgagcaga aacagctgtt tgtggaacag cacaagcact acctggacga 4860

gatcatcgag cagatcagcg agttctccaa gagagtgatc ctggccgacg ctaatctgga 4920

caaagtgctg tccgcctaca acaagcaccg ggataagccc atcagagagc aggccgagaa 4980

tatcatccac ctgtttaccc tgaccaatct gggagcccct gccgccttca agtactttga 5040

caccaccatc gaccggaaga ggtacaccag caccaaagag gtgctggacg ccaccctgat 5100

ccaccagagc atcaccggcc tgtacgagac acggatcgac ctgtctcagc tgggaggcga 5160

caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa aagaaaaagg gcggctccaa 5220

gcggcctgcc gcgacgaaga aagcgggaca ggccaagaaa aagaaaggat ccggcgcaac 5280

aaacttctct ctgctgaaac aagccggaga tgtcgaagag aatcctggac cggtgagcaa 5340

gggcgaggag ctgttcaccg gggtggtgcc catcctggtc gagctggacg gcgacgtaaa 5400

cggccacaag ttcagcgtgt ccggcgaggg cgagggcgat gccacctacg gcaagctgac 5460

cctgaagttc atctgcacca ccggcaagct gcccgtgccc tggcccaccc tcgtgaccac 5520

cctgacctac ggcgtgcagt gcttcagccg ctaccccgac cacatgaagc agcacgactt 5580

cttcaagtcc gccatgcccg aaggctacgt ccaggagcgc accatcttct tcaaggacga 5640

cggcaactac aagacccgcg ccgaggtgaa gttcgagggc gacaccctgg tgaaccgcat 5700

cgagctgaag ggcatcgact tcaaggagga cggcaacatc ctggggcaca agctggagta 5760

caactacaac agccacaacg tctatatcat ggccgacaag cagaagaacg gcatcaaggt 5820

gaacttcaag atccgccaca acatcgagga cggcagcgtg cagctcgccg accactacca 5880

gcagaacacc cccatcggcg acggccccgt gctgctgccc gacaaccact acctgagcac 5940

ccagtccgcc ctgagcaaag accccaacga gaagcgcgat cacatggtcc tgctggagtt 6000

cgtgaccgcc gccgggatca ctctcggcat ggacgagctg tacaagggct ccggcgaggg 6060

caggggaagt cttctaacat gcggggacgt ggaggaaaat cccggcccaa ccgagtacaa 6120

gcccacggtg cgcctcgcca cccgcgacga cgtccccagg gccgtacgca ccctcgccgc 6180

cgcgttcgcc gactaccccg ccacgcgcca caccgtcgat ccggaccgcc acatcgagcg 6240

ggtcaccgag ctgcaagaac tcttcctcac gcgcgtcggg ctcgacatcg gcaaggtgtg 6300

ggtcgcggac gacggcgccg cggtggcggt ctggaccacg ccggagagcg tcgaagcggg 6360

ggcggtgttc gccgagatcg gcccgcgcat ggccgagttg agcggttccc ggctggccgc 6420

gcagcaacag atggaaggcc tcctggcgcc gcaccggccc aaggagcccg cgtggttcct 6480

ggccaccgtc ggagtctcgc ccgaccacca gggcaagggt ctgggcagcg ccgtcgtgct 6540

ccccggagtg gaggcggccg agcgcgccgg ggtgcccgcc ttcctggaga cctccgcgcc 6600

ccgcaacctc cccttctacg agcggctcgg cttcaccgtc accgccgacg tcgaggtgcc 6660

cgaaggaccg cgcacctggt gcatgacccg caagcccggt gcctgaacgc gttaagtcga 6720

caatcaacct ctggattaca aaatttgtga aagattgact ggtattctta actatgttgc 6780

tccttttacg ctatgtggat acgctgcttt aatgcctttg tatcatgcta ttgcttcccg 6840

tatggctttc attttctcct ccttgtataa atcctggttg ctgtctcttt atgaggagtt 6900

gtggcccgtt gtcaggcaac gtggcgtggt gtgcactgtg tttgctgacg caacccccac 6960

tggttggggc attgccacca cctgtcagct cctttccggg actttcgctt tccccctccc 7020

tattgccacg gcggaactca tcgccgcctg ccttgcccgc tgctggacag gggctcggct 7080

gttgggcact gacaattccg tggtgttgtc ggggaaatca tcgtcctttc cttggctgct 7140

cgcctgtgtt gccacctgga ttctgcgcgg gacgtccttc tgctacgtcc cttcggccct 7200

caatccagcg gaccttcctt cccgcggcct gctgccggct ctgcggcctc ttccgcgtct 7260

tcgccttcgc cctcagacga gtcggatctc cctttgggcc gcctccccgc gtcgacttta 7320

agaccaatga cttacaaggc agctgtagat cttagccact ttttaaaaga aaagggggga 7380

ctggaagggc taattcactc ccaacgaaga caagatctgc tttttgcttg tactgggtct 7440

ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt 7500

aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac 7560

tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagggcc 7620

cgtttaaacc cgctgatcag cctcgactgt gccttctagt tgccagccat ctgttgtttg 7680

cccctccccc gtgccttcct tgaccctgga aggtgccact cccactgtcc tttcctaata 7740

aaatgaggaa attgcatcgc attgtctgag taggtgtcat tctattctgg ggggtggggt 7800

ggggcaggac agcaaggggg aggattggga agacaatagc aggcatgctg gggatgcggt 7860

gggctctatg gcctgcaggg gcgcctgatg cggtattttc tccttacgca tctgtgcggt 7920

atttcacacc gcatacgtca aagcaaccat agtacgcgcc ctgtagcggc gcattaagcg 7980

cggcgggtgt ggtggttacg cgcagcgtga ccgctacact tgccagcgcc ttagcgcccg 8040

ctcctttcgc tttcttccct tcctttctcg ccacgttcgc cggctttccc cgtcaagctc 8100

taaatcgggg gctcccttta gggttccgat ttagtgcttt acggcacctc gaccccaaaa 8160

aacttgattt gggtgatggt tcacgtagtg ggccatcgcc ctgatagacg gtttttcgcc 8220

ctttgacgtt ggagtccacg ttctttaata gtggactctt gttccaaact ggaacaacac 8280

tcaactctat ctcgggctat tcttttgatt tataagggat tttgccgatt tcggtctatt 8340

ggttaaaaaa tgagctgatt taacaaaaat ttaacgcgaa ttttaacaaa atattaacgt 8400

ttacaatttt atggtgcact ctcagtacaa tctgctctga tgccgcatag ttaagccagc 8460

cccgacaccc gccaacaccc gctgacgcgc cctgacgggc ttgtctgctc ccggcatccg 8520

cttacagaca agctgtgacc gtctccggga gctgcatgtg tcagaggttt tcaccgtcat 8580

caccgaaacg cgcgagacga aagggcctcg tgatacgcct atttttatag gttaatgtca 8640

tgataataat ggtttcttag acgtcaggtg gcacttttcg gggaaatgtg cgcggaaccc 8700

ctatttgttt atttttctaa atacattcaa atatgtatcc gctcatgaga caataaccct 8760

gataaatgct tcaataatat tgaaaaagga agagtatgag tattcaacat ttccgtgtcg 8820

cccttattcc cttttttgcg gcattttgcc ttcctgtttt tgctcaccca gaaacgctgg 8880

tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt gggttacatc gaactggatc 8940

tcaacagcgg taagatcctt gagagttttc gccccgaaga acgttttcca atgatgagca 9000

cttttaaagt tctgctatgt ggcgcggtat tatcccgtat tgacgccggg caagagcaac 9060

tcggtcgccg catacactat tctcagaatg acttggttga gtactcacca gtcacagaaa 9120

agcatcttac ggatggcatg acagtaagag aattatgcag tgctgccata accatgagtg 9180

ataacactgc ggccaactta cttctgacaa cgatcggagg accgaaggag ctaaccgctt 9240

ttttgcacaa catgggggat catgtaactc gccttgatcg ttgggaaccg gagctgaatg 9300

aagccatacc aaacgacgag cgtgacacca cgatgcctgt agcaatggca acaacgttgc 9360

gcaaactatt aactggcgaa ctacttactc tagcttcccg gcaacaatta atagactgga 9420

tggaggcgga taaagttgca ggaccacttc tgcgctcggc ccttccggct ggctggttta 9480

ttgctgataa atctggagcc ggtgagcgtg gaagccgcgg tatcattgca gcactggggc 9540

cagatggtaa gccctcccgt atcgtagtta tctacacgac ggggagtcag gcaactatgg 9600

atgaacgaaa tagacagatc gctgagatag gtgcctcact gattaagcat tggtaactgt 9660

cagaccaagt ttactcatat atactttaga ttgatttaaa acttcatttt taatttaaaa 9720

ggatctaggt gaagatcctt tttgataatc tcatgaccaa aatcccttaa cgtgagtttt 9780

cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga gatccttttt 9840

ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt 9900

tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc agagcgcaga 9960

taccaaatac tgttcttcta gtgtagccgt agttaggcca ccacttcaag aactctgtag 10020

caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc agtggcgata 10080

agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg cagcggtcgg 10140

gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac accgaactga 10200

gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca 10260

ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt ccagggggaa 10320

acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt 10380

tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg gcctttttac 10440

ggttcctggc cttttgctgg ccttttgctc acatgt 10476

<210> 3

<211> 3120

<212> DNA

<213> Artificial sequence

<400> 3

gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 60

cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt 120

tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 180

aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt 240

ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg 300

ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga 360

tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc 420

tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac 480

actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg 540

gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca 600

acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg 660

gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg 720

acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg 780

gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag 840

ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg 900

gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct 960

cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac 1020

agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact 1080

catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga 1140

tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 1200

cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct 1260

gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 1320

taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgttc 1380

ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 1440

tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 1500

ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 1560

cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 1620

agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 1680

gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 1740

atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 1800

gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1860

gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 1920

ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 1980

cagtgagcga ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 2040

cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca 2100

acgcaattaa tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc 2160

cggctcgtat gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg 2220

accatgatta cgccaagctt gcatgcaggc ctctgcagtc gacgggcccg ggatccgatg 2280

ataaacatgt gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc 2340

tgttagagag ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac 2400

gtgacgtaga aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat 2460

ggactatcat atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt 2520

gtggaaagga cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag 2580

ttaaaataag gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttc 2640

tagcgcgtgc gccaattctg cagacaaatg gctctagagg tacccataga tctagatgca 2700

ttcgcgaggt accgagctcg aattcactgg ccgtcgtttt acaacgtcgt gactgggaaa 2760

accctggcgt tacccaactt aatcgccttg cagcacatcc ccctttcgcc agctggcgta 2820

atagcgaaga ggcccgcacc gatcgccctt cccaacagtt gcgcagcctg aatggcgaat 2880

ggcgcctgat gcggtatttt ctccttacgc atctgtgcgg tatttcacac cgcatatggt 2940

gcactctcag tacaatctgc tctgatgccg catagttaag ccagccccga cacccgccaa 3000

cacccgctga cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg 3060

tgaccgtctc cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga 3120

<210> 4

<211> 368

<212> PRT

<213> Sus scrofa

<400> 4

Met Leu Lys Pro Pro Leu Pro Val Lys Ser Leu Leu Phe Leu Gln Leu

1 5 10 15

Pro Leu Leu Gly Val Gly Leu Asn Pro Lys Val Leu Thr His Ser Gly

20 25 30

Asn Glu Asp Ile Thr Ala Asp Phe Leu Leu Leu Ser Thr Pro Pro Gly

35 40 45

Thr Leu Asn Val Ser Thr Leu Pro Leu Pro Lys Val Gln Cys Phe Val

50 55 60

Phe Asn Val Glu Tyr Met Asn Cys Thr Trp Asn Ser Ser Ser Glu Leu

65 70 75 80

Gln Pro Thr Asn Leu Thr Leu His Tyr Trp Tyr Lys Thr Ser Asn Asp

85 90 95

Asp Lys Val Gln Glu Cys Gly His Tyr Leu Phe Ser Glu Gly Ile Thr

100 105 110

Ser Gly Cys Trp Phe Gly Lys Glu Glu Ile Arg Leu Tyr Gln Thr Phe

115 120 125

Val Val Gln Leu Gln Asp Pro Arg Glu Pro Arg Arg Gln Asp Pro Gln

130 135 140

Thr Leu Lys Leu Gln Asp Leu Val Ile Pro Trp Ala Pro Ala Asn Leu

145 150 155 160

Thr Leu Arg Thr Leu Ser Glu Ser Gln Leu Glu Leu Asn Trp Ser Asn

165 170 175

Arg Tyr Leu Asp His Cys Leu Glu His Leu Val Gln Tyr Arg Ser Asp

180 185 190

Arg Asp Arg Ser Trp Thr Glu Gln Ser Val Asp His Arg Gln Ser Phe

195 200 205

Ser Leu Pro Ser Val Asp Ala Gln Lys Leu Tyr Thr Phe Arg Val Arg

210 215 220

Ser Arg Tyr Asn Pro Leu Cys Gly Ser Ala Gln Arg Trp Ser Asp Trp

225 230 235 240

Ser His Pro Ile His Trp Gly Asn Thr Ser Lys Glu Asn Pro Leu Leu

245 250 255

Phe Ala Leu Glu Ala Val Leu Ile Pro Leu Gly Ser Met Gly Leu Ile

260 265 270

Val Gly Leu Met Cys Val Tyr Cys Trp Leu Glu Arg Thr Met Pro Arg

275 280 285

Ile Pro Thr Leu Lys Asn Leu Glu Asp Leu Val Thr Glu Tyr His Gly

290 295 300

Asn Phe Ser Ala Trp Ser Gly Val Ser Lys Gly Leu Ala Glu Ser Leu

305 310 315 320

Gln Pro Asp Tyr Ser Glu Arg Leu Cys His Val Ser Glu Ile Ser Pro

325 330 335

Lys Gly Gly Ala Leu Gly Glu Gly Pro Gly Gly Ser Pro Cys Ser Gln

340 345 350

His Ser Pro Tyr Trp Ala Pro Pro Cys Tyr Thr Leu Lys Pro Glu Thr

355 360 365

<210> 5

<211> 1185

<212> DNA

<213> Sus scrofa

<400> 5

aaattttaga gtactggggg gagggcaagg ggaagggttc cctgcctagt gctgcttctt 60

cttctgacca tcatgtcttc cctttgcctc ccccacttca ttttctcccc gtcctagatt 120

tcctcctgct ctctacaccc cctgggactc tcaacgtttc cactctaccc ctcccaaagg 180

ttcagtgttt tgtgttcaat gttgagtaca tgaattgcac ttggaacagc agctctgagc 240

tccagcctac caacctaact ctgcactact ggtatgagaa gggaagaggg gatatagcac 300

aggggaggga ggaagaggcg ctgggctaga tgtgagagat tgtgtgagga ccaagaaaga 360

ggttagccag catcccaggc ttcccactat attctcgtgg ggtaagtcat aagtcagttc 420

gtaggagctg aggctggact gtggaatctg tggtattcac atttacctca ctgttattct 480

tccttgaaat ccttctctag gtacaagacc tctaatgatg ataaagtcca ggagtgtggc 540

cactatctat tctctgaagg gatcacttct ggctgttggt ttggaaaaga ggagatccgc 600

ctctaccaaa catttgttgt ccagctccag gacccacggg aacccaggag gcaggaccca 660

cagacgctaa aactacagga tctgggtaat ttggaaatgg ggagggtcaa gggatattgt 720

gggggtattg gtgtatgtag agtggtattc ttgcaccata agggtacttg ggcagaaaag 780

aagaagtgag ggatccaatg gggtcgggag gagggatcag gagcactgcc ctcaggatcc 840

tgacttgtct aggccagggg aatgaccaca cacgcacaca tatctccagt gatcccctgg 900

gcgccggcga atctgaccct tcgcaccctg agtgaatccc agctagaact cagctggagc 960

aaccgatact tggaccactg tttggagcac ctcgtgcaat accggagtga ccgggaccgc 1020

agctggactg tgagtgagtg ggaacagcag ctggggctga gcaagtgggg ataaaggatt 1080

caatcagtcc agtaggaagg cttgattccc agctcctatt ctctgcatcc tggtgcctct 1140

gcccaccttc tcccctcctt ggactccttt ctctgtcgtc accat 1185

<210> 6

<211> 100

<212> RNA

<213> Artificial sequence

<400> 6

ccuguaguuu uagcgucugu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 7

<211> 100

<212> RNA

<213> Artificial sequence

<400> 7

caacaaaugu uugguagagg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 8

<211> 100

<212> RNA

<213> Artificial sequence

<400> 8

gaugauaaag uccaggagug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 9

<211> 100

<212> RNA

<213> Artificial sequence

<400> 9

cuggacuuua ucaucauuag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 10

<211> 100

<212> RNA

<213> Artificial sequence

<400> 10

uuguccagcu ccaggaccca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 11

<211> 100

<212> RNA

<213> Artificial sequence

<400> 11

ggccacuauc uauucucuga guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 12

<211> 100

<212> RNA

<213> Artificial sequence

<400> 12

ucccuucaga gaauagauag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 13

<211> 100

<212> RNA

<213> Artificial sequence

<400> 13

aacauuuguu guccagcucc guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 14

<211> 100

<212> RNA

<213> Artificial sequence

<400> 14

uguccagcuc caggacccac guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 15

<211> 364

<212> PRT

<213> Sus scrofa

<400> 15

Met Thr Gln Thr Pro Ala Phe Asp Lys Pro Lys Val Glu Leu His Val

1 5 10 15

His Leu Asp Gly Ala Ile Lys Pro Glu Thr Ile Leu Tyr Tyr Gly Arg

20 25 30

Lys Arg Gly Ile Ala Leu Pro Ala Asn Thr Pro Glu Glu Leu Gln Asp

35 40 45

Val Ile Gly Met Asp Lys Pro Leu Ser Leu Pro Ala Phe Leu Ala Lys

50 55 60

Phe Asp Tyr Tyr Met Pro Ala Ile Ala Xaa Gly Leu Pro Glu Ala Val

65 70 75 80

Lys Arg Ile Ala Tyr Glu Phe Val Glu Met Lys Ala Lys Glu Gly Val

85 90 95

Val Tyr Val Glu Val Arg Tyr Ser Pro His Leu Leu Ala Asn Ser Lys

100 105 110

Val Glu Pro Ile Pro Trp Asn Gln Ala Glu Gly Asp Leu Thr Pro Asp

115 120 125

Glu Val Val Asp Leu Val Gly Gln Gly Leu Gln Glu Gly Glu Arg Asp

130 135 140

Phe Gly Val Lys Val Arg Ser Ile Leu Cys Cys Met Arg His Gln Pro

145 150 155 160

Thr Trp Ser Pro Glu Val Val Glu Leu Cys Lys Lys Tyr Arg Gln Gln

165 170 175

Thr Val Val Ala Ile Asp Leu Ala Gly Asp Glu Thr Ile Glu Gly Ser

180 185 190

Ser Leu Phe Pro Gly His Val Gln Ala Tyr Glu Glu Ala Val Lys Ser

195 200 205

Gly Val His Arg Thr Val His Ala Gly Glu Val Gly Ser Ala Glu Val

210 215 220

Val Lys Glu Ala Val Asp Thr Leu Lys Thr Glu Arg Leu Gly His Gly

225 230 235 240

Tyr His Thr Leu Glu Asp Glu Ala Leu Tyr Thr Arg Leu Arg Gln Ala

245 250 255

Asn Met His Phe Glu Val Cys Pro Trp Ser Ser Tyr Leu Thr Gly Ala

260 265 270

Trp Lys Pro Gly Thr Glu His Ala Val Ile Arg Phe Lys Asn Asp Gln

275 280 285

Ala Asn Tyr Ser Leu Asn Thr Asp Asp Pro Leu Ile Phe Lys Ser Thr

290 295 300

Leu Asp Thr Asp Tyr Gln Met Thr Lys Arg Asp Met Gly Phe Thr Glu

305 310 315 320

Glu Glu Phe Lys Arg Leu Asn Ile Asn Ala Ala Lys Ser Ser Phe Leu

325 330 335

Pro Asp Asp Glu Lys Thr Glu Leu Leu Asp Leu Leu Tyr Lys Ala Tyr

340 345 350

Gly Met Pro Pro Thr Ser Ser Ala Glu His Arg Pro

355 360

<210> 16

<211> 1143

<212> DNA

<213> Sus scrofa

<400> 16

cgtggagatg gggagactgg ttagagggcg aaggtggtta gaagcacaga ggaagggccg 60

agaactggca tagagatcag aaataaagct cagtggtaat gaacctgact agtatccata 120

aagatgtggg tctgatccct ggcctgctca gtgggttaag gatctggtgt tgcggtgagc 180

tgcggtgtag gtcgcagaca cggcctggat ctggcattgc catgactgtg gtatatgctg 240

gcagctccat tttgacctct ggcctgggaa cttacatatg tcatgagtgt agtcctaaaa 300

acaaacaaaa aaattagagc caatgggact ctctatgctt ctagaatttt cttcagcaga 360

tgccaagagc tcgagactga gtaataagac tgggggccag acatgggttt gatctgccac 420

aggttgtgga cagctttgtt actcctggag ctcccaagag acttgggcag cattgtcccc 480

aacccctctt tccttctcag gggctcccgg aggccgtcaa aaggattgcc tacgagtttg 540

tggagatgaa agccaaggag ggcgtggtgt acgtggaggt gcgctacagc ccgcacctgc 600

tggccaactc caaggtggag ccgatcccct ggaaccaggc tgagtgagca accacccgga 660

gggctgtggc ggggtggccc aacccgcaac cgagcggcgg actctcagga gaccctgacc 720

caagagagac tttgatcttg ctccctgtgc tggtccacgg cctcagaaag atgggcttgg 780

ccgtcctaag ggacaggttc ccatccctca cctgggcttg cgtgttcacc ttgggtgaaa 840

gcgtttggct gcgtggccgt ccctcgtcct agatacaggg ctggagtcta ggagtgtgaa 900

cctggttatc cagtgactcc tagagggcct gtcctaaccc tgtaactgaa gtgggtctgg 960

cctattcctg ccctctctgc ccggacctca gggaggtcta agtggtacca cccgactacc 1020

ttgctccctt ctagccatga ctttgatgct tgtggacatg tgggaatctg acaccatagc 1080

agcgctctcc atcttggggc gggggatggg tttgtgtgcg acaacccccc caacacactg 1140

gga 1143

<210> 17

<211> 100

<212> RNA

<213> Artificial sequence

<400> 17

aaggauugcc uacgaguuug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 18

<211> 100

<212> RNA

<213> Artificial sequence

<400> 18

uuggaguugg ccagcaggug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 19

<211> 100

<212> RNA

<213> Artificial sequence

<400> 19

uuucaucucc acaaacucgu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 20

<211> 100

<212> RNA

<213> Artificial sequence

<400> 20

ucagccuggu uccaggggau guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 21

<211> 100

<212> RNA

<213> Artificial sequence

<400> 21

ccugcuggcc aacuccaaag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 22

<211> 100

<212> RNA

<213> Artificial sequence

<400> 22

ggagggcgug guguacgugg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 23

<211> 100

<212> RNA

<213> Artificial sequence

<400> 23

caaggagggc gugguguacg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 24

<211> 100

<212> RNA

<213> Artificial sequence

<400> 24

uguggagaug aaagccaagg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

Claims

Use of a sgrna combination or a plasmid combination in the preparation of a kit; the kit is used as follows (a) or (b): (a) preparing a recombinant cell; (b) preparing an immunodeficiency animal model;

The sgRNA combination consists of the sgRNA _IL2RG-g7 And sgRNA _ADA-g7 Composition;

the plasmid combination consists of a plasmid pKG-U6gRNA (IL 2RG-g 7) and a plasmid pKG-U6gRNA (ADA-g 7);

the plasmid pKG-U6gRNA (IL 2RG-g 7) was obtained by introducing the sgRNA with the aid of the restriction enzyme BbsI _IL2RG-g7 The target sequence binding region of (a) is inserted into a pKG-U6gRNA vector; the sgRNA _IL2RG-g7 The target sequence binding region of (a) is as set forth in SEQ ID NO:12 from nucleotide 1 to nucleotide 20;

the plasmid pKG-U6gRNA (ADA-g 7) was obtained by introducing the sgRNA with the aid of the restriction enzyme BbsI _ADA-g7 The target sequence binding region of (a) is inserted into a pKG-U6gRNA vector; the sgRNA _ADA-g7 The target sequence binding region of (a) is as set forth in SEQ ID NO:22 from nucleotide 1 to nucleotide 20;

the pKG-U6gRNA vector is shown as SEQ ID NO: 3.
2. Use of the plasmid combination according to claim 1 and the plasmid pKG-GE3 for the co-preparation of a kit; the kit is used as follows (a) or (b): (a) preparing a recombinant cell; (b) preparing an immunodeficiency animal model;

the plasmid pKG-GE3 is shown as SEQ ID NO: 2.
Combination of sgrnas, consisting of sgrnas _IL2RG-g7 And sgRNA _ADA-g7 Composition;

the sgRNA _IL2RG-g7 The target sequence binding region of (a) is as set forth in SEQ ID NO:12 from nucleotide 1 to nucleotide 20;

the sgRNA _ADA-g7 The target sequence binding region of (a) is as set forth in SEQ ID NO:22 from nucleotide 1 to nucleotide 20.
4. Plasmid combination consisting of plasmid pKG-U6gRNA (IL 2RG-g 7) and plasmid pKG-U6gRNA (ADA-g 7);

the plasmid pKG-U6gRNA (IL 2RG-g 7) was obtained by introducing the sgRNA with the aid of the restriction enzyme BbsI _IL2RG-g7 The target sequence binding region of (a) is inserted into a pKG-U6gRNA vector; the sgRNA _IL2RG-g7 The target sequence binding region of (a) is as set forth in SEQ ID NO:12 from nucleotide 1 to nucleotide 20;

the plasmid pKG-U6gRNA (ADA-g 7) was obtained by introducing the sgRNA with the aid of the restriction enzyme BbsI _ADA-g7 The target sequence binding region of (a) is inserted into a pKG-U6gRNA vector; the sgRNA _ADA-g7 The target sequence binding region of (a) is as set forth in SEQ ID NO:22 from nucleotide 1 to nucleotide 20;

the pKG-U6gRNA vector is shown as SEQ ID NO: 3.
5. A kit comprising the sgRNA combination of claim 3 or the plasmid combination of claim 4; the kit is used as follows (a) or (b): (a) preparing a recombinant cell; (b) preparing an immunodeficiency animal model.
6. The kit of claim 5, wherein: the kit also comprises a plasmid pKG-GE3; the plasmid pKG-GE3 is shown as SEQ ID NO: 2.
7. Use of the sgRNA combination of claim 3 or the plasmid combination of claim 4 or the kit of claim 5 or the kit of claim 6, said use being as follows (a) or (b): (a) preparing a recombinant cell; (b) preparing an immunodeficiency animal model.
8. A method of preparing a recombinant cell comprising the steps of: cotransfecting a pig cell with plasmid pKG-U6gRNA (IL 2RG-g 7), plasmid pKG-U6gRNA (ADA-g 7) and plasmid pKG-GE3 to obtain recombinant cells with mutated IL2RG genes and ADA genes;

the plasmid pKG-U6gRNA (IL 2RG-g 7) was obtained by introducing the sgRNA with the aid of the restriction enzyme BbsI _IL2RG-g7 The target sequence binding region of (a) is inserted into a pKG-U6gRNA vector; the sgRNA _IL2RG-g7 The target sequence binding region of (a) is as set forth in SEQ ID NO:12 from nucleotide 1 to nucleotide 20;

the plasmid pKG-U6gRNA (ADA-g 7) was obtained by introducing the sgRNA with the aid of the restriction enzyme BbsI _ADA-g7 The target sequence binding region of (a) is inserted into a pKG-U6gRNA vector; the sgRNA _ADA-g7 The target sequence binding region of (a) is as set forth in SEQ ID NO:22 from nucleotide 1 to nucleotide 20;

the pKG-U6gRNA vector is shown as SEQ ID NO:3 is shown in the figure;

the plasmid pKG-GE3 is shown as SEQ ID NO: 2.
9. The recombinant cell prepared by the method of claim 8.
10. Use of the recombinant cell of claim 9 in the preparation of an immunodeficient animal model.