CN112522258A

CN112522258A - Recombinant cell with IL2RG gene and ADA gene jointly knocked out and application of recombinant cell in preparation of immunodeficient pig model

Info

Publication number: CN112522258A
Application number: CN202010971715.7A
Authority: CN
Inventors: 牛冬; 汪滔; 马翔; 曾为俊; 王磊; 程锐; 赵泽英
Original assignee: Nanjing Qizhen Genetic Engineering Co Ltd
Current assignee: Nanjing Qizhen Genetic Engineering Co Ltd
Priority date: 2020-09-16
Filing date: 2020-09-16
Publication date: 2021-03-19
Anticipated expiration: 2040-09-16
Also published as: CN112522258B

Abstract

The invention discloses a recombinant cell with IL2RG gene and ADA gene knockout combined and application thereof in preparation of an immunodeficiency pig model. The invention provides a recombinant plasmid containing sgRNA_IL2RG‑g7And sgRNA_ADA‑g7The sgRNA combination is applied to the preparation of a kit. The invention also provides a sgRNA combination consisting of sgRNA_IL2RG‑g7And sgRNA_ADA‑g7And (4) forming. The sgRNA_IL2RG‑g7The target sequence binding region of (a) is as shown in SEQ ID NO: 12, nucleotides 1 to 20; the sgRNA_ADA‑g7The target sequence binding region of (a) is as shown in SEQ ID NO: 22 from nucleotide 1 to nucleotide 20. The invention also protects the application of the sgRNA combination in the preparation of recombinant cells and the application in the preparation of immunodeficient animal models. The invention lays a solid foundation for the preparation of the severe immunodeficiency pig model and has great application value for the research and development of severe immunodeficiency medicaments.

Description

Recombinant cell with IL2RG gene and ADA gene jointly knocked out and application of recombinant cell in preparation of immunodeficient pig model

Technical Field

The invention belongs to the technical field of biology, and relates to a recombinant cell with IL2RG gene and ADA gene knockout combined and application thereof in preparation of an immunodeficiency pig model.

Background

Severe Combined Immunodeficiency (SCID) is the most severe phenotype in primary immunodeficiency diseases, and refers to the development, differentiation, proliferation, metabolism or dysfunction of T cells, B cells and NK cells simultaneously caused by genetic, developmental or infection. SCID disease in human infants was first reported by Glanzmann and Riniker in 1950. Worldwide, the neonatal incidence of SCID is about 1/50000, the disease is early in age, clinically significant, and high in mortality. Most SCIDs are due to abnormalities in immune-related genes, and the major genetic patterns of SCIDs include both X-linked recessive inheritance and autosomal recessive inheritance. The disease has certain regionality and consanguinity, and is mostly seen in male patients due to the characteristic of X-linked recessive inheritance. Currently, the therapeutic approaches aimed at SCID mainly include bone marrow or hematopoietic stem cell transplantation and gene therapy. Bone marrow or stem cell transplantation is the best strategy for treating SCID, but finding donors that fit the patient appropriately is rather difficult.

As a large animal, the pig is a meat-source animal which is mainly used by human for a long time, is easy to breed and feed in a large scale, has lower requirements on ethics, animal protection and the like, has the body size and the organ function similar to those of the human, and is an ideal human disease model animal. In addition, when studying the efficacy of bioactive macromolecules or cellular therapies, testing with xenobiotics can produce immune rejection, and thus, effective animal testing is not possible. While the problem of immunological rejection between species can be avoided by using severe combined immunodeficiency model animals. Therefore, the research of developing human SCID pig model for drug (especially bioactive molecule) screening, drug effect detection, disease pathology, gene and cell therapy and the like can provide effective experimental data for further clinical application and provide powerful experimental means for successfully treating human SCID diseases.

SCID caused by X-linked recessive inheritance is the most common type, and the pathogenic mutation is that IL2RG gene which codes IL-2R gamma chain is mutated, thereby leading to IL-2R gamma chain dysfunction. The IL-2R gamma chain is also called a common gamma chain (common gamma chain), and is a signal transduction molecule commonly used when a plurality of cytokine receptors involved in the regulation of the differentiation, development and maturation of immune cells, such as IL-2, IL-4 and IL-7, are bound to their corresponding ligands and then transduce signals into the immune cells. Thus, dysfunction of the common gamma chain results in dysfunction or dysplasia of immune cells, which triggers SCID.

SCID resulting from autosomal recessive inheritance. Defects in the gene ADA associated with purine nucleotidase in the enzyme associated with nucleotide metabolism lead to a large enrichment of the intracellular nucleotide metabolites dATP or dGTP, which have a selective toxic effect on lymphocytes, thus causing dysfunction, damage or death of lymphocytes and further triggering SCID.

Disclosure of Invention

The invention aims to provide a recombinant cell with IL2RG gene and ADA gene knockout combined and application thereof in preparing an immunodeficiency pig model.

The invention provides a recombinant plasmid containing sgRNA_IL2RG-g7And sgRNA_ADA-g7The sgRNA combination is applied to the preparation of a kit.

The invention also provides application of a plasmid combination consisting of the plasmid pKG-T6gRNA (IL2RG-g7) and the plasmid pKG-T6gRNA (ADA-g7) in preparation of a kit. .

The invention also provides the application of the plasmid combination and the plasmid pKG-GE3 in the preparation of a kit. The plasmid combination consists of plasmid pKG-T6gRNA (IL2RG-g7) and plasmid pKG-T6gRNA (ADA-g 7).

The invention also provides a sgRNA combination which is prepared from the sgRNAs_IL2RG-g7And sgRNA_ADA-g7And (4) forming.

The invention also provides a plasmid combination, which consists of the plasmid pKG-T6gRNA (IL2RG-g7) and the plasmid pKG-T6gRNA (ADA-g 7).

The invention also provides a kit comprising the sgRNA combination.

The invention also provides a kit comprising the plasmid combination. The kit also includes plasmid pKG-GE 3.

The invention also protects the application of the sgRNA combination in the preparation of a kit.

The invention also protects the application of the plasmid combination in the preparation of a kit.

The invention also protects the application of the plasmid combination and the plasmid pKG-GE3 in the preparation of a kit.

The use of any one of the above kits is (a) or (b): (a) preparing a recombinant cell; (b) and (4) preparing an immunodeficiency animal model. When the immunodeficiency animal model is prepared, the recombinant cell is prepared firstly, and then the recombinant cell is used as a donor cell to obtain a cloned animal by adopting a somatic cell cloning technology, namely the immunodeficiency animal model. The immunodeficient animal model can also be used for preparing an immunodeficient cell model, namely corresponding cells of the immunodeficient animal model are separated to be used as the immunodeficient cell model. The animal may specifically be a pig. The animal model is a pig model. The cell model is a pig cell model. The recombinant cell is a porcine recombinant cell. The transformed receptor cell of the recombinant cell is a porcine cell. The porcine cells may be porcine fibroblasts. The porcine cells may specifically be porcine primary fibroblasts. The pig can be specifically a Yuanjiang fragrant pig.

The invention also protects the application of any one of the sgRNA combinations or any one of the plasmid combinations or any one of the kits in preparation of recombinant cells. The recombinant cell is a porcine recombinant cell. The transformed receptor cell of the recombinant cell is a porcine cell. The porcine cells may be porcine fibroblasts. The porcine cells may specifically be porcine primary fibroblasts. The pig can be specifically a Yuanjiang fragrant pig.

The invention also protects the application of any one of the sgRNA combinations or any one of the plasmid combinations or any one of the kits in preparation of an immunodeficient animal model. When the method is applied, the recombinant cell is prepared firstly, and then the recombinant cell is used as a donor cell to obtain a cloned animal by adopting a somatic cell cloning technology, namely the immunodeficiency animal model. The immunodeficient animal model can also be used for preparing an immunodeficient cell model, namely corresponding cells of the immunodeficient animal model are separated to be used as the immunodeficient cell model. The animal model is a pig model. The cell model is a pig cell model. The animal may specifically be a pig. The recombinant cell is a porcine recombinant cell. The transformed receptor cell of the recombinant cell is a porcine cell. The porcine cells may be porcine fibroblasts. The porcine cells may specifically be porcine primary fibroblasts. The pig can be specifically a Yuanjiang fragrant pig.

The invention also provides a method for preparing recombinant cells, which comprises the following steps: the plasmid pKG-T6gRNA (IL2RG-g7), the plasmid pKG-T6gRNA (ADA-g7) and the plasmid pKG-GE3 were co-transfected into porcine cells to obtain recombinant cells in which both the IL2RG gene and the ADA gene were mutated. The porcine cells may be porcine fibroblasts. The porcine cells may specifically be porcine primary fibroblasts. The pig can be specifically a Yuanjiang fragrant pig.

The recombinant cell prepared by the method also belongs to the protection scope of the invention.

In particular, the recombinant cell may be any one of: the monoclonal cell strains numbered 7, 15, 19, 20, 21, 26, 28, 30, 31, 35, 49 in tables 1 to 2.

The invention also protects the application of the recombinant cell in the preparation of an immunodeficiency animal model. When preparing the immunodeficiency animal model, the recombinant cells are used as donor cells to obtain cloned animals by adopting a somatic cell cloning technology, namely the immunodeficiency animal model. The immunodeficient animal model can also be used for preparing an immunodeficient cell model, namely corresponding cells of the immunodeficient animal model are separated to be used as the immunodeficient cell model. The animal model is a pig model. The cell model is a pig cell model.

Any of the above recombinant cells is a cell deficient in both the IL2RG gene and the ADA gene.

Any one of the above recombinant cells is a recombinant cell in which both IL2RG gene and ADA gene are mutated. The mutation may be a heterozygous mutation (heterozygous mutant type corresponding to the genotype) or a homozygous mutation (biallelic same mutant type or biallelic different mutant type corresponding to the genotype).

The sgRNA is obtained by transcribing the plasmid pKG-T6gRNA (IL2RG-g7)_IL2RG-g7。

The sgRNA is obtained by transcribing the plasmid pKG-T6gRNA (ADA-g7)_ADA-g7。

sgRNA_IL2RG-g7And (3) target point: 5'-TCCCTTCAGAGAATAGATAG-3' are provided.

sgRNA_ADA-g7And (3) target point: 5'-GGAGGGCGTGGTGTACGTGG-3' are provided.

sgRNA_IL2RG-g7The target sequence binding region of (a) is as shown in SEQ ID NO: 12, nucleotides 1 to 20;

sgRNA_ADA-g7the target sequence binding region of (a) is as shown in SEQ ID NO: 22 from nucleotide 1 to nucleotide 20.

The sgRNA_IL2RG-g7As shown in SEQ ID NO: shown at 12.

The sgRNA_ADA-g7As shown in SEQ ID NO: 22, respectively.

In particular. The plasmid pKG-T6gRNA (IL2RG-g7) is a sgRNA prepared by using a restriction enzyme BbsI_IL2RG-g7The coding sequence of the target sequence binding region is inserted into a pKG-U6gRNA vector.

Specifically, the plasmid pKG-T6gRNA (ADA-g7) binds sgRNA with the aid of the restriction enzyme BbsI_ADA-g7The coding sequence of the target sequence binding region is inserted into a pKG-U6gRNA vector.

The plasmid pKG-GE3 has a specific fusion gene; the specific fusion gene encodes a specific fusion protein;

the specific fusion protein sequentially comprises the following elements from N end to C end: two Nuclear Localization Signals (NLS), Cas9 protein, two nuclear localization signals, self-splicing polypeptide P2A, fluorescent reporter protein, self-cleavage polypeptide T2A, resistance selection marker protein;

in plasmid pKG-GE3, the expression of the specific fusion gene is driven by the EF1a promoter;

in plasmid pKG-GE3, the specific fusion gene has downstream of it a WPRE sequence element, a 3' LTR sequence element and a bGH poly (A) signal sequence element.

The plasmid pKG-GE3 has the following elements in the following order: CMV enhancer, EF1a promoter, the specific fusion gene, WPRE sequence element, 3' LTR sequence element, bGH poly (A) signal sequence element.

In the specific fusion protein, two nuclear localization signals at the upstream of the Cas9 protein are SV40 nuclear localization signals, and two nuclear localization signals at the downstream of the Cas9 protein are nucleoplasmin nuclear localization signals.

In the specific fusion protein, the fluorescent reporter protein can be EGFP protein.

In the specific fusion protein, the resistance screening marker protein can be Puromycin protein.

The amino acid sequence of self-cleaving polypeptide P2A is "ATNFSLLKQAGDVEENPGP" (the cleavage site that occurs self-cleaves is between the first and second amino acid residues from the C-terminus).

The amino acid sequence of self-cleaving polypeptide T2A is "EGRGSLLTCGDVEENPGP" (the cleavage site that occurs self-cleaves is between the first and second amino acid residues from the C-terminus).

The specific fusion gene is specifically shown as SEQ ID NO: 2, nucleotide 911-6706.

The CMV enhancer is as set forth in SEQ ID NO: 2 at nucleotide 395-680.

The EF1a promoter is shown as SEQ ID NO: 2, nucleotide 682-890.

The WPRE sequence element is shown as SEQ ID NO: 2 at nucleotide 6722 and 7310.

The 3' LTR sequence element is shown in SEQ ID NO: nucleotide 7382-7615 in 2.

The bGH poly (a) signal sequence element is as set forth in SEQ ID NO: 2 as shown by nucleotide 7647-7871.

The plasmid pKG-GE3 is specifically shown in SEQ ID NO: 2, respectively.

In plasmid pKG-U6gRNA, the plasmid has the sequence of SEQ ID NO: 3, the 2280-position 2637 nucleotide.

The plasmid pKG-U6gRNA is specifically shown in SEQ ID NO: 3, respectively.

Porcine IL2RG gene information: encoding the interleaver 2 receiver subBunit gamma; is located on the X chromosome; GeneID 397156, Sus scrofa. The protein coded by the porcine IL2RG gene is shown as SEQ ID NO: 4, respectively. In the genome DNA, the porcine IL2RG gene has 9 exons, wherein the 4 th exon and the upstream and downstream 500bp sequences thereof are shown as SEQ ID NO: 5, respectively. The pig IL2RG gene has sgRNA_IL2RG-g7The target gene of (1). The pig DRA gene is a gene with the sequence shown in SEQ ID NO: 5, or a fragment thereof.

Pig ADA gene information: encoding adenosine deaminase; is located on chromosome 17; GeneID 100625920, Sus scrofa. The protein coded by the pig ADA gene is shown as SEQ ID NO: shown at 15. In the genome DNA, the pig ADA gene has 12 exons, wherein the 4 th exon and the sequences of 500bp on the upstream and the downstream of the exon are shown as SEQ ID NO: shown at 16. Pig ADA gene with sgRNA_ADA-g7The target gene of (1). The pig ADA gene is a gene with the sequence shown in SEQ ID NO: 16, or a fragment thereof.

Any of the above-described immunodeficiency may specifically be severe immunodeficiency.

The invention can be used for obtaining the severe immunodeficiency pig model by a gene editing means, is used for researching drug screening, drug effect detection, disease pathology, gene therapy, cell therapy and the like, can provide effective experimental data for further clinical application, and lays a solid foundation for curing the severe immunodeficiency of human in the future.

Compared with the prior art, the invention has at least the following beneficial effects:

(1) the subject of the invention (pig) has better applicability than other animals (rats, mice, primates). At present, no serious immunodeficiency model of any large animal is successfully developed. Rodents such as rats and mice have great differences from humans in body types, organ sizes, physiology, pathology and the like, and cannot truly simulate normal physiological and pathological states of humans. Studies have shown that over 95% of drugs validated to be effective in large mice are not effective in human clinical trials. The large animals, primates, which are the animals most closely related to humans, are small in size, late in sexual maturity (mating starts at age 6-7), and are single-birth animals, and the population propagation rate is extremely slow, and the raising cost is high. In addition, primate cloning efficiency is low, difficulty is high, and cost is high. However, pigs, which are animals that have a close relationship with humans except primates, do not have the above-mentioned disadvantages as model animals, and have body types, body weights, organ sizes, and the like close to those of humans, and are very similar to those of humans in terms of anatomy, physiology, nutritional metabolism, disease pathogenesis, and the like. Meanwhile, the pigs have early sexual maturity (4-6 months), high reproductive capacity and multiple births, and can form a large group within 2-3 years. In addition, the cloning technology of the pig is very mature, and the cloning and feeding cost is much lower than that of a primate; and the resistance of the pig as a carnivorous animal for a long time in the aspects of animal protection, ethics and the like is relatively small when the pig is used as a disease model animal.

(2) The gene editing is carried out by adopting the cas9 high-efficiency expression vector modified by the invention, and the editing efficiency is obviously improved compared with that of the original vector.

(3) Gene editing is carried out on the Cas9 high-efficiency expression vector modified by the invention, the genotype of the obtained cell (homozygous mutation comprises double allele same mutation and double allele different mutation, heterozygous mutation or wild type) can be analyzed through the sequencing result of the target gene PCR product, and the probability of obtaining the homozygous mutation is 10-20%; in addition, the obtained homozygous mutant monoclonal cell strain is used for somatic cell nuclear transplantation to directly obtain a cloned pig containing a target gene homozygous mutation, and the homozygous mutation can be stably inherited.

The invention lays a solid foundation for the preparation of the severe immunodeficiency pig model and has great application value for the research and development of severe immunodeficiency medicaments.

Drawings

FIG. 1 is a schematic diagram of the structure of plasmid pX 330.

FIG. 2 is a schematic structural diagram of plasmid pKG-GE 3.

FIG. 3 is a schematic structural diagram of plasmid pKG-U6 gRNA.

FIG. 4 is a schematic diagram of insertion of a DNA molecule of about 20bp (target sequence binding region for transcription to form a gRNA) into a plasmid pKG-U6 gRNA.

FIG. 5 is an electrophoretogram of three sets of MSTN in step three of example 2.

FIG. 6 is an electrophoretogram of three sets of FNDC5 in step three of example 2.

FIG. 7 is an electrophoretogram obtained after PCR amplification of a primer pair consisting of IL2RG-GT-F4543/IL2RG-GT-R5180 using genomic DNA of 8 pigs as a template in step one of example 3.

FIG. 8 shows double-stranded DNA molecules having sticky ends in each of the three steps of example 3.

FIG. 9 is a graph of the sequencing peaks in step four of example 3.

FIG. 10 is an electrophoretogram obtained after PCR amplification using a primer set consisting of ADA-GT-F259/ADA-GT-R1005 and genomic DNA of 8 pigs as a template in step one of example 4.

FIG. 11 shows double-stranded DNA molecules having sticky ends in each of the three steps of example 4.

FIG. 12 is a graph of the sequencing peaks in step four of example 4.

FIG. 13 is a graph of the target gene sequencing peaks of a portion of the monoclonal cells in Table 1.

FIG. 14 is a graph of the target gene sequencing peaks of a portion of the monoclonal cells in Table 2.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified. Unless otherwise stated, the quantitative tests in the following examples were performed in triplicate, and the results were averaged. Complete culture broth (% by volume): 15% fetal bovine serum (Gibco) + 83% DMEM medium (Gibco) + 1% Penicilin-Streptomyces (Gibco) + 1% HEPES (Solarbio). Cell culture conditions: 37 ℃ and 5% CO₂、5％O₂The constant temperature incubator.

The 8 pigs in example 3 and example 4 were all fresh-born Jiangxiang pigs, with 4 females (named 1, 2, 3, 4, respectively) and 4 males (named A, B, C, D, respectively).

The method for preparing the primary pig fibroblast comprises the following steps: taking 0.5g of pig ear tissue, removing hairs, soaking for 30-40s by using 75% alcohol, washing for 5 times by using PBS (phosphate buffer solution) containing 5% (volume ratio) Penicillin-streptomycin (Gibco), and washing for one time by using the PBS; ② the tissue is cut into pieces by scissors, 5mL of 1% collagenase solution (Sigma) is adopted to digest for 1h at 37 ℃, then 500g is centrifuged for 5min, and the supernatant is discarded; thirdly, resuspending the precipitate with 1mL of complete culture solution, then paving the precipitate into a cell culture dish which contains 10mL of complete culture medium and is sealed by 0.2 percent gelatin (VWR) and has the diameter of 9cm, and culturing until the cell grows to be about 60 percent of the bottom of the dish; and fourthly, after the third step is finished, digesting and collecting the cells by adopting trypsin, and freezing and storing the cells by using a cell freezing medium (90% complete culture medium + 10% DMSO in volume ratio).

The porcine primary fibroblasts used in examples 2 to 5 were all obtained from the above-mentioned pig named 2 (female, blood group AO).

Example 1 preparation of plasmid

Plasmid pX330-U6-Chimeric _ BB-CBh-hSpCas9 was prepared as shown in SEQ ID NO: 1 is shown. Plasmid pX330-U6-Chimeric _ BB-CBh-hSpCas9, abbreviated as plasmid pX 330.

Plasmid pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO was prepared as shown in SEQ ID NO: 2, respectively. The plasmid pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO is called plasmid pKG-GE3 for short.

Plasmid pKG-U6gRNA was prepared as shown in SEQ ID NO: 3, respectively.

The plasmid pX330, the plasmid pKG-GE3 and the plasmid pKG-U6gRNA are all circular plasmids.

The structure of plasmid pX330 is schematically shown in FIG. 1. SEQ ID NO: 1, the 440-st-725 nucleotide constitutes the CMV enhancer, the 727-1208 th-1208 nucleotide constitutes the chicken beta-actin promoter, the 1304-st-1324 nucleotide encodes SV40 Nuclear Localization Signal (NLS), the 1325-st-5449 nucleotide encodes the Cas9 protein, and the 5450-st-5497 nucleotide encodes the nucleosplastin Nuclear Localization Signal (NLS).

The structure of plasmid pKG-GE3 is shown in FIG. 2. SEQ ID NO: 2, the 395-680 nucleotide constitutes a CMV enhancer, the 682-890 nucleotide constitutes an EF1a promoter, the 986-1006 nucleotide encodes a Nuclear Localization Signal (NLS), the 1016-1036 nucleotide encodes a Nuclear Localization Signal (NLS), the 1037-5161 nucleotide encodes a Cas9 protein, the 5162-5209 nucleotide encodes a Nuclear Localization Signal (NLS), the 5219-5266 nucleotide encodes a Nuclear Localization Signal (NLS), the 5276-5332 nucleotide encodes a self-splicing polypeptide P2A (the amino acid sequence of the self-splicing polypeptide P2A is "ATNFSLLKQAGDVEENPGP", the cleavage position occurring from the cleavage is between the first amino acid residue and the second amino acid residue from the C-terminal), the 5333-6046 nucleotide encodes an EGFP protein, the 526056-6109 nucleotide encodes a self-splicing polypeptide T2A (the amino acid sequence of the self-splicing polypeptide T2A is "EGRGSLLTCGDVEENPGP", between the first amino acid residue and the second amino acid residue from the C-terminal position of the cleavage site), nucleotides 6110-6703 encode Puromycin protein (Puro protein for short), nucleotides 6722-7310 constitute the WPRE sequence element, nucleotides 7382-7615 constitute the 3' LTR sequence element, and nucleotides 7647-7871 constitute the bGH poly (A) signal sequence element. SEQ ID NO: 2, 911-6706 form a fusion gene to express the fusion protein. Due to the presence of self-cleaving polypeptide P2A and self-cleaving polypeptide T2A, the fusion protein spontaneously forms the following three proteins: a protein with Cas9 protein, a protein with EGFP protein and a protein with Puro protein.

Compared with plasmid pX330, plasmid pKG-GE3 was mainly modified as follows: removing residual gRNA framework sequences (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTTT) to reduce interference; secondly, the original chicken beta-actin promoter is transformed into an EF1a promoter with higher expression activity, so that the protein expression capacity of the Cas9 gene is improved; ③ the nuclear localization signal coding gene (NLS) is added at the upstream and the downstream of the Cas9 gene, and the nuclear localization capability of the Cas9 protein is increased; the original plasmid does not have any eukaryotic cell screening marker, is not beneficial to screening and enriching of positive transformed cells, and is sequentially inserted with a P2A-EGFP-T2A-PURO coding gene at the downstream of the Cas9 gene to endow the vector with fluorescence and eukaryotic cell resistance screening capacity; inserting WPRE element and 3' LTR sequence element to strengthen the protein translating capacity of Cas9 gene.

The structure of plasmid pKG-U6gRNA is schematically shown in FIG. 3. SEQ ID NO: 3, the 2280-position 2539 nucleotide constitutes the hU6 promoter, and the 2558-position 2637 nucleotide is used for transcription to form a gRNA framework. When the recombinant gRNA is used, a DNA molecule (a target sequence binding region for forming gRNA through transcription) of about 20bp is inserted into a plasmid pKG-U6gRNA to form a recombinant plasmid, and the recombinant plasmid is transcribed in a cell to obtain the gRNA, wherein a schematic diagram is shown in figure 4.

Example 2 comparison of the Effect of plasmid pX330 and plasmid pKG-GE3

Two gRNA targets located in the MSTN gene were selected:

target of MSTN-gRNA 1: 5'-GCTGATTGTTGCTGGTCCCG-3', respectively;

target of MSTN-gRNA 2: 5'-TTTCCAGGCGAAGTTTACTG-3' are provided.

Two gRNA targets located at FNDC5 gene were selected:

target of FNDC5-gRNA 1: 5'-TGTACTCAGTGTCCTCCTCC-3', respectively;

target of FNDC5-gRNA 2: 5'-GCTCTTCAAGACGCCTCGCG-3' are provided.

The primers used to amplify the fragment containing the target were:

MSTN-F896：5’-TCTCTCAGACAGTGCAGGCATTA-3’；

MSTN-R1351：5’-CGTTTCCGTCGTAGCGTGATAAT-3’。

FNDC5-F209：5’-CAGTTCTCACTTGATGGCCTTGG-3’；

FNDC5-R718：5’-AGGGGTCTGGGGAGGAATGG-3’。

firstly, preparing recombinant plasmid

The plasmid pKG-U6gRNA was digested with the restriction enzyme BbsI, and the vector backbone (approximately 3kb linear large fragment) was recovered.

MSTN-1S and MSTN-1A are synthesized respectively, and then mixed and annealed to obtain double-stranded DNA molecules with cohesive ends. The double-stranded DNA molecule having the cohesive end was ligated to a vector backbone to obtain plasmid pKG-U6gRNA (MSTN-1).

MSTN-2S and MSTN-2A are synthesized respectively, and then mixed and annealed to obtain double-stranded DNA molecules with cohesive ends. The double-stranded DNA molecule with the cohesive end is connected with a vector framework to obtain a plasmid pKG-U6gRNA (MSTN-2).

FNDC5-1S and FNDC5-1A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having cohesive ends. The double-stranded DNA molecule having the cohesive ends was ligated to a vector backbone to obtain plasmid pKG-U6gRNA (FNDC 5-1).

FNDC5-2S and FNDC5-2A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having cohesive ends. The double-stranded DNA molecule having the cohesive ends was ligated to a vector backbone to obtain plasmid pKG-U6gRNA (FNDC 5-2).

MSTN-1S：5’-caccGCTGATTGTTGCTGGTCCCG-3’；

MSTN-1A：5’-aaacCGGGACCAGCAACAATCAGC-3’。

MSTN-2S：5’-caccgTTTCCAGGCGAAGTTTACTG-3’；

MSTN-2A：5’-aaacCAGTAAACTTCGCCTGGAAAc-3’。

FNDC5-1S：5’-caccgTGTACTCAGTGTCCTCCTCC-3’；

FNDC5-1A：5’-aaacGGAGGAGGACACTGAGTACAc-3’。

FNDC5-2S：5’-caccGCTCTTCAAGACGCCTCGCG-3’；

FNDC5-2A：5’-aaacCGCGAGGCGTCTTGAAGAGC-3’。

Secondly, the effect comparison of plasmid pX330 and plasmid pKG-GE3

1. Cotransfection

MSTN-B group: the plasmid pKG-U6gRNA (MSTN-1) and the plasmid pKG-U6gRNA (MSTN-2) were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.46. mu.g of plasmid pKG-U6gRNA (MSTN-1): 0.46. mu.g of plasmid pKG-U6gRNA (MSTN-2).

MSTN-330 group: the plasmid pKG-U6gRNA (MSTN-1), the plasmid pKG-U6gRNA (MSTN-2) and the plasmid pX330 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.46. mu.g of plasmid pKG-U6gRNA (MSTN-1): 0.46. mu.g of plasmid pKG-U6gRNA (MSTN-2): 1.08. mu.g of plasmid pX 330.

MSTN-KG group: the plasmid pKG-U6gRNA (MSTN-1), the plasmid pKG-U6gRNA (MSTN-2) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.46. mu.g of plasmid pKG-U6gRNA (MSTN-1): plasmid 0.46. mu.g pKG-U6gRNA (MSTN-2): 1.08. mu.g of plasmid pKG-GE 3.

FNDC 5-group B: the plasmid pKG-U6gRNA (FNDC5-1) and the plasmid pKG-U6gRNA (FNDC5-2) were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.46. mu.g of plasmid pKG-U6gRNA (FNDC 5-1): 0.46. mu.g of plasmid pKG-U6gRNA (FNDC 5-2).

FNDC5-330 group: the plasmid pKG-U6gRNA (FNDC5-1), the plasmid pKG-U6gRNA (FNDC5-2) and the plasmid pX330 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.46. mu.g of plasmid pKG-U6gRNA (FNDC 5-1): 0.46. mu.g of plasmid pKG-U6gRNA (FNDC 5-2): 1.08. mu.g of plasmid pX 330.

FNDC5-KG group: the plasmid pKG-U6gRNA (FNDC5-1), the plasmid pKG-U6gRNA (FNDC5-2) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.46. mu.g of plasmid pKG-U6gRNA (FNDC 5-1): 0.46. mu.g of plasmid pKG-U6gRNA (FNDC 5-2): 1.08. mu.g of plasmid pKG-GE 3.

Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, Thermofeisher) and a Neon TM transfection system electrotransfer instrument (parameters set at 1450V, 10ms, 3 pulses).

2. After step 1, the culture is carried out for 16 to 18 hours by using the complete culture solution, and then the culture is carried out by replacing the complete culture solution with a new one. The total time of incubation was 48 hours.

3. After completion of step 2, the cells were digested with trypsin and collected, genomic DNA was extracted, and PCR amplification was performed using a primer pair consisting of MSTN-F896 and MSTN-R1351 (three groups of MSTN), or a primer pair consisting of FNDC5-F209 and FNDC5-R718 (three groups of FNDC 5), followed by electrophoresis.

The results of three sets of MSTNs are shown in fig. 5.

The results of three sets of FNDC5 are shown in figure 6.

The gene deletion mutation efficiency of the MSTN-330 group is 27.6 percent, and the gene deletion mutation efficiency of the MSTN-KG group is 86.5 percent. The FNDC5-330 group gene deletion mutation efficiency is 18.6%, and the FNDC5-KG group gene deletion mutation efficiency is 81.7%. The results showed that the use of plasmid pKG-GE3 resulted in a significant improvement in gene editing efficiency compared to the use of plasmid pX 330.

Example 3 screening of target for IL2RG Gene knockout

First, IL2RG gene knockout preset target and adjacent genome sequence conservation analysis

Porcine IL2RG gene information: encoding the interleaver 2 receiver subBunit gamma; is located on the X chromosome; GeneID 397156, Sus scrofa. The protein coded by the porcine IL2RG gene is shown as SEQ ID NO: 4, respectively. In the genome DNA, the porcine IL2RG gene has 9 exons, wherein the 4 th exon and the upstream and downstream 500bp sequences thereof are shown as SEQ ID NO: 5, respectively.

The genomic DNA of 8 pigs were used as templates, PCR amplification was carried out using the primer pair IL2RG-GT-F4543/IL2RG-GT-R5180, and electrophoresis was carried out, as shown in FIG. 7. And recovering PCR amplification products, sequencing, and comparing the sequencing result with the IL2RG gene sequence in a public database for analysis. Based on the alignment, primers for detecting mutations were designed (the primers themselves avoid potential mutation sites). Primers designed to detect mutations were: IL2RG-nF33/IL2RG-nR 460.

IL2RG-GT-F4543：5’-ATATAGCACAGGGGAGGGAGGAA-3’；

IL2RG-GT-R5180：5’-AGGGTGCGAAGGGTCAGATTC-3’；

IL2RG-nF33：5’-CCCAGGCTTCCCACTATATTCTC-3’；

IL2RG-nR460：5’-CCATTGGATCCCTCACTTCTTCT-3’。

Secondly, screening target spots

And primarily screening a plurality of targets by screening NGG (avoiding possible mutation sites), and further screening 9 targets from the NGG through a preliminary experiment.

The 9 targets were as follows:

sgRNA_IL2RG-g1and (3) target point: 5'-CCTGTAGTTTTAGCGTCTGT-3', respectively;

sgRNA_IL2RG-g2and (3) target point: 5'-CAACAAATGTTTGGTAGAGG-3', respectively;

sgRNA_IL2RG-g3and (3) target point: 5'-GATGATAAAGTCCAGGAGTG-3', respectively;

sgRNA_IL2RG-g4and (3) target point: 5'-CTGGACTTTATCATCATTAG-3', respectively;

sgRNA_IL2RG-g5and (3) target point: 5'-TTGTCCAGCTCCAGGACCCA-3', respectively;

sgRNA_IL2RG-g6and (3) target point: 5'-GGCCACTATCTATTCTCTGA-3', respectively;

sgRNA_IL2RG-g7and (3) target point: 5'-TCCCTTCAGAGAATAGATAG-3', respectively;

sgRNA_IL2RG-g8and (3) target point: 5'-AACATTTGTTGTCCAGCTCC-3', respectively;

sgRNA_IL2RG-g9and (3) target point: 5'-TGTCCAGCTCCAGGACCCAC-3' are provided.

Thirdly, preparing recombinant plasmid

IL2RG-g1S and IL2RG-g1A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having cohesive ends (FIG. 8A). The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (IL2RG-g 1). Plasmid pKG-U6gRNA (IL2RG-g1) expresses the nucleic acid sequence of SEQ ID NO: sgRNA shown in FIG. 6_IL2RG-g1。

SEQ ID NO：6：

CCUGUAGUUUUAGCGUCUGUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

IL2RG-g2S and IL2RG-g2A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having cohesive ends (FIG. 8B). The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (IL2RG-g 2). Plasmid pKG-U6gRNA (IL2RG-g2) expresses the nucleic acid sequence of SEQ ID NO: 7 sgRNA_IL2RG-g2。

SEQ ID NO：7：

CAACAAAUGUUUGGUAGAGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

IL2RG-g3S and IL2RG-g3A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having cohesive ends (FIG. 8C). The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (IL2RG-g 3). Plasmid pKG-U6gRNA (IL2RG-g3) expresses the nucleic acid sequence of SEQ ID NO: sgRNA shown in FIG. 8_IL2RG-g3。

SEQ ID NO：8：

GAUGAUAAAGUCCAGGAGUGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

IL2RG-g4S and IL2RG-g4A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having cohesive ends (FIG. 8D). The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (IL2RG-g 4). Plasmid pKG-U6gRNA (IL2RG-g4) expresses the nucleic acid sequence of SEQ ID NO: 9 sgRNA_IL2RG-g4。

SEQ ID NO：9：

CUGGACUUUAUCAUCAUUAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

IL2RG-g5S and IL2RG-g5A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having cohesive ends (FIG. 8E). The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (IL2RG-g 5). Plasmid pKG-U6gRNA (IL2RG-g5) expresses the nucleic acid sequence of SEQ ID NO: 10 sgRNA_IL2RG-g5。

SEQ ID NO：10：

UUGUCCAGCUCCAGGACCCAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

IL2RG-g6S and IL2RG-g6A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having cohesive ends (FIG. 8F). The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (IL2RG-g 6). Plasmid pKG-U6gRNA (IL2RG-g6) expresses the nucleic acid sequence of SEQ ID NO: 11 sgRNA_IL2RG-g6。

SEQ ID NO：11：

GGCCACUAUCUAUUCUCUGAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

IL2RG-G7S and IL2RG-G7A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having cohesive ends (FIG. 8G). The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (IL2RG-g 7). Plasmid pKG-U6gRNA (IL2RG-g7) expresses the nucleic acid sequence of SEQ ID NO: 12 sgRNA_IL2RG-g7。

SEQ ID NO：12：

UCCCUUCAGAGAAUAGAUAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

IL2RG-g8S and IL2RG-g8A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having cohesive ends (FIG. 8H). The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (IL2RG-g 8). Plasmid pKG-U6gRNA (IL2RG-g8) expresses the nucleic acid sequence of SEQ ID NO: 13 sgRNA_IL2RG-g8。

SEQ ID NO：13：

AACAUUUGUUGUCCAGCUCCguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

IL2RG-g9S and IL2RG-g9A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having cohesive ends (FIG. 8I). The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (IL2RG-g 9). Plasmid pKG-U6gRNA (IL2RG-g9) expresses the nucleic acid sequence of SEQ ID NO: 14 sgRNA_IL2RG-g9。

SEQ ID NO：14：

UGUCCAGCUCCAGGACCCACguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

sgRNA-IL2RG-1S：5’-caccgCCTGTAGTTTTAGCGTCTGT-3’；

sgRNA-IL2RG-1A：5’-aaacACAGACGCTAAAACTACAGGc-3’。

sgRNA-IL2RG-2S：5’-caccgCAACAAATGTTTGGTAGAGG-3’；

sgRNA-IL2RG-2A：5’-aaacCCTCTACCAAACATTTGTTGc-3’。

sgRNA-IL2RG-3S：5’-caccGATGATAAAGTCCAGGAGTG-3’；

sgRNA-IL2RG-3A：5’-aaacCACTCCTGGACTTTATCATC-3’。

sgRNA-IL2RG-4S：5’-caccgCTGGACTTTATCATCATTAG-3’；

sgRNA-IL2RG-4A：5’-aaacCTAATGATGATAAAGTCCAGc-3’。

sgRNA-IL2RG-5S：5’-caccgTTGTCCAGCTCCAGGACCCA-3’；

sgRNA-IL2RG-5A：5’-aaacTGGGTCCTGGAGCTGGACAAc-3’。

sgRNA-IL2RG-6S：5’-caccgGGCCACTATCTATTCTCTGA-3’；

sgRNA-IL2RG-6A：5’-aaacTCAGAGAATAGATAGTGGCCc-3’。

sgRNA-IL2RG-7S：5’-caccgTCCCTTCAGAGAATAGATAG-3’；

sgRNA-IL2RG-7A：5’-aaacCTATCTATTCTCTGAAGGGAc-3’。

sgRNA-IL2RG-8S：5’-caccgAACATTTGTTGTCCAGCTCC-3’；

sgRNA-IL2RG-8A：5’-aaacGGAGCTGGACAACAAATGTTc-3’。

sgRNA-IL2RG-9S：5’-caccgTGTCCAGCTCCAGGACCCAC-3’；

sgRNA-IL2RG-9A：5’-aaacGTGGGTCCTGGAGCTGGACAc-3’。

The sgRNA-IL2RG-1S, sgRNA-IL2RG-1A, sgRNA-IL2RG-2S, sgRNA-IL2RG-2A, sgRNA-IL2RG-3S, sgRNA-IL2RG-3A, sgRNA-IL2RG-4S, sgRNA-IL2RG-4A, sgRNA-IL2RG-5S, sgRNA-IL2RG-5A, sgRNA-IL2RG-6S, sgRNA-IL2RG-6A, sgRNA-IL2RG-7S, sgRNA-IL2RG-7A, sgRNA-IL2RG-8S, sgRNA-IL2RG-8A, sgRNA-IL2RG-9S, sgRNA-IL2RG-9A are single-chain DNA molecules.

Four, comparison of editing efficiency of different target points

1. Cotransfection

A first group: plasmid pKG-U6gRNA (IL2RG-g1) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762 μ g plasmid pKG-U6gRNA (IL2RG-g 1): 1.238 μ g of plasmid pKG-GE 3.

Second group: plasmid pKG-U6gRNA (IL2RG-g2) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762 μ g plasmid pKG-U6gRNA (IL2RG-g 2): 1.238 μ g of plasmid pKG-GE 3.

Third group: plasmid pKG-U6gRNA (IL2RG-g3) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762 μ g plasmid pKG-U6gRNA (IL2RG-g 3): 1.238 μ g of plasmid pKG-GE 3.

And a fourth group: plasmid pKG-U6gRNA (IL2RG-g4) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762 μ g plasmid pKG-U6gRNA (IL2RG-g 4): 1.238 μ g of plasmid pKG-GE 3.

And a fifth group: plasmid pKG-U6gRNA (IL2RG-g5) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762 μ g plasmid pKG-U6gRNA (IL2RG-g 5): 1.238 μ g of plasmid pKG-GE 3.

A sixth group: plasmid pKG-U6gRNA (IL2RG-g6) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762 μ g plasmid pKG-U6gRNA (IL2RG-g 6): 1.238 μ g of plasmid pKG-GE 3.

A seventh group: plasmid pKG-U6gRNA (IL2RG-g7) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762 μ g plasmid pKG-U6gRNA (IL2RG-g 7): 1.238 μ g of plasmid pKG-GE 3.

And an eighth group: plasmid pKG-U6gRNA (IL2RG-g8) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762 μ g plasmid pKG-U6gRNA (IL2RG-g 8): 1.238 μ g of plasmid pKG-GE 3.

Ninth group: plasmid pKG-U6gRNA (IL2RG-g9) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762 μ g plasmid pKG-U6gRNA (IL2RG-g 9): 1.238 μ g of plasmid pKG-GE 3.

The tenth group: porcine primary fibroblasts, without any transfection procedure.

3. After completion of step 2, the cells were trypsinized and harvested, genomic DNA was extracted, PCR amplified using a primer pair consisting of IL2RG-nF33 and IL2RG-nR460, and then electrophoresed and sequenced, as shown in FIG. 9.

The editing efficiency of different targets was obtained by analyzing the sequencing peak patterns using the syntheo ICE tool. The editing efficiency of the first group to the tenth group of different target points is 1%, 0%, 3%, 5%, 0%, 46%, 65%, 18%, 34% and 0% in sequence. The results show that the seventh group has the highest editing efficiency, sgRNA_IL2RG-g7Is the optimal target point.

Example 4 screening of ADA Gene knockout targets

First, ADA gene knockout preset target and adjacent genome sequence conservation analysis

Pig ADA gene information: encoding adenosine deaminase; is located on chromosome 17;

GeneID 100625920, Sus scrofa. The protein coded by the pig ADA gene is shown as SEQ ID NO: shown at 15. In the genome DNA, the pig ADA gene has 12 exons, wherein the 4 th exon and the sequences of 500bp on the upstream and the downstream of the exon are shown as SEQ ID NO: shown at 16.

The genomic DNA of 8 pigs was used as a template, and PCR amplification was carried out using a primer set consisting of the primer ADA-GT-F259/ADA-GT-R1005, followed by electrophoresis, as shown in FIG. 10. And recovering PCR amplification products, sequencing, and comparing and analyzing the sequencing result with the ADA gene sequence in the public database. Based on the alignment, primers for detecting mutations were designed (the primers themselves avoid potential mutation sites). Primers designed to detect mutations were: ADA-nnF229/ADA-nnR 456.

ADA-GT-F259：5’-GTTAAGGATCTGGTGTTGCGGTG-3’；

ADA-GT-R1005：5’-GTTCACACTCCTAGACTCCAGCC-3’。

ADA-nnF229：5’-GAGGCCGTCAAAAGGATTGC-3’；

ADA-nnR456：5’-CAAAGTCTCTCTTGGGTCAGGG-3’。

Secondly, screening target spots

And primarily screening a plurality of targets by screening NGG (avoiding possible mutation sites), and further screening 8 targets from the NGG through a preliminary experiment.

The 8 targets were as follows:

sgRNA_ADA-g1and (3) target point: 5'-AAGGATTGCCTACGAGTTTG-3', respectively;

sgRNA_ADA-g2and (3) target point: 5'-TTGGAGTTGGCCAGCAGGTG-3', respectively;

sgRNA_ADA-g3and (3) target point: 5'-TTTCATCTCCACAAACTCGT-3', respectively;

sgRNA_ADA-g4and (3) target point: 5'-TCAGCCTGGTTCCAGGGGAT-3', respectively;

sgRNA_ADA-g6and (3) target point: 5'-CCTGCTGGCCAACTCCAAAG-3', respectively;

sgRNA_ADA-g7and (3) target point: 5'-GGAGGGCGTGGTGTACGTGG-3', respectively;

sgRNA_ADA-g8and (3) target point: 5'-CAAGGAGGGCGTGGTGTACG-3', respectively;

sgRNA_ADA-g9and (3) target point: 5'-TGTGGAGATGAAAGCCAAGG-3' are provided.

Thirdly, preparing recombinant plasmid

ADA-g1S and ADA-g1A were synthesized separately, mixed and annealed to obtain double-stranded DNA molecules having cohesive ends (FIG. 11A). Double strand D having cohesive endsThe NA molecule was ligated to the vector backbone to give plasmid pKG-U6gRNA (ADA-g 1). Plasmid pKG-U6gRNA (ADA-g1)) expresses SEQ ID NO: 17 sgRNA_ADA-g1。

SEQ ID NO：17：

AAGGAUUGCCUACGAGUUUGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

ADA-g2S and ADA-g2A were synthesized separately, mixed and annealed to obtain a double-stranded DNA molecule having cohesive ends (FIG. 11B). The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain plasmid pKG-U6gRNA (ADA-g 2). Plasmid pKG-U6gRNA (ADA-g2) expresses the nucleic acid sequence of SEQ ID NO: 18 of sgRNA_ADA-g2。

SEQ ID NO：18：

UUGGAGUUGGCCAGCAGGUGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

ADA-g3S and ADA-g3A were synthesized separately, mixed and annealed to obtain a double-stranded DNA molecule having cohesive ends (FIG. 11C). The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain plasmid pKG-U6gRNA (ADA-g 3). Plasmid pKG-U6gRNA (ADA-g3) expresses the nucleic acid sequence of SEQ ID NO: 19 sgRNA_ADA-g3。

SEQ ID NO：19：

UUUCAUCUCCACAAACUCGUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

ADA-g4S and ADA-g4A were synthesized separately, mixed and annealed to obtain double-stranded DNA molecules having cohesive ends (FIG. 11D). The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain plasmid pKG-U6gRNA (ADA-g 4). Plasmid pKG-U6gRNA (ADA-g4) expresses the nucleic acid sequence of SEQ ID NO: 20 sgRNA_ADA-g4。

SEQ ID NO：20：

UCAGCCUGGUUCCAGGGGAUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

ADA-g6S and ADA-g6A were synthesized separately, mixed and annealed to obtain double-stranded DNA molecules having cohesive ends (FIG. 11E). Will have sticky endsThe double-stranded DNA molecule was ligated to the vector backbone to obtain plasmid pKG-U6gRNA (ADA-g 6). Plasmid pKG-U6gRNA (ADA-g6) expresses the nucleic acid sequence of SEQ ID NO: 21 sgRNA_ADA-g6。

SEQ ID NO：21：

CCUGCUGGCCAACUCCAAAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

ADA-g7S and ADA-g7A were synthesized separately, mixed and annealed to obtain a double-stranded DNA molecule having cohesive ends (FIG. 11F). The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain plasmid pKG-U6gRNA (ADA-g 7). Plasmid pKG-U6gRNA (ADA-g7) expresses the nucleic acid sequence of SEQ ID NO: 22 of sgRNA_ADA-g7。

SEQ ID NO：22：

GGAGGGCGUGGUGUACGUGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

ADA-G8S and ADA-G8A were synthesized separately, mixed and annealed to obtain a double-stranded DNA molecule having cohesive ends (FIG. 11G). The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain plasmid pKG-U6gRNA (ADA-g 8). Plasmid pKG-U6gRNA (ADA-g8) expresses the nucleic acid sequence of SEQ ID NO: 23 sgRNA_ADA-g8。

SEQ ID NO：23：

CAAGGAGGGCGUGGUGUACGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

ADA-g9S and ADA-g9A were synthesized separately, mixed and annealed to obtain a double-stranded DNA molecule having cohesive ends (FIG. 11H). The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain plasmid pKG-U6gRNA (ADA-g 9). Plasmid pKG-U6gRNA (ADA-g9) expresses the nucleic acid sequence of SEQ ID NO: 24 sgRNA_ADA-g9。

SEQ ID NO：24：

UGUGGAGAUGAAAGCCAAGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

sgRNA-ADA-1S：5’-caccgAAGGATTGCCTACGAGTTTG-3’；

sgRNA-ADA-1A：5’-aaacCAAACTCGTAGGCAATCCTTc-3’。

sgRNA-ADA-2S：5’-caccgTTGGAGTTGGCCAGCAGGTG-3’；

sgRNA-ADA-2A：5’-aaacCACCTGCTGGCCAACTCCAAc-3’。

sgRNA-ADA-3S：5’-caccgTTTCATCTCCACAAACTCGT-3’；

sgRNA-ADA-3A：5’-aaacACGAGTTTGTGGAGATGAAAc-3’。

sgRNA-ADA-4S：5’-caccgTCAGCCTGGTTCCAGGGGAT-3’；

sgRNA-ADA-4A：5’-aaacATCCCCTGGAACCAGGCTGAc-3’。

sgRNA-ADA-6S：5’-caccgCCTGCTGGCCAACTCCAAAG-3’；

sgRNA-ADA-6A：5’-aaacCTTTGGAGTTGGCCAGCAGGc-3’。

sgRNA-ADA-7S：5’-caccGGAGGGCGTGGTGTACGTGG-3’；

sgRNA-ADA-7A：5’-aaacCCACGTACACCACGCCCTCC-3’。

sgRNA-ADA-8S：5’-caccgCAAGGAGGGCGTGGTGTACG-3’；

sgRNA-ADA-8A：5’-aaacCGTACACCACGCCCTCCTTGc-3’。

sgRNA-ADA-9S：5’-caccgTGTGGAGATGAAAGCCAAGG-3’；

sgRNA-ADA-9A：5’-aaacCCTTGGCTTTCATCTCCACAc-3’。

sgRNA-ADA-1S, sgRNA-ADA-1A, sgRNA-ADA-2S, sgRNA-ADA-2A, sgRNA-ADA-3S, sgRNA-ADA-3A, sgRNA-ADA-4S, sgRNA-ADA-4A, sgRNA-ADA-6S, sgRNA-ADA-6A, sgRNA-ADA-7S, sgRNA-ADA-7A, sgRNA-ADA-8S, sgRNA-ADA-8A, sgRNA-ADA-9S, sgRNA-ADA-9A are all single-stranded DNA molecules.

Four, comparison of editing efficiency of different target points

1. Cotransfection

A first group: plasmid pKG-U6gRNA (ADA-g1) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762. mu.g plasmid pKG-U6gRNA (ADA-g 1): 1.238 μ g of plasmid pKG-GE 3.

Second group: plasmid pKG-U6gRNA (ADA-g2) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762. mu.g plasmid pKG-U6gRNA (ADA-g 2): 1.238 μ g of plasmid pKG-GE 3.

Third group: plasmid pKG-U6gRNA (ADA-g3) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762. mu.g plasmid pKG-U6gRNA (ADA-g 3): 1.238 μ g of plasmid pKG-GE 3.

And a fourth group: plasmid pKG-U6gRNA (ADA-g4) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762. mu.g plasmid pKG-U6gRNA (ADA-g 4): 1.238 μ g of plasmid pKG-GE 3.

And a fifth group: plasmid pKG-U6gRNA (ADA-g6) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762. mu.g plasmid pKG-U6gRNA (ADA-g 6): 1.238 μ g of plasmid pKG-GE 3.

A sixth group: plasmid pKG-U6gRNA (ADA-g7) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762. mu.g plasmid pKG-U6gRNA (ADA-g 7): 1.238 μ g of plasmid pKG-GE 3.

A seventh group: plasmid pKG-U6gRNA (ADA-g8) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762. mu.g plasmid pKG-U6gRNA (ADA-g 8): 1.238 μ g of plasmid pKG-GE 3.

And an eighth group: plasmid pKG-U6gRNA (ADA-g9) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.762. mu.g plasmid pKG-U6gRNA (ADA-g 9): 1.238 μ g of plasmid pKG-GE 3.

Ninth group: porcine primary fibroblasts, without any transfection procedure.

3. After completion of step 2, the cells were trypsinized and harvested, genomic DNA was extracted, PCR amplified using a primer pair consisting of ADA-nnF229 and ADA-nnR456, and then electrophoresed and sequenced, as shown in FIG. 12.

The editing efficiency of different targets was obtained by analyzing the sequencing peak patterns using the syntheo ICE tool. The editing efficiency of the first group to the ninth group of different target points is 19%, 17%, 9%, 0%, 2%, 35%, 29%, 20% and 0% in sequence. The result shows that the editing efficiency of the sixth group is highest, and sgRNA_ADA-g7Is the optimal target point.

Example 5 preparation of IL2RG and ADA Gene-edited monoclonal cells

1. Cotransfection

The plasmid pKG-U6gRNA (IL2RG-g7), the plasmid pKG-U6gRNA (ADA-g7) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.44. mu.g plasmid pKG-U6gRNA (IL2RG-g 7): 0.44. mu.g plasmid pKG-U6gRNA (ADA-g 7): 2.12. mu.g of plasmid pKG-GE 3.

3. After completion of step 2, cells were trypsinized and collected, then washed with complete medium, then resuspended with complete medium, and then each individual monoclonal was picked up and transferred to a 96-well plate (1 cell per well with 200. mu.l of complete medium per well) for 2 weeks (replacement of new complete medium every 2-3 days).

4. After completion of step 3, cells were trypsinized and harvested (cells from each well, approximately 2/3 were plated into 6-well plates containing complete medium and the remaining 1/3 collected in 1.5mL centrifuge tubes).

5. The 6-well plate of step 4 was taken, cultured until the cells grew to 50% full, trypsinized and collected, and the cells were cryopreserved using a cell cryopreservation solution (90% complete medium + 10% DMSO by volume).

6. Taking the centrifuge tube in the step 4, taking cells, extracting genomic DNA, performing PCR amplification (respectively adopting a primer pair consisting of IL2RG-nF33 and IL2RG-nR460 and a primer pair consisting of ADA-nnF229 and ADA-nnR 456), and then performing electrophoresis. Porcine primary fibroblasts were used as wild type controls.

7. After completion of step 6, the PCR amplification product was recovered and sequenced.

The sequencing result of the primary pig fibroblast is only one, and the genotype of the primary pig fibroblast is homozygous wild type. If the sequencing result of a certain monoclonal cell has two types, one type is consistent with the sequencing result of the pig primary fibroblast, and the other type has mutation (mutation comprises deletion, insertion or substitution of one or more nucleotides) compared with the sequencing result of the pig primary fibroblast, the genotype of the monoclonal cell is heterozygote; if the sequencing result of a certain monoclonal cell is two types, the two types of the sequencing results are both mutated (the mutation comprises deletion, insertion or substitution of one or more nucleotides) compared with the sequencing result of the pig primary fibroblast, and the genotype of the monoclonal cell is a biallelic different mutant type; if the sequencing result of a certain monoclonal cell is one and mutation (mutation comprises deletion, insertion or substitution of one or more nucleotides) is generated compared with the sequencing result of the pig primary fibroblast, the genotype of the monoclonal cell is a biallelic gene identical mutant; if the sequencing result of a certain monoclonal cell is one and is consistent with the sequencing result of the pig primary fibroblast, the genotype of the monoclonal cell is a homozygous wild type.

The results of the IL2RG gene editing are shown in Table 1. The genotypes of the monoclonal cells numbered 7, 26, 30 and 35 are biallelic different mutants. The genotypes of the monoclonal cells numbered 14, 21 and 39 were heterozygous. The monoclonal cells numbered 15, 16, 19, 20, 28, 31, 49 all showed a complex set of peaks, and thus no valid sequence was obtained, and genotype and specific form could not be determined, but it was judged that gene editing occurred. The obtained IL2RG gene edited monoclonal cells at a rate of 14/53. An exemplary sequencing peak profile for IL2RG is shown in FIG. 13.

TABLE 1

The ADA gene was edited as shown in Table 2. The genotypes of the monoclonal cells numbered 19 and 26 are biallelic identical mutants. The genotypes of the monoclonal cells numbered 35 and 49 are biallelic different mutants. The genotype of the monoclonal cell numbered 5 was heterozygous. The monoclonal cells numbered 7, 9, 12, 15, 20, 21, 28, 30, 31, 45 all showed a complex set of peaks, and thus no effective sequence could be obtained, and genotype and specific form could not be determined, but it could be judged that gene editing occurred. The resulting ADA gene-edited monoclonal cell ratio was 15/53. An exemplary ADA sequencing peak profile is shown in FIG. 14.

TABLE 2

8. After completion of step 7, monoclonal cells were selected for simultaneous IL2RG and ADA gene knock-outs.

The monoclonal cells numbered 7, 15, 19, 20, 21, 26, 28, 30, 31, 35 and 49 were analyzed as monoclonal cells with IL2RG and ADA genes knocked out simultaneously.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

SEQUENCE LISTING

<110> Nanjing King Gene engineering Co., Ltd

<120> IL2RG gene and ADA gene combined knockout recombinant cell and application thereof in preparation of immunodeficient pig model

<130> GNCYX202101

<160> 24

<170> PatentIn version 3.5

<210> 1

<211> 8484

<212> DNA

<213> Artificial sequence

<400> 1

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaaataag 300

gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttg ttttagagct 360

agaaatagca agttaaaata aggctagtcc gtttttagcg cgtgcgccaa ttctgcagac 420

aaatggctct agaggtaccc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 480

ccaacgaccc ccgcccattg acgtcaatag taacgccaat agggactttc cattgacgtc 540

aatgggtgga gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc 600

caagtacgcc ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tgtgcccagt 660

acatgacctt atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta 720

ccatggtcga ggtgagcccc acgttctgct tcactctccc catctccccc ccctccccac 780

ccccaatttt gtatttattt attttttaat tattttgtgc agcgatgggg gcgggggggg 840

ggggggggcg gggcgagggg cggggcgggg cgaggcggag aggtgcggcg gcagccaatc 900

agagcggcgc gctccgaaag tttcctttta tggcgaggcg gcggcggcgg cggccctata 960

aaaagcgaag cgcgcggcgg gcgggagtcg ctgcgcgctg ccttcgcccc gtgccccgct 1020

ccgccgccgc ctcgcgccgc ccgccccggc tctgactgac cgcgttactc ccacaggtga 1080

gcgggcggga cggcccttct cctccgggct gtaattagct gagcaagagg taagggttta 1140

agggatggtt ggttggtggg gtattaatgt ttaattacct ggagcacctg cctgaaatca 1200

ctttttttca ggttggaccg gtgccaccat ggactataag gaccacgacg gagactacaa 1260

ggatcatgat attgattaca aagacgatga cgataagatg gccccaaaga agaagcggaa 1320

ggtcggtatc cacggagtcc cagcagccga caagaagtac agcatcggcc tggacatcgg 1380

caccaactct gtgggctggg ccgtgatcac cgacgagtac aaggtgccca gcaagaaatt 1440

caaggtgctg ggcaacaccg accggcacag catcaagaag aacctgatcg gagccctgct 1500

gttcgacagc ggcgaaacag ccgaggccac ccggctgaag agaaccgcca gaagaagata 1560

caccagacgg aagaaccgga tctgctatct gcaagagatc ttcagcaacg agatggccaa 1620

ggtggacgac agcttcttcc acagactgga agagtccttc ctggtggaag aggataagaa 1680

gcacgagcgg caccccatct tcggcaacat cgtggacgag gtggcctacc acgagaagta 1740

ccccaccatc taccacctga gaaagaaact ggtggacagc accgacaagg ccgacctgcg 1800

gctgatctat ctggccctgg cccacatgat caagttccgg ggccacttcc tgatcgaggg 1860

cgacctgaac cccgacaaca gcgacgtgga caagctgttc atccagctgg tgcagaccta 1920

caaccagctg ttcgaggaaa accccatcaa cgccagcggc gtggacgcca aggccatcct 1980

gtctgccaga ctgagcaaga gcagacggct ggaaaatctg atcgcccagc tgcccggcga 2040

gaagaagaat ggcctgttcg gaaacctgat tgccctgagc ctgggcctga cccccaactt 2100

caagagcaac ttcgacctgg ccgaggatgc caaactgcag ctgagcaagg acacctacga 2160

cgacgacctg gacaacctgc tggcccagat cggcgaccag tacgccgacc tgtttctggc 2220

cgccaagaac ctgtccgacg ccatcctgct gagcgacatc ctgagagtga acaccgagat 2280

caccaaggcc cccctgagcg cctctatgat caagagatac gacgagcacc accaggacct 2340

gaccctgctg aaagctctcg tgcggcagca gctgcctgag aagtacaaag agattttctt 2400

cgaccagagc aagaacggct acgccggcta cattgacggc ggagccagcc aggaagagtt 2460

ctacaagttc atcaagccca tcctggaaaa gatggacggc accgaggaac tgctcgtgaa 2520

gctgaacaga gaggacctgc tgcggaagca gcggaccttc gacaacggca gcatccccca 2580

ccagatccac ctgggagagc tgcacgccat tctgcggcgg caggaagatt tttacccatt 2640

cctgaaggac aaccgggaaa agatcgagaa gatcctgacc ttccgcatcc cctactacgt 2700

gggccctctg gccaggggaa acagcagatt cgcctggatg accagaaaga gcgaggaaac 2760

catcaccccc tggaacttcg aggaagtggt ggacaagggc gcttccgccc agagcttcat 2820

cgagcggatg accaacttcg ataagaacct gcccaacgag aaggtgctgc ccaagcacag 2880

cctgctgtac gagtacttca ccgtgtataa cgagctgacc aaagtgaaat acgtgaccga 2940

gggaatgaga aagcccgcct tcctgagcgg cgagcagaaa aaggccatcg tggacctgct 3000

gttcaagacc aaccggaaag tgaccgtgaa gcagctgaaa gaggactact tcaagaaaat 3060

cgagtgcttc gactccgtgg aaatctccgg cgtggaagat cggttcaacg cctccctggg 3120

cacataccac gatctgctga aaattatcaa ggacaaggac ttcctggaca atgaggaaaa 3180

cgaggacatt ctggaagata tcgtgctgac cctgacactg tttgaggaca gagagatgat 3240

cgaggaacgg ctgaaaacct atgcccacct gttcgacgac aaagtgatga agcagctgaa 3300

gcggcggaga tacaccggct ggggcaggct gagccggaag ctgatcaacg gcatccggga 3360

caagcagtcc ggcaagacaa tcctggattt cctgaagtcc gacggcttcg ccaacagaaa 3420

cttcatgcag ctgatccacg acgacagcct gacctttaaa gaggacatcc agaaagccca 3480

ggtgtccggc cagggcgata gcctgcacga gcacattgcc aatctggccg gcagccccgc 3540

cattaagaag ggcatcctgc agacagtgaa ggtggtggac gagctcgtga aagtgatggg 3600

ccggcacaag cccgagaaca tcgtgatcga aatggccaga gagaaccaga ccacccagaa 3660

gggacagaag aacagccgcg agagaatgaa gcggatcgaa gagggcatca aagagctggg 3720

cagccagatc ctgaaagaac accccgtgga aaacacccag ctgcagaacg agaagctgta 3780

cctgtactac ctgcagaatg ggcgggatat gtacgtggac caggaactgg acatcaaccg 3840

gctgtccgac tacgatgtgg accatatcgt gcctcagagc tttctgaagg acgactccat 3900

cgacaacaag gtgctgacca gaagcgacaa gaaccggggc aagagcgaca acgtgccctc 3960

cgaagaggtc gtgaagaaga tgaagaacta ctggcggcag ctgctgaacg ccaagctgat 4020

tacccagaga aagttcgaca atctgaccaa ggccgagaga ggcggcctga gcgaactgga 4080

taaggccggc ttcatcaaga gacagctggt ggaaacccgg cagatcacaa agcacgtggc 4140

acagatcctg gactcccgga tgaacactaa gtacgacgag aatgacaagc tgatccggga 4200

agtgaaagtg atcaccctga agtccaagct ggtgtccgat ttccggaagg atttccagtt 4260

ttacaaagtg cgcgagatca acaactacca ccacgcccac gacgcctacc tgaacgccgt 4320

cgtgggaacc gccctgatca aaaagtaccc taagctggaa agcgagttcg tgtacggcga 4380

ctacaaggtg tacgacgtgc ggaagatgat cgccaagagc gagcaggaaa tcggcaaggc 4440

taccgccaag tacttcttct acagcaacat catgaacttt ttcaagaccg agattaccct 4500

ggccaacggc gagatccgga agcggcctct gatcgagaca aacggcgaaa ccggggagat 4560

cgtgtgggat aagggccggg attttgccac cgtgcggaaa gtgctgagca tgccccaagt 4620

gaatatcgtg aaaaagaccg aggtgcagac aggcggcttc agcaaagagt ctatcctgcc 4680

caagaggaac agcgataagc tgatcgccag aaagaaggac tgggacccta agaagtacgg 4740

cggcttcgac agccccaccg tggcctattc tgtgctggtg gtggccaaag tggaaaaggg 4800

caagtccaag aaactgaaga gtgtgaaaga gctgctgggg atcaccatca tggaaagaag 4860

cagcttcgag aagaatccca tcgactttct ggaagccaag ggctacaaag aagtgaaaaa 4920

ggacctgatc atcaagctgc ctaagtactc cctgttcgag ctggaaaacg gccggaagag 4980

aatgctggcc tctgccggcg aactgcagaa gggaaacgaa ctggccctgc cctccaaata 5040

tgtgaacttc ctgtacctgg ccagccacta tgagaagctg aagggctccc ccgaggataa 5100

tgagcagaaa cagctgtttg tggaacagca caagcactac ctggacgaga tcatcgagca 5160

gatcagcgag ttctccaaga gagtgatcct ggccgacgct aatctggaca aagtgctgtc 5220

cgcctacaac aagcaccggg ataagcccat cagagagcag gccgagaata tcatccacct 5280

gtttaccctg accaatctgg gagcccctgc cgccttcaag tactttgaca ccaccatcga 5340

ccggaagagg tacaccagca ccaaagaggt gctggacgcc accctgatcc accagagcat 5400

caccggcctg tacgagacac ggatcgacct gtctcagctg ggaggcgaca aaaggccggc 5460

ggccacgaaa aaggccggcc aggcaaaaaa gaaaaagtaa gaattcctag agctcgctga 5520

tcagcctcga ctgtgccttc tagttgccag ccatctgttg tttgcccctc ccccgtgcct 5580

tccttgaccc tggaaggtgc cactcccact gtcctttcct aataaaatga ggaaattgca 5640

tcgcattgtc tgagtaggtg tcattctatt ctggggggtg gggtggggca ggacagcaag 5700

ggggaggatt gggaagagaa tagcaggcat gctggggagc ggccgcagga acccctagtg 5760

atggagttgg ccactccctc tctgcgcgct cgctcgctca ctgaggccgg gcgaccaaag 5820

gtcgcccgac gcccgggctt tgcccgggcg gcctcagtga gcgagcgagc gcgcagctgc 5880

ctgcaggggc gcctgatgcg gtattttctc cttacgcatc tgtgcggtat ttcacaccgc 5940

atacgtcaaa gcaaccatag tacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg 6000

tggttacgcg cagcgtgacc gctacacttg ccagcgcctt agcgcccgct cctttcgctt 6060

tcttcccttc ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc 6120

tccctttagg gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgatttgg 6180

gtgatggttc acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg 6240

agtccacgtt ctttaatagt ggactcttgt tccaaactgg aacaacactc aactctatct 6300

cgggctattc ttttgattta taagggattt tgccgatttc ggtctattgg ttaaaaaatg 6360

agctgattta acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaattttat 6420

ggtgcactct cagtacaatc tgctctgatg ccgcatagtt aagccagccc cgacacccgc 6480

caacacccgc tgacgcgccc tgacgggctt gtctgctccc ggcatccgct tacagacaag 6540

ctgtgaccgt ctccgggagc tgcatgtgtc agaggttttc accgtcatca ccgaaacgcg 6600

cgagacgaaa gggcctcgtg atacgcctat ttttataggt taatgtcatg ataataatgg 6660

tttcttagac gtcaggtggc acttttcggg gaaatgtgcg cggaacccct atttgtttat 6720

ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga taaatgcttc 6780

aataatattg aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc cttattccct 6840

tttttgcggc attttgcctt cctgtttttg ctcacccaga aacgctggtg aaagtaaaag 6900

atgctgaaga tcagttgggt gcacgagtgg gttacatcga actggatctc aacagcggta 6960

agatccttga gagttttcgc cccgaagaac gttttccaat gatgagcact tttaaagttc 7020

tgctatgtgg cgcggtatta tcccgtattg acgccgggca agagcaactc ggtcgccgca 7080

tacactattc tcagaatgac ttggttgagt actcaccagt cacagaaaag catcttacgg 7140

atggcatgac agtaagagaa ttatgcagtg ctgccataac catgagtgat aacactgcgg 7200

ccaacttact tctgacaacg atcggaggac cgaaggagct aaccgctttt ttgcacaaca 7260

tgggggatca tgtaactcgc cttgatcgtt gggaaccgga gctgaatgaa gccataccaa 7320

acgacgagcg tgacaccacg atgcctgtag caatggcaac aacgttgcgc aaactattaa 7380

ctggcgaact acttactcta gcttcccggc aacaattaat agactggatg gaggcggata 7440

aagttgcagg accacttctg cgctcggccc ttccggctgg ctggtttatt gctgataaat 7500

ctggagccgg tgagcgtgga agccgcggta tcattgcagc actggggcca gatggtaagc 7560

cctcccgtat cgtagttatc tacacgacgg ggagtcaggc aactatggat gaacgaaata 7620

gacagatcgc tgagataggt gcctcactga ttaagcattg gtaactgtca gaccaagttt 7680

actcatatat actttagatt gatttaaaac ttcattttta atttaaaagg atctaggtga 7740

agatcctttt tgataatctc atgaccaaaa tcccttaacg tgagttttcg ttccactgag 7800

cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa 7860

tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg ccggatcaag 7920

agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata ccaaatactg 7980

ttcttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca ccgcctacat 8040

acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag tcgtgtctta 8100

ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc tgaacggggg 8160

gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga tacctacagc 8220

gtgagctatg agaaagcgcc acgcttcccg aagggagaaa ggcggacagg tatccggtaa 8280

gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac gcctggtatc 8340

tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg tgatgctcgt 8400

caggggggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct 8460

tttgctggcc ttttgctcac atgt 8484

<210> 2

<211> 10476

<212> DNA

<213> Artificial sequence

<400> 2

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaaataag 300

gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttc tagcgcgtgc 360

gccaattctg cagacaaatg gctctagagg tacccgttac ataacttacg gtaaatggcc 420

cgcctggctg accgcccaac gacccccgcc cattgacgtc aatagtaacg ccaataggga 480

ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc 540

aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 600

ggcattgtgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 660

tagtcatcgc tattaccatg ggggcagagc gcacatcgcc cacagtcccc gagaagttgg 720

ggggaggggt cggcaattga tccggtgcct agagaaggtg gcgcggggta aactgggaaa 780

gtgatgtcgt gtactggctc cgcctttttc ccgagggtgg gggagaaccg tatataagtg 840

cagtagtcgc cgtgaacgtt ctttttcgca acgggtttgc cgccagaaca caggttggac 900

cggtgccacc atggactata aggaccacga cggagactac aaggatcatg atattgatta 960

caaagacgat gacgataaga tggcccccaa aaagaaacga aaggtgggtg ggtccccaaa 1020

gaagaagcgg aaggtcggta tccacggagt cccagcagcc gacaagaagt acagcatcgg 1080

cctggacatc ggcaccaact ctgtgggctg ggccgtgatc accgacgagt acaaggtgcc 1140

cagcaagaaa ttcaaggtgc tgggcaacac cgaccggcac agcatcaaga agaacctgat 1200

cggagccctg ctgttcgaca gcggcgaaac agccgaggcc acccggctga agagaaccgc 1260

cagaagaaga tacaccagac ggaagaaccg gatctgctat ctgcaagaga tcttcagcaa 1320

cgagatggcc aaggtggacg acagcttctt ccacagactg gaagagtcct tcctggtgga 1380

agaggataag aagcacgagc ggcaccccat cttcggcaac atcgtggacg aggtggccta 1440

ccacgagaag taccccacca tctaccacct gagaaagaaa ctggtggaca gcaccgacaa 1500

ggccgacctg cggctgatct atctggccct ggcccacatg atcaagttcc ggggccactt 1560

cctgatcgag ggcgacctga accccgacaa cagcgacgtg gacaagctgt tcatccagct 1620

ggtgcagacc tacaaccagc tgttcgagga aaaccccatc aacgccagcg gcgtggacgc 1680

caaggccatc ctgtctgcca gactgagcaa gagcagacgg ctggaaaatc tgatcgccca 1740

gctgcccggc gagaagaaga atggcctgtt cggaaacctg attgccctga gcctgggcct 1800

gacccccaac ttcaagagca acttcgacct ggccgaggat gccaaactgc agctgagcaa 1860

ggacacctac gacgacgacc tggacaacct gctggcccag atcggcgacc agtacgccga 1920

cctgtttctg gccgccaaga acctgtccga cgccatcctg ctgagcgaca tcctgagagt 1980

gaacaccgag atcaccaagg cccccctgag cgcctctatg atcaagagat acgacgagca 2040

ccaccaggac ctgaccctgc tgaaagctct cgtgcggcag cagctgcctg agaagtacaa 2100

agagattttc ttcgaccaga gcaagaacgg ctacgccggc tacattgacg gcggagccag 2160

ccaggaagag ttctacaagt tcatcaagcc catcctggaa aagatggacg gcaccgagga 2220

actgctcgtg aagctgaaca gagaggacct gctgcggaag cagcggacct tcgacaacgg 2280

cagcatcccc caccagatcc acctgggaga gctgcacgcc attctgcggc ggcaggaaga 2340

tttttaccca ttcctgaagg acaaccggga aaagatcgag aagatcctga ccttccgcat 2400

cccctactac gtgggccctc tggccagggg aaacagcaga ttcgcctgga tgaccagaaa 2460

gagcgaggaa accatcaccc cctggaactt cgaggaagtg gtggacaagg gcgcttccgc 2520

ccagagcttc atcgagcgga tgaccaactt cgataagaac ctgcccaacg agaaggtgct 2580

gcccaagcac agcctgctgt acgagtactt caccgtgtat aacgagctga ccaaagtgaa 2640

atacgtgacc gagggaatga gaaagcccgc cttcctgagc ggcgagcaga aaaaggccat 2700

cgtggacctg ctgttcaaga ccaaccggaa agtgaccgtg aagcagctga aagaggacta 2760

cttcaagaaa atcgagtgct tcgactccgt ggaaatctcc ggcgtggaag atcggttcaa 2820

cgcctccctg ggcacatacc acgatctgct gaaaattatc aaggacaagg acttcctgga 2880

caatgaggaa aacgaggaca ttctggaaga tatcgtgctg accctgacac tgtttgagga 2940

cagagagatg atcgaggaac ggctgaaaac ctatgcccac ctgttcgacg acaaagtgat 3000

gaagcagctg aagcggcgga gatacaccgg ctggggcagg ctgagccgga agctgatcaa 3060

cggcatccgg gacaagcagt ccggcaagac aatcctggat ttcctgaagt ccgacggctt 3120

cgccaacaga aacttcatgc agctgatcca cgacgacagc ctgaccttta aagaggacat 3180

ccagaaagcc caggtgtccg gccagggcga tagcctgcac gagcacattg ccaatctggc 3240

cggcagcccc gccattaaga agggcatcct gcagacagtg aaggtggtgg acgagctcgt 3300

gaaagtgatg ggccggcaca agcccgagaa catcgtgatc gaaatggcca gagagaacca 3360

gaccacccag aagggacaga agaacagccg cgagagaatg aagcggatcg aagagggcat 3420

caaagagctg ggcagccaga tcctgaaaga acaccccgtg gaaaacaccc agctgcagaa 3480

cgagaagctg tacctgtact acctgcagaa tgggcgggat atgtacgtgg accaggaact 3540

ggacatcaac cggctgtccg actacgatgt ggaccatatc gtgcctcaga gctttctgaa 3600

ggacgactcc atcgacaaca aggtgctgac cagaagcgac aagaaccggg gcaagagcga 3660

caacgtgccc tccgaagagg tcgtgaagaa gatgaagaac tactggcggc agctgctgaa 3720

cgccaagctg attacccaga gaaagttcga caatctgacc aaggccgaga gaggcggcct 3780

gagcgaactg gataaggccg gcttcatcaa gagacagctg gtggaaaccc ggcagatcac 3840

aaagcacgtg gcacagatcc tggactcccg gatgaacact aagtacgacg agaatgacaa 3900

gctgatccgg gaagtgaaag tgatcaccct gaagtccaag ctggtgtccg atttccggaa 3960

ggatttccag ttttacaaag tgcgcgagat caacaactac caccacgccc acgacgccta 4020

cctgaacgcc gtcgtgggaa ccgccctgat caaaaagtac cctaagctgg aaagcgagtt 4080

cgtgtacggc gactacaagg tgtacgacgt gcggaagatg atcgccaaga gcgagcagga 4140

aatcggcaag gctaccgcca agtacttctt ctacagcaac atcatgaact ttttcaagac 4200

cgagattacc ctggccaacg gcgagatccg gaagcggcct ctgatcgaga caaacggcga 4260

aaccggggag atcgtgtggg ataagggccg ggattttgcc accgtgcgga aagtgctgag 4320

catgccccaa gtgaatatcg tgaaaaagac cgaggtgcag acaggcggct tcagcaaaga 4380

gtctatcctg cccaagagga acagcgataa gctgatcgcc agaaagaagg actgggaccc 4440

taagaagtac ggcggcttcg acagccccac cgtggcctat tctgtgctgg tggtggccaa 4500

agtggaaaag ggcaagtcca agaaactgaa gagtgtgaaa gagctgctgg ggatcaccat 4560

catggaaaga agcagcttcg agaagaatcc catcgacttt ctggaagcca agggctacaa 4620

agaagtgaaa aaggacctga tcatcaagct gcctaagtac tccctgttcg agctggaaaa 4680

cggccggaag agaatgctgg cctctgccgg cgaactgcag aagggaaacg aactggccct 4740

gccctccaaa tatgtgaact tcctgtacct ggccagccac tatgagaagc tgaagggctc 4800

ccccgaggat aatgagcaga aacagctgtt tgtggaacag cacaagcact acctggacga 4860

gatcatcgag cagatcagcg agttctccaa gagagtgatc ctggccgacg ctaatctgga 4920

caaagtgctg tccgcctaca acaagcaccg ggataagccc atcagagagc aggccgagaa 4980

tatcatccac ctgtttaccc tgaccaatct gggagcccct gccgccttca agtactttga 5040

caccaccatc gaccggaaga ggtacaccag caccaaagag gtgctggacg ccaccctgat 5100

ccaccagagc atcaccggcc tgtacgagac acggatcgac ctgtctcagc tgggaggcga 5160

caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa aagaaaaagg gcggctccaa 5220

gcggcctgcc gcgacgaaga aagcgggaca ggccaagaaa aagaaaggat ccggcgcaac 5280

aaacttctct ctgctgaaac aagccggaga tgtcgaagag aatcctggac cggtgagcaa 5340

gggcgaggag ctgttcaccg gggtggtgcc catcctggtc gagctggacg gcgacgtaaa 5400

cggccacaag ttcagcgtgt ccggcgaggg cgagggcgat gccacctacg gcaagctgac 5460

cctgaagttc atctgcacca ccggcaagct gcccgtgccc tggcccaccc tcgtgaccac 5520

cctgacctac ggcgtgcagt gcttcagccg ctaccccgac cacatgaagc agcacgactt 5580

cttcaagtcc gccatgcccg aaggctacgt ccaggagcgc accatcttct tcaaggacga 5640

cggcaactac aagacccgcg ccgaggtgaa gttcgagggc gacaccctgg tgaaccgcat 5700

cgagctgaag ggcatcgact tcaaggagga cggcaacatc ctggggcaca agctggagta 5760

caactacaac agccacaacg tctatatcat ggccgacaag cagaagaacg gcatcaaggt 5820

gaacttcaag atccgccaca acatcgagga cggcagcgtg cagctcgccg accactacca 5880

gcagaacacc cccatcggcg acggccccgt gctgctgccc gacaaccact acctgagcac 5940

ccagtccgcc ctgagcaaag accccaacga gaagcgcgat cacatggtcc tgctggagtt 6000

cgtgaccgcc gccgggatca ctctcggcat ggacgagctg tacaagggct ccggcgaggg 6060

caggggaagt cttctaacat gcggggacgt ggaggaaaat cccggcccaa ccgagtacaa 6120

gcccacggtg cgcctcgcca cccgcgacga cgtccccagg gccgtacgca ccctcgccgc 6180

cgcgttcgcc gactaccccg ccacgcgcca caccgtcgat ccggaccgcc acatcgagcg 6240

ggtcaccgag ctgcaagaac tcttcctcac gcgcgtcggg ctcgacatcg gcaaggtgtg 6300

ggtcgcggac gacggcgccg cggtggcggt ctggaccacg ccggagagcg tcgaagcggg 6360

ggcggtgttc gccgagatcg gcccgcgcat ggccgagttg agcggttccc ggctggccgc 6420

gcagcaacag atggaaggcc tcctggcgcc gcaccggccc aaggagcccg cgtggttcct 6480

ggccaccgtc ggagtctcgc ccgaccacca gggcaagggt ctgggcagcg ccgtcgtgct 6540

ccccggagtg gaggcggccg agcgcgccgg ggtgcccgcc ttcctggaga cctccgcgcc 6600

ccgcaacctc cccttctacg agcggctcgg cttcaccgtc accgccgacg tcgaggtgcc 6660

cgaaggaccg cgcacctggt gcatgacccg caagcccggt gcctgaacgc gttaagtcga 6720

caatcaacct ctggattaca aaatttgtga aagattgact ggtattctta actatgttgc 6780

tccttttacg ctatgtggat acgctgcttt aatgcctttg tatcatgcta ttgcttcccg 6840

tatggctttc attttctcct ccttgtataa atcctggttg ctgtctcttt atgaggagtt 6900

gtggcccgtt gtcaggcaac gtggcgtggt gtgcactgtg tttgctgacg caacccccac 6960

tggttggggc attgccacca cctgtcagct cctttccggg actttcgctt tccccctccc 7020

tattgccacg gcggaactca tcgccgcctg ccttgcccgc tgctggacag gggctcggct 7080

gttgggcact gacaattccg tggtgttgtc ggggaaatca tcgtcctttc cttggctgct 7140

cgcctgtgtt gccacctgga ttctgcgcgg gacgtccttc tgctacgtcc cttcggccct 7200

caatccagcg gaccttcctt cccgcggcct gctgccggct ctgcggcctc ttccgcgtct 7260

tcgccttcgc cctcagacga gtcggatctc cctttgggcc gcctccccgc gtcgacttta 7320

agaccaatga cttacaaggc agctgtagat cttagccact ttttaaaaga aaagggggga 7380

ctggaagggc taattcactc ccaacgaaga caagatctgc tttttgcttg tactgggtct 7440

ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt 7500

aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac 7560

tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagggcc 7620

cgtttaaacc cgctgatcag cctcgactgt gccttctagt tgccagccat ctgttgtttg 7680

cccctccccc gtgccttcct tgaccctgga aggtgccact cccactgtcc tttcctaata 7740

aaatgaggaa attgcatcgc attgtctgag taggtgtcat tctattctgg ggggtggggt 7800

ggggcaggac agcaaggggg aggattggga agacaatagc aggcatgctg gggatgcggt 7860

gggctctatg gcctgcaggg gcgcctgatg cggtattttc tccttacgca tctgtgcggt 7920

atttcacacc gcatacgtca aagcaaccat agtacgcgcc ctgtagcggc gcattaagcg 7980

cggcgggtgt ggtggttacg cgcagcgtga ccgctacact tgccagcgcc ttagcgcccg 8040

ctcctttcgc tttcttccct tcctttctcg ccacgttcgc cggctttccc cgtcaagctc 8100

taaatcgggg gctcccttta gggttccgat ttagtgcttt acggcacctc gaccccaaaa 8160

aacttgattt gggtgatggt tcacgtagtg ggccatcgcc ctgatagacg gtttttcgcc 8220

ctttgacgtt ggagtccacg ttctttaata gtggactctt gttccaaact ggaacaacac 8280

tcaactctat ctcgggctat tcttttgatt tataagggat tttgccgatt tcggtctatt 8340

ggttaaaaaa tgagctgatt taacaaaaat ttaacgcgaa ttttaacaaa atattaacgt 8400

ttacaatttt atggtgcact ctcagtacaa tctgctctga tgccgcatag ttaagccagc 8460

cccgacaccc gccaacaccc gctgacgcgc cctgacgggc ttgtctgctc ccggcatccg 8520

cttacagaca agctgtgacc gtctccggga gctgcatgtg tcagaggttt tcaccgtcat 8580

caccgaaacg cgcgagacga aagggcctcg tgatacgcct atttttatag gttaatgtca 8640

tgataataat ggtttcttag acgtcaggtg gcacttttcg gggaaatgtg cgcggaaccc 8700

ctatttgttt atttttctaa atacattcaa atatgtatcc gctcatgaga caataaccct 8760

gataaatgct tcaataatat tgaaaaagga agagtatgag tattcaacat ttccgtgtcg 8820

cccttattcc cttttttgcg gcattttgcc ttcctgtttt tgctcaccca gaaacgctgg 8880

tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt gggttacatc gaactggatc 8940

tcaacagcgg taagatcctt gagagttttc gccccgaaga acgttttcca atgatgagca 9000

cttttaaagt tctgctatgt ggcgcggtat tatcccgtat tgacgccggg caagagcaac 9060

tcggtcgccg catacactat tctcagaatg acttggttga gtactcacca gtcacagaaa 9120

agcatcttac ggatggcatg acagtaagag aattatgcag tgctgccata accatgagtg 9180

ataacactgc ggccaactta cttctgacaa cgatcggagg accgaaggag ctaaccgctt 9240

ttttgcacaa catgggggat catgtaactc gccttgatcg ttgggaaccg gagctgaatg 9300

aagccatacc aaacgacgag cgtgacacca cgatgcctgt agcaatggca acaacgttgc 9360

gcaaactatt aactggcgaa ctacttactc tagcttcccg gcaacaatta atagactgga 9420

tggaggcgga taaagttgca ggaccacttc tgcgctcggc ccttccggct ggctggttta 9480

ttgctgataa atctggagcc ggtgagcgtg gaagccgcgg tatcattgca gcactggggc 9540

cagatggtaa gccctcccgt atcgtagtta tctacacgac ggggagtcag gcaactatgg 9600

atgaacgaaa tagacagatc gctgagatag gtgcctcact gattaagcat tggtaactgt 9660

cagaccaagt ttactcatat atactttaga ttgatttaaa acttcatttt taatttaaaa 9720

ggatctaggt gaagatcctt tttgataatc tcatgaccaa aatcccttaa cgtgagtttt 9780

cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga gatccttttt 9840

ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt 9900

tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc agagcgcaga 9960

taccaaatac tgttcttcta gtgtagccgt agttaggcca ccacttcaag aactctgtag 10020

caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc agtggcgata 10080

agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg cagcggtcgg 10140

gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac accgaactga 10200

gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca 10260

ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt ccagggggaa 10320

acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt 10380

tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg gcctttttac 10440

ggttcctggc cttttgctgg ccttttgctc acatgt 10476

<210> 3

<211> 3120

<212> DNA

<213> Artificial sequence

<400> 3

gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 60

cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt 120

tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 180

aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt 240

ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg 300

ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga 360

tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc 420

tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac 480

actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg 540

gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca 600

acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg 660

gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg 720

acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg 780

gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag 840

ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg 900

gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct 960

cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac 1020

agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact 1080

catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga 1140

tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 1200

cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct 1260

gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 1320

taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgttc 1380

ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 1440

tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 1500

ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 1560

cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 1620

agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 1680

gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 1740

atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 1800

gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1860

gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 1920

ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 1980

cagtgagcga ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 2040

cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca 2100

acgcaattaa tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc 2160

cggctcgtat gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg 2220

accatgatta cgccaagctt gcatgcaggc ctctgcagtc gacgggcccg ggatccgatg 2280

ataaacatgt gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc 2340

tgttagagag ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac 2400

gtgacgtaga aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat 2460

ggactatcat atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt 2520

gtggaaagga cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag 2580

ttaaaataag gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttc 2640

tagcgcgtgc gccaattctg cagacaaatg gctctagagg tacccataga tctagatgca 2700

ttcgcgaggt accgagctcg aattcactgg ccgtcgtttt acaacgtcgt gactgggaaa 2760

accctggcgt tacccaactt aatcgccttg cagcacatcc ccctttcgcc agctggcgta 2820

atagcgaaga ggcccgcacc gatcgccctt cccaacagtt gcgcagcctg aatggcgaat 2880

ggcgcctgat gcggtatttt ctccttacgc atctgtgcgg tatttcacac cgcatatggt 2940

gcactctcag tacaatctgc tctgatgccg catagttaag ccagccccga cacccgccaa 3000

cacccgctga cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg 3060

tgaccgtctc cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga 3120

<210> 4

<211> 368

<212> PRT

<213> Sus scrofa

<400> 4

Met Leu Lys Pro Pro Leu Pro Val Lys Ser Leu Leu Phe Leu Gln Leu

1 5 10 15

Pro Leu Leu Gly Val Gly Leu Asn Pro Lys Val Leu Thr His Ser Gly

20 25 30

Asn Glu Asp Ile Thr Ala Asp Phe Leu Leu Leu Ser Thr Pro Pro Gly

35 40 45

Thr Leu Asn Val Ser Thr Leu Pro Leu Pro Lys Val Gln Cys Phe Val

50 55 60

Phe Asn Val Glu Tyr Met Asn Cys Thr Trp Asn Ser Ser Ser Glu Leu

65 70 75 80

Gln Pro Thr Asn Leu Thr Leu His Tyr Trp Tyr Lys Thr Ser Asn Asp

85 90 95

Asp Lys Val Gln Glu Cys Gly His Tyr Leu Phe Ser Glu Gly Ile Thr

100 105 110

Ser Gly Cys Trp Phe Gly Lys Glu Glu Ile Arg Leu Tyr Gln Thr Phe

115 120 125

Val Val Gln Leu Gln Asp Pro Arg Glu Pro Arg Arg Gln Asp Pro Gln

130 135 140

Thr Leu Lys Leu Gln Asp Leu Val Ile Pro Trp Ala Pro Ala Asn Leu

145 150 155 160

Thr Leu Arg Thr Leu Ser Glu Ser Gln Leu Glu Leu Asn Trp Ser Asn

165 170 175

Arg Tyr Leu Asp His Cys Leu Glu His Leu Val Gln Tyr Arg Ser Asp

180 185 190

Arg Asp Arg Ser Trp Thr Glu Gln Ser Val Asp His Arg Gln Ser Phe

195 200 205

Ser Leu Pro Ser Val Asp Ala Gln Lys Leu Tyr Thr Phe Arg Val Arg

210 215 220

Ser Arg Tyr Asn Pro Leu Cys Gly Ser Ala Gln Arg Trp Ser Asp Trp

225 230 235 240

Ser His Pro Ile His Trp Gly Asn Thr Ser Lys Glu Asn Pro Leu Leu

245 250 255

Phe Ala Leu Glu Ala Val Leu Ile Pro Leu Gly Ser Met Gly Leu Ile

260 265 270

Val Gly Leu Met Cys Val Tyr Cys Trp Leu Glu Arg Thr Met Pro Arg

275 280 285

Ile Pro Thr Leu Lys Asn Leu Glu Asp Leu Val Thr Glu Tyr His Gly

290 295 300

Asn Phe Ser Ala Trp Ser Gly Val Ser Lys Gly Leu Ala Glu Ser Leu

305 310 315 320

Gln Pro Asp Tyr Ser Glu Arg Leu Cys His Val Ser Glu Ile Ser Pro

325 330 335

Lys Gly Gly Ala Leu Gly Glu Gly Pro Gly Gly Ser Pro Cys Ser Gln

340 345 350

His Ser Pro Tyr Trp Ala Pro Pro Cys Tyr Thr Leu Lys Pro Glu Thr

355 360 365

<210> 5

<211> 1185

<212> DNA

<213> Sus scrofa

<400> 5

aaattttaga gtactggggg gagggcaagg ggaagggttc cctgcctagt gctgcttctt 60

cttctgacca tcatgtcttc cctttgcctc ccccacttca ttttctcccc gtcctagatt 120

tcctcctgct ctctacaccc cctgggactc tcaacgtttc cactctaccc ctcccaaagg 180

ttcagtgttt tgtgttcaat gttgagtaca tgaattgcac ttggaacagc agctctgagc 240

tccagcctac caacctaact ctgcactact ggtatgagaa gggaagaggg gatatagcac 300

aggggaggga ggaagaggcg ctgggctaga tgtgagagat tgtgtgagga ccaagaaaga 360

ggttagccag catcccaggc ttcccactat attctcgtgg ggtaagtcat aagtcagttc 420

gtaggagctg aggctggact gtggaatctg tggtattcac atttacctca ctgttattct 480

tccttgaaat ccttctctag gtacaagacc tctaatgatg ataaagtcca ggagtgtggc 540

cactatctat tctctgaagg gatcacttct ggctgttggt ttggaaaaga ggagatccgc 600

ctctaccaaa catttgttgt ccagctccag gacccacggg aacccaggag gcaggaccca 660

cagacgctaa aactacagga tctgggtaat ttggaaatgg ggagggtcaa gggatattgt 720

gggggtattg gtgtatgtag agtggtattc ttgcaccata agggtacttg ggcagaaaag 780

aagaagtgag ggatccaatg gggtcgggag gagggatcag gagcactgcc ctcaggatcc 840

tgacttgtct aggccagggg aatgaccaca cacgcacaca tatctccagt gatcccctgg 900

gcgccggcga atctgaccct tcgcaccctg agtgaatccc agctagaact cagctggagc 960

aaccgatact tggaccactg tttggagcac ctcgtgcaat accggagtga ccgggaccgc 1020

agctggactg tgagtgagtg ggaacagcag ctggggctga gcaagtgggg ataaaggatt 1080

caatcagtcc agtaggaagg cttgattccc agctcctatt ctctgcatcc tggtgcctct 1140

gcccaccttc tcccctcctt ggactccttt ctctgtcgtc accat 1185

<210> 6

<211> 100

<212> RNA

<213> Artificial sequence

<400> 6

ccuguaguuu uagcgucugu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 7

<211> 100

<212> RNA

<213> Artificial sequence

<400> 7

caacaaaugu uugguagagg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 8

<211> 100

<212> RNA

<213> Artificial sequence

<400> 8

gaugauaaag uccaggagug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 9

<211> 100

<212> RNA

<213> Artificial sequence

<400> 9

cuggacuuua ucaucauuag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 10

<211> 100

<212> RNA

<213> Artificial sequence

<400> 10

uuguccagcu ccaggaccca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 11

<211> 100

<212> RNA

<213> Artificial sequence

<400> 11

ggccacuauc uauucucuga guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 12

<211> 100

<212> RNA

<213> Artificial sequence

<400> 12

ucccuucaga gaauagauag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 13

<211> 100

<212> RNA

<213> Artificial sequence

<400> 13

aacauuuguu guccagcucc guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 14

<211> 100

<212> RNA

<213> Artificial sequence

<400> 14

uguccagcuc caggacccac guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 15

<211> 364

<212> PRT

<213> Sus scrofa

<400> 15

Met Thr Gln Thr Pro Ala Phe Asp Lys Pro Lys Val Glu Leu His Val

1 5 10 15

His Leu Asp Gly Ala Ile Lys Pro Glu Thr Ile Leu Tyr Tyr Gly Arg

20 25 30

Lys Arg Gly Ile Ala Leu Pro Ala Asn Thr Pro Glu Glu Leu Gln Asp

35 40 45

Val Ile Gly Met Asp Lys Pro Leu Ser Leu Pro Ala Phe Leu Ala Lys

50 55 60

Phe Asp Tyr Tyr Met Pro Ala Ile Ala Xaa Gly Leu Pro Glu Ala Val

65 70 75 80

Lys Arg Ile Ala Tyr Glu Phe Val Glu Met Lys Ala Lys Glu Gly Val

85 90 95

Val Tyr Val Glu Val Arg Tyr Ser Pro His Leu Leu Ala Asn Ser Lys

100 105 110

Val Glu Pro Ile Pro Trp Asn Gln Ala Glu Gly Asp Leu Thr Pro Asp

115 120 125

Glu Val Val Asp Leu Val Gly Gln Gly Leu Gln Glu Gly Glu Arg Asp

130 135 140

Phe Gly Val Lys Val Arg Ser Ile Leu Cys Cys Met Arg His Gln Pro

145 150 155 160

Thr Trp Ser Pro Glu Val Val Glu Leu Cys Lys Lys Tyr Arg Gln Gln

165 170 175

Thr Val Val Ala Ile Asp Leu Ala Gly Asp Glu Thr Ile Glu Gly Ser

180 185 190

Ser Leu Phe Pro Gly His Val Gln Ala Tyr Glu Glu Ala Val Lys Ser

195 200 205

Gly Val His Arg Thr Val His Ala Gly Glu Val Gly Ser Ala Glu Val

210 215 220

Val Lys Glu Ala Val Asp Thr Leu Lys Thr Glu Arg Leu Gly His Gly

225 230 235 240

Tyr His Thr Leu Glu Asp Glu Ala Leu Tyr Thr Arg Leu Arg Gln Ala

245 250 255

Asn Met His Phe Glu Val Cys Pro Trp Ser Ser Tyr Leu Thr Gly Ala

260 265 270

Trp Lys Pro Gly Thr Glu His Ala Val Ile Arg Phe Lys Asn Asp Gln

275 280 285

Ala Asn Tyr Ser Leu Asn Thr Asp Asp Pro Leu Ile Phe Lys Ser Thr

290 295 300

Leu Asp Thr Asp Tyr Gln Met Thr Lys Arg Asp Met Gly Phe Thr Glu

305 310 315 320

Glu Glu Phe Lys Arg Leu Asn Ile Asn Ala Ala Lys Ser Ser Phe Leu

325 330 335

Pro Asp Asp Glu Lys Thr Glu Leu Leu Asp Leu Leu Tyr Lys Ala Tyr

340 345 350

Gly Met Pro Pro Thr Ser Ser Ala Glu His Arg Pro

355 360

<210> 16

<211> 1143

<212> DNA

<213> Sus scrofa

<400> 16

cgtggagatg gggagactgg ttagagggcg aaggtggtta gaagcacaga ggaagggccg 60

agaactggca tagagatcag aaataaagct cagtggtaat gaacctgact agtatccata 120

aagatgtggg tctgatccct ggcctgctca gtgggttaag gatctggtgt tgcggtgagc 180

tgcggtgtag gtcgcagaca cggcctggat ctggcattgc catgactgtg gtatatgctg 240

gcagctccat tttgacctct ggcctgggaa cttacatatg tcatgagtgt agtcctaaaa 300

acaaacaaaa aaattagagc caatgggact ctctatgctt ctagaatttt cttcagcaga 360

tgccaagagc tcgagactga gtaataagac tgggggccag acatgggttt gatctgccac 420

aggttgtgga cagctttgtt actcctggag ctcccaagag acttgggcag cattgtcccc 480

aacccctctt tccttctcag gggctcccgg aggccgtcaa aaggattgcc tacgagtttg 540

tggagatgaa agccaaggag ggcgtggtgt acgtggaggt gcgctacagc ccgcacctgc 600

tggccaactc caaggtggag ccgatcccct ggaaccaggc tgagtgagca accacccgga 660

gggctgtggc ggggtggccc aacccgcaac cgagcggcgg actctcagga gaccctgacc 720

caagagagac tttgatcttg ctccctgtgc tggtccacgg cctcagaaag atgggcttgg 780

ccgtcctaag ggacaggttc ccatccctca cctgggcttg cgtgttcacc ttgggtgaaa 840

gcgtttggct gcgtggccgt ccctcgtcct agatacaggg ctggagtcta ggagtgtgaa 900

cctggttatc cagtgactcc tagagggcct gtcctaaccc tgtaactgaa gtgggtctgg 960

cctattcctg ccctctctgc ccggacctca gggaggtcta agtggtacca cccgactacc 1020

ttgctccctt ctagccatga ctttgatgct tgtggacatg tgggaatctg acaccatagc 1080

agcgctctcc atcttggggc gggggatggg tttgtgtgcg acaacccccc caacacactg 1140

gga 1143

<210> 17

<211> 100

<212> RNA

<213> Artificial sequence

<400> 17

aaggauugcc uacgaguuug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 18

<211> 100

<212> RNA

<213> Artificial sequence

<400> 18

uuggaguugg ccagcaggug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 19

<211> 100

<212> RNA

<213> Artificial sequence

<400> 19

uuucaucucc acaaacucgu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 20

<211> 100

<212> RNA

<213> Artificial sequence

<400> 20

ucagccuggu uccaggggau guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 21

<211> 100

<212> RNA

<213> Artificial sequence

<400> 21

ccugcuggcc aacuccaaag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 22

<211> 100

<212> RNA

<213> Artificial sequence

<400> 22

ggagggcgug guguacgugg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 23

<211> 100

<212> RNA

<213> Artificial sequence

<400> 23

caaggagggc gugguguacg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 24

<211> 100

<212> RNA

<213> Artificial sequence

<400> 24

uguggagaug aaagccaagg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

Claims

The application of sgRNA combination or plasmid combination in the preparation of a kit; the application of the kit is as follows (a) or (b): (a) preparing a recombinant cell; (b) preparing an immunodeficiency animal model;

the sgRNA combination consists of sgRNAs_IL2RG-g7And sgRNA_ADA-g7Composition is carried out;

the plasmid combination consists of a plasmid pKG-T6gRNA (IL2RG-g7) and a plasmid pKG-T6gRNA (ADA-g 7);

the sgRNA is obtained by transcribing the plasmid pKG-T6gRNA (IL2RG-g7)_IL2RG-g7；

The sgRNA is obtained by transcribing the plasmid pKG-T6gRNA (ADA-g7)_ADA-g7；

The sgRNA_IL2RG-g7The target sequence binding region of (a) is as shown in SEQ ID NO: 12, nucleotides 1 to 20;

the sgRNA_ADA-g7The target sequence binding region of (a) is as shown in SEQ ID NO: 22 from nucleotide 1 to nucleotide 20.
2. Use of the plasmid combination of claim 1 and plasmid pKG-GE3 in the preparation of a kit; the application of the kit is as follows (a) or (b): (a) preparing a recombinant cell; (b) preparing an immunodeficiency animal model;

the plasmid pKG-GE3 has a specific fusion gene; the specific fusion gene encodes a specific fusion protein;

the specific fusion protein sequentially comprises the following elements from N end to C end: two nuclear localization signals, Cas9 protein, two nuclear localization signals, self-splicing polypeptide P2A, fluorescent reporter protein, self-cleavage polypeptide T2A and resistance screening marker protein;

in plasmid pKG-GE3, the expression of the specific fusion gene is driven by the EF1a promoter;

in plasmid pKG-GE3, the specific fusion gene has downstream of it a WPRE sequence element, a 3' LTR sequence element and a bGH poly (A) signal sequence element.
sgRNA combinations consisting of sgRNAs_IL2RG-g7And sgRNA_ADA-g7Composition is carried out;

the sgRNA_IL2RG-g7The target sequence binding region of (a) is as shown in SEQ ID NO: 12, nucleotides 1 to 20;

the sgRNA_ADA-g7The target sequence binding region of (a) is as shown in SEQ ID NO: 22 from nucleotide 1 to nucleotide 20.
4. A plasmid combination consisting of a plasmid pKG-T6gRNA (IL2RG-g7) and a plasmid pKG-T6gRNA (ADA-g 7);

the sgRNA is obtained by transcribing the plasmid pKG-T6gRNA (IL2RG-g7)_IL2RG-g7；

The sgRNA is obtained by transcribing the plasmid pKG-T6gRNA (ADA-g7)_ADA-g7；

The sgRNA_IL2RG-g7The target sequence binding region of (a) is as shown in SEQ ID NO: 12, nucleotides 1 to 20;

the sgRNA_ADA-g7The target sequence binding region of (a) is as shown in SEQ ID NO: 22 from nucleotide 1 to nucleotide 20.
5. A kit comprising the sgRNA combination of claim 3 or the plasmid combination of claim 4; the application of the kit is as follows (a) or (b): (a) preparing a recombinant cell; (b) and (4) preparing an immunodeficiency animal model.
6. The kit of claim 5, wherein: the kit further comprises the plasmid pKG-GE3 as described in claim 2.
7. The sgRNA combination according to claim 3, or the plasmid combination according to claim 4, or the kit according to claim 5, or the kit according to claim 6, for use in (a) or (b) as follows: (a) preparing a recombinant cell; (b) and (4) preparing an immunodeficiency animal model.
8. A method of making a recombinant cell comprising the steps of: co-transfecting pig cells with plasmid pKG-T6gRNA (IL2RG-g7), plasmid pKG-T6gRNA (ADA-g7) and plasmid pKG-GE3 to obtain recombinant cells with mutated IL2RG genes and ADA genes;

the sgRNA is obtained by transcribing the plasmid pKG-T6gRNA (IL2RG-g7)_IL2RG-g7；

The sgRNA is obtained by transcribing the plasmid pKG-T6gRNA (ADA-g7)_ADA-g7；

The sgRNA_IL2RG-g7The target sequence binding region of (a) is as shown in SEQ ID NO: 12, nucleotides 1 to 20;

the sgRNA_ADA-g7The target sequence binding region of (a) is as shown in SEQ ID NO: 22 from nucleotide 1 to nucleotide 20;

the plasmid pKG-GE3 has a specific fusion gene; the specific fusion gene encodes a specific fusion protein;

the specific fusion protein sequentially comprises the following elements from N end to C end: two nuclear localization signals, Cas9 protein, two nuclear localization signals, self-splicing polypeptide P2A, fluorescent reporter protein, self-cleavage polypeptide T2A and resistance screening marker protein;

in plasmid pKG-GE3, the expression of the specific fusion gene is driven by the EF1a promoter;

in plasmid pKG-GE3, the specific fusion gene has downstream of it a WPRE sequence element, a 3' LTR sequence element and a bGH poly (A) signal sequence element.
9. The recombinant cell produced by the method of claim 8.
10. Use of the recombinant cell of claim 9 for the preparation of an immunodeficient animal model.