CN106350541A - Construction method and application of congenital immunodeficiency gene therapy vector - Google Patents
Construction method and application of congenital immunodeficiency gene therapy vector Download PDFInfo
- Publication number
- CN106350541A CN106350541A CN201610819040.8A CN201610819040A CN106350541A CN 106350541 A CN106350541 A CN 106350541A CN 201610819040 A CN201610819040 A CN 201610819040A CN 106350541 A CN106350541 A CN 106350541A
- Authority
- CN
- China
- Prior art keywords
- promoter
- recombinant vector
- il2rg
- cell
- vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/177—Receptors; Cell surface antigens; Cell surface determinants
- A61K38/1793—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
- A61K48/0066—Manipulation of the nucleic acid to modify its expression pattern, e.g. enhance its duration of expression, achieved by the presence of particular introns in the delivered nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
- C12N2740/15041—Use of virus, viral particle or viral elements as a vector
- C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Wood Science & Technology (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Pharmacology & Pharmacy (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Virology (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a recombinant lentiviral vector for expressing an IL2RG gene and a preparation method of the recombinant lentiviral vector for expressing the IL2RG gene. The recombinant lentiviral vector is a self-inactivated third-generation lentiviral vector SIN, and the sequence of the IL2RG gene is shown as SEQ ID NO:1. The invention further provides application of the recombinant lentiviral vector to preparation of drugs for treating primary immunodeficiency diseases.
Description
Technical field
The present invention relates to a kind of recombinated interleukin-2 receptor subunits γ and its expression vector establishment method, belong to
Gene engineering technology field.
Background technology
Immunodeficiency (immunodeficiency disease, idd), refers to any one part work(of immune system
Energy is abnormal or disappearance is thus lead to the disease of immune dysfunction.According to the difference of disease incidence mechanism, immunodeficiency is permissible
It is divided into PID (primary immunodeficiency disease, pidd) and secondary immunodeficiency disease
(secondary immunodeficiency disease, sidd).Most of pidd are genetic diseasess among these, Er Qieduo
Send out in the child of less than 1 years old.According to the difference of genetic mutation, PID (pidd) can be subdivided into multiple Asias again
Class, at present it has been reported that just have including x chromosome linkage, autosomal recessive, autosomal dominant more than 300 kinds
Heredopathia.
Gene therapy refers to import in specific cell type target gene with cure diseases.Lack in constitutional immunity
Fall in the gene therapy of disease, the usual manner of gene therapy is the hematopoietic stem cell separating patient, by means of viral vector for example
Retrovirus import target gene to recover the expression of defective gene, repair the hematopoietic stem cell completing or hemopoietic precursors are thin
In born of the same parents, again import in the patient to recover immune system (the alain fischer et.al.nature of patient itself
reviews disease primers,2015).
The gene therapy early start of PID is in the early stage nineties in 20th century.At present, gene therapy exists
Research in four class PIDs is the most noticeable: x chain severe immunodeficiency (x-scid), adenosine deamination
Deficient severe immunodeficiency (ada-scid), wiskott-aldrich syndrome (was) and chronic granuloma (cgd).
Researcher carries out the clinical gene therapy experiment of correlation using γ retrovirus (γ rv) carrier.For example carry out gene earliest
In the PID ada-scid for the treatment of, achieved with one-tenth in the clinical experiment being carried out using γ rv viral vector
Work(.40 started from 2000 accept in the ada-scid patient of γ rv viral vector therapy, and the survival rate of patient is up to
100%, and disease free survival rate is more up to 75%.
Although γ rv viral vector can successfully realize the importing of exogenous gene in clinical studies, remove ada-scid
Outside patient, all the symptoms such as leukemia or myelodysplasia in other patients, and this safety with viral vector used is not
Foot is in close relations.For overcoming above difficulty, researcher spends huge energy in terms of viral vector transformation and builds and obtain safety
The higher viral vector of coefficient inactivates retrovirus (sin- γ rv) and inactivation slow viruss (sin-lv, self- certainly certainly
inactivating lentiviral vector).These novel carriers have been widely used for PID
In clinical gene therapy experiment, its safety is also confirmed.For example from the beginning of 2012, the clinical treatment of ada-scid
Begin with the higher slow virus carrier sin-lv of safety coefficient, the PRELIMINARY RESULTS of associated treatment also allows people joyful very much.
For another kind of PID x-scid, γ rv viral vector has also been applied wherein.1999-2006
Year, one has the gene therapy that 20 patients receive the mediation of γ rv viral vector, and wherein 18 patients are survived so far.But by
In the safety issue of γ rv viral vector, 5 patients are had to suffer from the white blood of t cell acute lymphocytic in the several years after the treatment
Sick (t-all).After this, 2010 start, and researcher adopts safety more preferable sin- γ rv and sin-lv viral vector
Carry out the gene therapy of x-scid, the clinical trial results wherein carried out with sin- γ rv viral vector were published in 2014
" New England Journal of Medicine " is upper: researcher has raised 9 scid-x1 patients in Europe and the U.S., and safety in utilization is more preferable
Sin- γ rv viral vector carries il2rg transgenic infected patient, and (morbidity of x-scid is derived from the disappearance of il2rg gene.) bone marrow
The cd34 positive cell in source is treated.After 12.1-38.7 after treatment month, have in 9 patients accepting treatment 8 people according to
So survive, 7 people have had functional peripheral blood t cell among these, and can effectively remove infection.In addition study and also refer to
The safety going out sin- γ rv viral vector is significantly improved than traditional γ rv viral vector.
But, there is no application at present in the world from the clinical trial report inactivating slow viruss (sin-lv) treatment x-scid disease
Road, the present invention designs and applies to come to congenital immune deficiency disease from inactivation slow viruss (sin-lv) structure il2rg carrier
Carry out gene therapy.
In addition to above-mentioned ada-scid and x-scid, the gene therapy of the PID of non-scid class
Also carry out.Compared with scid class disease, the PID of non-scid class is difficult to carry out hematopoietic stem cell transplantation
Treatment, thus gene therapy just seems more urgent.Non- scid class PID with was and cgd as representative,
Safety issue has equally been encountered in the gene therapy of early stage γ rv viral vector mediation, but the improvement with viral vector,
In was the and cgd clinical gene therapy experiment currently carrying out, all employ safety more preferable sin- γ rv and sin-lv
Viral vector, and the PRELIMINARY RESULTS of clinic shows, the integral status of the patient of acceptance treatment have obviously to be improved.
Therefore, the viral vector of selection is the higher sin-lv carrier of safety, builds the sin-lv disease of il2rg overexpression
Poisonous carrier, transforms to the promoter in carrier, obtains the sin-lv-il2rg carrier with high promoter activity, has weight
The research wanted and clinical value.
Content of the invention
The present invention provide a kind of recombinant vector it is characterised in that: this recombinant vector comprises viral vector and at least portion
The il2rg coded polynucleotide dividing.
Wherein, described viral vector is selected from the slow virus carrier of itself inactivation；Preferably described viral vector is selected from fugw；Excellent
The promoter selecting described viral vector is selected from ef1a promoter, cag promoter, hubi promoter, cbh promoter；Preferably described
The sequence of viral vector is as shown in seq id no 2；The sequence of preferably described recombinant vector is selected from seq id no 3,4,5
With the sequence in the group of 6 compositions.
Foregoing recombinant vector, described recombinant vector is to be connected to il2rg in the multiple clone site of fugw carrier
The dna fragment of gene, the sequence of preferably described il2rg gene is as shown in seq id no 1.
The invention provides a kind of preparation method of foregoing recombinant vector it is characterised in that: will be at least part of
Il2rg coded polynucleotide is connected in the multiple clone site of viral vector and builds recombinant vector, then positive recombinant vector is turned
Dye host cell culture, obtains described recombinant vector；Described viral vector is selected from the slow virus carrier of itself inactivation；Preferably institute
State viral vector and be selected from fugw；The promoter of preferably described viral vector is selected from ef1a promoter, cag promoter, hubi startup
Son, cbh promoter；The sequence of preferably described viral vector is as shown in seq id no 2；The sequence of preferably described il2rg gene
Row are as shown in seq id no 1；The sequence selection of preferably described recombinant vector is from the group that seq id no 3,4,5 and 6 forms
Sequence.
Foregoing preparation method is it is characterised in that divide in described at least part of il2rg coded polynucleotide end
Not Yin Ru bamhi and mfei restriction enzyme site, preferably described restriction enzyme site introduced by primer；Preferably described primer sequence
It is classified as: ggtaccgagctcggatccgc as shown in seq id no 7 and as shown in seq id no 8
cccaattggcgggtttatcacttatcgtcgtc.
Foregoing preparation method is it is characterised in that described fugw carrier passes through bamhi and ecori enzyme action.
Foregoing preparation method is it is characterised in that described be connected by is t4 ligase.
Foregoing preparation method is it is characterised in that described host cell is 293t cell.
Foregoing preparation method is it is characterised in that methods described includes the step screening positive recombinant vector: passes through
E. coli competent top10 converts, and monoclonal is selected, and pcr identifies, sequencing determines.
Present invention also offers a kind of virus, it comprises foregoing recombinant vector.
Present invention also offers a kind of host cell, described host cell comprises foregoing recombinant vector.
Wherein, described host cell is selected from 293t cell, hematopoietic stem cell, hemopoietic forebody cell.
Present invention also offers a kind of compositionss, described compositionss comprise the restructuring described in any one of claim 1-3
Virus described in carrier or claim 10 or at least one in the host cell described in claim 11 or 12.
The present invention still further provides foregoing recombinant vector or virus or as previously described place as previously described
The chief cell or foregoing compositionss purposes in preparation treatment PID medicine.
Wherein, described PID is selected from: antibody deficiency disease, t cell defect disease, t cell and b cell connection
Any one in closing defect disease, phagocyte defect disease and not replacing system defect sick.
In foregoing purposes, described medicine also comprises pharmaceutically useful diluent, excipient or drug administration carrier.
The beneficial effect of the invention
The beneficial effects of the present invention is using the higher sin-lv carrier of safety, building the sin- of il2rg overexpression
Lv viral vector, and by sin-lv overexpression il2rg infected rats model (il2rg knockout rat model), by analysis
The symptom variation of rat model, can make accurate assessment to the effectiveness of gene therapy x-scid.On this basis, fully
Carry out the gene therapy of clinic on the basis of assessment related gene Therapeutic safety and effectiveness, realize domestic x-scid gene
The treatment breakthrough of zero.
Brief description
Fig. 1 illustrates the sin-lv-il2rg Vector map that promoter is hubi.
Fig. 2 illustrates that the sin-lv-il2rg carrier that promoter is hubi transfects the immunoblotting analysis figure after 293t cell.
Fig. 3 illustrates the sin-lv-il2rg Vector map that promoter is ef1a.
Fig. 4 illustrates the sin-lv-il2rg Vector map that promoter is cag.
Fig. 5 illustrates the sin-lv-il2rg Vector map that promoter is cbh.
Fig. 6 illustrates that the sin-lv-il2rg carrier of activated sub- transformation transfects the immunoblotting analysis figure after 293t cell.
Specific embodiment
Below by specific embodiment and experimental data, the present invention is further illustrated.Although for clearly mesh
, proprietary term is used below, but these terms have been not meant to define or have limited the scope of the present invention.
Term " carrier " refers to, in genetic engineering restructuring dna technology, dna fragment (genes of interest) is transferred to recipient cell
A kind of dna molecule of energy self replication of born of the same parents, including bacterial plasmid, phage and animals and plants virus.In the present invention, term " disease
Poisonous carrier " has its genome of transmission using virus and enters other cells, and the molecular mechanism being infected betides intact live
In (in vivo) or cell culture (in vitro), also apply be applicable to including but not limited to basic research, gene therapy or epidemic disease
The fields such as Seedling exploitation.
Term " fugw carrier " is also referred to as fugw plasmid, and it includes but is not limited to the carrier through promoter engineering, wherein
Promoter includes but is not limited to: ef1a promoter, cag promoter, hubi promoter, cbh promoter.
Term " ubi ", " ubi " have identical meanings, are class promoteres, have two kinds of forms: one kind is that human ubiquitine opens
Mover, ubc；Another kind is plant ubiquitin promoter ubi.Therefore, in human diseasess field, " ubi " and " ubc " have identical
Implication.
Experimental technique in following embodiments, if no special instructions, is conventional method.
Specific embodiment:
Embodiment 1, sin-lv-il2rg build
The sequence of recombinated interleukin-2 receptor subunits γ gene (il2rg) of the present invention is according to genbank data
The il2rg gene order (as shown in seq id no 1) that storehouse provides carries out synthetic and forms.
The construction method of the restructuring application slow virus carrier of recombinated interleukin-2 receptor subunits γ gene, its step
Rapid inclusion:
Synthesis human interleukin-12 receptor subunits γ gene (il2rg) sequence, design primer (be respectively provided with bamhi and
Mfei restriction enzyme site), il2rg for:ggtaccgagctcggatccgc (as shown in seq id no 7)；il2rg rev
(mfei): cccaattggcgggtttatcacttatcgtcgtc (as shown in seq id no 8).
Expanded by pcr, wherein the pcr polymerase of selection is kod plus (toyobo, kod-201).Reaction system is such as
Under:
10 × kod plus buffer: 5 μ l；
Dntps (2.5mm each): 5 μ l；
The magnesium sulfate of 25mm: 2 μ l；
Kod plus dna polymerase: 1 μ l；
Dna template (50ng/ μ l): 1 μ l；
Il2rg primer (positive, reverse 10 μm): each 1.5 μ l
Distilled water: 33 μ l.
Pcr amplification condition:
95 DEG C 3 minutes；(98 DEG C 10 seconds, 54 DEG C 30 seconds, 68 DEG C 1 point 10 seconds) × 40 circulations；68 DEG C 10 minutes；10 DEG C 2 points
Clock.
Pcr product is tapped rubber after purification through dna, and using bamhi and mfei double digestion (restriction endonuclease is all from neb), fugw carries
(through the carrier of promoter engineering, wherein promoter includes but is not limited to body: ef1a promoter, cag promoter, hubi start
Son, cbh promoter) adopt bamhi and ecori double digestion (restriction endonuclease is all from neb).
Digestion products reclaim through rubber tapping, connect (from neb) il2rg digestion products using t4 ligase and produce with fugw enzyme action
Thing).Connection product is converted by E. coli competent top10, selects monoclonal, selects the positive after pcr identification, sequencing identification
Clone preserves.Positive colony carrier is:
1) promoter is the sin-lv-il2rg carrier of hubi, and, as shown in seq id no 3, Vector map is such as carrier sequence
Shown in Fig. 1；
2) promoter is the sin-lv-il2rg carrier of ef1a, and, as shown in seq id no 4, Vector map is such as carrier sequence
Shown in Fig. 3；
3) promoter is the sin-lv-il2rg carrier of cag, and, as shown in seq id no 5, Vector map is such as carrier sequence
Shown in Fig. 4；
4) promoter is the sin-lv-il2rg carrier of cbh, and, as shown in seq id no 6, Vector map is such as carrier sequence
Shown in Fig. 5；
Embodiment 2, the checking of sin-lv-il2rg
Positive colony is through transfection 293t cell checking.After sin-lv-il2rg expression vector rotaring redyeing 293 cell, carry within 48 hours
Take total protein, carry out western blot analysis, find that sin-lv-il2rg (hubi promoter) expression is normal (Fig. 2).
Embodiment 3, the comparison of different carriers expression effect
Promoter is respectively ef1a promoter, cag promoter, hubi promoter, the sin-lv-il2rg table of cbh promoter
After reaching carrier rotaring redyeing 293 cell, extract total protein within 48 hours, carry out western blot analysis, compare negative control group and (do not turn
Dye carrier), after ef1a promoter, cag promoter, hubi promoter, the sin-lv-il2rg expression vector of cbh promoter transfect
Cell in il2rg all have an expression, and thin after the sin-lv-il2rg expression vector transfection of ef1a promoter, hubi promoter
Il2rg expression higher (Fig. 6) in born of the same parents, illustrates above promoter with expression correlation in cell for the genes of interest preferably, egg
White expression effect is also preferable.
In protein expression system, for the different albumen of expression, it usually needs using different carriers.Mammal is thin
Cellular expression carrier must comprise protokaryon sequence, promoter, enhancer, selectable marker gene, terminator and polymerized nucleoside acid signal
Etc. control element.It is to improve expression in cell for the il2rg albumen, it has been found that multiple difference opens in this application
Mover drives il2rg albumen in the expression activity in 293t cell, ef1a promoter, cag promoter, hubi promoter, cbh
The sin-lv-il2rg expression vector of promoter, after cell transfecting, although il2rg all has expression, compares other startups
Son, the sin-lv-il2rg effect of ef1a promoter and hubi promoter is best.These explanation different promoters and destination protein
Expression between have differences, therefore il2rg egg in ef1a promoter or hubi promoter and sin-lv-il2rg carrier
Between white both expression effects, compatible degree is good.
Embodiment 4, the application of sin-lv-il2rg recombinant slow virus
By sin-lv overexpression il2rg infected rats model (il2rg knockout rat model), by analyzing rat mould
The symptom variation of type, can make accurate assessment to the effectiveness of gene therapy x-scid.On this basis moreover it is possible to further
Prepare the sin-lv virus of gmp rank, carry out clinical on the basis of abundant assessment related gene Therapeutic safety and effectiveness
Gene therapy, realize the domestic x-scid gene therapy breakthrough of zero.
More than, it is illustrated based on embodiments of the present invention, but the present invention is not limited to this, those skilled in the art
Member it should be understood that can be implemented in the way of being deformed and changing in the range of the purport of the present invention, such deformation and
The mode of change, ought to belong to protection scope of the present invention.
Claims (16)
1. a kind of recombinant vector it is characterised in that: this recombinant vector comprise viral vector and at least part of il2rg coding multinuclear
Thuja acid.
2. recombinant vector as claimed in claim 1, described viral vector is selected from the slow virus carrier of itself inactivation；Preferably described
Viral vector is selected from fugw；The promoter of preferably described viral vector be selected from ef1a promoter, cag promoter, hubi promoter,
Cbh promoter；The sequence of preferably described viral vector is as shown in seq id no 2；The sequence of preferably described recombinant vector is selected from
Sequence in the group being made up of seq id no 3,4,5 and 6.
3. recombinant vector as claimed in claim 1 or 2, described recombinant vector is to connect in the multiple clone site of fugw carrier
The dna fragment of il2rg gene, the sequence of preferably described il2rg gene is as shown in the seq id no 1.
4. the recombinant vector as described in any one of claim 1-3 preparation method it is characterised in that: will be at least part of
Il2rg coded polynucleotide is connected in the multiple clone site of viral vector and builds recombinant vector, then positive recombinant vector is turned
Dye host cell culture, obtains described recombinant vector；Described viral vector is selected from the slow virus carrier of itself inactivation；Preferably institute
State viral vector and be selected from fugw；The promoter of preferably described viral vector is selected from ef1a promoter, cag promoter, hubi startup
Son, cbh promoter；The sequence of preferably described viral vector is as shown in seq id no 2；The sequence of preferably described il2rg gene
Row are as shown in seq id no 1；The sequence selection of preferably described recombinant vector is from the group that seq id no 3,4,5 and 6 forms
Sequence.
5. preparation method as claimed in claim 4 is it is characterised in that in described at least part of il2rg coded polynucleotide
End introduces bamhi and mfei restriction enzyme site respectively, and preferably described restriction enzyme site is introduced by primer；Preferably described
Primer sequence is: ggtaccgagctcggatccgc as shown in seq id no 7 and as shown in seq id no 8
cccaattggcgggtttatcacttatcgtcgtc.
6. the preparation method as described in claim 4 or 5 is it is characterised in that described fugw carrier passes through bamhi and ecori
Enzyme action.
7. the preparation method as described in any one of claim 4-6 is it is characterised in that described be connected by is t4 ligase.
8. the preparation method as described in any one of claim 4-7 is it is characterised in that described host cell is 293t cell.
9. the preparation method as described in any one of claim 4-8 is it is characterised in that methods described includes screening positive restructuring load
The step of body: converted by E. coli competent top10, monoclonal is selected, pcr identifies, sequencing determines.
10. a kind of virus, it comprises the recombinant vector described in any one of claim 1-3.
A kind of 11. host cells, described host cell comprises the recombinant vector described in any one of claim 1-3.
12. host cells as claimed in claim 11, described host cell is before 293t cell, hematopoietic stem cell, hemopoietic
Somatic cell.
A kind of 13. compositionss, described compositionss comprise recombinant vector or claim 10 described in any one of claim 1-3
At least one in host cell described in described virus or claim 11 or 12.
14. recombinant vectors as described in any one of claim 1-3 or the virus as described in claim 10 or claim 11 or
Host cell described in 12 or the compositionss described in claim 13 use in preparation treatment PID medicine
On the way.
15. purposes as claimed in claim 14, described PID is selected from: antibody deficiency disease, t cell defect
Disease, t cell and b cell joint defect disease, phagocyte defect disease and do not replace system defect disease in any one.
16. purposes as described in claims 14 or 15 it is characterised in that described medicine also comprise pharmaceutically useful diluent,
Excipient or drug administration carrier.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610819040.8A CN106350541B (en) | 2016-09-13 | 2016-09-13 | Construction method and application of congenital immunodeficiency gene therapy vector |
| PCT/CN2017/099603 WO2018049980A1 (en) | 2016-09-13 | 2017-08-30 | Method for constructing congenital immunodeficiency gene therapy vector and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610819040.8A CN106350541B (en) | 2016-09-13 | 2016-09-13 | Construction method and application of congenital immunodeficiency gene therapy vector |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106350541A true CN106350541A (en) | 2017-01-25 |
| CN106350541B CN106350541B (en) | 2020-01-17 |
Family
ID=57859468
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610819040.8A Active CN106350541B (en) | 2016-09-13 | 2016-09-13 | Construction method and application of congenital immunodeficiency gene therapy vector |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN106350541B (en) |
| WO (1) | WO2018049980A1 (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018049980A1 (en) * | 2016-09-13 | 2018-03-22 | 苏州兰希亚生物科技有限公司 | Method for constructing congenital immunodeficiency gene therapy vector and use thereof |
| CN108504685A (en) * | 2018-03-27 | 2018-09-07 | 宜明细胞生物科技有限公司 | A method of utilizing CRISPR/Cas9 system homologous recombination repair IL-2RG dcc genes |
| CN110699381A (en) * | 2019-09-17 | 2020-01-17 | 合肥瑞灵生物科技有限公司 | Mediterranean anemia gene therapy vector construction method and application thereof |
| CN112522258A (en) * | 2020-09-16 | 2021-03-19 | 南京启真基因工程有限公司 | Recombinant cell with IL2RG gene and ADA gene jointly knocked out and application of recombinant cell in preparation of immunodeficient pig model |
| WO2022010761A1 (en) * | 2020-07-06 | 2022-01-13 | The Board Of Regents Of The University Of Texas System | Tdp-43 biosensor cell lines |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112522202B (en) * | 2020-09-23 | 2022-04-05 | 南京启真基因工程有限公司 | Method for preparing ADDI four-gene combined knockout severe immunodeficiency swine-derived recombinant cell and special kit thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106350541B (en) * | 2016-09-13 | 2020-01-17 | 合肥瑞灵生物科技有限公司 | Construction method and application of congenital immunodeficiency gene therapy vector |
-
2016
- 2016-09-13 CN CN201610819040.8A patent/CN106350541B/en active Active
-
2017
- 2017-08-30 WO PCT/CN2017/099603 patent/WO2018049980A1/en active Application Filing
Non-Patent Citations (3)
| Title |
|---|
| MARSHALL W HUSTON ET AL.: "Correction of Murine SCID-X1 by Lentiviral Gene Therapy Using a Codon-optimized IL2RG Gene and Minimal Pretransplant Conditioning", 《MOLECULAR THERAPY》 * |
| 何佳平 张敬之: "慢病毒载体转录"通读"改进研究进展", 《生物工程学报》 * |
| 张玲 等: "高效包装重组慢病毒及其定量方法的建立", 《白求恩医学杂志》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018049980A1 (en) * | 2016-09-13 | 2018-03-22 | 苏州兰希亚生物科技有限公司 | Method for constructing congenital immunodeficiency gene therapy vector and use thereof |
| CN108504685A (en) * | 2018-03-27 | 2018-09-07 | 宜明细胞生物科技有限公司 | A method of utilizing CRISPR/Cas9 system homologous recombination repair IL-2RG dcc genes |
| CN110699381A (en) * | 2019-09-17 | 2020-01-17 | 合肥瑞灵生物科技有限公司 | Mediterranean anemia gene therapy vector construction method and application thereof |
| WO2022010761A1 (en) * | 2020-07-06 | 2022-01-13 | The Board Of Regents Of The University Of Texas System | Tdp-43 biosensor cell lines |
| CN112522258A (en) * | 2020-09-16 | 2021-03-19 | 南京启真基因工程有限公司 | Recombinant cell with IL2RG gene and ADA gene jointly knocked out and application of recombinant cell in preparation of immunodeficient pig model |
| CN112522258B (en) * | 2020-09-16 | 2023-08-22 | 南京启真基因工程有限公司 | Recombinant cell with IL2RG gene and ADA gene knocked out in combined mode and application of recombinant cell in preparation of immunodeficiency pig model |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2018049980A1 (en) | 2018-03-22 |
| CN106350541B (en) | 2020-01-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106350541A (en) | Construction method and application of congenital immunodeficiency gene therapy vector | |
| CN104910278B (en) | A kind of slow virus with high-efficiency transfection ability and biological activity for being used to prepare CART cells | |
| CN113278619A (en) | Double sgRNA, gene knockout vector, pig fibroblast line with STING gene knockout function and construction method thereof | |
| CN109706148A (en) | A kind of gRNA, gRNA composition and electric shifting method for knocking out BCL11A gene or BCL11A genetic enhancer | |
| CN109486814A (en) | A kind of gRNA for repairing HBB1 point mutation, gene editing system, expression vector and gene editing kit | |
| CN105820255A (en) | Anti-CD33 chimeric antigen receptor, coding gene, recombinant expression vector and construction method and application of recombinant expression vector | |
| CN109652380A (en) | The CAR-T cell and its preparation method and application of LewisY is targeted based on base editor | |
| CN111484994B (en) | Method for specifically knocking out pig Fah and Rag2 double genes by CRISPR-Cas9 | |
| CN103724410B (en) | The fusion protein and method of one class regulation and control CCR5 and CXCR4 genes | |
| CN110760480A (en) | Anti-tumor NK (Natural killer) cell and preparation method thereof | |
| CN101245106A (en) | Anti-VRGF acceptor monoclone antibody, preparation method and application thereof | |
| CN109705225B (en) | Chimeric antigen receptor resisting human CAIX antigen and application thereof | |
| CN109055433B (en) | Method for activating expression of endogenous Ngn3 and MAFA genes | |
| CN109536494A (en) | A kind of gRNA for repairing HBB1 point mutation, gene editing system, expression vector and gene editing kit | |
| CN103509100B (en) | A kind of IL-1 R antagonist mutant | |
| JPH09503655A (en) | Method of suppressing autoimmune response | |
| CN102627690B (en) | Pair of transcription activator-like effector nucleases (TALENs) and coding genes and application thereof | |
| CN111321169A (en) | Genetically modified NK cell and preparation method and application thereof | |
| CN111518772A (en) | Construction method and application of NK cell for expressing hACE2 protein extracellular segment | |
| CN109402116A (en) | A kind of gRNA, gRNA composition and CRISPR-Cas9 system and application thereof for knocking out CCR5 gene | |
| CN113481238B (en) | Method for preparing IL-2Rg knockout non-human animal model and application thereof | |
| CN115058455B (en) | Preparation method and application of clinical blood immune cell preparation | |
| CN112342244B (en) | Cell strain for expressing Furin protein and application of cell strain in avian infectious bronchitis virus culture | |
| CN116693626A (en) | Staple peptides and uses thereof and methods for expanding stem cells in vitro | |
| US20210214722A1 (en) | Methods and materials for cloning functional t cell receptors from single t cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20180612 Address after: Room 6189, room 6, No. 999, Changning Road, Changning District, Shanghai Applicant after: Lanca Gene Technology Co., Ltd., Shanghai Address before: 215125 E190 unit, two floor, North Tower, A1 building, 218 bio Lake Park, Suzhou Industrial Park, Suzhou, Jiangsu. Applicant before: Suzhou Lanxi Ya Biological Technology Co. Ltd. |
|
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20190910 Address after: 230001 Room 2006, 21 Floor, F5 Building, Phase II, Innovation Industrial Park, 2800 Innovation Avenue, Hefei High-tech Zone, Anhui Province Applicant after: Hefei Ruiling Biotechnology Co., Ltd. Address before: 200051 room 6189, 6 building, 999 Changning Road, Changning District, Shanghai. Applicant before: Lanca Gene Technology Co., Ltd., Shanghai |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |