WO2018049980A1

WO2018049980A1 - Method for constructing congenital immunodeficiency gene therapy vector and use thereof

Info

Publication number: WO2018049980A1
Application number: PCT/CN2017/099603
Authority: WO
Inventors: 程田林; 仇子龙
Original assignee: 苏州兰希亚生物科技有限公司
Priority date: 2016-09-13
Filing date: 2017-08-30
Publication date: 2018-03-22
Also published as: CN106350541B; CN106350541A

Abstract

Disclosed are a recombinant lentiviral vector expressing the IL2RG gene, and the preparation thereof, wherein the vector is a self-inactivated third-generation lentiviral vector SIN, and the sequence of the IL2RG gene is as shown in SEQ ID NO: 1. Provided are a method for preparing the vector and the use of the vector in the preparation of a drug for treating primary immunodeficiency diseases.

Description

Congenital immunodeficiency gene therapy vector construction method and use thereof

Cross-reference to related applications

The present invention claims priority to Chinese Patent Application No. 201610819040.8, filed on Sep. 13, the entire content of

Technical field

The invention relates to a recombinant human interleukin 2 receptor subunit γ and a method for constructing the expression vector thereof, and belongs to the technical field of genetic engineering.

Background technique

Immunodeficiency disease (IDD) refers to a disease in which any part of the immune system is abnormally functioned or absent, resulting in immune dysfunction. According to the pathogenesis of diseases, immunodeficiency diseases can be divided into primary immunodeficiency disease (PIDD) and secondary immunodeficiency disease (SIDD). Most of these PIDDs are genetic diseases and are more common in children under one year of age. According to different genetic mutations, primary immunodeficiency disease (PIDD) can be subdivided into a variety of sub-categories, and more than 300 have been reported including X-linked, autosomal recessive, and autosomal dominant. Genetic disease.

Gene therapy refers to the introduction of a target gene into a specific cell type to cure the disease. In the gene therapy of primary immunodeficiency disease, the conventional way of gene therapy is to isolate the patient's hematopoietic stem cells, and to introduce the target gene by means of a viral vector such as retrovirus to restore the expression of the damaged gene, repair the completed hematopoietic stem cells or Hematopoietic progenitor cells are reintroduced into the patient's body to restore the patient's own immune system (Alain Fischer et. al. Nature reviews disease primers, 2015).

Gene therapy for primary immunodeficiency began in the early 1990s. At present, the research of gene therapy in four types of primary immunodeficiency diseases is the most striking: X-linked severe immunity Disease-deficient disease (X-SCID), adenosine deaminase-deficient severe immunodeficiency disease (ADA-SCID), Wiskott-Aldrich syndrome (WAS) and chronic granuloma (CGD). Researchers used gamma retrovirus (γRV) vectors for related gene therapy clinical trials. For example, in the primary immunodeficiency disease ADA-SCID, which was the first to carry out gene therapy, success has been achieved in clinical trials using γRV viral vectors. In the 40 patients with ADA-SCID who received γRV viral vector therapy since 2000, the survival rate of patients was as high as 100%, and the disease-free survival rate was as high as 75%.

Although γRV viral vectors can successfully achieve the introduction of foreign genes in clinical studies, all patients except ADA-SCID have symptoms such as leukemia or myelodysplasia, which is closely related to the safety of the viral vectors used. . In order to overcome the above difficulties, the researchers spent a great deal of effort in the transformation of viral vectors and constructed a viral vector with a higher safety factor, self-inactivation of retrovirus (SIN-γRV) and self-inactivating lentivirus (SIN-LV, Self-inactivating). Lentiviral vector). These novel vectors have been widely used in clinical trials of gene therapy for primary immunodeficiency diseases, and their safety has also been confirmed. For example, since 2012, the clinical treatment of ADA-SCID has also begun to use the lentivirus vector SIN-LV with higher safety factor. The preliminary results of related treatments are also very gratifying.

For another primary immunodeficiency disease X-SCID, a γRV viral vector has also been applied thereto. In 1999-2006, a total of 20 patients received γRV viral vector-mediated gene therapy, and 18 of them survived to date. However, due to the safety of the γRV viral vector, five patients developed T-cell acute lymphoblastic leukemia (T-ALL) within a few years after treatment. After that, in 2010, researchers began to use X-SCID gene therapy with safer SIN-γRV and SIN-LV viral vectors. The results of clinical trials with SIN-γRV viral vector were published in 2014. In the New England Journal of Medicine: Researchers recruited nine SCID-X1 patients in Europe and the United States to use the safer SIN-γRV viral vector to carry IL2RG transgenic infections (the pathogenesis of X-SCID is derived from the IL2RG gene). Missing.) Bone marrow-derived CD34 positive cells were treated. After 12.1-38.7 months after treatment, 8 of the 9 patients treated were still alive, 7 of whom had functional peripheral blood T cells and were able to effectively clear the infection. In addition, the study also pointed out that the safety of SIN-γRV virus vector is higher than that of traditional γRV. The viral vector has been significantly improved.

However, there are no clinical trials in the world for the treatment of X-SCID diseases by self-inactivation of lentivirus (SIN-LV). The present invention designs and uses self-inactivating lentivirus (SIN-LV) to construct IL2RG vectors for innate Gene therapy for sexually immunodeficient diseases.

In addition to the ADA-SCID and X-SCID mentioned above, gene therapy for non-SCID-type primary immunodeficiency diseases is also underway. Compared with SCID-like diseases, non-SCID primary immunodeficiency disease is difficult to carry out hematopoietic stem cell transplantation, so gene therapy is more urgent. The non-SCID primary immunodeficiency disease represented by WAS and CGD also encountered safety problems in early γRV viral vector-mediated gene therapy, but with the improvement of viral vectors, WAS and CGD are currently underway. In the clinical trials of gene therapy, the safer SIN-γRV and SIN-LV viral vectors were used, and the preliminary clinical results showed that the overall condition of the patients treated was significantly improved.

Therefore, the selected viral vector is a safer SIN-LV vector, and the IL2RG overexpressing SIN-LV viral vector is constructed, and the promoter in the vector is modified to obtain a SIN-LV-IL2RG vector with high promoter activity. Has important research and clinical value.

Summary of the invention

The invention provides a recombinant vector, characterized in that the recombinant vector comprises a viral vector and at least a portion of an IL2RG encoding polynucleotide.

Wherein the viral vector is selected from a lentiviral vector that is inactivated by itself; preferably the viral vector is selected from the group consisting of FUGW; preferably, the promoter of the viral vector is selected from the group consisting of an EF1a promoter, a CAG promoter, a hUbi promoter, and a CBh promoter. Preferably, the sequence of the viral vector is as set forth in SEQ ID NO: 2; preferably the sequence of the recombinant vector is selected from the group consisting of SEQ ID NOs: 3, 4, 5 and 6.

a recombinant vector as described above, which is in the cloning position of the FUGW vector A DNA fragment in which the IL2RG gene is ligated, and preferably the sequence of the IL2RG gene is shown in SEQ ID NO: 1.

The invention provides a preparation method of a recombinant vector as described above, characterized in that at least a part of the IL2RG encoding polynucleotide is ligated into a multiple cloning site of a viral vector to construct a recombinant vector, and then the positive recombinant vector is transferred. The host cell is cultured to obtain the recombinant vector; the viral vector is selected from a lentiviral vector which is inactivated by itself; preferably, the viral vector is selected from FUGW; preferably, the promoter of the viral vector is selected from the group consisting of EF1a promoter, CAG a promoter, a hUbi promoter, a CBh promoter; preferably the sequence of the viral vector is set forth in SEQ ID NO: 2; preferably the sequence of the IL2RG gene is set forth in SEQ ID NO: 1; preferably the recombinant vector The sequences were selected from the sequences in the group consisting of SEQ ID NOs: 3, 4, 5 and 6.

The preparation method as described above, characterized in that a BamHI and MfeI cleavage site is introduced at the end of the at least part of the IL2RG-encoding polynucleotide, preferably the cleavage site is introduced by a primer; The primer sequences described are: GGTACCGAGCTCGGATCCGC as shown in SEQ ID NO: 7 and CCCAATTGGCGGGTTTATCACTTATCGTCGTC as shown in SEQ ID NO: 8.

The preparation method as described above, characterized in that the FUGW vector is digested with BamHI and EcoRI.

The preparation method as described above, characterized in that the connection employs a T4 ligase.

The preparation method as described above, characterized in that the host cell is a 293T cell.

The preparation method as described above, characterized in that the method comprises the step of screening a positive recombinant vector: by E. coli competent TOP10 transformation, monoclonal selection, PCR identification, and sequencing.

The invention also provides a virus comprising a recombinant vector as described above.

The invention also provides a host cell comprising a recombinant vector as described above.

Wherein the host cell is selected from the group consisting of 293T cells, hematopoietic stem cells, and hematopoietic precursor cells.

The present invention also provides a composition comprising the recombinant vector of any one of claims 1 to 3 or the virus of claim 10 or the host cell of claim 11 or 12 At least one.

The invention still further provides the use of a recombinant vector as described above or a virus as described above or a host cell as described above or a composition as described above for the preparation of a medicament for the treatment of primary immunodeficiency disease.

Wherein the primary immunodeficiency disease is selected from the group consisting of: antibody deficiency disease, T cell deficiency disease, T cell and B cell combined deficiency disease, phagocytic cell deficiency disease and non-systemic deficiency disease.

In the use as described above, the medicament further comprises a pharmaceutically acceptable diluent, excipient or carrier for administration.

Advantageous effects of the invention

The present invention has the beneficial effects of constructing an IL2RG overexpressing SIN-LV viral vector by using a more safe SIN-LV vector, and over-expressing the IL2RG-infected rat model (IL2RG knockout rat model) by SIN-LV, By analyzing the symptom changes in the rat model, an accurate assessment of the effectiveness of gene therapy X-SCID can be made. On this basis, the clinical gene therapy was carried out on the basis of fully assessing the safety and effectiveness of related gene therapy, and the breakthrough of X-SCID gene therapy in China was achieved.

DRAWINGS

Figure 1 shows a SIN-LV-IL2RG vector map of the promoter hHbi.

Figure 2 shows the immunoblotting profile after transfection of 293T cells with the SIN-LV-IL2RG vector with the promoter hHbi.

Figure 3 shows a SIN-LV-IL2RG vector map of the promoter EF1a.

Figure 4 shows a SIN-LV-IL2RG vector map of the promoter as CAG.

Figure 5 shows a SIN-LV-IL2RG vector map of the promoter CBh.

Figure 6 shows the immunoblotting profile after transfection of 293T cells with the promoter-engineered SIN-LV-IL2RG vector.

detailed description

The present invention will be further described below by way of specific embodiments and experimental data. Although specific terms are used hereinafter for the purpose of clarity, these terms are not intended to define or limit the scope of the invention.

The term "vector" refers to a self-replicating DNA molecule, including bacterial plasmids, bacteriophages, and animal and plant viruses, that transfer a DNA fragment (the gene of interest) to a recipient cell in genetically engineered recombinant DNA technology. In the present invention, the term "viral vector" utilizes a molecular mechanism in which a virus transmits its genome into other cells for infection, occurs in a whole in vivo or in vitro, and can also be applied to include but not Limited to basic research, gene therapy or vaccine development.

The term "FUGW vector" is also referred to as a FUGW plasmid, which includes, but is not limited to, a vector engineered by a promoter, wherein the promoter includes, but is not limited to, an EF1a promoter, a CAG promoter, a hUbi promoter, a CBh promoter.

The terms "Ubi" and "UBI" have the same meaning and are a type of promoter in two forms: one is the human ubiquitin promoter, UbC; the other is the plant ubiquitin promoter Ubi. Therefore, in the field of human diseases, "Ubi" has the same meaning as "UbC".

The experimental methods in the following examples are conventional methods unless otherwise specified.

Specific embodiment:

Example 1, SIN-LV-IL2RG construction

The sequence of the recombinant human interleukin 2 receptor subunit γ gene (IL2RG) of the present invention is artificially synthesized according to the IL2RG gene sequence (shown as SEQ ID NO: 1) provided in the GenBank database.

Recombinant human interleukin 2 receptor subunit γ gene recombinant method for constructing a lentiviral vector, the steps of which include:

Synthesis of human interleukin 2 receptor subunit gamma gene (IL2RG) sequence, design primers (with BamHI and MfeI cleavage sites, respectively), IL2RG for: GGTACCGAGCTCGGATCCGC (as shown in SEQ ID NO: 7); IL2RG rev ( MfeI): CCCAATTGGCGGGTTTATCACTTATCGTCGTC (shown as SEQ ID NO: 8).

Amplification by PCR, wherein the selected PCR polymerase is KOD PLUS (TOYOBO, KOD-201). The reaction system is as follows:

10×KOD PLUS buffer: 5 μL;

dNTPs (2.5 mM each): 5 μL;

25 mM magnesium sulfate: 2 μL;

KOD Plus DNA polymerase: 1 μL;

DNA template (50 ng/μL): 1 μL;

IL2RG primer (forward and reverse 10 μM): 1.5 μL each

Double distilled water: 33 μL.

PCR amplification conditions:

95 ° C for 3 minutes; (98 ° C for 10 seconds, 54 ° C for 30 seconds, 68 ° C for 1 minute and 10 seconds) × 40 cycles; 68 ° C for 10 minutes; 10 ° C for 2 minutes.

The PCR product was purified by DNA gelatinization, and digested with BamHI and MfeI (endase from NEB), FUGW vector (transformed vector modified by promoter, including but not limited to: EF1a promoter, CAG promoter, The hUbi promoter and the CBh promoter were digested with BamHI and EcoRI (endases were all from NEB).

The digested product was recovered by tapping, and ligated with T4 ligase (from NEB), the IL2RG digested product and the FUGW digested product). The ligation product was transformed by E. coli competent TOP10, and the monoclonal was selected, and the positive clones were selected by PCR identification, sequencing and identification. Positive cloning vectors are:

1) The promoter is hUbi SIN-LV-IL2RG vector, the vector sequence is shown in SEQ ID NO: 3, and the vector map is shown in Figure 1;

2) the promoter is SF1a SIN-LV-IL2RG vector, the vector sequence is shown in SEQ ID NO: 4, and the vector map is shown in Figure 3;

3) The promoter is a SIN-LV-IL2RG vector of CAG, the vector sequence is shown in SEQ ID NO: 5, and the vector map is shown in Figure 4;

4) The promoter is CBh SIN-LV-IL2RG vector, the vector sequence is shown in SEQ ID NO: 6, and the vector map is shown in Figure 5;

Example 2, verification of SIN-LV-IL2RG

Positive clones were verified by transfection of 293T cells. After transfecting 293 cells with SIN-LV-IL2RG expression vector, total protein was extracted for 48 hours, and Western Blot analysis revealed that SIN-LV-IL2RG (hUbi promoter) was normal expression (Fig. 2).

Example 3, comparison of expression effects of different vectors

The promoters were transfected into 293 cells with the EF1a promoter, CAG promoter, hUbi promoter, and CBh promoter SIN-LV-IL2RG expression vector, and the total protein was extracted 48 hours later for Western Blot analysis. Untransfected vector), EF1a promoter, CAG promoter, hUbi promoter, CBh promoter SIN-LV-IL2RG expression vector transfected cells expressed IL2RG, and EF1a promoter, hUbi promoter The expression of IL2RG in the cells transfected with SIN-LV-IL2RG expression vector was higher (Fig. 6), indicating that the above promoters have a better correlation with the expression of the target gene in the cells, and the protein expression effect is also better.

In protein expression systems, different vectors are usually required for expression of different proteins. Mammalian cell expression vectors must contain control elements such as prokaryotic sequences, promoters, enhancers, selectable marker genes, terminators, and polynucleotide signals. In order to increase the expression level of IL2RG protein in cells in the present application, Applicants have found that EF1a promoter, CAG promoter, hUbi promoter, CBh promoter After transfection of SIN-LV-IL2RG expression vector, IL2RG was expressed, but compared with other promoters, SIN-LV-IL2RG of EF1a promoter and hUbi promoter had the best effect. These indicate that there is a difference between the expression levels of different promoters and the target protein, and therefore the fit between the EF1a promoter or the hUbi promoter and the expression of IL2RG protein in the SIN-LV-IL2RG vector is good.

Example 4, Application of SIN-LV-IL2RG recombinant lentivirus

The SIN-LV overexpressing IL2RG-infected rat model (IL2RG knockout rat model) can be used to accurately assess the effectiveness of gene therapy X-SCID by analyzing the symptom changes in the rat model. On this basis, the GMP-grade SIN-LV virus can be further prepared, and clinical gene therapy can be carried out on the basis of fully assessing the safety and effectiveness of the relevant gene therapy, achieving a breakthrough in the domestic X-SCID gene therapy.

The embodiments of the present invention have been described above, but the present invention is not limited thereto, and those skilled in the art can understand that modifications and changes can be made within the scope of the gist of the present invention. The manner of modification is intended to fall within the scope of protection of the present invention.

Claims

A recombinant vector, characterized in that the recombinant vector comprises a viral vector and at least a portion of an IL2RG encoding polynucleotide.
The recombinant vector according to claim 1, wherein the viral vector is selected from a lentiviral vector which is inactivated by itself; preferably, the viral vector is selected from the group consisting of FUGW; preferably, the promoter of the viral vector is selected from the group consisting of an EF1a promoter and a CAG promoter. a hUbi promoter, a CBh promoter; preferably the sequence of the viral vector is set forth in SEQ ID NO: 2; preferably the sequence of the recombinant vector is selected from the group consisting of SEQ ID NOs: 3, 4, 5 and 6. sequence.
The recombinant vector according to claim 1 or 2, wherein the recombinant vector is a DNA fragment in which a IL2RG gene is ligated in a multiple cloning site of a FUGW vector, and preferably the sequence of the IL2RG gene is as shown in SEQ ID NO: 1. .
The method for preparing a recombinant vector according to any one of claims 1 to 3, wherein at least a part of the IL2RG-encoding polynucleotide is ligated into a multiple cloning site of the viral vector to construct a recombinant vector, and the positive recombinant vector is further Transfecting the host cell to obtain the recombinant vector; the viral vector is selected from a lentiviral vector which is inactivated by itself; preferably, the viral vector is selected from FUGW; preferably, the promoter of the viral vector is selected from the EF1a promoter, a CAG promoter, a hUbi promoter, a CBh promoter; preferably the sequence of the viral vector is set forth in SEQ ID NO: 2; preferably the sequence of the IL2RG gene is set forth in SEQ ID NO: 1; preferably the recombinant vector The sequence is selected from the sequences in the group consisting of SEQ ID NOs: 3, 4, 5 and 6.
The method according to claim 4, wherein a BamHI and MfeI cleavage site is introduced at the end of the at least part of the IL2RG-encoding polynucleotide, preferably the cleavage site is introduced by a primer; Preferably, the primer sequence is: GGTACCGAGCTCGGATCCGC as shown in SEQ ID NO: 7 and CCCAATTGGCGGGTTTATCACTTATCGTCGTC as shown in SEQ ID NO: 8.
The preparation method according to claim 4 or 5, wherein the FUGW vector is digested with BamHI and EcoRI.
The preparation method according to any one of claims 4 to 6, wherein the ligation is carried out by T4 ligase.
The preparation method according to any one of claims 4 to 7, wherein the host cell is a 293T cell.
The preparation method according to any one of claims 4 to 8, wherein the method comprises the step of screening a positive recombinant vector: by E. coli competent TOP10 transformation, monoclonal selection, PCR identification, and sequencing.
A virus comprising the recombinant vector of any one of claims 1-3.
A host cell comprising the recombinant vector of any one of claims 1-3.
The host cell according to claim 11, wherein the host cell is selected from the group consisting of 293T cells, hematopoietic stem cells, and hematopoietic precursor cells.
A composition comprising the recombinant vector of any one of claims 1 to 3, or the virus of claim 10, or at least one of the host cells of claim 11 or 12.
A recombinant vector according to any one of claims 1 to 3, or a host according to claim 10 or a host cell according to claim 11 or 12 or a composition according to claim 13 for the treatment of primary immunodeficiency Use in disease drugs.
The use according to claim 14, wherein said primary immunodeficiency disease is selected from the group consisting of: Any of antibody deficiency disease, T cell deficiency disease, T cell and B cell joint deficiency disease, phagocytic cell deficiency disease, and replacement system deficiency disease.
The use according to claim 14 or 15, wherein the medicament further comprises a pharmaceutically acceptable diluent, excipient or carrier for administration.