CN112342244B

CN112342244B - Cell strain for expressing Furin protein and application of cell strain in avian infectious bronchitis virus culture

Info

Publication number: CN112342244B
Application number: CN202011211170.6A
Authority: CN
Inventors: 廖瑛; 丁铲; 王欢; 孙英杰; 谭磊; 孟春春; 宋翠萍; 仇旭升; 刘炜玮
Original assignee: Shanghai Veteromaru Research Institute Caas China Animal Health And Epidemiology Center Shanghan Branch Center
Current assignee: Shanghai Veteromaru Research Institute Caas China Animal Health And Epidemiology Center Shanghan Branch Center
Priority date: 2020-11-03
Filing date: 2020-11-03
Publication date: 2023-06-30
Anticipated expiration: 2040-11-03
Also published as: CN112342244A

Abstract

The invention provides a cell strain for expressing Furin protein and application thereof in avian infectious bronchitis virus culture, wherein the cell strain for expressing Furin protein is a mammalian cell integrated with chicken-origin Furin gene in genome, and the chicken-origin Furin gene is introduced into the mammalian cell through slow virus. The cell strain expressing Furin protein can be used for in vitro culture of multiple IBVs, solves the technical problem that most IBV strains cannot grow in mammalian cells in the prior art, simplifies the propagation process of viruses, eliminates the potential biological hazards possibly caused by infection of other birds, and has wide application value in basic research and vaccine research and development.

Description

Cell strain for expressing Furin protein and application of cell strain in avian infectious bronchitis virus culture

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a cell strain for expressing Furin protein and application of the cell strain in avian infectious bronchitis virus culture.

Background

Infectious bronchitis caused by avian infectious bronchitis virus (Infectious bronchitis virus, IBV) is an acute, highly contagious epidemic disease of birds, mainly affecting the respiratory, digestive and genitourinary systems of birds, causing great losses to the poultry industry in our country and world.

Researchers have conducted intensive studies on IBV and they have adopted different methods to obtain a sufficient number of more viable viruses. Currently, avian viruses are mainly prepared by a chick embryo propagation method and a cell culture method.

Li Huawei et al (Li Huawei et al, propagation of infectious bronchitis virus M41 type and suitability study on chick embryo kidney cells [ J ]. Probex university, 2011, 26 (3): 31-34.) obtained allantoic fluid with IBV by inoculating chick embryo allantoic virus into allantoic cavity of SPF chick embryo of 9-11 days old, repeatedly transferring to 11 th generation, and proved that 10-day old chick embryo was better than 9-day old and 11-day old chick embryo in inoculation effect. The chick embryo breeding method is simple and easy to implement, but a large number of chick embryos are needed, and after virus liquid is harvested, innocent treatment is needed to be carried out on the rest chick embryos after inoculation, other birds can be possibly endangered due to improper treatment, and biological hidden danger exists.

Chick embryo kidney Cells (CEKs) can also be used for the propagation of IBVs. Li Anxing et al (Li Anxing et al, effect of cholesterol on chicken infectious bronchitis virus infection of chicken embryo kidney cells [ J ]. University of northeast agricultural university report, 2017, 48 (4): 45-52.) CEK cells were prepared, and single-layer CEK cells were inoculated with IBV M41 virus suspension, and the inoculated cells all exhibited cytopathic effect (CPE), and the cells were rounded and condensed, and then they proved that IBV proliferated in the CEK by RT-PCR method. Cell culture is favorable for developing basic research of viruses, however, CEK cells are not continuously passaged at present, the preparation process of primary cells is complex, the operation is complex, and a higher operation level is required, so that the CEK cells are rarely applied to the propagation of IBV.

At present, only IBV-Beaudette strain can grow in Vero cell line and partial human cell line, which brings difficulty to the research of IBV. There are researchers who modify IBV to achieve its continuous culture in mammalian cells. CN106119207A discloses an IBV modified strain, and the S gene of the Vero cell adaptation strain Beaudette P65 strain is replaced with the S gene of the H120 strain by the No See' M technology, so that the R-H120-Beaudette P65 (S) rescue strain is obtained, and the adaptation growth of the strain in the Vero cell line is realized. However, modifying the virus necessarily changes the original characteristics of the virus, and the obtained experimental data and actual data have errors, and in addition, if the operation is incorrect, the modified virus may be infected by the non-natural host of the IBV.

Avian infectious bronchitis virus is one of the main pathogens currently affecting the development of the poultry industry in China and the world, other IBV strains are difficult to subculture in an in vitro cell line besides Beaudette strain, and the research on the infection and pathogenic mechanism of the virus and the research and development of novel vaccines are severely limited. How to realize continuous culture of most IBV strains on passage cells by the existing operation technology is a problem to be solved at present.

Disclosure of Invention

Aiming at the defects and actual demands of the prior art, the invention provides a cell strain for expressing Furin protein and application thereof in avian infectious bronchitis virus culture, and the cell strain for expressing Furin protein can be used for replication of a plurality of IBV strains, so that the virus titer is increased, the propagation process of the IBV is simplified, the operation level requirement of researchers is reduced, and the potential biological hazards possibly caused by the traditional chick embryo culture method are also eliminated.

To achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the invention provides a recombinant vector which is a lentiviral vector containing a chicken source Furin gene.

In the invention, furin is an important endoprotease, is related to pathogenicity of viruses, and constructs a lentiviral vector containing chicken-origin Furin genes, so that the aim of introducing the chicken-origin Furin genes into mammalian cells through a lentiviral system is fulfilled.

Preferably, the chicken source Furin gene comprises a nucleic acid sequence shown in SEQ ID NO. 1.

SEQ ID NO:1：

cggccgcggcggcggcgcctcgctctcccgtcccgccggcggcccgggcccctcggtctgttgggctgcgcagaggccagcggggcagagcggggcccggtgtgccgcagggcgctgacgtgggagccgcgcctggacctcgtgctctggtagaagacccccgatactctgatggatctgaggccctgctcactgctcctgctctggactctggtggttgccctcgctctcctggcccgagaggtgttggcccagcgcatttacaccaacacctgggctgtgctcgtccctgctgggccgctggaggccaaccggctggccaggaagcatggattccttaacctgggcccgattttcggtgactattaccacttccagcaccgcggcgtggtgaagcgctccctttcaccccaccagccctggcacagccgtttggcacgggagccacaggtgcactggcttgagcagcaggtggcgaagcgcaggaccaagcgagacattttcatggagcccacagacccgaagttcccgcagcagtggtacctgtacaacacaaaccagcgggacctgaacgtgcgtcaggcctgggagcagggttacacgggcaagggcattgtggtttccatcctggatgatggcattgagaagaaccaccctgacctggaggctaactacgatccaggggcaagctttgatgtcaatgaccaggacccagacccacagccccgttacacacagatgaatgacaacaggcatggcactcgatgcgctggggaagtcgctgccgtagcaaacaatgggatctgtggcgttggcgtggcttacaatgcccggattggaggtgtgcgcatgctggatggggaggtgacggatgctgtggaggcccattccctgggtctcaatcccaaccacatccacatctacagcgccagctggggccctgaggacgatggcaagacggtcgatggcccagcccggctggcagaggaggccttcttccgaggggtcagccagggacgcggggggctgggctccatcttcgtctgggcatctggaaacgggggccgtgaacacgacagctgcaactgtgatggttacaccaacagcatctacacactgtccatcagcagcaccacgcagtatggcaacgtaccctggtacagcgaggcctgctcctccaccctcgccaccacctacagtagtggcaaccagaatgagaagcagatcgtgacaactgacctgagacagaagtgcaccgaatcgcacacggggacatcggcttcagcgcctctcgctgctgggatcattgctcttgccctggaggcaaacaagaacctaacctggagggacatgcagcacctggtggtgcagacctcgaagccggcgcacctcaatgccaatgactgggtcaccaacggcgttggccgcaaagtcagccactcctacggctatggcctgctggacgccggggccatggtaagcctggccaggaactggatcacagtgggacctcagaggaaatgtgtcatcgacgtcctcacggagcctaaggacatcgggaagcgcctggaggtgcgacggaaggttgatgcctgcctggggaaggccaactacatcagccggctggagcacgcgcaggcccggctgacactgtcctacaaccggcggggtgacctggccatccacctcgtcagccccatgggcacccgctctaccctcctggctgccaggccccatgactactcggctgatggcttcaatgactgggccttcatgacgacacactcgtgggatgaggacccttctggggagtggctgctggagattgagaacactagtgatgccaataactacggcacactgaccaagttcacgctggtgctgtacgggacagccactgacccccctgggctctccaatcagctggagagtagtggctgcaagaccttgacccccagccagacctgcgtggtctgcgaagagggatactacctgcaccagaagagctgcctgaagcgctgcccccctggcttcgcacctggagtgcagaacacacactacaacctggagaacagcatggagcccatcgcaccccagctctgcctgccctgccacccctcctgcgccacctgcacggggcccggccccaatcagtgcctgacctgccccgcgcactcccacttcagcagcttggacctctcctgctcccaccagacgcagagcagccgtgcgtcccccgccctggtggagggtgaggggcagtctgaggcccctcctccagccaacccgctcgtcctcatcgccagcctcagctgcgttctcattgtcgtcatcttcatcaccgtcttcctggtgctgcaagtgcgctccgggttcagcctgcggggcgtgaaggtctacgccctggacagcggcatcatctcctacaaggggctgccctccgacatctggcaggaggagggcccttcggagtcggacattgaggagtgcgaagtgcacaatgagaggactgccttcatcagagaccaaagtgccctttgatgaccctctgcccctccctcctcctcctggcaccgcggcgcaggggcagatgaggccgaggggcctggactctgctcccgtccccctccgtggcattctgggctccccactgctggtaccgtcctcagccctgcgctgtccccgtcccggaccatctctcacagcctcgtgtccatgctgtgccctgtgctggtgtgtggccagaccctggtgctggctttgtgctggcagctgcgttccttcccctgggccggcggttgctgggggccacacgtggctgcggggatgggggccggcgcccttgttggtgttgccctgactgggctaccttgaagctccccgccgcct。

Preferably, the recombinant vector is a Phage-puro vector connected with a nucleic acid sequence shown in SEQ ID NO. 1.

In a second aspect, the present invention provides a recombinant lentivirus packaged by mammalian cells co-transfected with the recombinant vector of the first aspect and a helper plasmid.

Preferably, the helper plasmids include pMD2.G and psPAX2.

Preferably, the mammalian cells comprise 293T cells.

In a third aspect, the invention provides a cell line expressing Furin protein, which contains the recombinant vector of the first aspect.

Preferably, the cell line expressing Furin protein comprises the recombinant lentivirus of the second aspect.

Preferably, the cell line expressing Furin protein is a Vero cell line with the nucleic acid sequence shown in SEQ ID NO. 1 integrated in the genome.

In the invention, the Furin gene is introduced into the mammalian cells, so that the affinity of the mammalian cells to IBV viruses is enhanced, IBV can be proliferated in the mammalian cells, the proliferation process of the IBV is simplified, and cytopathic effect (CPE) of the mammalian cells infected by the IBV can be rapidly generated.

In a fourth aspect, the invention provides a method for constructing the cell strain expressing Furin protein in the third aspect, which comprises the following steps:

constructing a recombinant vector, and co-transfecting mammalian cells by adopting the recombinant vector and auxiliary plasmids to construct a recombinant lentivirus;

and (3) infecting host cells by adopting the recombinant lentivirus, and screening puromycin to obtain the cell strain expressing Furin protein.

Preferably, the construction method of the recombinant vector comprises the following steps:

PCR amplification of chicken fibroblast line cDNA by using a primer pair shown in SEQ ID NO. 2-3 to obtain chicken source Furin gene;

and (3) connecting the chicken source Furin gene into a linearization slow virus vector, transforming competent cells, and obtaining the recombinant vector after resistance, sequencing and screening.

SEQ ID NO:2：

ttcaggtgtcgtgaagcggccgcatggatctgaggccctgctca。

SEQ ID NO:3：

cgttaggggggggggtctagatcaaagggcactttggtctctgat。

Preferably, the chicken source Furin gene is inserted between the Not I and Xba I cleavage sites of the lentiviral vector.

Preferably, the host cell comprises a Vero cell line.

Preferably, the concentration of puromycin at the time of the screening is 0.1 to 1. Mu.g/mL, for example, 0.1. Mu.g/mL, 0.15. Mu.g/mL, 0.2. Mu.g/mL, 0.25. Mu.g/mL, 0.3. Mu.g/mL, 0.35. Mu.g/mL, 0.4. Mu.g/mL, 0.45. Mu.g/mL, 0.5. Mu.g/mL, 0.55. Mu.g/mL, 0.6. Mu.g/mL, 0.65. Mu.g/mL, 0.7. Mu.g/mL, 0.75. Mu.g/mL, 0.8. Mu.g/mL, 0.85. Mu.g/mL, 0.9. Mu.g/mL, 0.95. Mu.g/mL or 1. Mu.g/mL.

Preferably, the screening time is not shorter than 48h, and may be 48h, 60h, 72h, 84h or 96h, for example.

In the invention, blank cells are inoculated on a 24-hole cell culture plate, puromycin with gradient concentration is added, the death condition of the cells is observed after 48 hours, and the lowest concentration for killing all the cells is the optimal screening concentration of the puromycin. If the puromycin concentration is low, the blank cells cannot be completely killed and false positives can be caused; if the concentration of puromycin is higher, the puromycin is unfavorable for the growth of recombinant cells, and the difficulty of screening is increased.

The invention screens out cell strains expressing Furin protein through a plurality of puromycin screens. If puromycin is selected for a short period of time, a part of unstable cells which contain recombinant lentivirus but are not integrated into the genome of mammalian cells are also selected, and part of cells lose the recombinant lentivirus in subsequent passages, and the chicken Furin gene cannot be expressed stably.

In a fifth aspect, the present invention provides a method of culturing avian infectious bronchitis virus, said method comprising the steps of:

(1) Culturing the Furin protein-expressing cell of the third aspect;

(2) Inoculating avian infectious bronchitis virus into the cells expressing Furin protein, and co-culturing;

(3) Removing unadsorbed avian infectious bronchitis virus particles, changing culture medium, culturing, and collecting cell supernatant.

Preferably, the temperature of the culture in step (1) is 35 to 40℃and may be, for example, 35℃35.5℃36.5℃37℃37.5℃38℃38.5℃39℃39.5℃40℃preferably 37 ℃.

Preferably, the cultured CO of step (1) ₂ The concentration is 4.5% to 5.5%, and may be, for example, 4.5%, 4.6%, 4.7%, 4.8%, 4.9%, 5.0%, 5.1%, 5.2%, 5.3%, 5.4% or 5.5%, preferably 5%.

Preferably, the abundance of the Furin protein-expressing cells of step (1) is not less than 90%, for example, 90%, 91%, 92%, 93%, 94% or 95%.

Preferably, the temperature of the co-cultivation in step (2) is 35 to 40 ℃, for example 35 ℃, 35.5 ℃, 36 ℃, 36.5 ℃, 37 ℃, 37.5 ℃, 38 ℃, 38.5 ℃, 39 ℃, 39.5 ℃ or 40 ℃, preferably 37 ℃.

Preferably, CO of the CO-culture of step (2) ₂ The concentration is 4.5% to 5.5%, and may be, for example, 4.5%, 4.6%, 4.7%, 4.8%, 4.9%, 5.0%, 5.1%, 5.2%, 5.3%, 5.4% or 5.5%, preferably 5%.

Preferably, the co-cultivation in step (2) takes 0.5 to 2 hours, for example, 0.5 hours, 1 hour, 1.5 hours or 2 hours, preferably 1 hour.

Preferably, the removing of unadsorbed avian infectious bronchitis virus particles in step (3) is performed by centrifugation.

Preferably, the rotational speed of the centrifugation is 800rpm to 1500rpm, for example, 800rpm, 900rpm, 1000rpm, 1100rpm, 1200rpm, 1300rpm, 1400rpm or 1500rpm, preferably 1000rpm.

Preferably, the centrifugation time is 2 to 10min, for example, 2min, 3min, 4min, 5min, 6min, 7min, 8min, 9min or 10min, preferably 3min.

Preferably, step (3) further comprises a step of washing the cells 1 to 3 times with PBS solution, for example, 1 time, 2 times or 3 times, before changing the medium.

Preferably, the medium of step (3) is a maintenance medium.

Preferably, the temperature of the continued culture in step (3) is 35 to 40℃and may be, for example, 35℃35.5℃36℃36.5℃37℃37.5℃38℃38.5℃39.5℃39.5℃or 40℃and preferably 37 ℃.

Preferably, the CO of step (3) is continued to be cultivated ₂ The concentration is 4.5% to 5.5%, and may be, for example, 4.5%, 4.6%, 4.7%, 4.8%, 4.9%, 5.0%, 5.1%, 5.2%, 5.3%, 5.4% or 5.5%, preferably 5%.

Preferably, the time for continuing the culture in step (3) is not shorter than 24 hours, and may be, for example, 24 hours, 28 hours, 32 hours, 36 hours, 40 hours, 45 hours, 50 hours, 55 hours or 60 hours, preferably 50 hours.

Preferably, the cell supernatant is collected after the continued culture of step (3) until the cytopathy reaches not less than 80%, for example, 80%, 85%, 90% or 95%.

Preferably, the avian infectious bronchitis virus comprises any one or at least two of IBV-Beaudette strain, IBV-H120 strain, IBV-4/91 strain, IBV-QX strain or IBV-M41 strain.

As a preferred technical scheme, the invention provides a method for culturing avian infectious bronchitis virus, which comprises the following steps:

(1) At 35-40 ℃ and 4.5-5.5% CO ₂ Culturing the Furin protein-expressing cell of the third aspect under conditions such that the abundance of the Furin protein-expressing cell is no less than 90%;

(2) Inoculating any one or a combination of at least two of an avian infectious bronchitis virus IBV-Beaudette strain, an IBV-H120 strain, an IBV-4/91 strain, an IBV-QX strain or an IBV-M41 strain into the cells expressing Furin protein, and inoculating the cells with 4.5% -5.5% CO at 35-40 DEG C ₂ Co-culturing for 0.5 to 2 hours under the condition;

(3) Centrifuging at 800-1500 rpm for 2-10 min to remove unadsorbed avian infectious bronchitis virus particles, washing cells 1-3 times with PBS solution, changing maintenance medium, and maintaining at 35-40deg.C with 4.5% -5.5% CO ₂ Culturing for not less than 24 hr, and collecting cell supernatant after cytopathy reaches 80% or more.

In a sixth aspect, the invention provides an application of the recombinant vector in the first aspect, the recombinant lentivirus in the second aspect or the cell strain expressing Furin protein in culturing avian infectious bronchitis virus.

Compared with the prior art, the invention has the following beneficial effects:

(1) According to the invention, a recombinant lentivirus containing a chicken source Furin gene is inoculated into Vero cells, and a cell strain for stably expressing Furin protein is obtained through drug screening, and the cell strain for expressing Furin protein can be used for in vitro culture of multiple IBVs;

(2) The invention successfully constructs the cell strain for expressing Furin protein through the operation steps of constructing the recombinant vector, constructing the recombinant slow virus, infecting host cells by slow virus and screening the recombinant cells by puromycin, has simple process and does not need very high operation technology;

(3) The cell strain expressing Furin protein constructed by the invention can realize in vitro proliferation of a plurality of IBV viruses, the IBV viruses can be detected 28h after infection, the virus titer reaches a peak 50h after infection, the technical problem that other IBV strains except Beaudette strains cannot grow in mammalian cells is overcome, the virus proliferation process is simplified, the requirement on the operation technical level of researchers due to the use of primary cell proliferation of chick embryos is reduced, and the biological hidden trouble possibly caused by infection of other poultry by the traditional chick embryo culture method is also eliminated.

Drawings

FIG. 1 is an agarose gel electrophoresis diagram of an amplification product of a Furin gene, in which lane 1 is a DNA molecular weight (marker) and lane 2 is a PCR amplification product of a Furin gene;

FIG. 2A is a western blot image of 4H, 8H, 12H, 24H, 36H, 40H and 50H and negative controls after infection of cells expressing Furin protein with IBV-H120 strain, FIG. 2B is a western blot image of 4H, 8H, 12H, 24H, 36H, 40H and 50H and negative controls after infection of cells expressing Furin protein with IBV-Sczy3 strain, FIG. 2C is a western blot image of 4H, 8H, 12H, 24H, 36H, 40H and 50H and negative controls after infection of cells expressing Furin protein with IBV-QX strain, FIG. 2D is a western blot image of 4H, 8H, 12H, 24H, 36H, 40H and 50H and negative controls after infection of cells expressing Furin protein with IBV-M41 strain, and FIG. 2E is a western blot image of 4H, 8H, 12H, 24H, 36H and 50H and negative controls after infection of cells expressing Furin protein with IBV-4/91 strain;

FIG. 3 is an indirect immunofluorescence of IBV-Beaudette strain, IBV-H120 strain, IBV-Sczy3 strain, IBV-4/91 strain, IBV-QX strain and IBV-M41 strain of example 7 of the present invention after 50H infection of Vero cells and Vero cells expressing Furin protein, respectively, and negative control;

FIG. 4A is a graph showing the one-step growth of IBV-H120 strain in Vero cells and cells expressing Furin protein, FIG. 4B is a graph showing the one-step growth of IBV-Sczy3 strain in Vero cells and cells expressing Furin protein, FIG. 4C is a graph showing the one-step growth of IBV-QX-HD strain in Vero cells and cells expressing Furin protein, FIG. 4D is a graph showing the one-step growth of IBV-4/91 strain in Vero cells and cells expressing Furin protein, and FIG. 4E is a graph showing the one-step growth of IBV-M41 strain in Vero cells and cells expressing Furin protein.

Detailed Description

The technical means adopted by the invention and the effects thereof are further described below with reference to the examples and the attached drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and are not limiting thereof.

The specific techniques or conditions are not identified in the examples and are described in the literature in this field or are carried out in accordance with the product specifications. The reagents or apparatus used were conventional products commercially available through regular channels, with no manufacturer noted.

Reagent:

PCR amplification reagents were purchased from Nanjing Norvigator technologies Co., ltd;

the fast cutting enzymes Not I and Xba I were purchased from Thermo Fisher company;

the glue recovery kit was purchased from the american biological company;

homologous recombination kits were purchased from nanjing novzan technologies limited;

293T cells were purchased from ATCC;

transfection reagent Transport5 ^TM Purchased from Thermo Fisher company;

vectors Phage-puro, pMD2.G, and psPAX2 were purchased from Youbao biological company;

vero cells were purchased from ATCC company;

puromycin was purchased from Invivogen;

IBV N protein antibodies were purchased from Biorbyt company;

anti-murine secondary antibodies were purchased from CST company;

alexa Fluor 594 labeled secondary antibodies were purchased from Thermo Fisher company.

Example 1

The method for obtaining and amplifying the chicken source Furin gene specifically comprises the following steps:

designing primers SEQ ID NO. 2-3 by referring to CDS sequence of chicken source Furin mRNA in NCBI, amplifying chicken source Furin gene SEQ ID NO. 1 by taking DF-1 cell cDNA as a template, wherein a reaction system is shown in table 1, and an amplification system is shown in table 2.

TABLE 1

Component (A)	Volume of
		5 Xbuffer	10μL
The upstream primer SEQ ID NO. 2 (10. Mu.M)	2μL
		The downstream primer SEQ ID NO. 3 (10. Mu.M)	2μL
dNTPs(10mM)	1μL
		DNA polymerase	1μL
cDNA template	1μL
		ddH ₂ O	33μL
Total volume of	50μL

TABLE 2

The amplified fragment is verified by agarose gel electrophoresis, the electrophoresis result is shown in figure 1, and the full length of the amplified product is about 2370bp and the band is clear, so that the chicken source Furin gene amplification is successful.

Example 2

The recombinant lentiviral vector Phage-ChF containing the chicken source Furin gene is constructed in the embodiment, and specifically comprises the following steps:

and (3) carrying out water bath enzyme digestion on the Phage-puro vector for 4 hours at 37 ℃ by using fast digestion enzymes Not I and Xba I, recovering the digested linearized plasmid fragment, and carrying out homologous recombination with a chicken source Furin PCR product by using a homologous recombination kit. The homologous recombination system is shown in Table 3.

TABLE 3 Table 3

Component (A)	Volume of
		Linearization of Phage-puro vector	2μL
Chicken-derived Furin-PCR product	3μL
		2×clone Express Mix	5μL
Total volume of	10μL

The reaction conditions were incubation at 50℃for 10min, and immediately after cooling to 4℃they were placed on ice.

The recombinant product is transformed into escherichia coli DH5 alpha, the escherichia coli DH5 alpha is cultured overnight in an incubator at 37 ℃ after plating, positive colonies are selected the next day, sequencing identification is carried out after amplification culture, and plasmids are extracted after identification is correct, so that a recombinant vector Phage-ChF is obtained.

Empty vector Phage-puro, which was not ligated into the chicken source Furin gene, served as a negative control plasmid.

Example 3

The packaging, transfection and concentration of recombinant lentiviruses and negative control viruses are carried out in the embodiment, and specifically comprise the following steps:

the 293T cells with good growth state are digested by pancreatin, and the cells are inoculated in a 10cm culture dish after being resuspended;

when the cell density reaches 60%, the recombinant vector Phage-ChF, helper plasmid pMD2.G and psPAX2 are co-transfected into 293T cells, and the plasmid and transfection reagent Transport5 ^TM The use ratio of (2) is 1:2;

collecting cell supernatant after 60h, centrifuging at 4deg.C for 15min at 3000g, filtering with 0.45 μm filter membrane, and preserving supernatant at-80deg.C to obtain recombinant lentivirus containing chicken Furin gene and empty lentivirus of negative control.

Example 4

The present example determines optimal puromycin screening concentration, specifically comprising:

taking Vero cells growing in the logarithmic phase, and inoculating the Vero cells into a 24-well plate;

after 24h incubation, puromycin was added at a gradient concentration of 0, 0.25. Mu.g/mL, 0.5. Mu.g/mL, 0.75. Mu.g/mL and 1. Mu.g/mL, respectively, at 37℃with 5% CO ₂ Culturing under the condition;

after 48h, cell death in the 24 well plates was observed to give the optimum screening concentration at the minimum concentration to kill all cells.

Finally, the screening concentration of puromycin was determined to be 0.25. Mu.g/mL.

Example 5

The recombinant lentivirus prepared in the example 3 is used for constructing a cell strain expressing Furin protein, and the cell strain specifically comprises the following components:

inoculating Vero cells growing in logarithmic phase into 6-well plate, adhering cells, adding virus supernatant (virus supernatant: culture medium=1:1) of empty-load slow virus and recombinant slow virus and 0.25 μg/mL puromycin respectively, changing to complete culture medium after 48h infection, and simultaneously adding puromycin for continuous screening;

after 48 hours, the virus infected group can see that the resistant cells survive, the cells of the negative control group are all dead, the resistant cells are picked up for continuous screening, and the cells are frozen after expansion culture, thus obtaining the cell strain for expressing Furin protein.

Example 6

In this example, western blot verification is performed on the Furin protein-expressing cells prepared in example 5 after a plurality of IBV infection, and specifically includes:

furin protein-expressing cells were cultured at 5X 10 ⁵ Cell count/well was seeded in 6-well plates at 37℃in 5% CO ₂ Culturing under the condition for 12h until the cell density reaches 60%;

the method comprises the steps of respectively infecting cells in a hole by using IBV-H120 strain, IBV-Sczy3 strain, IBV-QX strain, IBV-M41 strain and IBV-4/91 strain viruses, setting negative control without adding the viruses, discarding culture medium supernatant after 1H, and washing the cells in the hole for 2 times by using PBS solution;

collecting cells infected by different strains of 4h, 8h, 12h, 24h, 36h, 40h and 50h after infection, adding a 2X loading buffer, and fully lysing for 3min;

scraping a cell sample into a clean EP tube, incubating for 10min in a metal bath at 100 ℃, and centrifuging for 5min at 10000 rpm;

taking 10 mu L of supernatant, loading, using a BIO-RAD 3000X1 type electrophoresis apparatus, performing electrophoresis for 30min at constant pressure of 80V, adjusting the voltage to constant pressure of 120V when bromophenol blue moves to the junction of the concentrated gel and the separation gel, performing electrophoresis for 100min, and stopping electrophoresis after bromophenol blue completely moves to the bottom of the separation gel;

taking out the albumin glue, mounting the albumin glue, the sponge, the filter paper and the NC film into a sandwich structure in a mode of negative glue positive film, transferring for 95min under the condition of constant current of 250mA in pre-cooled transfer liquid, and cooling by using an ice bag in the transfer process;

taking out the NC film after the transfer printing is finished, and sealing the NC film for 1h by using 5% skim milk at room temperature;

after the sealing is finished, cleaning the NC film for three times by using TBST solution, and removing redundant skim milk;

NC membrane was incubated with Anti-Flag antibody at 1:1000 dilution for 1.5h at room temperature (or overnight incubation at 4 ℃);

washing the NC film 3 times by using TBST solution, and removing redundant primary antibodies;

incubating NC membrane with anti-mouse secondary antibody diluted 1:8000 for 1h at room temperature;

washing the NC film for 3 times by using TBST, and removing redundant secondary antibodies;

preparing ECL luminescent color developing solution in dark, incubating NC film and ECL luminescent color developing solution for 0.5min, and detecting signal on full-automatic luminescent image analysis system.

As shown in fig. 2A, 2B, 2C, 2D and 2E, after different IBV strains infect the cell strain expressing Furin protein, IBV-H120 strain, IBV-QX strain and IBV-4/91 strain can detect the expression of IBV N protein after 40H of infection, and the expression level of IBV-Sczy3 strain and IBV-M41 strain can detect the expression of IBV N protein after 50H of infection, wherein the expression level of IBV N protein in 50H of cells after infection is higher than that in 40H of cells after infection; the IBV N protein expression can not be detected in the negative control cells without the virus, which indicates that the IBV viruses of different strains can express the related protein in the cell strain expressing the Furin protein, and the stable expression of the chicken source Furin protease can enable the Vero cells to obtain the infectivity of the non-cell adapted IBV strain.

Example 7

This example demonstrates indirect immunofluorescence of proliferation status of multiple IBV strains in Furin protein-expressing cells prepared in example 5, and specifically includes:

spreading the sterilized single flyweights in 6-well plate, and culturing Furin protein-expressing cells at a ratio of 1×10 ⁵ Cell count of/well was inoculated into 6-well plate at 37℃with 5% CO ₂ Culturing under the condition for 12 hours until the cell density reaches 60%;

the method comprises the steps of respectively infecting cells in a hole by using IBV-Beaudette strain, IBV-H120 strain, IBV-Sczy3 strain, IBV-4/91 strain, IBV-QX strain and IBV-M41 strain viruses, simultaneously setting a negative control group without adding the viruses, discarding a culture medium supernatant after 1H, washing the cells in the hole for 2 times by using PBS solution, and replacing the cells with a maintenance culture medium;

50h after virus infection, discarding the maintenance medium, cleaning the cells for 3 times by using a precooled PBS solution, adding 1mL of 5% paraformaldehyde prepared at present into each hole, and fixing for 10min at room temperature;

washing the cells 3 times by using a pre-cooled TBST solution to remove the superfluous paraformaldehyde;

1mL of TBST solution containing 5% BSA was added to each well, and the mixture was blocked at 37℃for 30min;

washing the cells 3 times with TBST solution, and removing the excessive BSA solution;

taking out the cover glass fully paved with cells, reversely buckling the cover glass on a preservative film dripped with Anti-IBV N antibody diluted according to the proportion of 1:200, and incubating the cover glass for 1.5h at 37 ℃;

washing the cells 3 times with TBST solution for 10min each time, and removing excessive primary antibody;

taking out the cover glass fully paved with cells, reversely buckling the cover glass on a preservative film dripped with a secondary antibody solution marked by Alexa Fluor 594, and incubating for 60 minutes at room temperature;

washing the cells 3 times with TBST solution for 10min each time, and removing excessive secondary antibodies;

taking out the cover glass fully paved with cells, reversely buckling the cover glass on a preservative film dripped with DAPI diluent diluted according to 1:500, and incubating for 5min at room temperature;

washing the cells 3 times with TBST solution for 10min each time, and removing redundant DAPI diluent;

taking out the cover glass covered with cells, inversely buckling the cover glass on the glass slide dripped with the anti-fluorescence quenching sealing tablet, air-drying overnight in a dark place, and then preserving at 4 ℃ and observing the cover glass in a dark place by using a zeiss laser confocal microscope.

As shown in FIG. 3, the left side is normal Vero cells, and after IBV-Beaudette strain, IBV-H120 strain, IBV-Sczy3 strain, IBV-4/91 strain, IBV-QX strain and IBV-M41 strain are respectively infected with the cells for 50 hours, only the IBV-Beaudette strain can obviously detect the fluorescent signal of IBV N protein, and the cells infected with other 5 strains can not detect the expression of virus protein IBV N protein; the right side is a cell stably expressing Furin protein, and after IBV-Beaudette strain, IBV-H120 strain, IBV-Sczy3 strain, IBV-4/91 strain, IBV-QX strain and IBV-M41 strain are respectively infected with the cell for 50 hours, compared with a normal Vero group, the fluorescent signals of IBV N protein can be detected by the infected cell expressing Furin protein; negative controls without added virus always have no fluorescent signal, increasing the reliability of the results. Taken together, the results show that stable expression of chicken Furin protease can enable Vero cells to acquire infectivity of non-cell-adapted IBV strains.

Example 8

In this example, a one-step growth curve is drawn for the proliferation status of a plurality of IBVs in the Furin protein-expressing cells prepared in example 5, specifically including:

furin protein-expressing cells were cultured at 5X 10 ⁵ Cell count/well was seeded in 6-well plates at 37℃in 5% CO ₂ Culturing under the condition until the cell density reaches 70%; simultaneously inoculating Vero cells to perform the same operation as a condition control;

respectively infecting the cell strain expressing Furin protein and Vero cells with IBV-H120 strain, IBV-Sczy3 strain, IBV-QX-HD strain, IBV-4/91 strain and IBV-M41 strain, discarding culture medium supernatant after 1H, cleaning cells in the holes for 2 times by using PBS solution, and replacing a maintenance culture medium;

collecting cell supernatant from 4h, 8h, 12h, 16h, 20h, 24h, 28h, 32h, 36h, 40h, 50h and 60h after infection, centrifuging at 1000rpm for 3min, and removing cell debris to obtain a virus sample;

subjecting the collected virus sample to 10-fold gradient dilution to obtain diluted concentrations of 10 respectively ^-2 ～10 ^-10 ；

Vero cells were cultured at 5X 10 ⁴ Cell number/well was seeded in 96-well plates at 37℃in 5% CO ₂ Culturing under the condition, after the cells are attached to the wall and grow, respectively adding diluted virus samples, adding 100 mu L of each hole, and simultaneously setting negative control without adding the virus samples;

the infected cells were subjected to 5% CO at 37 ℃ ₂ Culturing for 1h under the condition, discarding the supernatant, adding 100 mu L of maintenance medium, and continuing culturing;

cytopathy is observed and counted under a microscope, and the result is calculated to TCID according to a Reed-Muench method ₅₀ 。

As shown in fig. 4A, 4B, 4C, 4D and 4E, the virus titer of Vero infected groups was 0, since other IBV strains could not infect Vero cells, no apparent CPE appeared; the 5 IBV strains can be proliferated in cells expressing Furin protein, the virus titer is gradually increased, viruses can be detected in a sample 28h after infection, and other strains reach peak values 60h after infection except that the IBV-QX strain reaches peak values 50h after infection.

Example 9

This example uses the Furin protein-expressing cell line prepared in example 5 for in vitro proliferation of multiple IBV strains, specifically comprising:

cell lines expressing Furin protein were inoculated into T75 cell flasks at 37℃with 5% CO ₂ Culturing under the condition until the cell abundance reaches 90%;

different IBV strains were inoculated into cells, 100. Mu.L of virus suspension was inoculated per bottle of cells, and the cells were inoculated with 5% CO at 37 ℃ ₂ Culturing for 1h under the condition;

centrifuging the cells at 1000rpm for 3min, discarding the culture medium, washing the cells with PBS solution for 2 times, removing unadsorbed virus particles, and exchangingThe medium was maintained at 37℃with 5% CO ₂ Culturing under the condition, collecting cell supernatant after cytopathy reaches 80%, wherein the cell supernatant contains IBV virus particles.

In summary, the invention constructs a recombinant vector and a recombinant lentivirus, and utilizes the recombinant lentivirus to integrate the chicken source Furin gene into the genome of a mammalian cell Vero cell, thereby constructing a Vero cell strain for expressing Furin protein; the constructed cell strain expressing Furin protein can be used for proliferation of a plurality of IBVs, so that the technical problem that most IBVs cannot proliferate in mammalian cells is solved, the proliferation process of the IBVs is simplified, and the cell strain has wide application value in basic research and vaccine research and development work of the IBVs.

The applicant states that the detailed method of the present invention is illustrated by the above examples, but the present invention is not limited to the detailed method described above, i.e. it does not mean that the present invention must be practiced in dependence upon the detailed method described above. It should be apparent to those skilled in the art that any modification of the present invention, equivalent substitution of raw materials for the product of the present invention, addition of auxiliary components, selection of specific modes, etc., falls within the scope of the present invention and the scope of disclosure.

SEQUENCE LISTING

<110> Shanghai veterinary institute of agricultural sciences China (China center Shanghai of animal health and epidemiology)

Sub-center

<120> a cell strain expressing Furin protein and application thereof in culturing avian infectious bronchitis virus

<130> 2020

<160> 3

<170> PatentIn version 3.3

<210> 1

<211> 2889

<212> DNA

<213> chicken source

<400> 1

cggccgcggc ggcggcgcct cgctctcccg tcccgccggc ggcccgggcc cctcggtctg 60

ttgggctgcg cagaggccag cggggcagag cggggcccgg tgtgccgcag ggcgctgacg 120

tgggagccgc gcctggacct cgtgctctgg tagaagaccc ccgatactct gatggatctg 180

aggccctgct cactgctcct gctctggact ctggtggttg ccctcgctct cctggcccga 240

gaggtgttgg cccagcgcat ttacaccaac acctgggctg tgctcgtccc tgctgggccg 300

ctggaggcca accggctggc caggaagcat ggattcctta acctgggccc gattttcggt 360

gactattacc acttccagca ccgcggcgtg gtgaagcgct ccctttcacc ccaccagccc 420

tggcacagcc gtttggcacg ggagccacag gtgcactggc ttgagcagca ggtggcgaag 480

cgcaggacca agcgagacat tttcatggag cccacagacc cgaagttccc gcagcagtgg 540

tacctgtaca acacaaacca gcgggacctg aacgtgcgtc aggcctggga gcagggttac 600

acgggcaagg gcattgtggt ttccatcctg gatgatggca ttgagaagaa ccaccctgac 660

ctggaggcta actacgatcc aggggcaagc tttgatgtca atgaccagga cccagaccca 720

cagccccgtt acacacagat gaatgacaac aggcatggca ctcgatgcgc tggggaagtc 780

gctgccgtag caaacaatgg gatctgtggc gttggcgtgg cttacaatgc ccggattgga 840

ggtgtgcgca tgctggatgg ggaggtgacg gatgctgtgg aggcccattc cctgggtctc 900

aatcccaacc acatccacat ctacagcgcc agctggggcc ctgaggacga tggcaagacg 960

gtcgatggcc cagcccggct ggcagaggag gccttcttcc gaggggtcag ccagggacgc 1020

ggggggctgg gctccatctt cgtctgggca tctggaaacg ggggccgtga acacgacagc 1080

tgcaactgtg atggttacac caacagcatc tacacactgt ccatcagcag caccacgcag 1140

tatggcaacg taccctggta cagcgaggcc tgctcctcca ccctcgccac cacctacagt 1200

agtggcaacc agaatgagaa gcagatcgtg acaactgacc tgagacagaa gtgcaccgaa 1260

tcgcacacgg ggacatcggc ttcagcgcct ctcgctgctg ggatcattgc tcttgccctg 1320

gaggcaaaca agaacctaac ctggagggac atgcagcacc tggtggtgca gacctcgaag 1380

ccggcgcacc tcaatgccaa tgactgggtc accaacggcg ttggccgcaa agtcagccac 1440

tcctacggct atggcctgct ggacgccggg gccatggtaa gcctggccag gaactggatc 1500

acagtgggac ctcagaggaa atgtgtcatc gacgtcctca cggagcctaa ggacatcggg 1560

aagcgcctgg aggtgcgacg gaaggttgat gcctgcctgg ggaaggccaa ctacatcagc 1620

cggctggagc acgcgcaggc ccggctgaca ctgtcctaca accggcgggg tgacctggcc 1680

atccacctcg tcagccccat gggcacccgc tctaccctcc tggctgccag gccccatgac 1740

tactcggctg atggcttcaa tgactgggcc ttcatgacga cacactcgtg ggatgaggac 1800

ccttctgggg agtggctgct ggagattgag aacactagtg atgccaataa ctacggcaca 1860

ctgaccaagt tcacgctggt gctgtacggg acagccactg acccccctgg gctctccaat 1920

cagctggaga gtagtggctg caagaccttg acccccagcc agacctgcgt ggtctgcgaa 1980

gagggatact acctgcacca gaagagctgc ctgaagcgct gcccccctgg cttcgcacct 2040

ggagtgcaga acacacacta caacctggag aacagcatgg agcccatcgc accccagctc 2100

tgcctgccct gccacccctc ctgcgccacc tgcacggggc ccggccccaa tcagtgcctg 2160

acctgccccg cgcactccca cttcagcagc ttggacctct cctgctccca ccagacgcag 2220

agcagccgtg cgtcccccgc cctggtggag ggtgaggggc agtctgaggc ccctcctcca 2280

gccaacccgc tcgtcctcat cgccagcctc agctgcgttc tcattgtcgt catcttcatc 2340

accgtcttcc tggtgctgca agtgcgctcc gggttcagcc tgcggggcgt gaaggtctac 2400

gccctggaca gcggcatcat ctcctacaag gggctgccct ccgacatctg gcaggaggag 2460

ggcccttcgg agtcggacat tgaggagtgc gaagtgcaca atgagaggac tgccttcatc 2520

agagaccaaa gtgccctttg atgaccctct gcccctccct cctcctcctg gcaccgcggc 2580

gcaggggcag atgaggccga ggggcctgga ctctgctccc gtccccctcc gtggcattct 2640

gggctcccca ctgctggtac cgtcctcagc cctgcgctgt ccccgtcccg gaccatctct 2700

cacagcctcg tgtccatgct gtgccctgtg ctggtgtgtg gccagaccct ggtgctggct 2760

ttgtgctggc agctgcgttc cttcccctgg gccggcggtt gctgggggcc acacgtggct 2820

gcggggatgg gggccggcgc ccttgttggt gttgccctga ctgggctacc ttgaagctcc 2880

ccgccgcct 2889

<210> 2

<211> 44

<212> DNA

<213> Synthesis

<400> 2

ttcaggtgtc gtgaagcggc cgcatggatc tgaggccctg ctca 44

<210> 3

<211> 45

<212> DNA

<213> Synthesis

<400> 3

cgttaggggg gggggtctag atcaaagggc actttggtct ctgat 45

Claims

1. Application of recombinant vector, recombinant lentivirus or cell strain expressing Furin protein in culturing avian infectious bronchitis virus;

the recombinant vector is a lentiviral vector containing a chicken source Furin gene;

the chicken source Furin gene is a nucleic acid sequence shown in SEQ ID NO. 1;

the recombinant lentivirus is obtained by packaging the recombinant vector and the auxiliary plasmid cotransfected mammalian cells;

the cell strain expressing Furin protein contains the recombinant vector or the recombinant lentivirus;

the avian infectious bronchitis virus is any one or a combination of at least two of IBV-H120 strain, IBV-4/91 strain, IBV-QX strain or IBV-M41 strain;

the cell strain expressing Furin protein is a Vero cell line with a nucleic acid sequence shown in SEQ ID NO. 1 integrated in a genome.

2. The use of claim 1, wherein the mammalian cells comprise 293T cells.

3. The use according to claim 1, wherein the recombinant vector is a Phage-puro vector having the nucleic acid sequence shown in SEQ ID NO. 1 attached thereto.

4. The use according to claim 1, wherein the method for constructing the Furin protein-expressing cell line comprises:

5. The use according to claim 4, wherein the construction method of the recombinant vector comprises:

PCR (polymerase chain reaction) amplification of chicken fibroblast line cDNA (complementary deoxyribonucleic acid) by using a primer pair shown in SEQ ID NO. 2-3 to obtain a chicken source Furin gene;

6. The use according to claim 5, wherein the chicken source Furin gene is inserted between Not I and Xba I cleavage sites of a lentiviral vector.

7. The use according to claim 4, wherein the host cell comprises a Vero cell line.

8. The use according to claim 4, wherein the concentration of puromycin during the screening is 0.1-1 μg/mL.

9. The use according to claim 4, wherein the screening is not shorter than 48 h.

10. A method of culturing avian infectious bronchitis virus, said method comprising the steps of:

(1) Culturing the Furin protein-expressing cell of claim 1;

(3) Removing unadsorbed avian infectious bronchitis virus particles, changing culture medium, continuously culturing, and collecting cell supernatant;

the cell expressing Furin protein is a Vero cell line with a nucleic acid sequence shown in SEQ ID NO. 1 integrated in the genome.

11. The method of claim 10, wherein the temperature of the culturing in step (1) is 35-40 ℃.

12. The method of claim 11, wherein the temperature of the culturing in step (1) is 37 ℃.

13. The method of claim 10, wherein the CO of step (1) is cultured ₂ The concentration is 4.5% -5.5%.

14. The method of claim 13, wherein the CO of step (1) is cultured ₂ Concentration of5%.

15. The method of claim 10, wherein the cells expressing Furin protein of step (1) are cultured to an abundance of no less than 90%.

16. The method of claim 10, wherein the temperature of the co-cultivation in step (2) is 35-40 ℃.

17. The method of claim 16, wherein the temperature of the co-cultivation in step (2) is 37 ℃.

18. The method of claim 10, wherein CO-cultivation of CO in step (2) ₂ The concentration is 4.5% -5.5%.

19. The method of claim 18, wherein step (2) is performed with CO ₂ The concentration was 5%.

20. The method of claim 10, wherein the co-cultivation in step (2) is performed for a period of 0.5h to 2 h.

21. The method of claim 20, wherein the co-cultivation in step (2) is for a period of time of 1h.

22. The method of claim 10, wherein the removing of unadsorbed avian infectious bronchitis virus particles of step (3) is by centrifugation.

23. The method of claim 22, wherein the rotational speed of the centrifugation is 800rpm to 1500 rpm.

24. The method of claim 23, wherein the rotational speed of the centrifugation is 1000rpm.

25. The method of claim 22, wherein the centrifugation is for 2-10 minutes.

26. The method of claim 25, wherein the centrifugation is for 3 minutes.

27. The method of claim 10, wherein step (3) further comprises the step of washing the cells 1-3 times with PBS solution before changing the medium.

28. The method of claim 10, wherein the medium of step (3) is a maintenance medium.

29. The method of claim 10, wherein the temperature of the continued culture in step (3) is 35-40 ℃.

30. The method according to claim 29, wherein the temperature at which the culturing is continued in step (3) is 37 ℃.

31. The method according to claim 10, wherein the CO continued to be cultured in step (3) ₂ The concentration is 4.5% -5.5%.

32. The method of claim 31, wherein step (3) is performed on CO that continues to be cultured ₂ The concentration was 5%.

33. The method of claim 10, wherein the time for continuing the culturing in step (3) is not shorter than 24 h.

34. The method of claim 33, wherein the time for continuing the culturing in step (3) is 50h.

35. The method of claim 10, wherein the cell supernatant is collected after the culturing of step (3) is continued until the cytopathic effect reaches 80% or more.

36. The method according to any one of claims 10 to 35, characterized in that it comprises the steps of:

(1) At 35-40 ℃, 4.5% -5.5% CO ₂ Culturing cells expressing Furin protein under the condition that the abundance of the cells expressing Furin protein is not lower than 90%, wherein the cells expressing Furin protein are Vero cell lines with nucleic acid sequences shown in SEQ ID NO. 1 integrated in genome;

(2) Inoculating any one or a combination of at least two of an IBV-H120 strain, an IBV-4/91 strain, an IBV-QX strain or an IBV-M41 strain of avian infectious bronchitis virus into the cells expressing Furin protein, and carrying out CO concentration of 4.5% -5.5% at 35-40 DEG C ₂ Co-culturing for 0.5-2 h under the condition;

(3) Centrifuging at 800-1500 rpm for 2-10 min, removing unadsorbed avian infectious bronchitis virus particles, washing cells with PBS solution for 1-3 times, replacing maintenance medium, and maintaining at 35-40deg.C with 4.5% -5.5% CO ₂ Culturing under the condition of no less than 24h, and collecting cell supernatant after cytopathy reaches no less than 80%.