CN111549059A

CN111549059A - TPL 2gene knockout HEK293T cell line and construction method and application thereof

Info

Publication number: CN111549059A
Application number: CN202010360252.0A
Authority: CN
Inventors: 郑海学; 张克山; 闫鸣昊; 郝军红; 申超超; 朱紫祥; 李丹; �田宏; 茹毅; 杨帆; 曹伟军; 刘湘涛
Original assignee: Lanzhou Veterinary Research Institute of CAAS
Current assignee: Lanzhou Veterinary Research Institute of CAAS
Priority date: 2020-04-30
Filing date: 2020-04-30
Publication date: 2020-08-18

Abstract

The invention relates to a TPL 2gene knockout HEK293T cell line and a construction method and application thereof. The invention provides a construction method of a TPL 2gene knockout HEK293T cell line, which takes a second exon region of a human TPL 2gene as a target sequence, and concretely takes a 390 th to 459 th bp sequence or a 391 th to 448 th bp sequence of a TPL2 allele 1 and a second exon of an allele 2 of SEQ ID NO:1 as the target sequence. The invention provides a TPL 2gene knockout HEK293T cell line HEK293T-KO-TPL2 with a preservation number of CCTCC NO: C2019328. The morphology, proliferation speed and other aspects of the knockout cell line obtained by the invention have no obvious difference from those of a control cell, and the knockout cell line is an ideal TPL2 knockout cell model; the modified cell line is stable, provides a key biological material for researching the mode of inhibiting virus replication by TPL2 protein and the pathogenic mechanism of the virus, and can be used for separating and culturing SVA and applied to large-scale cell culture and production of SVA vaccine strains.

Description

TPL 2gene knockout HEK293T cell line and construction method and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a TPL 2gene knockout HEK293T cell line, and a construction method and application thereof.

Background

The HEK293 cell line is a human embryonic kidney epithelial cell transfected with the adenovirus E1A gene. The HEK293T cell is a high-trans derivative formed by transferring SV40T-antigen gene into HEK293 cell, can express SV40 large T antigen, and can replicate a plasmid containing SV40 replication starting point and promoter region. The cell can be used for gene expression and protein production of various types, and can also be used for producing high-titer retroviruses and other viruses, such as adenoviruses and other mammalian viruses.

TPL2 is a serine/threonine kinase, also known as COT or MAP3K8, that when unstimulated TPL2 forms a complex with p105 and ABIN2 to remain inactive (GANTKE T, SRISKANTHARAJAH S, LEY S C. Regulation and function of TPL-2, an IkappaB kinase-regulated MAP kinase [ J ]. Cell Res, 2011, 21(1): 131-45.). After various receptors such as TLR, TNFR, IL1R and the like are stimulated, the activation of various signal proteins such as downstream ERK, JNK, p38, NF-kappa B and the like can be regulated and controlled through signal transduction mediated by TPL 2; it also stimulates a variety of innate immune cells such as macrophages, dendritic cells, neutrophils to produce a large number of cytokines such as type I interferons, tumor necrosis factors, etc. (GANTKE T, SRISKANTHARAAJAH S, SADOWSKI M, et al. I.I.kappa.B kinase regulation of the TPL-2/ERK MAPK pathway [ J ]. Immunol Rev, 2012,246(1): 168-82.). TPL2 is also essential in regulating the differentiation of CD4+ T cells to generate different Th cell lineages (ZHU J, PAUL W E. CD 4T cells: tissues, functions, and functions [ J ] Blood,2008, 112(5): 1557-69.), is an important participant in innate immunity, inflammation and tumor, and plays an important role in both innate immunity and acquired immunity.

The CRISPR/Cas9 gene editing technology is a third generation genome editing technology that has evolved rapidly following ZFN and TALEN technologies. The technology comes from a CRISPR-Cas acquired immune system resisting phage invasion existing in bacteria and archaea, and is gradually developed through artificial modification (development and application of CRISPR/Cas9 technology of Sichuan university of agriculture [ N ] scientific report, 2019-08-20 (B02)). Bacteria, with the help of CRISPR and Cas9, can target and silence key parts of invader's genetic information via the guidance of small RNA molecules. The CRISPR/Cas9 Genome editing technology is that a target gene sequence is specifically recognized by a gRNA, a Cas9 endonuclease is guided to cut double-stranded DNA at a targeted site, then a non-homologous end joining repair mechanism (NHEJ) of a cell rejoins the genomic DNA at a break, and insertion or deletion mutations are introduced (CONG L, F Z. Genome engineering using CRISPR/Cas9system [ J ] Methods mol Bio, 2015, 1239: 197-217.). Three gene editing endonucleases, namely ZNF, TALEN and CRISPR/Cas9, are applied to clinic at present. Among them, the CRISPR/Cas9system is the most widely used gene editing technology in this field due to its advantages of high efficiency, rapidness, multiple functions, easy use, low cost, etc., and has been applied to various species (MEMI F, NTOKOU A, PAPANGELII. CRISPR/Cas9 gene-editing: Research technologies, clinical applications and clinical diagnostics [ J ]. SeminPerinato, 2018, 42(8): 487-500.).

The Chinese invention patent with the publication number of CN 110862968A discloses a PK-15 cell line PK-15-KO-MAP3K8 knocked out by MAP3K8 gene, a construction method and application thereof. The cell line can promote the proliferation of FMDV and SVV, improve the virus yield, can be used for large-scale cell culture and production of FMDV and SVV vaccine strains, and can provide a powerful tool for researching the action mechanism of MAP3K8 in the virus infection process. However, in later practice, the cell line is not stable enough in terms of cell morphology and proliferation rate compared with a wild cell line, and is not favorable for application in basic research.

Disclosure of Invention

The invention provides a TPL 2gene knockout HEK293T cell line HEK293T-KO-TPL2, which aims to solve the problem that the cell line of the TPL 2gene knockout cell line is poor in stability in aspects of cell morphology, proliferation speed and the like. The growth speed, the cell morphology and the propagation speed of the cell line HEK293T-KO-TPL2 are not different from those of a wild HEK293T cell line, so that the cell line is an ideal TPL2 knockout cell model and is a key biological material for researching a mode of inhibiting virus replication by TPL2 protein and accumulating a virus pathogenesis.

The invention specifically adopts the following technical scheme:

in a first aspect, the invention provides a construction method of a TPL 2gene knockout HEK293T cell line, wherein a second exon region of a human TPL 2gene is used as a target sequence, and specifically, 390-459 bp sequences or 391-448 bp sequences of second exons of a TPL2 allele 1 and an allele 2 shown in SEQ ID NO. 1 are used as target sequences.

Preferably, the target sequences of allele 1 and allele 2 are knocked-in exogenous sequences or knocked-out target sequences.

Preferably, an exogenous sequence is inserted between 390 th to 391bp of TPL2 allele 1 shown in SEQ ID NO. 1, the base G at 449bp is knocked out, and 58bp of 391 th to 448bp of allele 2 are knocked out;

or knocking out the 393bp 'C' base of the TPL2 allele 1 shown in SEQ ID NO. 1, knocking out 18bp altogether from 442-459 bp, and knocking out 58bp altogether from 391-448 bp of the allele 2.

More preferably, the insertion exogenous sequence of the TPL2 allele 1 between 390 th bp and 391 th bp is shown as SEQ ID NO. 6.

The construction method of the TPL 2gene knockout HEK293T cell line specifically comprises the following steps:

step 1: design of sgRNA oligo sequence: two pairs of sgRNAs specifically targeting human TPL2 genes are constructed according to the sequence of the human TPL2 gene: sgRNA1 and sgRNA 2;

specifically, the sgRNA targets the second exon region of the human TPL2 gene.

Further, the sgRNA1 was synthesized from the following sequence:

H-TPL2-sgRNA1Forward：5’-TCCTCGGGGCGCCTTTGGAA-3’；

H-TPL2-sgRNA1Reverse：5’-TTCCAAAGGCGCCCCGAGGA-3’；

the sgRNA2 was synthesized from the following sequence:

H-TPL2-sgRNA2Forward：5’-CCGATGTTCTCCTGATCCCC-3’；

H-TPL2-sgRNA2Reverse：5’-GGGGATCAGGAGAACATCGG-3’；

step 2: construction of pX-EZ-TPL2-sgRNA recombinant plasmid: cloning two sgRNAs of the constructed specific target knockout human TPL 2gene to the same CRISPR/Cas9 vector plasmid pX459 to obtain a recombinant plasmid pX-EZ-TPL 2-sgRNA;

specifically, two sgrnas were cloned onto the same CRISPR/Cas9 vector plasmid pX459 using an EZ-guideexh helper plasmid.

And step 3: plasmid transfection: respectively transfecting the pX-EZ-TPL2-sgRNA recombinant plasmid and the pX-EZ no-load plasmid into HEK293T cells;

specifically, the transfection process was performed according to the instructions of the HighGene transfection reagent.

Prior to transfection, HEK293T cells were cultured in DMEM medium supplemented with 10% fetal bovine serum and 1% penicillin streptomycin.

And 4, step 4: drug screening monoclonal cell lines: the CRISPR/Cas9system is utilized to achieve the purpose of gene silencing, negative cells are killed through drug screening, and then a positive monoclonal cell line is obtained through limited dilution sorting;

specifically, the screening drug is puromycin (puromycin) antibiotic.

And 5: identification of knockout cell lines: and (3) carrying out amplification culture on the sorted monoclonal cell line, identifying the knockout condition of a positive monoclonal cell line gene by genotyping PCR sequencing, and then further identifying the screened homozygous knockout cell line by Westernblotting to verify the knockout condition of the TPL2 protein in the cell line.

Specifically, the expansion culture is as follows: and (3) inoculating the sorted monoclonal cells into a 96-well plate, carrying out passage to a 48-well plate after the monoclonal cells grow to full length, and sequentially carrying out amplification culture to a 24-well plate, a 12-well plate, a 6-well plate and a T25 culture bottle.

Further, the genotyping PCR detection primer sequence is as follows:

H-TPL2 genetyping Forward：5’-GACCAGGCACCTGCATCTGTT-3’，

H-TPL2 genetyping Reverse：5’-TGAGGCAGTGCACCCTCAGA-3’。

in a second aspect, the invention provides a cell line constructed by the construction method of the TPL 2gene knockout HEK293T cell line.

Furthermore, the invention provides a TPL 2gene knockout HEK293T cell line HEK293T-KO-TPL2 with a preservation number of CCTCC NO: C2019328.

In a third aspect, the invention provides application of a TPL 2gene knockout HEK293T cell line in researching a mode that TPL2 inhibits virus replication and virus pathogenesis.

Further, the virus is SVA.

In a fourth aspect, the invention provides the use of a TPL2 knock-out HEK293T cell line for isolation and culture of SVAs.

In a fifth aspect, the invention provides application of the TPL 2gene knockout HEK293T cell line in large-scale cell culture and production of SVA vaccine strains.

The invention has the following beneficial effects:

1. the TPL 2gene knockout HEK293T cell line HEK293T-KO-TPL2 is constructed by using a CRISPR/Cas9system, the cell line is stable after being modified, the aspects of cell morphology, proliferation speed and the like are not obviously different from those of a control cell, the cell line is an ideal TPL2 knockout cell model, and a key biological material is provided for researching a mode of TPL2 protein inhibiting virus replication and a virus pathogenic mechanism.

2. The TPL 2gene knockout HEK293T cell line HEK293T-KO-TPL2 can not correctly express TPL2 protein due to the fact that certain fragments are deleted to change the open reading frame of TPL2 coding protein to cause frame shift mutation, and therefore the gene knockout purpose is achieved. As the TPL2 protein has an antiviral effect, the proliferation of SVA virus in wild-type HEK293T cells can be inhibited, and TPL 2gene knockout HEK293T cell line HEK293T-KO-TPL2 cannot correctly express TPL2 protein, so that the SVA virus can be favorably propagated in the cell line to obtain larger virus with high titer, and the feasibility strategy that the engineering cell line for vaccine production edited by the CRISPR/Cas9 gene editing technology is a feasible strategy for improving the virus yield is proved, and the method has important significance for large-scale cell culture and production of SVA vaccine strains in the future.

Drawings

FIG. 1 is a diagram showing the results of sequencing verification of pX459-sgRNA1 and EZ-sgRNA2 recombinant plasmids constructed in the examples of the present invention.

FIG. 2 is a diagram showing the PCR identification result of the recombinant plasmid pX-EZ-TPL2-sgRNA constructed in the example of the present invention, in which lanes 1 to 4 are sequentially Marker DL2000, recombinant plasmid pX-EZ-TPL2-sgRNA, blank lane, and recombinant plasmid pX-EZ-TPL 2-sgRNA.

FIG. 3 is a diagram showing the results of PCR identification of TPL2 knock-out cell line genome in the present example, wherein lane 1 is Marker DL2000, lane 2 is HEK293T-WT-TPL2 cell line, lane 3 is HEK293T-KO-TPL2-A2 cell line, lane 5 is HEK293T-KO-TPL2-B1 cell line, and the other lanes are non-positive clones.

FIG. 4 is a diagram showing the sequencing results of the genotype alignment of the TPL 2gene knockout cell line HEK293T-KO-TPL2-A2 and HEK293T-KO-TPL2-B1 in the example of the present invention.

FIG. 5 is a diagram for detecting the abundance of TPL2 protein in HEK293T-WT-TPL2 and HEK293T-KO-TPL2 cells by Western blotting in the embodiment of the invention.

FIG. 6 is a cell morphology of HEK293T-WT-TPL2 and HEK293T-KO-TPL2 cells under an inverted microscope in the examples of the present invention.

FIG. 7 is a graph showing the time taken for cells to form cell monolayers in HEK293T-WT-TPL2 and HEK293T-KO-TPL2 in examples of the present invention.

FIG. 8 is a graph showing the fluorescence expression level of SVA in HEK293T-WT-TPL2 and HEK293T-KO-TPL2 cells observed under a fluorescence microscope in the examples of the present invention.

FIG. 9 is a graph of absolute quantification of SVA replication in HEK293T-WT-TPL2 and HEK293T-KO-TPL2 cells in an example of the invention.

FIG. 10 is a graph showing the relative quantification of SVA viral transcript levels in HEK293T-WT-TPL2 and HEK293T-KO-TPL2 cells in accordance with an embodiment of the present invention.

FIG. 11 is a diagram showing the abundance of structural proteins of viruses replicated by SVA in HEK293T-WT-TPL2 and HEK293T-KO-TPL2 cells detected by Western blotting in the examples of the present invention.

FIG. 12 is a SVATCID of cell expansion of HEK293T-WT-TPL2 and HEK293T-KO-TPL2 in an example of the invention₅₀Titre profile.

In the drawings there is shown in detail,p<0.05 indicated statistically significant difference; **,p<0.01 indicates that the statistical difference is very significant.

Preservation information:

preservation time: 11/29/2019;

the name of the depository: china center for type culture Collection;

the preservation number is: CCTCC NO: C2019328;

the address of the depository: wuhan university in China;

and (3) classification and naming: human embryonic kidney cells HEK293T-KO-TPL 2.

Detailed Description

The invention is described in further detail below with reference to the drawings and specific examples, which are provided for illustration only and are not intended to limit the scope of the invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are all commercially available reagents and materials unless otherwise specified.

Sources of materials used in the examples:

cells, plasmids and viruses: human embryonic kidney 293T cells (HEK293T) were supplied by ABClonal. The CRISPR/Cas9 vector plasmid pX459 pSpCas9-2A-puro-MCS and the helper vector plasmid EZ-guideXH are supplied by ABClonal. Coli Trans5 α competent cells were purchased from Hokko gold. Seneca Valley virus (SVA) strains were maintained by the foot and mouth disease epidemiology team at the lanzhou veterinary institute.

Reagents and antibodies: 0.25% trypsin, Opti-MEM, DMEM medium, streptomycin and heat inactivated Fetal Bovine Serum (FBS) were purchased from Gibco; t4 DNA ligase (Quick), the HighGene transfection reagent were purchased from ABClonal; SDS-PAGE protein loading buffer (5X), RNA extraction reagent Trizol, 5 XFirst buffer, 0.1M DTT, RNase inhibitor (RRI) and reverse transcriptase M-MLV were purchased from Invitrogen; oligo (dT) primers, Random primers, deoxyribonucleoside triphosphates (dNTPs), 2 × one step RT-PCR Buffer III, TaKaPa EX Taq HS, and PrimeScript RT Enzyme mix II were all purchased from Takara; phosphate buffer (PBS solution pH7.4, 0.0067M) from Hyclone; both RAPI cell lysate and PMSF were purchased from pecan corporation; restriction endonucleases Bbs1, Spe1, Kpn1, protein prestainer, and ECL color developing solution were all available from Thermo Fisher Scientific; nitrocellulose membranes (NC membranes) were purchased from Pall corporation; 50 XTAE, DEPC water, 30% polyacrylamide were obtained from Sobela; TB Green ™ Premix Ex Taq II (TliRNaseH plus), LA Taq DNA polymerase and nucleic acid Marker were purchased from Bao bioengineering Dalian Co., Ltd; tween20 and agarose were purchased from Roche. Commercial antibodies useful in the present invention include: HRP-labeled goat anti-rabbit IgG antibody (Proteintech), HRP-labeled goat anti-mouse IgG antibody (Proteintech), mouse anti-TPL 2 monoclonal antibody (Santa Cruz Biotechnology), mouse anti-beta-actin monoclonal antibody (Santa Cruz Biotechnology); goat anti-rabbit fluorescent secondary antibody (CST). The rabbit anti-SVA polyclonal antibody is provided by a foot-and-mouth disease epidemiology team of Lanzhou veterinary institute, and Western blotting detection can show three protein bands of VP0, VP1 and VP 3.

The instrument comprises the following steps: the nucleic acid electrophoresis tank, the membrane transfer instrument and the high-resolution image acquisition system are purchased from BIO-RAD company; CO 2₂Constant temperature incubator, 4 ℃ display cabinet, -20 ℃ refrigerator, -80 ℃ ultra-low temperature refrigerator and fluorescent quantitative PCR instrument are all purchased from Thermoscientific company; laser scanning confocal microscopy was purchased from Leica, germany; inverted optical microscopes were purchased from Nikon corporation; the electric heating constant-temperature water bath kettle is purchased from Shanghai Shenan company; the vortex oscillator, ice maker and horizontal shaker were all purchased from six companies, Beijing; PCR instruments, small room temperature centrifuges, cryoultracentrifuges, and pH meters are all available from Eppendorf Inc.

The present invention will be described in detail with reference to examples. The following examples will assist those skilled in the art in further understanding the invention, but are not intended to limit the invention in any way. It should be noted that it would be apparent to those skilled in the art that several modifications and improvements can be made without departing from the inventive concept. All falling within the scope of the present invention.

1. Design of sgRNA oligo sequences

According to the published human TPL 2Gene sequence (Gene ID: 1326, shown in SEQ ID NO: 1) from NCBI database, two pairs of specific sgRNA sequences were designed by an online CRISPR design tool (http:// CRISPR. mit. edu /), targeting the second exon of human TPL 2. The designed oligonucleotide sequences are shown in Table 1.

TABLE 1 human TPL2 sgRNA oligo sequences

Primer name	Primer sequence (5 '-3')	Sequence numbering
			H-TPL2-sgRNA1Forward	TCCTCGGGGCGCCTTTGGAA	SEQ ID NO:2
H-TPL2-sgRNA1 Reverse	TTCCAAAGGCGCCCCGAGGA	SEQ ID NO:3
			H-TPL2-sgRNA2Forward	CCGATGTTCTCCTGATCCCC	SEQ ID NO:4
H-TPL2-sgRNA2 Reverse	GGGGATCAGGAGAACATCGG	SEQ ID NO:5

2. Construction of pX-EZ-TPL2-sgRNA recombinant plasmid

Annealing the synthesized two single-stranded sgRNA oligoDNAs to form double strands, carrying out enzyme digestion on a CRISPR/Cas9 vector pX459 pSpCas9-2A-puro-MCS and an auxiliary vector EZ-guideXH through Bbs1, and then recovering a linearized vector. The annealed sgRNA1 and sgRNA2 double-stranded DNA were ligated with linearized pX459 pSpCas9-2A-puro-MCS and EZ-guideXH for 5min at room temperature (25 ℃) by using T4 DNA quick ligase to obtain pX459-sgRNA1 and EZ-sgRNA2 recombinant plasmids, and the recombinant plasmids were then subjected to sequencing and identification, as shown in FIG. 1, it can be seen from FIG. 1 that the sgRNA1 and sgRNA2 double-stranded DNA were successfully ligated into pX459 pSpCas9-2A-puro-MCS and EZ-guideXH. The two obtained recombinant plasmids are subjected to double enzyme digestion by Spe1 and Kpn1, and after recovery, a linearized enzyme digestion product is connected for 5min at room temperature (25 ℃) by utilizing T4 DNA fast ligase, and finally, a pX-EZ-TPL2-sgRNA recombinant plasmid is obtained. The plasmid was transformed into Trans 5. alpha. competent cells, followed by plating on ampicillin resistant plates overnight at 37 ℃. Selecting the monoclonal bacteria the next day, adding an LB culture medium with ampicillin resistance, carrying out shake culture in a constant temperature box at 37 ℃, extracting plasmids according to the specification of the plasmid miniprep kit after 12-16 h, and carrying out colony PCR screening, wherein the correct size of the amplified positive clone PCR product is about 520bp and is consistent with the expected size, as shown in FIG. 2. The positive clones plasmids screened were then further verified by sequencing with the U6 universal primer.

3. Cell culture and transfection

HEK293T cells were cultured in DMEM medium containing 10% fetal bovine serum and 1% penicillin streptomycin and placed at 37 ℃ in 5% CO₂Culturing in an incubator. Before transfection, HEK293T cells in logarithmic growth phase with good growth state are inoculated into a 6-well cell culture plate for culture, when the cell density reaches 70% -80%, 4 mu g of the constructed pX-EZ-TPL2-sgRNA recombinant plasmid is transfected into the cells according to the specification of a HighGene transfection reagent (the HighGene and the recombinant plasmid are mixed according to the concentration of 2: 1), and an equal amount of pX-EZ empty vector is transfected to serve as a negative control.

4. Drug screening monoclonal cell lines

And after 24-48 h of cell transfection, replacing a fresh DMEM complete culture medium containing 1.3 mug/mL puromycin antibiotics for drug screening, replacing the fresh DMEM complete culture medium containing 0.65 mug/mL puromycin antibiotics after two days, and continuing screening for about 7 days to observe that all cells in the negative control group die. Digesting the obtained positive cells into single cells, diluting the cells into a 96-well plate by using a limiting dilution method, observing the growth condition of the single clone after culturing for one week, and selecting the single clone with good growth state for identification after about two weeks.

5. Identification of HEK293T cell line with TPL 2gene knockout

And (3) inoculating the selected monoclonal cells in a 96-well plate into a 48-well plate, and after the cells grow to be full, sequentially carrying out amplification culture on the cells to a 24-well plate, a 12-well plate, a 6-well plate and a T25 culture bottle. During the period, a part of cells are taken to extract total RNA of the cells and are reversely transcribed into a cDNA template, and high specificity primers (shown in table 2) designed aiming at knockout targets are used for PCR amplification and nucleic acid electrophoresis detection, and the result is shown in figure 3. And then carrying out genotyping PCR sequencing identification on the suspected positive clone, comparing the suspected positive clone with the original genome, and detecting whether the targeted knockout of the TPL 2gene is successful or not, wherein the sequence of a detection primer is shown in Table 2. The result of the sequence comparison analysis shows that the selected HEK293T-KO-TPL2-A2 cell line TPL2 allele 1 is knocked in by 54bp (shown as SEQ ID NO. 6) between 390 and 391bp, and the base G at 449bp is knocked out; 58bp (shown as SEQ ID NO. 7) in total of 391-448 bp of the allele 2 is knocked out; the 393bp 'C' base of the HEK293T-KO-TPL2-B1 cell line TPL2 allele 1 is knocked out, 18bp (shown as SEQ ID NO. 8) of 442-459 bp is knocked out, and 58bp (shown as SEQ ID NO. 7) of the allele 2 is knocked out, as shown in FIG. 4. Therefore, the HEK293T-KO-TPL2-A2 and the HEK293T-KO-TPL2-B1 cell lines are homozygous knockouts. And extracting proteins from the monoclonal cells and the control cells which are sequenced correctly, detecting the expression of the protein level of TPL2 by Western blotting, and further verifying the knockout effect of the TPL 2gene, wherein the Western blotting experimental method is shown in the following section 10, and the replication condition of SVA on HEK293T-KO-TPL2 cells is verified by Western blotting. The result shows that the TPL2 protein in the control cell HEK293T-WT-TPL2 is normally expressed, while the TPL2 protein is not detected in the TPL2 knockout monoclonal cell lines HEK293T-KO-TPL2-A2 and HEK293T-KO-TPL2-B1, the expression amount of the internal reference beta-actin is normal and basically consistent, and the result is shown in FIG. 5, which indicates that the TPL2 knockout cell line is successfully established in the invention. A HEK293T-KO-TPL2-B1 cell line was randomly selected from the two knock-out cell lines for subsequent functional evaluation and named HEK293T-KO-TPL 2.

TABLE 2genetypingPCR detection primer sequences

Primer name	Primer sequence (5 '-3')
		H-TPL2 genetyping Forward	GACCAGGCACCTGCATCTGTT
H-TPL2 genetyping Reverse	TGAGGCAGTGCACCCTCAGA

6. Cytomorphology observation and proliferation speed analysis of TPL 2gene knockout HEK293T cell line

When HEK293T-KO-TPL2 and HEK293T-WT-TPL2 cells were cultured to a confluency of 80% to 90%, 0.25% trypsin was added for digestion, and fresh DMEM complete medium was added to stop digestion when the cells became suspended. Centrifuging the cell suspension at 1200r/min for 5min, removing the supernatant, retaining the precipitate, adding a culture medium to resuspend the cells, and carrying out cell passage according to the ratio of 1: 4. The cells were seeded in 6-well plates, and HEK293T-KO-TPL2 cells grown to a monolayer were observed at random field of view with an inverted microscope and photographed, and their cell morphology was compared with HEK293T-WT-TPL2 cells, and it was found that HEK293T-KO-TPL2 and HEK293T-WT-TPL2 cells were in agreement with their morphology, both adherent and epithelial-like, as shown in fig. 6. Thus, the knockout of TPL2 did not result in a significant change in cell morphology under the conditions of this experiment. HEK293T-KO-TPL2 and HEK293T-WT-TPL2 cells were continuously passaged in a 6-well plate, the time for two groups of cells to form a cell monolayer was observed every 2 generations, and 3 duplicate wells were repeated to perform statistical analysis on the proliferation rate of the cells. The results showed that the time for cell monolayer formation was almost the same between HEK293T-KO-TPL2 and HEK293T-WT-TPL2 cell lines at passage 2, passage 4, passage 6, passage 8 and passage 10, which are all about 36h, as shown in FIG. 7. This indicates that both cells have the same proliferation rate.

7. Viral infection

The HEK293T-KO-TPL2 and HEK293T-WT-TPL2 cells are subjected to self-resuscitation and then are subjected to passage for 2-3 generations, and the cells are eliminated after the cell state is stableChemolysis was performed in 6-well plates, 5 × 10 per well⁵The cells were incubated at 37 ℃ with 5% CO₂An incubator. When the cells grow to 80% -90%, the cells are washed once by serum-free DMEM to remove the residual serum in the cells, then two groups of cells are infected by 1 multiple multiplicity of infection (MOI) SVA virus respectively and placed at 37 ℃ and 5% CO₂Adsorbing for 1 h in an incubator. After the adsorption was completed, the inoculum was discarded, and the culture was continued by changing to DMEM maintenance solution containing 2% FBS and the cells were harvested at the indicated time points. The harvested cell samples were washed twice with PBS to remove attached virus for subsequent experiments.

8. Indirect immunofluorescence observation of fluorescence expression quantity of SVA virus particles on HEK293T-KO-TPL2 cells

Spreading HEK293T-KO-TPL2 and HEK293T-WT-TPL2 cells in 20 mm glass dish, and infecting two groups of cells with SVA virus according to the infection method and dosage when the cells grow to 60-70%; collecting cells at 0 h, 8h and 16 h after infection, and washing with 1 × PBS for 3 times; adding 4% paraformaldehyde (1 mL per dish) and fixing overnight in the dark; discard the supernatant, wash 3 times with 1 × PBS 5 min/time (add 1 × PBS lightly to prevent cells from being washed up); adding 0.2% Triton X-100 (0.2% Triton X-100: 100 mL PBS + 200. mu. LTritonX-100) and allowing to permeate at room temperature for 1 h; discarding the supernatant, washing 3 times with 1 × PBS for 5 min/time; blocking with 5% BSA (5% BSA: 10 mL +0.5 g BSA) for 1.5h at 37 ℃; removing the blocking solution, adding SVA virus primary antibody diluted by 5% BSA, and incubating overnight at 4 ℃; washing with 1 XPBST (1 XPBST: 100 mL 1 XPBST +50 uL Tween 20) three times, 10 min/time, adding a fluorescein-labeled secondary antibody (immunofluorescence rabbit secondary antibody) diluted with 1 XPBST, and incubating at 37 ℃ for 1.5 h; washing with 1 XPBST three times for 10 min/time, and adding 100. mu.L of anti-fluorescence attenuation blocking tablet sealing piece (containing DAPI) to each dish; fluorescence was observed using a confocal laser instrument and the pictures were saved. As a result, as shown in the figure, in the samples collected at 8h and 16 h after infection, the fluorescence expression amount of SVA virions in HEK293T-KO-TPL2 cells was significantly higher than that of HEK293T-WT-TPL2 cells, as shown in FIG. 8.

9. RT-qPCR verified replication of SVA in HEK293T-KO-TPL2 cells

0 h, 8h and 16 h after SVA infectionCollecting cells, extracting total RNA of the cells by using a Triozl cracking method, then carrying out absolute quantitative analysis on the extracted whole genome RNA by using an absolute quantitative primer SVA-3D-F/R for amplifying a conserved region of SVA3D protein and a specific probe of SVA3D protein, and determining the copy number of the SVA, wherein the sequence of the primer is detailed in Table 3. The results showed that SVA virus was present in HEK293T-KO-TPL2 cells in samples harvested at 8h and 16 h post-infectionSVA3DThe copy number of (a) was significantly higher than that of HEK293T-WT-TPL2 cells, as shown in FIG. 9. Reverse transcribing the extracted total RNA to cDNA, using cDNA as template, and using relative quantitative primer SVA-F/R of amplified SVA, adopting Mx3005P-QPCR system and TB Green. Premix Ex Taq II (TliRNaseH plus) reagent to perform relative quantitative analysis on the transcription level of SVA. GAPDH mRNA expression level was referenced by 2^-△△CTThe method calculates the expression level of SVA mRNA and the primer sequences are detailed in Table 3. As a result, as shown in the figure, in the samples collected at 8h and 16 h after infection, the expression level of SVA mRNA was significantly increased in HEK293T-KO-TPL2 cells as compared with HEK293T-WT-TPL2 cells, as shown in FIG. 10.

TABLE 3RT-qPCR primer sequences

Primer name	Primer sequence (5 '-3')
		SVA-3D Forward	AGAATTTGGAAGCCATGCTCT
SVA-3DReverse	GAGCCAACATAGARACAGATTGC
		SVA3D Probe	TTCAAACCAGGAACACTACTCGAGA
SVA Forward	AGAATTTGGAAGCCATGCTCT
		SVA Reverse	GAGCCAACATAGARACAGATTGC
H-GAPDH Forward	GACAAGCTTCCCGTTCTCAG
		H-GAPDH Reverse	GAGTCAACGGATTTGGTGGT

10. Western blotting verified the replication of SVA on HEK293T-KO-TPL2 cells

Collecting cells at 0 h, 8h and 16 h after SVA infection, adding RAPI cell lysate containing PMSF and 5 Xprotein loading buffer solution, scraping the cells, placing the cells in a metal bath at 100 ℃ for boiling for 12 min to denature the protein, and then centrifuging at 10000 r/min for 10min to remove cell debris. Separating target protein by SDS-polyacrylamide gel electrophoresis (SDS-PAGE), and transferring the target protein to a nitrocellulose membrane (NC membrane); sealing the NC membrane with 5% skimmed milk powder solution at room temperature for 1-1.5 h; TPL2 antibody (diluted 1: 1000), SVA antibody (diluted 1: 1000) and beta-actin antibody (diluted 1: 5000) are added respectively, and shaking culture is carried out at 4 ℃ overnight; washing the membrane 4 times (8 min/time) with 1 × TBST; adding HRP-labeled goat anti-rabbit IgG (diluted 1: 5000) and goat anti-mouse IgG (diluted 1: 5000) antibodies, and incubating at room temperature for 1.5 h; washing the membrane 4 times (8 min/time) with 1 × TBST; and (3) photographing and analyzing the electrophoresis result by using a full-automatic chemiluminescence imaging analysis system. As shown in FIG. 11, in the samples collected at 8h and 16 h after the inoculation, the abundance of SVA proteins VP0, VP1 and VP3 in HEK293T-KO-TPL2 cells was significantly higher than that of HEK293T-WT-TPL2 cells. These results indicate that the knockout of TPL2 promotes replication of SVA virus in HEK293T cells. This is because the TPL2 protein has antiviral effect, and HEK293T-KO-TPL2 does not express TPL2 protein correctly, so it is beneficial to SVA virus replication.

11. SVA Virus infectivity (TCID)₅₀) Measurement of (2)

HEK293T-KO-TPL2 and HEK293T-WT-TPL2 cells were infected with SVA MOI =1, respectively, and virus venom was collected when the cellular lesion reached 50% -60%. After repeated freeze thawing for three times in a refrigerator at minus 80 ℃, sucking out the culture medium, adding the culture medium into a 15 mL centrifuge tube, centrifuging for 5min at 5000 r/min, sucking out the supernatant, and performing virus infectivity determination by using wild type HEK293T cells. Two groups of SVA viruses obtained were subjected to 10 with serum-free DMEM^-3～10^-10Dilution was performed in a double gradient, and a full monolayer of HEK293T cells in a 96-well cell culture plate were inoculated with each dilution of the venom, and 8 wells were inoculated with each dilution, 0.1 mL per well. Placing at 37 ℃ and 5% CO₂Culturing in constant temperature incubator for 4 days, observing and recording cytopathic effect (CPE) every half day, and calculating TCID of amplified virus according to the cytopathic effect of each well by Reed-Muench method₅₀. The results showed that SVA had TCID of supernatant virus after HEK293T-WT-TPL2 cell replication₅₀The titer measurement was 10^5.7TCID₅₀. 0.1 mL^-1And TCID of supernatant virus after HEK293T-KO-TPL2 cell replication₅₀The titer measurement was 10^6.9TCID₅₀. 0.1 mL^-1As shown in fig. 12, an increase of about 16 times. Therefore, TPL2 knockout can promote proliferation of progeny viruses after SVA infection, and the HEK293T-KO-TPL2 cells can obtain SVA with higher titer under the same condition, so that the yield of the SVA viruses is increased.

The above embodiments are merely preferred embodiments of the present invention, and not intended to limit the scope of the invention, so that equivalent changes or modifications made based on the structure, characteristics and principles of the invention should be included in the claims of the present invention.

SEQUENCE LISTING

<110> Lanzhou veterinary research institute of Chinese academy of agricultural sciences

<120> TPL 2gene knockout HEK293T cell line, and construction method and application thereof

<130> do not

<160>8

<170>PatentIn version 3.5

<210>1

<211>1404

<212>DNA

<213> human (Homo sapiens)

<400>1

atggagtaca tgagcactgg aagtgacaat aaagaagaga ttgatttatt aattaaacat 60

ttaaatgtgt ctgatgtaat agacattatg gaaaatcttt atgcaagtga agagccagca 120

gtttatgaac ccagtctaat gaccatgtgt caagacagta atcaaaacga tgagcgttct 180

aagtctctgc tgcttagtgg ccaagaggta ccatggttgt catcagtcag atatggaact 240

gtggaggatt tgcttgcttt tgcaaaccat atatccaaca ctgcaaagca tttttatgga 300

caacgaccac aggaatctgg aattttatta aacatggtca tcactcccca aaatggacgt 360

taccaaatag attccgatgt tctcctgatc ccctggaagc tgacttacag gaatattggt 420

tctgatttta ttcctcgggg cgcctttgga aaggtatact tggcacaaga tataaagacg 480

aagaaaagaa tggcgtgtaa actgatccca gtagatcaat ttaagccatc tgatgtggaa 540

atccaggctt gcttccggca cgagaacatc gcagagctgt atggcgcagt cctgtggggt 600

gaaactgtcc atctctttat ggaagcaggc gagggagggt ctgttctgga gaaactggag 660

agctgtggac caatgagaga atttgaaatt atttgggtga caaagcatgt tctcaaggga 720

cttgattttc tacactcaaa gaaagtgatc catcatgata ttaaacctag caacattgtt 780

ttcatgtcca caaaagctgt tttggtggat tttggcctaa gtgttcaaat gaccgaagat 840

gtctattttc ctaaggacct ccgaggaaca gagatttaca tgagcccaga ggtcatcctg 900

tgcaggggcc attcaaccaa agcagacatc tacagcctgg gggccacgct catccacatg 960

cagacgggca ccccaccctg ggtgaagcgc taccctcgct cagcctatcc ctcctacctg 1020

tacataatcc acaagcaagc acctccactg gaagacattg cagatgactg cagtccaggg 1080

atgagagagc tgatagaagc ttccctggag agaaacccca atcaccgccc aagagccgca 1140

gacctactaa aacatgaggc cctgaacccg cccagagagg atcagccacg ctgtcagagt 1200

ctggactctg ccctcttgga gcgcaagagg ctgctgagta ggaaggagct ggaacttcct 1260

gagaacattg ctgattcttc gtgcacagga agcaccgagg aatctgagat gctcaagagg 1320

caacgctctc tctacatcga cctcggcgct ctggctggct acttcaatct tgttcgggga 1380

ccaccaacgc ttgaatatgg ctga 1404

<210>2

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

tcctcggggc gcctttggaa 20

<210>3

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

ttccaaaggc gccccgagga 20

<210>4

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

ccgatgttct cctgatcccc 20

<210>5

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

ggggatcagg agaacatcgg 20

<210>6

<211>54

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

tgtgaccgtc tccgggagct gcatgtgtca gaggttttca ccgtcatcac cgaa 54

<210>7

<211>58

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

ccctggaagc tgacttacag gaatattggt tctgatttta ttcctcgggg cgcctttg 58

<210>8

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

gcctttggaa aggtatac 18

Claims

A construction method of a TPL 2gene knockout HEK293T cell line is characterized in that a second exon region of a human TPL 2gene is used as a target sequence, and specifically, 390 th to 459 th bp sequences or 391 th to 448 th bp sequences of a TPL2 allele 1 and a second exon of an allele 2 shown in SEQ ID NO. 1 are used as target sequences.
2. The method for constructing the TPL 2gene knockout HEK293T cell line as claimed in claim 1, wherein an exogenous sequence is inserted into the target sequences of allele 1 and allele 2 or the target sequence is knocked out.
3. The construction method of the TPL 2gene knockout HEK293T cell line as claimed in claim 1, characterized in that an exogenous sequence is inserted between 390 th to 391bp of TPL2 allele 1 shown in SEQ ID NO. 1, and 449bp base "G" is knocked out, 58bp in total of 391 th to 448bp of allele 2 is knocked out;

or knocking out the 393bp 'C' base of the TPL2 allele 1 shown in SEQ ID NO. 1, knocking out 18bp altogether from 442-459 bp, and knocking out 58bp altogether from 391-448 bp of the allele 2.
4. The method for constructing the TPL 2gene knockout HEK293T cell line as claimed in claim 1, which comprises the following steps:

step 1: constructing two pairs of sgRNAs targeting a human TPL2 genome sequence and cloning the sgRNAs to the same CRISPR/Cas9 vector plasmid pX459 to obtain a pX-EZ-TPL2-sgRNA recombinant plasmid; the sgRNAs of the two pairs of targeted human TPL2 genome sequences are sgRNA1 and sgRNA2, and the sequences of the sgRNA1 and the sgRNA2 are respectively synthesized by sequences shown as SEQ ID NO. 2-3 and SEQ ID NO. 4-5;

step 2: transfecting HEK293T cells with the constructed pX-EZ-TPL2-sgRNA recombinant plasmid, and killing negative cells by drug screening;

and step 3: carrying out monoclonal sorting by a limiting dilution method;

and 4, step 4: and (4) carrying out expanded culture and verification on the sorted monoclonal cells.
5. The cell line constructed by the construction method of the TPL 2gene knockout HEK293T cell line as claimed in any one of claims 1 to 4.
6. The cell line of claim 5, wherein the cell line has a collection number of CCTCC NO: C2019328, HEK293T-KO-TPL 2.
7. Use of the cell line of claim 6 to study the manner in which TPL2 inhibits viral replication and the pathogenesis of a virus.
8. The use of the cell line of claim 6 to study the manner in which TPL2 inhibits viral replication and the pathogenesis of a virus, wherein said virus is SVA.
9. Use of the cell line of claim 6 to isolate and culture SVA.
10. The TPL 2gene knockout HEK293T cell line of claim 6, applied to large-scale cell culture and production of SVA vaccine strains.