CN112980878B

CN112980878B - HDAC8 gene knockout BHK-21 cell line and construction method and application thereof

Info

Publication number: CN112980878B
Application number: CN202110154123.0A
Authority: CN
Inventors: 孙跃峰; 侯石桐; 毛箬青; 张会军; 殷相平; 赵帅阳
Original assignee: Lanzhou Veterinary Research Institute of CAAS
Current assignee: Lanzhou Veterinary Research Institute of CAAS
Priority date: 2021-02-04
Filing date: 2021-02-04
Publication date: 2023-03-31
Anticipated expiration: 2041-02-04
Also published as: CN112980878A

Abstract

The invention discloses a construction method of a BHK-21 cell line with HDAC8 gene knockout, which comprises the steps of carrying out gene knockout on HDAC8 in the cell line BHK-21 for producing a foot-and-mouth disease vaccine by using a CRISPR/Cas9 technology, transfecting BHK-21 cells with CRISPR plasmids for knocking out HDAC8, screening by using antibiotics, combining gradient dilution, and separating a plurality of cell clones by using a cloning ring method. After extracting genome DNA, PCR amplification and sequencing are carried out, and 2 cell clones with homozygous frameshift mutation of HDAC8 genes are successfully identified. The replication rate of the hoof virus in the HDAC8 knockout BHK-21 cell line is obviously accelerated, the final virus titer is obviously improved, and the cell growth rate is not obviously influenced after the HDAC8 knockout, which shows that the cell has a prospect for producing foot-and-mouth disease vaccines. Lays a foundation for further knocking out HDAC8 in suspension culture type BHK-21 cells and directly applying the HDAC8 to the production of the foot-and-mouth disease vaccine.

Description

HDAC8 gene knockout BHK-21 cell line and construction method and application thereof

Technical Field

The invention belongs to the field of genetic engineering, and particularly relates to a HDAC8 gene knockout BHK-21 cell line, and a construction method and application thereof.

Background

Foot-and-mouth disease (FMD) is an acute, hot and highly contagious epidemic disease caused by FMDV (Foot-and-mouth disease virus) infection, and mainly infects artiodactyls such as pigs, cows and sheep. The disease has multiple transmission ways and high transmission speed, once causes huge economic loss in the world, and is listed as the first epidemic disease of A-type animals by the world animal health organization. At present, the prevention and control of the disease are mainly based on vaccine immunization prevention, and the traditional inactivated vaccine still occupies the market leading position. The production of the inactivated foot-and-mouth disease vaccine completely depends on the replication of the foot-and-mouth disease virus in Baby hamster kidney passaged cells BHK-21 (Baby hamster kidney cell). BHK-21 cells were first established by MacPherson and Stoker in 1962 using 1 day old Syrian hamster kidney cells. The cell grows rapidly, has wide virus sensitivity spectrum, and is subsequently used for the proliferation of various viruses and the production of vaccines, such as foot-and-mouth disease vaccines, rabies vaccines, newcastle disease vaccines and the like. The original BHK-21 cells are anchorage-growing cells, which are not favorable for large-scale production of commercial vaccines. Suspension culture and domestication of BHK-21 cells are carried out by Capstick and the like, and the domesticated suspension culture type BHK-21 cells are used for culturing and producing the foot and mouth disease vaccine in a stainless steel fermentation tank in 1965, thereby opening a new era of producing the foot and mouth disease vaccine by using the suspension culture BHK-21 cells. The production process of foot-and-mouth disease vaccine in China is to inoculate the foot-and-mouth disease virus to BHK-21 cells cultured by adherence for a plurality of times of subculture and amplification for production. The foot-and-mouth disease vaccine production enterprises of China began to successively carry out the technological transformation of BHK-21 cell suspension culture in 2009, and the bioreactor suspension culture technology is completely realized in a short period of several years. At present, the adherent growth type BHK-21 cells are mainly used for early-stage research in a laboratory, and the suspension culture type BHK-21 cells are completely adopted for commercial vaccine production. Although BHK-21 cells have been used for more than 50 years in the production of foot and mouth disease vaccines, except suspension culture and domestication, no research has been made to modify BHK-21 cells by genetic means so that the BHK-21 cells are more favorable for virus replication and the BHK-21 cells after genetic modification are used in the production of foot and mouth disease vaccines.

The CRISPR/Cas9 technology is a novel gene editing technology which is rapidly developed in recent years and can be used for mammalian cells, and has a very good application prospect in many fields. The technology is used for modifying related genes for regulating and controlling foot-and-mouth disease virus infection and immunity in BHK-21 cells, so that the replication efficiency of the foot-and-mouth disease virus in the BHK-21 cells is improved, and the yield or the quality of the foot-and-mouth disease vaccine can be improved.

Protein acetylation is an important protein posttranslational modification, and existing researches show that the protein acetylation influences the infection and immune processes of viruses in various ways such as acetylation of virus proteins, acetylation of histones in host immune related gene promoter regions, acetylation of immune signal molecules and the like. The level of protein acetylation is dynamically regulated by Histone Acetyltransferase (HAT) and Histone Deacetylase (HDAC). The HDACs family in mammals shares 18 members, and different HDACs have specific functions without significant functional redundancy. The individual members of the hdac family have been shown to play important regulatory roles in virus-host interaction. However, the role of protein acetylation and HDACs family genes in the foot and mouth disease virus infection process is unclear.

Disclosure of Invention

The invention aims to provide a gene-edited BHK-21 cell line which is expected to be used for producing a foot-and-mouth disease vaccine. The method is characterized in that the CRISPR/Cas9 technology is utilized, after HDAC8 is knocked out in BHK-21 cells, the foot-and-mouth disease virus replication rate is accelerated, the virus titer is obviously improved, and the method is expected to be used for producing foot-and-mouth disease vaccines and improving the yield and quality of the vaccines.

The foot-and-mouth disease virus used in the invention is an epidemic strain FMDV/O/BY/2010 in China in recent years, and the strain is also a vaccine strain at present. The cell line used in the invention is an adherent culture type BHK-21 cell line. Cell culture at 5% CO ₂ In the incubator, the temperature is 37 ℃, and 10% fetal bovine serum and 1% antibiotic (penicilin-streptomycin) are added into a DMEM medium. The specific technical scheme is as follows:

1. construction of HDAC8 knockout BHK-21 cell line by CRIPSR/Cas9 technology

Based on the HDAC8 gene sequence of the golden hamster in NCBI (Mesocricetus auratus), gRNA sequences were designed in the 1 st exon region of HDAC8 using CRISPOR software (http:// CRISPOR. Tefor. Net /): GCTCTTCTGATCGGCCCGGG. The designed gRNA was synthesized, annealed and ligated to PX459 (addge # 62988) plasmid according to methods published by the zhanfeng laboratories (Nature Protocols, 2013). And extracting the CRISPR plasmid with correct sequencing for later use. According to the standard transfection procedure of Invitrogen Lipofectamine 2000, the CRISPR plasmid is used for transfecting a BHK-21 cell line, puromycin with the final concentration of 3 mu g/mL is added after 48 hours of transfection, after 5-7 days of screening, cell counting is carried out, 100 cells and 300 cells are respectively paved, after one week, a single cell clone is formed, the single clone is picked by using a cloning ring, transferred to a 24-well plate, and expanded culture is carried out. Different cell clones were collected and individually identified at the DNA level. When the DNA level is identified, the following primers are used for amplification: GT-FP (GGTTTCCCCGGCTTCCTAAA), GT-RP (ACATCTCCCAGCATGCTGCTG), amplification products were subjected to Sanger sequencing.

2. Foot-and-mouth disease virus infection experiment and evaluation of virus replication rate

HDAC8 knock-out BHK-21 and control cell lines (BHK-21 cell lines transfected with PX459 empty plasmid) were cultured to approximately 80% confluence in a 60mm cell culture dish, the medium was aspirated, 2mL PBS was added to wash the cells twice and then PBS was aspirated, 1mL dmdmdmdmmem (control) or foot and mouth disease virus diluted to MOI =0.1 was added, incubated for 1h in an incubator, virus fluid was aspirated, 2mL PBS was added to wash the cells twice and then PBS was aspirated, 3mL DMEM medium was added. Respectively collecting supernatant and cell samples at different infection times, and comprehensively evaluating the replication condition of the foot-and-mouth disease virus by using methods such as RT-qPCR, western blot, virus titer determination and the like.

RT-qPCR detection of relative expression of viral RNA:

the collected cell samples were subjected to Trizol method to extract total RNA, and after concentration measurement, primeScript was used ^TM The RT reagent Kit with gDNA Eraser (TaKaRa, RR 047A) reverse transcription Kit carries out reverse transcription, and qPCR is completed by SYBR Green qPCR Supermix (Takara) reagent. beta-Actin is used as an internal reference gene to quantify the relative expression level of VP 1. The primers used were: VP1-q-FP (GACAACACCACAACCA), VP1-q-RP (CCTTCTGTAGCCAGCAGCACTT); beta-actin-q-FP (GCTGGCCGGGACCTGACAGACTCC), beta-actin-q-RP (TCTCCAGGGAGGAAGGATGCGGCGGC).

Westernblot for detecting the protein expression level of the foot-and-mouth disease virus structural protein VP 1:

170 μ l of cell lysate (Pierce) was added to the collected cell sample, the cell debris was removed by centrifugation after the cells were sufficiently lysed to collect the supernatant, and total protein was quantified using BCA protein quantification kit (Thermo). The remaining portion was mixed with a quarter volume of 4 Xloading buffer, boiled for 5 minutes, and allowed to stand at room temperature for cooling. The quantitative results were used to determine the loading volume, which was typically 20-40. Mu.g. And (3) carrying out SDS-PAGE electrophoresis on the protein sample, then transferring the protein sample to a PVDF membrane, and transferring the protein sample to the PVDF membrane at a constant voltage of 90V in ice bath for 2h. Sealing with 5% skimmed milk powder for 1 hr. beta-Actin antibody (Santa Cruz) 1) 1. Horseradish peroxidase (HRP) labeled corresponding secondary antibody was diluted 1-4000 times and the secondary antibody was incubated for 1h at room temperature. Protein detection was performed using a chromogenic kit (Pierce) from Thermo corporation ^TM ECLWestern Blotting Substrate) using an X-ray film automatic developing machine.

Determination of viral titres:

BHK-21 cells were grown in 96-well microplates to a confluence of about 70% and ready for use. Firstly, virus liquid to be detected is respectively diluted by 10 times in a gradient way in a centrifugal tube of 1.5mL, cells are washed twice by 100 mu l of PBS, the diluted virus liquid is inoculated into a 96-well plate, a row of 8 wells are inoculated at each dilution degree, and 100 mu l of virus liquid is inoculated into each well. After incubating for 1h in the incubator, the virus solution was aspirated, the cells were washed twice with 100. Mu.l of PBS and then the PBS was aspirated and cleaned, and a maintenance medium containing 1% FBS was added and the incubation was continued in the incubator. Observing and recording cytopathic results day by day, and calculating TCID according to Reed-Muench two-handed method after continuously observing for 5-7 days ₅₀ The value is obtained.

3. Determination of cell growth rate

After digestion, the cells are counted, 10000 cells per well are inoculated to a 96-well plate, and the plate is placed in a cell culture box for normal culture. To determine cell viability at a particular time, 10. Mu.L of CCK8 solution was added to each well of medium, the incubator was placed and incubated for 1h, and absorbance at 450nm was measured on a Varioskan LUX multifunctional microplate reader (Thermo). A growth curve of the cells was prepared based on the measured absorbance.

The inventor takes the frequently used adherent growth type BHK-21 cells in a laboratory as an object, constructs an HDAC gene knockout cell line by performing early stage screening on the genes of the HDACs family and utilizing the CRISPR/Cas9 technology, and finds that HDAC8 has a very obvious effect of resisting foot-and-mouth disease virus infection. The replication rate of the hoof virus in the HDAC8 knockout BHK-21 cell line is obviously accelerated, the final virus titer is obviously improved, and the cell growth rate is not obviously influenced after the HDAC8 knockout, which shows that the cell has a prospect for producing foot-and-mouth disease vaccines. Lays a foundation for further knocking out HDAC8 in suspension culture type BHK-21 cells and directly applying the HDAC8 to the production of the foot-and-mouth disease vaccine.

Has the advantages that:

the invention successfully constructs the BHK-21 cell line with the HDAC8 gene knocked out by using the CRISPR/Cas9 technology; the HDAC8 gene is proved to have very obvious effect of resisting hoof-and-mouth disease virus infection for the first time, the foot-and-mouth disease virus replication rate in the BHK-21 cell line with the HDAC8 knockout is accelerated, the virus titer is obviously improved, and the cell growth rate is not obviously influenced, so that the HDAC8 gene is expected to be used for the commercial production of the foot-and-mouth disease vaccine.

Drawings

Figure 1 shows the identification of HDAC8 knock-out cell lines.

FIG. 1A shows the partial sequence alignment of wild-type HDAC8 (WT) in BHK-21 cells and mutant HDAC8 near the mutation position in a knock-out cell line.

FIG. 1B shows a graph of the sequencing peaks near the mutation position of wild-type HDAC8 in BHK-21 cells and mutant HDAC8 in knock-out cell lines.

Figure 2 shows that the rate of replication of foot and mouth disease virus is significantly accelerated in HDAC8 knock-out cell line.

FIG. 2A shows that the level of viral RNA replication in the HDAC8 knock-out cell line (KOHDAC 8-1, KOHDAC8-2) is significantly higher than the control cell line (WT) following foot and mouth disease virus infection. Different cell lines are infected by foot-and-mouth disease virus with 0.1MOI for different time, cell samples are collected, and the virus structural protein VP1 mRNA is relatively quantified by using an RT-qPCR method.

Figure 2B shows that VP1 protein accumulation in HDAC8 knockout cell lines is significantly accelerated following foot and mouth disease virus infection. Different cell lines were infected with foot-and-mouth disease virus at 0.1MOI and cell samples were collected at different times, and VP1 protein levels were measured using Westernblot, and β -Actin was used as an internal control.

Figure 2C shows that viral titers were significantly elevated in HDAC8 knockout cell line medium following foot and mouth disease virus infection. Infecting different cell lines with 0.1MOI of foot and mouth disease virus, culturing for different time, collecting cell culture medium, and treating with TCID ₅₀ The method determines the virus titer.

Figure 3 shows that the growth rate of cells was not significantly affected following HDAC8 knockdown. The control cell line and the HDAC8 knockout cell line were inoculated in a 96-well plate and cultured normally, and cell viability was measured at regular intervals by the CCK8 method to prepare a growth curve.

Detailed Description

The invention is further described below with reference to the accompanying drawings:

successfully constructing HDAC8 gene knockout BHK-21 cell line by using CRISPR/Cas9 technology

According to the preliminary screening and preliminary function analysis of the HDAC family members in our laboratories, the inventors found that HDAC8 has an important function of resisting foot-and-mouth disease virus infection. Therefore, the inventor intends to perform gene knockout on HDAC8 in the cell line BHK-21 for producing the foot-and-mouth disease vaccine by using the CRISPR/Cas9 technology so as to improve the replication efficiency of the foot-and-mouth disease virus in the cell line and improve the yield or quality of the foot-and-mouth disease vaccine. After transfecting BHK-21 cells with CRISPR plasmid for knocking out HDAC8, the inventor separates a plurality of cell clones by using a cloning loop method by using antibiotic screening and gradient dilution. After extracting genome DNA, PCR amplification and sequencing are carried out, and 2 cell clones with homozygous frameshift mutation of HDAC8 genes are successfully identified. Wherein KOHDAC8-1 has a 4 base deletion at the Cas9 pre-cleavage site (cleavage between

bases

3 and 4 from the PAM motif), while KOHDAC8-2 has a 2 base insertion at this site (fig. 1A). Such frameshift mutations are expected to cause frameshift, premature termination, and loss of function in protein translation. The quality of the sequencing peak map near the mutation position is high (FIG. 1B), indicating that the sequencing result is reliable.

Example 1

Based on the HDAC8 gene sequence of the golden hamster (Mesocricetus auratus) in NCBI, gRNA sequences were designed in the 1 st exon region of HDAC8 using CRISPOR software (http:// CRISPOR. For. Net /): GCTCTTCTGATCGGCCCGGG. The designed gRNA was synthesized, annealed and ligated to PX459 (addge # 62988) plasmid according to methods published by the zhanfeng laboratories (Nature Protocols, 2013). And extracting the CRISPR plasmid with correct sequencing for later use. According to the standard transfection procedure of Invitrogen Lipofectamine 2000, the CRISPR plasmid is used for transfecting a BHK-21 cell line, puromycin with the final concentration of 3 mu g/mL is added after 48 hours of transfection, after 5-7 days of screening, cell counting is carried out, 100 cells and 300 cells are respectively paved, after one week, a single cell clone is formed, the single clone is picked by using a cloning ring, transferred to a 24-well plate, and expanded culture is carried out. Different cell clones were collected and characterized at the DNA level and protein level, respectively. When the DNA level is identified, the following primers are used for amplification: GT-FP (GGTTTCCCCGGCTCCTAAA), GT-RP (ACATTCCCAGCATGCTGCTG), and Sanger sequencing of the amplified products.

Test example 1

The replication rate of the foot-and-mouth disease virus in the HDAC8 knockout cell line is obviously accelerated

In order to evaluate the replication rate of the foot-and-mouth disease virus in the HDAC8 knockout cell line, the inventor uses the foot-and-mouth disease virus with 0.1MOI to respectively infect a control cell line and the HDAC8 knockout cell line, cultures samples are collected at different times, respectively detects the replication level of virus RNA, the accumulation of virus protein and the virus titer, and comprehensively evaluates the influence on the replication rate of the foot-and-mouth disease virus after the HDAC8 knockout. As shown in fig. 2A, following foot and mouth disease virus infection, the level of viral RNA replication in HDAC8 knock-out cell line (KOHDAC 8-1, KOHDAC 8-2) was significantly higher than control cell line (WT). As shown in FIG. 2B, the cells infected with foot-and-mouth disease virus were detected by Western blot to detect VP1 protein level, and β -Actin was used as an internal control, which indicated that the expression level of virus structural protein VP1 was significantly increased in the HDAC8 knockout cell lines (KOHDAC 8-1 and KOHDAC 8-2) as compared with the control cell line (WT). The virus titer results showed that the virus titer of the HDAC8 knockout cell line was significantly increased after infection with foot and mouth disease virus compared to the cell titer of the control group (fig. 2C). These results fully demonstrate that HDAC8 knockout cells can significantly accelerate the rate of replication of foot and mouth disease virus.

Test example 2

There was no significant difference in growth rate between the HDAC8 knockout cell line and the control cell line

HDAC8 knockout cells (KOHDAC 8-1, KOHDAC 8-2) and control cells (WT) were seeded into 96-well plates for normal culture at 10000 cells per well by cell count. After plating for 6 hours, 12 hours, 24 hours, 36 hours, and 48 hours, respectively, 10ul CCK8 solution was added to each well, and the mixture was cultured for 1 hour, and the absorbance value at 450nm was measured. And taking the time and the OD value as an abscissa and an ordinate to make a growth curve. From the results, there was no significant difference in growth rate of the HDAC8 knock-out cell line compared to the control group (fig. 3).

Finally, it should be noted that: although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that modifications may be made to the embodiments described above, or equivalents may be substituted for elements thereof. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

/>

/>

/>

/>

Sequence listing

<110> Lanzhou veterinary research institute of Chinese academy of agricultural sciences

BHK-21 cell line with <120> HDAC8 gene knockout function and construction method and application thereof

<130> 2021

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gctcttctga tcggcccggg 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ggtttccccg gcttcctaaa 20

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

acatctccca gcatgctctg 20

<210> 4

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gacaacacca ccaaccca 18

<210> 5

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ccttctgagc cagcactt 18

<210> 6

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gctggccggg acctgacaga ctacc 25

<210> 7

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tctccaggga ggaagaggat gcggc 25

Claims

A method for constructing an HDAC8 gene-knocked-out BHK-21 cell line, which is characterized by comprising the following steps: based on the HDAC8 gene sequence of hamsters in NCBI, gRNA sequences were designed in the 1 st exon region of HDAC8 using CRISPOR software: GCTCTTCTGATCGGCCCGGG; the designed gRNA is synthesized, annealed and connected to PX459 plasmid; sequencing the correct CRISPR plasmid for later use; according to a standard transfection procedure of Invitrogen Lipofectamine 2000, transfecting a BHK-21 cell line by using CRISPR plasmid, adding puromycin with the final concentration of 3 mug/mL after transfecting for 48 hours, screening for 5-7 days, counting cells, respectively paving 100 and 300 cells, picking out a monoclonal by using a cloning ring after a single cell clone is formed after one week, transferring the monoclonal to a 24-well plate, and carrying out expanded culture; different cell clones were collected and characterized at the DNA level and protein level, respectively.
2. The method for constructing an HDAC8 knock-out BHK-21 cell line according to claim 1, wherein: the cell line is an adherent culture type BHK-21 cell line; cell culture in 5% CO ₂ In the incubator, the temperature is 37 ℃, and 10% fetal calf serum and 1% antibiotic penicilin-streptomycin are added into a DMEM medium.
3. The method for constructing an HDAC8 knock-out BHK-21 cell line according to claim 1, wherein: when the DNA level is identified, the following primers are used for amplification: GT-FP GGTTTCCCCGGCTTCCTAAA, GT-RP ACATCTCCCAGCATGCTGCTG, and the amplified products were subjected to Sanger sequencing.
4. The method for constructing an HDAC8 knock-out BHK-21 cell line according to claim 1, wherein: the HDAC8 knockout cells KOHDAC8-1, KOHDAC8-2, KOHDAC8-1 are obtained by cutting a deletion of 4 bases between Cas9 and PAM motif 3 rd and 4 th bases, and KOHDAC8-2 has an insertion of 2 bases between Cas9 and PAM motif 3 rd and 4 th bases.
5. An HDAC8 knockout BHK-21 cell line constructed according to the method of any of claims 1-4.
6. The method for evaluating the replication rate of foot-and-mouth disease virus in an HDAC8 gene-knocked-out BHK-21 cell line according to claim 5, wherein:

when the HDAC8 knockout BHK-21 cell line and the control cell line are cultured in a cell culture dish with the thickness of 60mm to reach about 80% of confluence, sucking out the culture medium, adding 2mL of PBS to wash the cells twice, sucking out the PBS, adding 1mL of DMEM control or foot-and-mouth disease virus diluted to MOI =0.1, incubating for 1h in an incubator, sucking out the virus liquid, adding 2mL of PBS to wash the cells twice, sucking out the PBS, and adding 3mL of DMEM culture medium; respectively collecting supernatant and cell samples at different infection times, and comprehensively evaluating the replication condition of the foot-and-mouth disease virus by using RT-qPCR, western blot and a virus titer determination method, wherein the control cell line is a BHK-21 cell line transfected with PX459 empty plasmid;

RT-qPCR detection of relative expression of viral RNA:

the collected cell samples were subjected to Trizol method for total RNA extraction, and after concentration measurement, primeScript was used ^TM The RT reagent Kit carries out reverse transcription with gDNA Eraser reverse transcription Kit, and the qPCR is completed by SYBR Green qPCR Supermix reagent; taking beta-Actin as an internal reference gene to quantify the relative expression level of VP 1; the primers used were: VP1-q-FP GACAACACCAACCA, VP1-q-RP CCTTCTGTAGCCAGCAGCACTT; beta-actin-q-FP GCTGGCCGGGACCTGACAGACTCC, beta-actin-q-RP TCTCTCCAGGGAGGAAGAGGATGCGGC;

western blot detection of protein expression level of foot-and-mouth disease virus structural protein VP 1:

adding 170 mul of cell lysate Pierce into the collected cell sample, centrifuging to remove cell debris after the cells are fully lysed, collecting supernatant, and quantifying total protein by using a BCA protein quantification kit; adding one fourth volume of 4 Xloading buffer solution into the rest part, mixing, boiling for 5 min, standing at room temperature, and cooling; determining the sample loading volume by using the quantitative result, wherein the sample loading amount is 20-40 mug; protein samples are subjected to SDS-PAGE electrophoresis, then converted into a PVDF membrane, and converted into the PVDF membrane in ice bath at a constant voltage of 90V for 2 hours; sealing with 5% skimmed milk powder for 1 hr; β -Actin antibody 1 was diluted 6000-fold, VP1 antibody 1 was diluted 1000-fold, primary antibody was incubated overnight at 4 ℃; diluting the horseradish peroxidase-labeled corresponding secondary antibody by 1 time to 4000 times, and incubating the secondary antibody for 1h at room temperature; the protein detection uses a color development kit of Thermo company, and an X-ray automatic developing machine is used during developing;

determination of viral titres:

BHK-21 cells are grown in a 96-well microplate until the confluency is about 70% for later use; firstly, continuously diluting virus solutions to be detected by 10 times in a gradient manner in a 1.5mL centrifuge tube, after cells are washed twice by 100 microliters of PBS, inoculating the diluted virus solutions into a 96-well plate, wherein each dilution is inoculated into a column of 8 holes, and each hole is inoculated with 100 microliters; incubating for 1h in an incubator, sucking away virus liquid, washing the cells twice with 100 mul PBS, sucking out the PBS, adding a maintenance culture medium containing 1% FBS, and continuing culturing in the incubator; observing and recording cytopathic results day by day, and calculating TCID according to Reed-Muench two-handed method after continuously observing for 5-7 days ₅₀ The value is obtained.
7. The method for measuring a cell growth rate of an HDAC8 knock-out BHK-21 cell line according to claim 5, wherein:

counting after cell digestion, inoculating 10000 cells per hole to a 96-hole plate, and placing the 96-hole plate in a cell culture box for normal culture; in order to determine the cell viability at a specific time, 10. Mu.L of CCK8 solution is added into each well of culture medium, the culture box is placed for continuous incubation and culture for 1h, and the light absorption value at 450nm is determined on a Varioskan LUX multifunctional microplate reader; a growth curve of the cells was prepared based on the measured absorbance.
8. The use of the HDAC8 knock-out BHK-21 cell line of claim 5 in the production of a foot and mouth disease vaccine.
9. A method for knocking out HDAC8 gene based on CRISPR/Cas9 technology is characterized in that: the method comprises the following steps:

based on the HDAC8 gene sequence of hamsters in NCBI, gRNA sequences were designed in the 1 st exon region of HDAC8 using CRISPOR software: GCTCTTCTGATCGGCCCGGG; the designed gRNA is synthesized, annealed and connected to PX459 plasmid; extracting CRISPR plasmid with correct sequencing for later use; the CRISPR plasmid transfected cell line BHK-21 was transfected according to standard transfection procedure of Invitrogen Lipofectamine 2000.
10. Use of an HDAC8 knock-out cell line obtained according to any of the methods of claims 1 to 4 in the production of a foot and mouth disease vaccine.