CN115058455B

CN115058455B - Preparation method and application of clinical blood immune cell preparation

Info

Publication number: CN115058455B
Application number: CN202210583135.XA
Authority: CN
Inventors: 王显荣; 李素芬; 王亮
Original assignee: Western Medical Biotechnology Chengdu Co ltd Shuangliu Medical Branch
Current assignee: Western Medical Biotechnology Chengdu Co ltd Shuangliu Medical Branch
Priority date: 2022-05-26
Filing date: 2022-05-26
Publication date: 2023-07-14
Anticipated expiration: 2042-05-26
Also published as: CN115058455A

Abstract

The application discloses a preparation method and application of a clinical blood immune cell preparation. According to the preparation method, T cells expressing CD8 and CD28 are separated, and a lentivirus is used for mediating and transferring a human KIR3DS1 receptor and a human IFN-alpha 1 into the T cells, so that a T cell line stably expressing the KIR3DS1 receptor and the IFN-alpha 1 is obtained. The T cell line not only can kill various tumor cells in vitro, but also has the therapeutic effects of slowing down tumor growth and improving survival rate in vivo, and has small side effect and wide development prospect.

Description

Preparation method and application of clinical blood immune cell preparation

Technical Field

The application relates to the technical field of cell preparations, in particular to a preparation method and application of a clinical blood immune cell preparation.

Background

In recent decades, great progress has been made in the field of tumor therapy. Cell-based therapies, particularly against tumor-associated antigens (TAAs), have evolved rapidly. T cells were engineered to have the ability to attack tumor cells by generating a CAR construct consisting of a gene encoding an scFv, a costimulatory domain (CD 28 or TNFRSF 9) and a CD247 signaling domain for T cell proliferation and activation. In principle, CAR-T cells are activated by scFv recognition of TAAs on the surface of T cells, and then intracellular signaling domains linked by scFv are subsequently activated to induce downstream signaling pathways involved in T cell proliferation, activation and cytokine production. Currently, the effective function of CAR-T cell therapies has been demonstrated in a variety of diseases including hematological malignancies, solid tumors, autoimmune diseases, and allergic diseases such as asthma. Furthermore, antigen-specific T regulatory cells (Tregs) and genetically edited T cells appear to be beneficial in controlling inflammation of allergic asthma.

Disclosure of Invention

Based on the above, the inventor creatively carries out related genetic engineering on T cells, obtains T cells stably expressing KIR3DS1 receptor and IFN-alpha 1 through lentivirus mediation, and confirms the anti-tumor performance through cell and animal experiments.

In a first aspect, embodiments of the present application disclose a method for preparing a clinical blood immune cell preparation, comprising:

obtaining isolated T cells expressing CD8 and CD 28;

preparing a lentivirus carrying a human KIR3DS1 receptor transcript and a human IFN-alpha 1 transcript, wherein the nucleotide sequence of the human KIR3DS1 receptor transcript is shown as NCBI NM_001368254.1, and the nucleotide sequence of the human IFN-alpha 1 transcript is shown as NCBI NM_ 024013.3;

infecting the cells with a lentivirus to obtain T cells expressing KIR3DS1 receptor and IFN-alpha 1, and dissolving or dispersing the T cells in an electrolyte solution suitable for growth of the T cells to prepare a clinical blood immune cell preparation.

In the examples herein, "preparing a lentivirus carrying a human KIR3DS1 receptor transcript and a human IFN-. Alpha.1 transcript" includes:

synthesizing to obtain a human KIR3DS1 receptor transcript and a connector of a human IFN-alpha 1 transcript as target fragments;

and (3) connecting the target fragment into a vector, and carrying out slow virus packaging to obtain the recombinant slow virus vector.

In the embodiment of the application, the nucleotide sequence of the target fragment is shown as SEQ ID NO.1 or 2.

In the embodiment of the present application, after the target fragment is obtained by synthesis, the method further includes a step of amplifying the target fragment, where the step of amplifying the target fragment specifically includes:

designing a first primer pair to amplify a 1-960 bp region of the target fragment;

designing a second primer pair to amplify the 940 bp-1900 bp region of the target fragment;

designing a third primer pair to amplify the 1890 bp-3' end region of the target fragment; and

and (3) carrying out enzyme digestion on the amplified 1 st to 960 th bp region, the amplified 1 st to 960 th bp region and the amplified 1890 th bp & gt3' end region, purifying, mixing the obtained products to serve as templates, and carrying out PCR amplification by using mixed primers of the first primer pair, the second primer pair and the third primer pair again.

In an embodiment of the present application, the step of "performing lentivirus packaging" includes:

inoculating the recombinant plasmid with the target fragment sequence which is sequenced correctly into LB culture medium containing antibiotics for full culture, extracting bacterial liquid, cracking, purifying, extracting and harvesting the plasmid; and

the plasmids were transferred into 293T cells and the packaged lentivirus supernatants were harvested.

In the examples herein, the step of "isolating clinical blood-derived T cells expressing CD8 and CD 28" includes:

extracting spleen cells of a pregnant female CBA/J pregnant mouse;

the immune should antibody label and magnetic bead are utilized to sort the cells, so that the T cells expressing CD8 and CD28 are obtained.

In an embodiment of the present application, the step of "infecting the cells with a lentivirus" includes:

mixing the T cells expressing CD8 and CD28 obtained by sorting with the lentiviral supernatant, culturing at 37 ℃ for 10 hours, removing the lentiviral supernatant, replacing fresh alpha-MEM culture medium, continuing culturing, and culturing for 5 days after infection, thus obtaining the T cells expressing KIR3DS1 receptor and IFN-alpha 1.

In a second aspect, the present application discloses a clinical blood immune cell preparation prepared by the preparation method of the first aspect, comprising T cells stably expressing KIR3DS1 receptor and IFN- α, said T cells further expressing CD8 and CD28.

In embodiments of the present application, the clinical liquid immune cell preparation further comprises an electrolyte solution suitable for its growth. Among them, the "electrolyte solution suitable for its growth" may be an α -MEM medium suitable for its growth, may be a buffer solution containing serum albumin, may be a sugar solution containing serum albumin, an antibiotic, and DMSO.

In a third aspect, the embodiment of the application also discloses the clinical liquid immune cell preparation prepared by the preparation method in the first aspect or the application of the clinical liquid immune cell preparation in the second aspect in preparing medicines and preparations related to liver cancer, chronic myelogenous leukemia, breast cancer and colon cancer.

Compared with the prior art, the application has at least one of the following beneficial effects:

the embodiment of the application provides an in vitro synthesis method of a human KIR3DS1 receptor transcript and a human IFN-alpha 1 transcript, a lentiviral vector is constructed, a T cell of a mouse origin is infected, and a cell line for stably expressing the KIR3DS1 receptor and the IFN-alpha 1 is constructed.

The application further proves that the T cell line expressing CD8 and CD28 has better tumor cell killing rate and obvious curative effect on liver cancer, chronic myelogenous leukemia, breast cancer and colon cancer through cell tests and animal tests.

In addition, the application also discovers through detecting the expression level of the related tumor biocidal factors that the CD8+CD28+T cells improved by the embodiment of the application can achieve the killing effect through inducing the expression of the performance and FasL in target cells.

Drawings

FIG. 1 is an electrophoresis chart of the target fragment provided in example 1 (lane 1), example 2 (lane 2) and comparative example (1) (lane 3) of the present application, respectively.

FIG. 2 provides an electrophoretogram of recombinant plasmids of example 1 (lane 1), example 2 (lane 2) and comparative example (1) (lane 3), respectively, of the present application.

FIG. 3 shows the results of flow cytometry assays of CD8 (left panel) and CD28 (right panel) expressing T cells isolated in the examples of the present application.

Detailed Description

In order to make the objects, technical solutions and advantages of the present application more apparent, the present application will be further described in detail with reference to examples. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the present application. Reagents not specifically and individually described in this application are all conventional reagents and are commercially available; methods which are not specifically described in detail are all routine experimental methods and are known from the prior art.

It should be noted that, the terms "first," "second," and the like in the description and the claims of the present invention and the above drawings are used for distinguishing similar objects, and are not necessarily used for describing a particular sequence or order, nor do they substantially limit the technical features that follow. It is to be understood that the data so used may be interchanged where appropriate such that the embodiments of the invention described herein may be implemented in sequences other than those illustrated or otherwise described herein. Furthermore, the terms "comprises," "comprising," and "having," and any variations thereof, are intended to cover a non-exclusive inclusion, such that a process, method, system, article, or apparatus that comprises a list of steps or elements is not necessarily limited to those steps or elements expressly listed but may include other steps or elements not expressly listed or inherent to such process, method, article, or apparatus.

Target fragment

1. Target fragment

The target fragment disclosed in the embodiment of the application is obtained by connecting a human KIR3DS1 receptor transcript (NM_ 001368254.1) and a human IFN-alpha 1 transcript (NM_ 024013.3) through an intermediate connecting sequence. Wherein, the human KIR is a killer cell immunoglobulin-like receptor (KIR) which is a member of immunoglobulin superfamily, and the extracellular region of the human KIR-like receptor contains an immunoglobulin-like domain which is a human KIR3DS1 receptor.

In one embodiment, the above fragments of interest (SEQ ID NOS.1-2) are synthesized chemically.

In one embodiment, the intermediate linkage sequence is as shown in SEQ ID NO.3 or as shown in SEQ ID NO. 4. In one comparative example 1, the fragment of interest was a DNA molecule (shown in SEQ ID NO. 5) obtained by direct ligation of a human KIR3DS1 receptor transcript and a human IFN-. Alpha.1 transcript and chemical synthesis.

2. Designing primers

In order to obtain a desired fragment at a proper concentration, it is necessary to perform PCR amplification of the desired fragment, and since the desired fragment is more than 2500bp in each of example 1, example 2 and comparative example 1, the primer set and the PCR amplification method are provided in the examples of the present application. In some embodiments, the primer set provided in the embodiments of the present application includes a first primer pair, a second primer pair and a third primer pair, wherein the first primer pair amplifies a region of 1 to 960bp of the target fragment, the second primer pair amplifies a region of 940 to 1900bp of the target fragment, and the third primer pair amplifies a region of 1890bp→3' of the target fragment. For this purpose, the examples of the present application provide a variety of primer pairs, as specifically shown in table 1. In Table 1, the lower strand is the cleavage site, and the thickened portion is the protecting base.

TABLE 1

3. PCR amplification

In order to obtain the objective fragments of examples 1 and 2 and comparative example 1 in large concentrations, respectively, the examples of the present application also provide a PCR amplification method. The method comprises the steps of performing a first amplification, a cleavage and a second amplification, respectively. Wherein, the 2 nd amplification is carried out by using 3 primer pairs as shown in Table 1, respectively using the target fragments of examples 1,2 and comparative example 1 as templates, respectively, to obtain corresponding partial sequences in the respective target fragments, respectively, carrying out enzyme digestion to form purification, mixing the obtained partial sequences, and then respectively mixing with the 3 primer pairs again, thereby carrying out the 2 nd amplification.

Wherein the reaction system for amplification 1 or 2 (for example, 50. Mu.L) comprises: 1.0. Mu.L dNTP (2.5 mmol/L), 9.0. Mu.L upstream primer (10. Mu. Mol/L), 9.0. Mu.L downstream primer (10. Mu. Mol/L), 1.0. Mu.L LPfuDNA polymerase (5U/. Mu.L), 10 Xbuffer 5.0. Mu.L, double distilled water 25. Mu.L. The PCR reaction conditions were 94℃for 5min,94℃for 30s,56℃for 30s,72℃for 1min,28 cycles, and finally 72℃for 10min, and 4℃for termination.

In the above steps, the fragment of interest was recovered using a PCR product purification kit (Guangzhou Novolac, cat# KG 033-1), and the recovered fragment of interest was sequenced and identified in a manner well known to those skilled in the art. The gel electrophoresis of the product obtained by the above procedure is shown in FIG. 1, wherein the concentration of the fragment of interest is significantly higher than the concentration of other non-fragments of interest.

Vector construction

1. Linearization vector and amplification vector

The vector used in the application is GV115 (Ji Kai gene), and AgeI and EcoRI are used for double enzyme digestion to obtain a linearization vector, and the linearization vector is amplified under the action of TransStartFast Pfu DNA polymerase.

2. Lentiviral vector construction

Ligation was performed using Fermentas T4 DNA ligase, for example, a 20. Mu.L reaction system comprising: linearized Vector (100 ng/. Mu.L), 1. Mu.LT 4 DNA library, 2. Mu.L 10 XT 4 DNA ligase Buffer, 1. Mu.L of the fragment of interest (100 ng/. Mu.L) (examples 1,2 and comparative example 1) and make-up double distilled water to 20. Mu.L.

The recombinant vector formed was transformed into TransTl competent cells (catalog number CD501-02, beijing full-size gold Biotechnology Co., ltd.) using conventional bacterial transformation methods well known to those skilled in the art, and the purified vector backbone cleavage product was transformed into a negative control. 2 single clones were picked and plasmids were extracted by conventional methods, and positive clones were identified by AgeI and EcoRI cleavage and PCR. The amplification was carried out using the universal primers (F: cctatttcccatgattccttcata, SEQ ID NO.24; R: gtaatacggttatccacgcg, SEQ ID NO. 25). Both the digested and PCR products were electrophoresed through agarose gel to observe the positions of the bands. Finally, the plasmids positive for both cleavage and PCR identification were sequenced by the Probiotechnological engineering (Shanghai) Co., ltd. Sequencing was performed using the sequencing universal primers T7 and SP6 on the vector for forward and reverse sequencing, respectively.

As shown in FIG. 2, the recombinant plasmid PCR amplification products were subjected to 0.8% agarose gel electrophoresis, and a distinct specific band at about 8.0kb was seen, which was consistent with the expected size.

3. Lentivirus package

(1) Plasmid extraction

Transferring the bacterial liquid with correct sequencing to LB liquid culture medium containing antibiotics (Amp), shaking overnight for culture by a shaking table, and culturing at a constant temperature of 37 ℃ and 220rpm/min for 12-16 h; centrifuging the bacterial liquid at 4000g for 10min, adding Solution I (Ai Mota Weidaul International trade (Shanghai) limited company) containing 10mL RNaseA into the precipitate, stirring uniformly, continuously adding 10mL Solution II, gently mixing upside down for 8-10 times to obtain clear lysate, incubating for 2-3min, adding 5mL precooled N3Buffer (Beijing Bai Albo), gently mixing reversely until egg white floccule appears, standing for 10min at room temperature, filtering, adding 10%v/v times of ETR Solution (Omega) into the supernatant, incubating for 10min on ice until the liquid becomes clear, incubating for 5min at 25 ℃ in a water bath kettle at 42 ℃, centrifuging for 5min at 4000g, capturing the supernatant into 50mL, adding 50%v/v volume ratio absolute ethyl alcohol (standing at room temperature for 96-100%) and incubating for 1-2 min at room temperature; loading to a 50mL filter column (Milbot Co., USA), centrifuging 4000g for 3min, adding 10mL of HBC Buffer (Omega Bio-tek) to the precipitate, centrifuging 4000g for 3min, adding 15mL of DNA Wash Buffer (Omega Bio-tek) to the precipitate, centrifuging 4000g for 3min, adding 10mL of DNA Wash Buffer to the precipitate, centrifuging 4000g for 3min, loading the precipitate to an air-dried filter column, standing the filtrate at room temperature for 5min, and centrifuging 4000g for 5min to obtain the filtrate, wherein the obtained filtrate is the desired plasmid. The concentration and purity of the target plasmid and the packaging plasmid are respectively measured by a Nanodrop ultramicro spectrophotometer, and then the plasmid and the packaging plasmid are stored in a refrigerator at the temperature of minus 20 ℃.

(2) Culture of 293T cells and lentiviral packaging

Resuscitating and subculturing 293T cells (Siemens to obtain suspension cell liquid with the fusion degree of 80%; 10. Mu.g of the plasmid prepared above, 7.0. Mu.g of the packaging plasmid pSPAX2 and 2.0. Mu.g of the packaging plasmid PMD2G were added to a 1.5mL EP tube, and after mixing, 500. Mu.L of CaCl was added ₂ Blowing the solutionAfter uniformly mixing, slowly dripping the mixture into BBS balanced salt solution with the same volume, after uniformly blowing and mixing, incubating for 30mi at room temperature until turbidity is visible, adding the mixed solution into 293T cell culture solution, after uniformly mixing, placing the mixed solution into a 37 ℃ incubator for culturing for 8-10 hours, taking precipitate, washing the precipitate for 1-2 times by PBS, replacing 15mL of fresh DMEM culture medium containing 10% fetal bovine serum, continuously culturing the sediment for 48-72 hours, observing the expression intensity of green fluorescent protein under a fluorescent microscope, and thus determining whether to harvest cell supernatant which is slow virus, or adding fresh culture solution for mechanical culturing.

Centrifuging the collected lentivirus supernatant at 3500g for 10min, removing cell debris, filtering with 0.45 μm for sterilization, concentrating, transferring into a sterile ultrafiltration tube, centrifuging at 3500g until concentrating to 500 μl, and packaging in a freezing tube, and storing at-80deg.C. The qPCR lentivirus titer was measured using a qPCR lentivirus titer detection kit (Cat. No. LU900, aibi Meng Biotechnology Co., ltd.). As a result, the virus titers obtained by lentiviral packaging using the recombinant plasmids obtained in example 1, example 2 and comparative example 1 of the present application were all 10 ⁸ The transfection requirement of the T cell for preparing the expressed target gene is met.

T cell for stably expressing target gene

1. Preparation of autologous T cells

The autologous T cells provided in the examples herein were derived from pregnant female CBA/J pregnant mice (Beijing Botai Honda Biotechnology Co., ltd.). The pregnant mice are killed by cervical dislocation on the 9 th day of pregnancy, soaked in 75% alcohol for 3min, placed on sterile paper with the left abdomen side facing upwards, and placed in a sterile super clean bench; cutting a pregnant opening in the middle of the left abdominal side of a pregnant mouse, tearing open the skin, exposing the abdominal wall, and displaying red long-strip spleen; lifting the peritoneum on the lower side of the spleen, cutting, turning up, exposing the spleen, lifting the spleen by forceps, aseptically separating connective tissue below the spleen by using an ophthalmic scissors, taking out the spleen, placing the spleen in a culture dish containing 5mL of Hank's liquid, placing the spleen on a screen, lightly grinding the spleen by using a 2mL syringe needle core, and obtaining a cell suspension; the collected spleen cell suspension is centrifuged at 1800rpm and 4 ℃ for 8min; discard supernatant and resuspend cellsAdding 5mLELS (erythrocyte lysate), mixing, and standing at room temperature for 5min; adding Hank's solution to 10mL, mixing well, centrifuging at 1800rpm and 4 ℃ for 8min; discarding the supernatant, adding Hank's solution to 10mL, mixing, filtering with a screen, centrifuging at 1800rpm at 4deg.C for 8min, discarding the supernatant; resuspend cells with 5ml RPMI 1640; adjusting the concentration to 10 ⁸ mol/L。

2. Immunofluorescence antibody mark and magnetic bead sorting magnetic bead positive sorting

Cd8+ T cells: taking 1×10 ⁸ The individual cells were resuspended in 100. Mu.L of 1640, 10. Mu.L of CD8-FITC was added, mixed well, incubated at 4-8℃for 15min, then 1ml RPM was added, mixed well, centrifuged at 1000r/min for 10min, the supernatant was discarded, and resuspended in 80. Mu.L of 1640. Adding 40 mu LCD8 magnetic beads into the cell suspension, uniformly mixing, incubating for 20min at 4-8 ℃, centrifuging for 10min at 1000r/min after buffer washing, discarding the supernatant, precipitating, and re-suspending by using 500 mu L buffer. The LD magnetic bead sorting column was placed in a sorter, 2mL buffer was passed through the column, and then the cell suspension was added thereto, and the cells flowing out of the sorting column were collected to obtain CD8+ cells. Similarly, magnetic bead fractions were used to sort CD8+CD28+ T cells, and CD8-CD 28-cells. The results are shown in FIG. 3.

3. Lentivirus-infected cells

The CD8+CD28+ T cells and the medium for CD8-CD 28-cells obtained by the above-mentioned sorting were adjusted to 10 ⁵ The cells were placed in 24-well plates, and the lentivirus stock solutions (multiplicity of infection 150) obtained in examples 1 and 2 and comparative example 1 were added, respectively, and polybrene was added at a final concentration of 8. Mu.g/mL, and after mixing, they were placed in an incubator at 37℃for 10 hours, centrifuged, the lentivirus supernatant was removed, and fresh alpha-MEM medium was replaced, followed by further culture. After 48 hours and 72 hours of infection culture, the expression of Green Fluorescent Protein (GFP) was observed under a fluorescence microscope, respectively, to examine the effect of lentivirus infection. After 5 days of infection culture, the target fragment T cells are obtained.

4. Detection of expression of Gene of interest

(1) Cell preparation

The lentiviruses obtained in examples 1,2 and comparative example 1, respectively, infest CD8+CD28+ T cells and CD8-CD 28-cells 1X 10 ⁶ Washing with PBS buffer containing 1% fetal bovine serum (washing buffer), and then washing with 100% fetal bovine serummu.L of wash buffer resuspended cells to give a cell suspension.

(2) Detection of T cell proliferation levels

The lentiviruses obtained in examples 1,2 and comparative example 1 were used to infect CD8+CD28+ T cells and CD8-CD 28-cells, respectively, and the cell concentration was adjusted to 10 ⁶ Each cell proliferation rate was calculated by adding 100. Mu.L of each well, culturing at 37℃for 24 hours, measuring the proliferation level of each cell by CCK-8 method, adding 10. Mu. LCCK-8 solution to the cell solution, incubating in an incubator at 37℃for 2.5 hours, measuring absorbance at 450nm by using an ELISA reader, and calculating cell proliferation rate (%) = (experimental OD value-blank OD value)/(experimental OD value-blank OD value) ×100% by using CD8+CD28+ T cells and CD8-CD 28-cells which were not infected with lentivirus as controls and well plates without adding cell solution (buffer only) as blank.

(3)RT-PCR

KIR3DS1 receptor expression assay: total RNA of each cell was extracted by TRIZOL method, and cDNA was synthesized by reverse transcription, and PCR amplification was performed using the following primers.

KIR3DS1F:cagcgctgtggtgcctcgc，SEQ ID NO.26；

KIR3DS1R:ctgtgaccatgatcaccat，SEQ ID NO.27；

GAPDHF:tgcttdcaacagcgacaccca，SEQ ID NO.28，

GAPDHR:caccctgttgctgtagccaaa，SEQ ID NO.29；

IFN-ɑF:ttaggatccatggcctcgcccttt，SEQ ID NO.30，

IFN-ɑR:cgcgaattcgttattccttcctcc，SEQ ID NO.31；

PerformF:agtacagcttcagcactgaca，SEQ ID NO.32；

PerformR:atgaagtgggtgccgtagtt，SEQ ID NO.33；

FasLF:cactttgggattctttccat，SEQ ID NO.34；

FasLR:gtgagttgaggagctacaga，SEQ ID NO.35。

Reverse transcription is carried out by adopting a Promega M-MLV kit to obtain cDNA, and the reaction comprises 0.4 mu l of Rnasin (40U/. Mu.l), 2.6 mu l of Rnasin (40U/. Mu.l) and 2.0 mu L of dNTPs10mM, 0.1. Mu.LM-MLV-RTase and 5 XRT buffer 4. Mu.L. PCR expansion is carried out by taking synthesized cDNA as a template, and a reaction system comprises: 1.0. Mu.L cDNA, 10. Mu. L SYBR prmix ex taq, 5. Mu.L upstream and downstream primers 0.5. Mu.L and 20. Mu.L RNase-Free H ₂ O. The reaction condition is 95 ℃ for 15 seconds; the melting curve was prepared by keeping the reaction temperature at 95℃for 5 seconds at 95℃and 60℃at 95℃from 55℃to 95℃for 4 seconds at each 0.5℃increase, and reading the absorbance. The relative expression levels of KIR3DS1 receptor and IFN-a mRNA were calculated using control group 2- ΔΔct assay.

(4) ELISA detection

Further taking 40mL of cell suspension (containing 10mM Tris-HCl, 0.1% deoxycholate sodium, pH 8.0), adding 12.5mg of lysozyme and 32 mu L of 0.1M PMSF, standing at room temperature for 30min, performing ultrasonic sterilization, freezing and storing at 4 ℃ and 12000r/min multiplied by 10min, and the supernatant at-70 ℃; adding washing solution (10 mM Tris,0.5M urea, pH 8.0), re-suspending the precipitate, performing ultrasonic sterilization, centrifuging, repeating washing for 3 times, dissolving in BufferB (100 mM NaH) ₂ PO ₄ After SDS-PAGE was performed for 2 hours in 10mM Tris.HCl, 8M urea, pH 8.0), the blocking solution was 5% skim milk powder, murine anti-human KIR3DS1 monoclonal antibody DX9 (bioleged) was used as primary antibody, goat anti-murine IgG was used as secondary antibody, DAB was used as chromogenic substrate, and ELISA was performed to determine the expression level of KIR3DS1 in the cells.

Further, 40. Mu.L of the cell suspension was taken, the supernatant was taken, 160. Mu.L of the sample diluent was added, blank wells were set, and ELISA was performed to determine the IFN-. Alpha.expression level (eBioscience) in the cell supernatant using murine anti-human KIR3DS1 monoclonal antibody DX9 (Biolegend) as primary antibody, goat anti-mouse IgG as secondary antibody, DAB as chromogenic substrate.

(5) Results

Table 2 shows the relative levels of KIR3DS1 receptor mRNA and IFN-alpha mRNA, and the amount of KIR3DS1 receptor expression in cells and IFN-alpha expression in cell supernatants, respectively, produced by example 1, example 2 and comparative example 1 for lentiviruses transfected respectively, "-" in Table 2 indicates undetectable. As can be seen from Table 2, the lentiviruses provided in example 1, example 2 and comparative example 1 respectively infect CD8+CD28+T and CD8-CD28-T cells of female CBA/J pregnant mouse origin respectively, and T cells stably expressing KIR3DS1 receptor and IFN-alpha are sequentially prepared, and have no obvious trend of decreasing proliferation level compared with cells which are not infected by the lentiviruses. Neither comparative example 1 nor the control group showed expression of KIR3DS1 receptor and IFN-alpha. The CD8+CD28+T and CD8-CD28-T cells provided in examples 1 and 2 both have KIR3DS1 receptor and IFN-alpha expression, and IFN-alpha is expressed extracellularly, while KIR3DS1 receptor is expressed in or on the cell surface. To verify whether the cell line obtained in the application stably expresses the related target genes, normal T cells of examples 1 and 2 and comparative example 1 and a control group are respectively passaged for 5 generations, and then the related levels of KIR3DS1 receptor mRNA and IFN-alpha mRNA are detected again, wherein the levels are not obviously reduced, so that the target genes are stably inherited by the cells.

TABLE 2

Note that P <0.01 compared to "CD8-CD28-T

In vitro cell assay

1. MTT assay

T cells prepared in examples 1 and 2 and comparative example 1 of the present application were used as effector cells (CD8+CD28+T and CD8-CD 28-T), and HepG2 (human hepatoma cell, accession No. SNL-083, shang En Bio), K562 (human chronic myelogenous leukemia cell, SNL-042, shang En bio) and EMT6 cells (mouse breast cancer cell, SNL-298, shang En bio) were used as target cells, respectively. Collecting target cells growing in log phase, washing, and adjusting cell concentration to 5×10 ⁴ transfer/mL into 96-well plates, 100. Mu.L per well, 5% CO at 37deg.C ₂ After culturing in an incubator for 12h, effector cells (0.5:1, 2.5:1, 5:1) were added according to different target ratios, 5 compound wells were set per target ratio, the total volume of each well was 200. Mu.L, a complete medium was used as a zeroing control well, and 5% CO was used at 37 ℃ ₂ After the incubator continues to cultivate for 6 hours, MTT is added to continue to cultivateAfter 4h, the supernatant was removed by centrifugation, 100u1DMSO was added to each well, the OD value at 570nm was determined, and T cell killing activity was calculated according to the following formula: killing rate (%) = [1- (OD) _E+T -OD _E )/OD _T ]×100％。

2. Data processing

All test data are expressed in mean and standard deviation, data were processed using SPSS13.0 software and multiple comparisons and significance signatures were performed for each column or row.

5. Results

Table 3 shows the results of killing of each target cell by T cells provided in example 1, example 2, comparative example 1 and control at an effect ratio of 0.5:1,2.5:1,5:1, multiple comparisons and significant difference labeling were performed for each row of data in table 3. As can be seen from table 3, as the effector ratio increases, the T cells provided in examples 1,2, comparative example 1 and control group increased the killing rate of each target cell, and the cd8+cd28+ T cells provided in examples 1 and 2 had higher killing rate than the CD8-CD28-T cells, while the cd8+cd28+ T cells or CD8-CD28-T cells provided in comparative example 1 were not significantly different from the control group. It can be seen from Table 2 that the effect of killing target cells is not enhanced due to the fact that CD8+CD28+ T cells or CD8-CD28-T cells provided in comparative example 1 are not expressed by KIR3DS1 receptor and IFN-alpha.

TABLE 3 killing Rate (%)

Note that P <0.05 compared to "CD8-CD28-T", delta indicates P <0.05 compared to "control"

TABLE 4 mRNA expression of related genes

Note that P <0.05 compared to "CD8-CD28-T

Table 4 shows mRNA expression levels of relevant tumor killing molecules after T cells provided in example 1, example 2, and comparative example 1, respectively, act on target cells. Wherein, the relative tumor killing molecule expression of the T cells provided by the comparative example 1 and the control group is not changed significantly, while the expression level of the performance and the FasL in the CD8+CD28+T cells provided by the example 1 and the example 2 is increased significantly. Thus, it was demonstrated that T cells engineered with KIR3DS and IFN-alpha induced and promoted expression of both perform and FasL.

Animal experiment

1. Materials and methods

The experimental example adopts NOD tumor-bearing mice (HT-29 colon cancer, kernel-derived organisms), SPF grade feeding is started when the tumor diameter reaches 4-5 mm.

The injections were given 1 time every 3 days after tumor inoculation, 14 times consecutively, and a blank group was set. At each treatment, each mouse in the blank group was intraperitoneally injected with 100 μlpbs buffer; each mouse of the experimental group was injected intraperitoneally 10 ⁶ T cells provided in example 1, example 2, comparative example 1 and control group. According to the formula V = length x width ² Tumor volume was calculated by/2, data was entered into GraphPadPrism5 software, and tumor volume change rate after treatment was completed and survival rate of mice was calculated. Wherein, tumor volume change rate = (pre-treatment tumor volume-post-treatment tumor volume)/post-treatment tumor volume x 100%, and mouse survival rate was calculated as 100 days post-treatment mouse survival rate.

2. Statistical analysis

All results are presented as mean ± standard deviation, statistical analysis detected with Student's t test, p <0.05, p < 0.01).

3. Results

TABLE 5

Table 5 shows the rate of change of tumor volume and the survival of mice after intervention of tumor-bearing mice with T cells provided in example 1, example 2 and comparative example 1, respectively. In table 5, p <0.05, # indicates p <0.01 compared to corresponding CD8-CD28-T cells; delta represents the blank versus p <0.05; and (d) represents p <0.05 compared to the corresponding comparative example 1. As can be seen from table 5, the T cell intervention tumor-bearing mice provided in example 1, example 2 and comparative example 1 respectively have more remarkable therapeutic effects. In particular, the cd8+cd28+ T cells provided in each of the examples and comparative examples have a more pronounced therapeutic effect relative to the CD8-CD28-T cells; examples 1 and 2 have a more pronounced therapeutic effect relative to comparative example 1.

In summary, the examples of the present application provide for in vitro synthesis of human KIR3DS1 receptor transcripts and human IFN- α1 transcripts, and construction of lentiviral vectors, infecting T cells of mouse origin, and constructing cell lines stably expressing KIR3DS1 receptor and IFN- α1.

The foregoing is merely a preferred embodiment of the present application, but the scope of the present application is not limited thereto, and any changes or substitutions easily contemplated by those skilled in the art within the technical scope of the present application should be covered by the scope of the present application.

Sequence listing

<110> Western medical and biomedical science and technology Co., ltd, double-flow medical division

Preparation method and application of <120> clinical blood immune cell preparation

<141> 2022-05-23

<160> 35

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2817

<212> DNA

<213> Artificial Sequence

<400> 1

agagaaccta gagcccaagg ttcagagtca cccatctcag caagcccaga agtatctgca 60

atatctacga tggcctcgcc ctttgcttta ctgatggtcc tggtggtgct cagctgcaag 120

tcaagctgct ctctgggctg tgatctccct gagacccaca gcctggataa caggaggacc 180

ttgatgctcc tggcacaaat gagcagaatc tctccttcct cctgtctgat ggacagacat 240

gactttggat ttccccagga ggagtttgat ggcaaccagt tccagaaggc tccagccatc 300

tctgtcctcc atgagctgat ccagcagatc ttcaacctct ttaccacaaa agattcatct 360

gctgcttggg atgaggacct cctagacaaa ttctgcaccg aactctacca gcagctgaat 420

gacttggaag cctgtgtgat gcaggaggag agggtgggag aaactcccct gatgaatgcg 480

gactccatct tggctgtgaa gaaatacttc cgaagaatca ctctctatct gacagagaag 540

aaatacagcc cttgtgcctg ggaggttgtc agagcagaaa tcatgagatc cctctcttta 600

tcaacaaact tgcaagaaag attaaggagg aaggaataac atctggtcca acatgaaaac 660

aattcttatt gactcataca ccaggtcacg ctttcatgaa ttctgtcatt tcaaagactc 720

tcacccctgc tataactatg accatgctga taaactgatt tatctattta aatatttatt 780

taactattca taagatttaa attatttttg ttcatataac gtcatgtgca cctttacact 840

gtggttagtg taataaaaca tgttccttat atttactcga gaaccatccc agtaacccga 900

ccgccgctgg tcttcgctgg acaccgctga gctgagctgg ggcgcagccg cctgtctgca 960

ccggcagcac catgttgctc atggtcgtca gcatggcgtg tgttgggttg ttcttggtcc 1020

agagggccgg tccacacatg ggtggtcagg acaagccctt cctgtctgcc tggcccagcg 1080

ctgtggtgcc tcgcggagga cacgtgactc ttcggtgtca ctatcgtcat aggtttaaca 1140

atttcatgct atacaaagaa gacagaatcc acgttcccat cttccatggc agaatattcc 1200

aggagggctt caacatgagc cctgtgacca cagcacatgc agggaactac acatgtcggg 1260

gttcacaccc acactccccc actgggtggt cggcacccag caaccccatg gtgatcatgg 1320

tcacaggaaa ccacagaaaa ccttccctcc tggcccaccc aggtcccctg gtgaaatcag 1380

gagagagagt catcctgcaa tgttggtcag atatcatgtt tgagcacttc tttctgcaca 1440

aagagtggat ctctaaggac ccctcacgcc tcgttggaca gatccatgat ggggtctcca 1500

aggccaattt ctccatcggt tccatgatgc gtgcccttgc agggacctac agatgctacg 1560

gttctgttac tcacaccccc tatcagttgt cagctcccag tgatcccctg gacatcgtgg 1620

tcacaggtct atatgagaaa ccttctctct cagcccagcc gggccccaag gttcaggcag 1680

gagagagcgt gaccttgtcc tgtagctccc ggagctccta tgacatgtac catctatcca 1740

gggagggggg agcccatgaa cgtaggctcc ctgcagtgcg caaggtcaac agaacattcc 1800

aggcagattt ccctctgggc cctgccaccc acggagggac ctacagatgc ttcggctctt 1860

tccgtcactc tccctacgag tggtcagacc cgagtgaccc actgcttgtt tctgtcacag 1920

gaaacccttc aagtagttgg ccttcaccca cagaaccaag ctccaaatct ggtaacctca 1980

gacacctgca cattctgatt gggacctcag tggtcaaaat ccctttcacc atcctcctct 2040

tctttctcct tcatcgctgg tgctccaaca aaaaaaaatg ctgctgtaat ggaccaagag 2100

cctgcaggga acagaagtga acagcgagga ttctgatgaa caagaccatc aggaggtgtc 2160

atacgcataa ttggaacact gtgttttcac acagagaaaa atcactcgcc cttctcagag 2220

gcccaagaca cccccaacag ataccagcat gtacatagaa cttccaaatg ctgagcccag 2280

atccaaagtt gtcttctgtc cacgagcacc acagtcaggc cttgagggga tcttctaggg 2340

agacaacagc cctgtctcaa aactgggttg ccagctccca tgtaccagca gctggaatct 2400

gaaggcatca gtcttcatct tagggcatcg ctcttcctca caccacaaat ctgaatgtgc 2460

ctctcacttg cttacaaatg tctaaggtcc ccactgcctg ctggagaaaa aacacactcc 2520

tttgcttagc ccacagttct ccatttcact tgacccctgc ccacctctcc aacctaactg 2580

gcttacttcc tagtctactt gaggctgcaa tcacactgag gaactcacaa ttccacacat 2640

acaagaggct ccgtcttaac gcagcactta gacacgtgct gttccacctt ccctcatgct 2700

gttccacctc ccctcagact agctttcagc cttctgtcag cagtaaaact tatatacttt 2760

ttaaaataac ttcaatgtag ttttccatcc ttcaaataaa catgtctgcc cccatgg 2817

<210> 2

<211> 2858

<212> DNA

<213> Artificial Sequence

<400> 2

agagaaccta gagcccaagg ttcagagtca cccatctcag caagcccaga agtatctgca 60

atatctacga tggcctcgcc ctttgcttta ctgatggtcc tggtggtgct cagctgcaag 120

tcaagctgct ctctgggctg tgatctccct gagacccaca gcctggataa caggaggacc 180

ttgatgctcc tggcacaaat gagcagaatc tctccttcct cctgtctgat ggacagacat 240

gactttggat ttccccagga ggagtttgat ggcaaccagt tccagaaggc tccagccatc 300

tctgtcctcc atgagctgat ccagcagatc ttcaacctct ttaccacaaa agattcatct 360

gctgcttggg atgaggacct cctagacaaa ttctgcaccg aactctacca gcagctgaat 420

gacttggaag cctgtgtgat gcaggaggag agggtgggag aaactcccct gatgaatgcg 480

gactccatct tggctgtgaa gaaatacttc cgaagaatca ctctctatct gacagagaag 540

aaatacagcc cttgtgcctg ggaggttgtc agagcagaaa tcatgagatc cctctcttta 600

tcaacaaact tgcaagaaag attaaggagg aaggaataac atctggtcca acatgaaaac 660

aattcttatt gactcataca ccaggtcacg ctttcatgaa ttctgtcatt tcaaagactc 720

tcacccctgc tataactatg accatgctga taaactgatt tatctattta aatatttatt 780

taactattca taagatttaa attatttttg ttcatataac gtcatgtgca cctttacact 840

gtggttagtg taataaaaca tgttccttat atttactcat caggaggcat cactgaggcc 900

aggagtatca gccctttatc cacgcttttc tacaatggca ttcaataaag tgcacgtgtt 960

tctggtgctg agctgagctg gggcgcagcc gcctgtctgc accggcagca ccatgttgct 1020

catggtcgtc agcatggcgt gtgttgggtt gttcttggtc cagagggccg gtccacacat 1080

gggtggtcag gacaagccct tcctgtctgc ctggcccagc gctgtggtgc ctcgcggagg 1140

acacgtgact cttcggtgtc actatcgtca taggtttaac aatttcatgc tatacaaaga 1200

agacagaatc cacgttccca tcttccatgg cagaatattc caggagggct tcaacatgag 1260

ccctgtgacc acagcacatg cagggaacta cacatgtcgg ggttcacacc cacactcccc 1320

cactgggtgg tcggcaccca gcaaccccat ggtgatcatg gtcacaggaa accacagaaa 1380

accttccctc ctggcccacc caggtcccct ggtgaaatca ggagagagag tcatcctgca 1440

atgttggtca gatatcatgt ttgagcactt ctttctgcac aaagagtgga tctctaagga 1500

cccctcacgc ctcgttggac agatccatga tggggtctcc aaggccaatt tctccatcgg 1560

ttccatgatg cgtgcccttg cagggaccta cagatgctac ggttctgtta ctcacacccc 1620

ctatcagttg tcagctccca gtgatcccct ggacatcgtg gtcacaggtc tatatgagaa 1680

accttctctc tcagcccagc cgggccccaa ggttcaggca ggagagagcg tgaccttgtc 1740

ctgtagctcc cggagctcct atgacatgta ccatctatcc agggaggggg gagcccatga 1800

acgtaggctc cctgcagtgc gcaaggtcaa cagaacattc caggcagatt tccctctggg 1860

ccctgccacc cacggaggga cctacagatg cttcggctct ttccgtcact ctccctacga 1920

gtggtcagac ccgagtgacc cactgcttgt ttctgtcaca ggaaaccctt caagtagttg 1980

gccttcaccc acagaaccaa gctccaaatc tggtaacctc agacacctgc acattctgat 2040

tgggacctca gtggtcaaaa tccctttcac catcctcctc ttctttctcc ttcatcgctg 2100

gtgctccaac aaaaaaaaat gctgctgtaa tggaccaaga gcctgcaggg aacagaagtg 2160

aacagcgagg attctgatga acaagaccat caggaggtgt catacgcata attggaacac 2220

tgtgttttca cacagagaaa aatcactcgc ccttctcaga ggcccaagac acccccaaca 2280

gataccagca tgtacataga acttccaaat gctgagccca gatccaaagt tgtcttctgt 2340

ccacgagcac cacagtcagg ccttgagggg atcttctagg gagacaacag ccctgtctca 2400

aaactgggtt gccagctccc atgtaccagc agctggaatc tgaaggcatc agtcttcatc 2460

ttagggcatc gctcttcctc acaccacaaa tctgaatgtg cctctcactt gcttacaaat 2520

gtctaaggtc cccactgcct gctggagaaa aaacacactc ctttgcttag cccacagttc 2580

tccatttcac ttgacccctg cccacctctc caacctaact ggcttacttc ctagtctact 2640

tgaggctgca atcacactga ggaactcaca attccacaca tacaagaggc tccgtcttaa 2700

cgcagcactt agacacgtgc tgttccacct tccctcatgc tgttccacct cccctcagac 2760

tagctttcag ccttctgtca gcagtaaaac ttatatactt tttaaaataa cttcaatgta 2820

gttttccatc cttcaaataa acatgtctgc ccccatgg 2858

<210> 3

<211> 47

<212> DNA

<213> Artificial Sequence

<400> 3

gagaaccatc ccagtaaccc gaccgccgct ggtcttcgct ggacacc 47

<210> 4

<211> 88

<212> DNA

<213> Artificial Sequence

<400> 4

atcaggaggc atcactgagg ccaggagtat cagcccttta tccacgcttt tctacaatgg 60

cattcaataa agtgcacgtg tttctggt 88

<210> 5

<211> 2770

<212> DNA

<213> Artificial Sequence

<400> 5

agagaaccta gagcccaagg ttcagagtca cccatctcag caagcccaga agtatctgca 60

atatctacga tggcctcgcc ctttgcttta ctgatggtcc tggtggtgct cagctgcaag 120

tcaagctgct ctctgggctg tgatctccct gagacccaca gcctggataa caggaggacc 180

ttgatgctcc tggcacaaat gagcagaatc tctccttcct cctgtctgat ggacagacat 240

gactttggat ttccccagga ggagtttgat ggcaaccagt tccagaaggc tccagccatc 300

tctgtcctcc atgagctgat ccagcagatc ttcaacctct ttaccacaaa agattcatct 360

gctgcttggg atgaggacct cctagacaaa ttctgcaccg aactctacca gcagctgaat 420

gacttggaag cctgtgtgat gcaggaggag agggtgggag aaactcccct gatgaatgcg 480

gactccatct tggctgtgaa gaaatacttc cgaagaatca ctctctatct gacagagaag 540

aaatacagcc cttgtgcctg ggaggttgtc agagcagaaa tcatgagatc cctctcttta 600

tcaacaaact tgcaagaaag attaaggagg aaggaataac atctggtcca acatgaaaac 660

aattcttatt gactcataca ccaggtcacg ctttcatgaa ttctgtcatt tcaaagactc 720

tcacccctgc tataactatg accatgctga taaactgatt tatctattta aatatttatt 780

taactattca taagatttaa attatttttg ttcatataac gtcatgtgca cctttacact 840

gtggttagtg taataaaaca tgttccttat atttactcgc tgagctgagc tggggcgcag 900

ccgcctgtct gcaccggcag caccatgttg ctcatggtcg tcagcatggc gtgtgttggg 960

ttgttcttgg tccagagggc cggtccacac atgggtggtc aggacaagcc cttcctgtct 1020

gcctggccca gcgctgtggt gcctcgcgga ggacacgtga ctcttcggtg tcactatcgt 1080

cataggttta acaatttcat gctatacaaa gaagacagaa tccacgttcc catcttccat 1140

ggcagaatat tccaggaggg cttcaacatg agccctgtga ccacagcaca tgcagggaac 1200

tacacatgtc ggggttcaca cccacactcc cccactgggt ggtcggcacc cagcaacccc 1260

atggtgatca tggtcacagg aaaccacaga aaaccttccc tcctggccca cccaggtccc 1320

ctggtgaaat caggagagag agtcatcctg caatgttggt cagatatcat gtttgagcac 1380

ttctttctgc acaaagagtg gatctctaag gacccctcac gcctcgttgg acagatccat 1440

gatggggtct ccaaggccaa tttctccatc ggttccatga tgcgtgccct tgcagggacc 1500

tacagatgct acggttctgt tactcacacc ccctatcagt tgtcagctcc cagtgatccc 1560

ctggacatcg tggtcacagg tctatatgag aaaccttctc tctcagccca gccgggcccc 1620

aaggttcagg caggagagag cgtgaccttg tcctgtagct cccggagctc ctatgacatg 1680

taccatctat ccagggaggg gggagcccat gaacgtaggc tccctgcagt gcgcaaggtc 1740

aacagaacat tccaggcaga tttccctctg ggccctgcca cccacggagg gacctacaga 1800

tgcttcggct ctttccgtca ctctccctac gagtggtcag acccgagtga cccactgctt 1860

gtttctgtca caggaaaccc ttcaagtagt tggccttcac ccacagaacc aagctccaaa 1920

tctggtaacc tcagacacct gcacattctg attgggacct cagtggtcaa aatccctttc 1980

accatcctcc tcttctttct ccttcatcgc tggtgctcca acaaaaaaaa atgctgctgt 2040

aatggaccaa gagcctgcag ggaacagaag tgaacagcga ggattctgat gaacaagacc 2100

atcaggaggt gtcatacgca taattggaac actgtgtttt cacacagaga aaaatcactc 2160

gcccttctca gaggcccaag acacccccaa cagataccag catgtacata gaacttccaa 2220

atgctgagcc cagatccaaa gttgtcttct gtccacgagc accacagtca ggccttgagg 2280

ggatcttcta gggagacaac agccctgtct caaaactggg ttgccagctc ccatgtacca 2340

gcagctggaa tctgaaggca tcagtcttca tcttagggca tcgctcttcc tcacaccaca 2400

aatctgaatg tgcctctcac ttgcttacaa atgtctaagg tccccactgc ctgctggaga 2460

aaaaacacac tcctttgctt agcccacagt tctccatttc acttgacccc tgcccacctc 2520

tccaacctaa ctggcttact tcctagtcta cttgaggctg caatcacact gaggaactca 2580

caattccaca catacaagag gctccgtctt aacgcagcac ttagacacgt gctgttccac 2640

cttccctcat gctgttccac ctcccctcag actagctttc agccttctgt cagcagtaaa 2700

acttatatac tttttaaaat aacttcaatg tagttttcca tccttcaaat aaacatgtct 2760

gcccccatgg 2770

<210> 6

<211> 26

<212> DNA

<213> Artificial Sequence

<400> 6

ggaattcaga gaacctagag cccaag 26

<210> 7

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 7

ggaattcggt gtccagcgaa g 21

<210> 8

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 8

ggaattcaga gaacctagag cccaagg 27

<210> 9

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 9

ggaattcgca ccagaaacac gtgc 24

<210> 10

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 10

ggaattcaga gaacctagag cccaagg 27

<210> 11

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 11

ggaattccag ctcagctcag cgag 24

<210> 12

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 12

ggaattcctt cgctggacac c 21

<210> 13

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 13

ggaattcagg gagagtgacg gaaagag 27

<210> 14

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 14

ggaattcgca cgtgtttctg gtgc 24

<210> 15

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 15

ggaattcgac cactcgtagg gagagtg 27

<210> 16

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 16

ggaattcctc gctgagctga gctg 24

<210> 17

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 17

ggaattcgac cactcgtagg gagagtg 27

<210> 18

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 18

ggaattcctc tttccgtcac tctccct 27

<210> 19

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 19

ggaattccca tgggggcag 19

<210> 20

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 20

ggaattccac tctccctacg agtggtc 27

<210> 21

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 21

ggaattccca tgggggcag 19

<210> 22

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 22

ggaattccac tctccctacg agtggtc 27

<210> 23

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 23

ggaattccca tgggggca 18

<210> 24

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 24

cctatttccc atgattcctt cata 24

<210> 25

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 25

gtaatacggt tatccacgcg 20

<210> 26

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 26

cagcgctgtg gtgcctcgc 19

<210> 27

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 27

ctgtgaccat gatcaccat 19

<210> 28

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 28

tgcttdcaac agcgacaccc a 21

<210> 29

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 29

caccctgttg ctgtagccaa a 21

<210> 30

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 30

ttaggatcca tggcctcgcc cttt 24

<210> 31

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 31

cgcgaattcg ttattccttc ctcc 24

<210> 32

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 32

agtacagctt cagcactgac a 21

<210> 33

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 33

atgaagtggg tgccgtagtt 20

<210> 34

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 34

cactttggga ttctttccat 20

<210> 35

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 35

gtgagttgag gagctacaga 20

Claims

1. A method for preparing a clinical blood immune cell preparation, comprising:

obtaining isolated T cells expressing CD8 and CD 28;

preparing a lentivirus carrying a human KIR3DS1 receptor transcript and a human IFN-alpha 1 transcript;

2. The method of claim 1, wherein preparing a lentivirus carrying a human KIR3DS1 receptor transcript and a human IFN- α1 transcript comprises:

synthesizing nucleotide sequences of a human KIR3DS1 receptor transcript and a human IFN-alpha 1 transcript to obtain target fragments;

3. The preparation method of claim 2, wherein the nucleotide sequence of the target fragment is as shown in SEQ ID NO:1 or 2.

4. The production method according to claim 2, wherein, after the synthesis of the target fragment, the production method further comprises a step of amplifying the target fragment, "the step of amplifying the target fragment" specifically comprises:

and (3) carrying out enzyme digestion on the amplified 1-960 bp region, the 940 bp-190 bp region and the 1890 bp-3' end region, purifying, mixing to serve as templates, and carrying out PCR amplification by using mixed primers of the first primer pair, the second primer pair and the third primer pair.

5. The method of claim 2, wherein the step of "packaging lentiviruses" comprises:

inoculating the recombinant plasmid carrying the target fragment with correct sequencing into LB culture medium containing antibiotics for full culture, extracting bacterial liquid, cracking, purifying, extracting and harvesting the recombinant plasmid; and

transferring the recombinant plasmid into 293T cells, and harvesting the packaged lentivirus supernatant.

6. The method of claim 1, wherein the step of infecting the cells with a lentivirus comprises:

mixing the T cells expressing CD8 and CD28 obtained by sorting with the lentiviral supernatant, culturing at 37 ℃ for 10 hours, removing the lentiviral supernatant, replacing fresh alpha-MEM culture medium, continuing culturing, and infecting and culturing for 5 days to obtain the T cells expressing KIR3DS1 receptor and IFN-alpha 1.