CN105950663B - A kind of replication defective recombinant slow virus CAR-T transgene carrier targeting CD30 and its construction method and application - Google Patents

Abstract

The invention discloses a kind of CAR-T transgene carriers of replication defective recombinant slow virus for targeting CD30, comprising: the prokaryotic replions pUC Ori sequence for plasmid replication；The sequence of AmpR containing ampicillin resistance gene for purpose bacterial strain massive amplification；For enhancing the Viral Replicon SV40Ori sequence of the duplication in eukaryocyte；Slow virus for slow virus packaging packs cis element；ZsGreen1 green fluorescent protein for eukaryotic cell expression green fluorescence；IRES ribosome binding sequence for common transcriptional expression protein；People's EF1 α promoter of eukaryotic transcription for Chimeric antigen receptor gene；Integrate identification, transmitting, two generation CAR of starting or the Chimeric antigen receptor of three generations CAR for forming；For enhancing the eWPRE element of the expression efficiency of transgenosis.In addition, also disclosing construction method and the application of the carrier.The method can significantly improve the secretion of cell factor, the killing effect in vitro of CAR-T cell, clinical treatment Hodgkin lymphoma or non-Hodgkin lymphoma effect are prominent.

Description

It is a kind of target CD30 replication defective recombinant slow virus CAR-T transgene carrier and Its construction method and application

Technical field

The invention belongs to field of medical biotechnology, and in particular to a kind of carrier more particularly to a kind of duplication for targeting CD30 lack Fall into the CAR-T transgene carrier of property recombinant slow virus.Moreover, it relates to construction method and the application of the carrier.

Background technique

The theoretical basis of immunotherapy of tumors is that immune system has identification tumor associated antigen, regulation body attack tumour The ability of cell (cell dissolution of high degree of specificity).This bioprocess is sufficiently complex, at present still in research among.Previous generation It records the nineties, multiple computer MSR Information systems have discovered that tumour antigen (t μm of or antigens), and T lymphocyte can be by main Histocompatibility complex (major histocompatibility complex, MHC) dependence mode identifies these tumours Antigen.

Immunotherapy of tumors is generally divided into two classes, nospecific immunity and specific immunity.Nonspecific immunotherapy for bronchus master It to include interleukin 2 (interle μ kin-2, IL-2), interferon-' alpha ' (interferon α, IFN-α), tumor necrosis factor Sub (t μm of or necrosis factor, TNF-α), the cell factors such as BCG vaccine and toxin, adoptive cellular immunotherapy etc.. Specific active immunotherapy is mainly tumor vaccine.

1.1 tumour Nonspecific immunotherapy for bronchus

Nonspecific immune response be it is inherent, its formation does not need antigenic stimulus, can be widely for more Kind antigen, is the basis of immune response, but specificity is not strong, tends not to generate sufficient intensity to certain specific antigen substance React nonspecific immunization therapy.In the cytokine profiles for entering clinical test, interleukin 2 and interferon are answered With the most extensively [Rosenberg S A, Lotze M T, M μ μ l L M, et al.A progress report on the treatment of 157 patients with advanced cancerμsing lymphokine-activated killer cells and interleμkin-2 or high-dose interleμkin-2 alone[J].N Engl J Med, 1987,316 (15): 889-897.].

The immunization therapy of 1.2 anti-cancer monoclonal antibodies

Monoclonal antibody is used widely in therapeutic field of tumor over nearly more than 20 years.Antitumor monoclonal antibody medicine generally wraps Include two classes: first is that antitumor monoclonal antibody, second is that antitumor monoclonal antibody conjugate or immune conjugate.Immune conjugate molecule is by list Anti- to form with " bullet " drug two parts, " bullet " mainly includes radionuclide, drug and toxin, is distinguished after connecting with monoclonal antibody Constitute radio-immunity conjugate, chemo-immunity conjugate and immunotoxin.In in November, 1997 and U.S. FDA in October, 1998 point Two monoclonal antibodies for clinical cancer therapy-Rit μ ximab (rit μ xan) and Trast μ z μm ab is not passed through (herceptin)[Dillman R O.Magic bμllets at last！Finally—approval of a Monoclonal antibody for the treatment of cancer [J] .Cancer Biother Radiopharm, 1997,12:223-225.].It is now recognized that the mechanism of action of monoclonal antibody has blocking effect, signal transduction effect and targeting Deng three kinds of mechanism of action, without direct lethal effect.The problem of additionally there are in terms of pharmacology, mainly reaches tumour Dose is insufficient.Since conjugate is foreign protein, can be absorbed by reticuloendothelial system, have it is a great deal of will accumulate in liver, spleen and Marrow.Conjugate is macromolecular substances, by capillary endothelium layer and penetrates tumour cell external series gap and is restricted.

The adoptive immunotherapy of 1.3 tumours

The adoptive immunotherapy of tumour, which refers to, is transfused to patient for the self or alloimmune effector cell of Activation In Vitro, with Kill the tumour cell of patient's body.A critical issue in tumour adoptive immunotherapy is to find suitable tumor-killing Cell.Since the eighties in last century, including LAK, cell because induction killing cell (cytokine-ind μ ced Killers, CIK), the cells such as TIL be successively applied to clinic, but it is lower since there is amplification speeds, cell origin is difficult, The not high problems of cytotoxicity, are restricted in clinical application.The specific for tumour antigen for how improving T cell has Important clinical meaning.T cell mainly passes through T cell receptor (T cell receptor, TCR) to the identification of tumour antigen Human leukocyte antigen (h μm of an le μ kocyte antigen, the HLA)-peptide complexes on tumor cell surface, therefore, T The specificity of cells against tumor antigen recognizing depends on the TCR on T cell surface.It is special using the means clonal tumours of molecular biology The TCR of specific T cell, and by building the viral vectors containing TCR, TCR is transferred in normal T cell, make these T cells because It carries tumour-specific and becomes specific tumor killing cell [Johnson L A, Morgan R A, D μ dley M E, et al.Gene therapy with hμman and moμse T-cell receptors mediates cancer Regression and targets normal tiss μ es expressing cognate antigen [J] .Blood, 2009,114 (3): 535-546.].

1.4 tumor vaccine therapy

Tumor vaccine therapy is to excite the specificity antineoplastic immunity of patient by importing tumour antigen to patient's body Reaction.Due to vaccine therapy have many advantages, such as specificity, in vivo immunological effect hold time it is long, have become at present research heat Point.In recent years polypeptide vaccine, nucleic acid vaccine, holoprotein vaccine, anti-unique antibody vaccine, recombinant viral vaccine, bacterial vaccine, Tumor cell vaccine, Dendritic Cells (dendritic cells, DC) vaccine of gene modification etc. are widely studied and apply [Robbins P F, Morgan R A, Feldman S A, et al.T μm or regression in patients with metastatic synovial cell sarcoma and melanomaμsing genetically engineered Lymphocytes reactive with NY-ESO-1 [J] .J Clin Oncol, 2011,29 (7): 917-924.].Tumour The large-scale application of vaccine therapy is urgently to be resolved the problem of there are three aspects.It is each tumour, every firstly, tumor associated antigen A hypotype, each neoplasm staging, these are different with respect to antigen presentation, so making an accurate selection of antigen, the patient crowd that makes an accurate selection of is to cause It closes important.Second, how to reach tumour antigen efficient absorption and expression in Dendritic Cells? antigen is inhaled by Dendritic Cells Receipts are with surface receptor for mediation.Dendritic Cells has more than ten of receptor, how according to the selection of specific antigen accordingly by Body? third, for the regulation of differentiation of dendritic cells maturation.The differentiation and maturation of Dendritic Cells is an extremely complex mistake Journey, it, which can both move towards activation T cell, can also move towards to inhibit T cell.[targeting DC cell therapeutic type tumor vaccine: bright spot with It challenges and deposits.http://www.biodiscover.com/news/research/115794.html].

1.5 tumour CAR-T treatment

CAR-T, full name are Chimeric Antigen Receptor T-Cell Imm μ notherapy, chimeric antigen by Body T cell immunotherapy, structure [Eleanor J.Cheadle, et al.CAR T cells:driving the as shown in Figure 1 road from the laboratory to the clinic.Immμnological Reviews 2014.Vol.257:91– 106]。

The t cell activation that first generation CAR is mediated is completed by the Tyrosine Activating Motifs on CD3z chain or FceRIg. Letter needed for CD3z chain is capable of providing t cell activation, cracking target cell, adjusts IL-2 secretion and play anti-tumor activity in vivo Number.But the anti-tumor activity of first generation CAR transformation T cell is restricted in vivo, and it is thin that T cell proliferation reduction eventually leads to T The apoptosis of born of the same parents.

Second generation CAR increases a new costimulatory signal intracellular, it is demonstrated experimentally that this original to make to be originated from " signal 1 " of TCR/CD3 complex expands, and many researchs all show the second generation CAR and first generation CAR that are equipped with " signal 2 " It compares, antigentic specificity is constant, and T cell proliferation, cytokine secretion increase, and Anti-apoptotic proteins secretion increases, and cell is dead Die delay.Common costimulatory molecules are CD28, but have research to be replaced CD28 with CD137 (4-1BB) later, except this it Outside, a kind of thinking using NK cell receptor CD244 is also suggested.Although which is better and which is worse actually by different second generation CAR, no Same researcher is not quite similar with result obtained in external research in vivo with different tumours.[depth full version: CAR- The status and future biology paddy .2015-051-15 of T]

In order to further improve the design of CAR, it not only includes " letter that many study groups, which start to be conceived to, which develops third generation CAR, Number 1 ", " signal 2 ", further comprise additional costimulatory signal.Different researchers are opened with different target spot and costimulatory signal The having a certain difference property of comparison result of the obtained second generation CAR and third generation CAR of research of exhibition.Table is reported in some researchs Recombination T cell up to third generation CAR is significantly increased in terms of anti-tumor activity, time to live and cytokine release； Second generation CAR and the third generation CAR recombination T cell of the result of study display targeting M Μ C1 of Wilkie etc. is in antitumor cell poison Property aspect and no significant difference, although expression third generation CAR T cell can secrete a greater amount of IFN-γ (Wilkie S, Picco G,Foster J,et al.Retargeting of hμman T cells to tμmorassociated MΜC1: the evolμtion of a chimeric antigen receptor.J Immμnol 2008；180:4901–4909.). It is worth noting that, above-mentioned difference is only the conclusion obtained in experiment in vitro, not yet compare the second generation and in vivo at present The report of three generations CAR.

Difference between this several generations CAR may be incessantly from signal transduction domain, extracellular antigen binding domain (scFv), again The transfection method (slow virus VS retrovirus) of group T cell, feedback mode (the venous re-transfusion VS peritonaeum VS tumor for recombinating T cell Body) etc. may influence the final antitumous effect of CAR-T cell.

It is entitled filed in the applicant on March 17th, 2016 that " one kind is based on replication defective recombinant slow virus CAR-T transgene carrier and its construction method and application " application for a patent for invention (number of patent application: 201610008360.5) CAR-T transgene carrier and its building of the replication defective recombinant slow virus for CD19, are disclosed Methods and applications.The present invention be directed to the CAR-T transgene carriers of CD30.

Summary of the invention

One of the technical problem to be solved in the present invention is to provide the replication defective recombinant slow virus of targeting CD30 a kind of CAR-T transgene carrier.

The second technical problem to be solved by the present invention is to provide the replication defective recombinant slow virus of targeting CD30 The construction method of CAR-T transgene carrier.

The third technical problem to be solved by the present invention is to provide the replication defective recombinant slow virus of targeting CD30 The application of CAR-T transgene carrier.

The present invention relates to the medical configuration product containing peptide, and in particular to:

One, the sequence of AmpR containing ampicillin resistance gene, prokaryotic replions pUC Ori sequence, Viral Replicon SV40 Ori sequence, RSV promoter, people EF1 α promoter, 5 terminal LTR of slow virus, 3 terminal Self- of slow virus Inactivating LTR, Gag cis element, RRE cis element, env cis element, cPPT cis element, IRES ribosomes The recombinant slow virus load of binding sequence, ZsGreen1 green fluorescent protein, eWPRE marmot hepatitis B posttranscriptional regulatory element Body skeleton, this recombined lentivirus vector skeleton can carry different therapeutic genes and be widely used in adoptive cell and control Treatment field.

Two, recombined lentivirus vector skeleton, CD8 leader Chimerical receptor signal peptide, CD30 single-chain antibody light chain VL, list Chain antibody hinge LinkerA, single-chain antibody hinge Linker B, single-chain antibody hinge Linker C, CD30 single-chain antibody heavy chain VH, CD8 Hinge Chimerical receptor hinge, CD8 Transmembrane Chimerical receptor transmembrane region, the costimulation of CD28 Chimerical receptor because Son, CD137 Chimerical receptor costimulating factor, TCR Chimerical receptor t cell activation domain construct to form recombined lentivirus vector, the party The recombined lentivirus vector that method obtains may be implemented to express CD30 Chimeric antigen receptor on human T lymphocyte, guides and activates T Lymphocyte is used clinically for treatment Hodgkin lymphoma (HL) and non-Hodgkin's leaching to the lethal effect of CD30 positive cell Bar tumor (NHL).

CAR-T technology of the present invention for CD30 is that a kind of the immune of anti-cancer monoclonal antibody that combine is controlled Treat the targeted therapy new technology with the adoptive immunotherapy advantage of tumour.CD30 belongs to Tumor Necrosis Factor Receptors family, is drenching It plays an important role in the apoptosis and proliferation of bar cell, almost in all Hodgkin lymphomas and part non-Hodgkin lymphoma table There is expression in face, the important symbol diagnosed at present in clinic as Hodgkin lymphoma and primary cutaneous type, (Carlos A.Ramos,et al.Chimeric T-Cells for Therapy of CD30+Hodgkin and Non- Hodgkin Lymphomas(HL&NHL).Biology of Blood and MarrowTransplantation,2016,22 (3): S145-S146.), since it has significant curative effect in the treatment of CD30+ tumour, it is considered to be most it is promising suddenly One of odd gold lymthoma (HL) and non-Hodgkin lymphoma (NHL) therapeutic modality.

Chimeric antigen receptor (CAR) is the core component (shown in Fig. 1) of CAR-T, and it is non-dependent to assign T lymphocyte HLA Mode identifies the ability of tumour antigen, this enables by the T cell of CAR transformation compared to nave T cell surface receptor TCR Identify wider target.It include a tumor associated antigen (t μm of or-associated in the basic engineering of CAR Antigen, TAA) combined area (the scFV section for being typically derived from monoclonal antibody antigen bond area), an extracellular hinge area, One transmembrane region and an intracellular signal transduction area.Specificity, validity and genetic modification of scFV sections of the design for CAR It is crucial determinant for the safety of T cell itself.

In order to solve the above-mentioned technical problem, the present invention is achieved through the following technical solutions:

In one aspect of the invention, a kind of CAR-T transgenosis of replication defective recombinant slow virus targeting CD30 is provided Carrier, comprising: for the prokaryotic replions pUC Ori sequence of plasmid replication, as shown in SEQ ID NO.2；For purpose bacterial strain The sequence of AmpR containing ampicillin resistance gene of massive amplification, as shown in SEQ ID NO.1；For enhancing in eukaryocyte The Viral Replicon SV40 Ori sequence of duplication, as shown in SEQ ID NO.3；Slow virus packaging for slow virus packaging is cis- Element；For the ZsGreen1 green fluorescent protein of eukaryotic cell expression green fluorescence, as shown in SEQ ID NO.11；For altogether With the IRES ribosome binding sequence of transcriptional expression protein, as shown in SEQ ID NO.12；For Chimeric antigen receptor gene Eukaryotic transcription people's EF1 α promoter, as shown in SEQ ID NO.14；EWPRE for enhancing the expression efficiency of transgenosis increases Strong type marmot hepatitis B posttranscriptional regulatory element, as shown in SEQ ID NO.13；And identify, transmit for forming collection, Start in the Chimeric antigen receptor of the two generation CAR or three generations CAR of one；It is described to integrate identification, transmitting, starting for forming The Chimeric antigen receptor of two generation CAR include: the CD8 leader Chimerical receptor signal peptide as shown in SEQ ID NO.15, such as CD30 single-chain antibody light chain VL, Optimal Linker C as shown in SEQ ID NO.19 shown in SEQ ID NO.20, such as CD30 single-chain antibody heavy chain VH shown in SEQ ID NO.16, the hinge of the CD8 Hinge Chimerical receptor as shown in SEQ ID NO.21 Chain, CD8 Transmembrane Chimerical receptor transmembrane region, CD28 as shown in SEQ ID NO.22, such as SEQ ID NO.23 institute The CD137 Chimerical receptor costimulating factor that shows, the TCR Chimerical receptor t cell activation domain as shown in SEQ ID NO.24.The use In the Chimeric antigen receptor of three generations CAR that composition integrates identification, transmitting, starting include: as shown in SEQ ID NO.15 CD8 leader Chimerical receptor signal peptide, CD30 single-chain antibody light chain VL, such as SEQ ID as shown in SEQ ID NO.20 Optimal Linker C shown in NO.19, CD30 single-chain antibody heavy chain VH, such as SEQ ID as shown in SEQ ID NO.16 CD8 Hinge Chimerical receptor hinge, the CD8 Transmembrane as shown in SEQ ID NO.22 shown in NO.21 it is chimeric by Body transmembrane region, CD28, the CD137 Chimerical receptor costimulating factor as shown in SEQ ID NO.23, as shown in SEQ ID NO.24 The Chimerical receptor t cell activation domain TCR and the CD28 Chimerical receptor costimulating factor as shown in SEQ ID NO.25.This hair ScFV sections of linker design, can be applied to second generation CAR design scheme, equally also can be applied to third used by bright For CAR design scheme.Third generation CAR design increases CD28 Chimerical receptor costimulating factor (SEQ compared with second generation design ID NO.25), in theory, have stronger signal amplification.

Further, the slow virus packaging cis element includes: such as SEQ ID NO.5 using second generation slow virus carrier Shown in slow virus 5terminal LTR, the 3 terminal Self- of slow virus as shown in SEQ ID NO.6 Inactivating LTR, the Gag cis element as shown in SEQ ID NO.7, the cis- member of RRE as shown in SEQ ID NO.8 Part, the env cis element as shown in SEQ ID NO.9, the cPPT cis element as shown in SEQ ID NO.10.The slow virus Packaging cis element using third generation slow virus carrier include: 5 terminal LTR of slow virus as shown in SEQ ID NO.5, 3 terminal Self-Inactivating LTR of slow virus as shown in SEQ ID NO.6, as shown in SEQ ID NO.7 Gag cis element, the RRE cis element as shown in SEQ ID NO.8, the env cis element as shown in SEQ ID NO.9, such as Slow virus described in cPPT cis element shown in SEQ ID NO.10 packs cis element, and as shown in SEQ ID NO.4 RSV promoter.The used CAR design scheme of the present invention can be applied in third generation slow virus carrier structure, can also apply In in second generation slow virus carrier structure.The difference (as shown in Figure 2 B) of the second generation and third generation slow virus carrier in structure, Mainly the region U3 of 5 ' LTR of second generation carrier is replaced with RSV promoter by third generation slow virus carrier, and thus eliminating the need U3 To the dependence of Tat albumen when transcription, Tat sequence can be both removed in the structural gene of slow virus, also improves slow virus base Because of group transcriptional level and transcription duration.The second generation and third generation slow virus carrier are mainly the difference of subgenomic transcription mode, Therefore the used CAR design scheme of the present invention can be applied to this two generations slow virus carrier.Carrier framework of the present invention Preferably third generation slow virus carrier (shown in Fig. 2A), 3 ' SIN LTR eliminate the region U3, eliminate slow virus carrier and self answer A possibility that processed, substantially increases safety；CPPT and eWPRE element is increased, the table of transduction efficiency and transgenosis is improved Up to efficiency；The lasting efficient transcription of core RNA when ensure that slow virus carrier packaging using RSV promoter；Using people's itself EF1 α promoter enables CAR gene in human body long lasting for expression.

Further, the enhanced marmot hepatitis B posttranscriptional regulatory element of the eWPRE has the enhancing of 6 nucleotide Mutation, specifically: g.396G > A, g.397C > T, g.398T > C, g.399G > A, g.400A > T, g.411A > T.

In another aspect of this invention, a kind of CAR-T of the replication defective recombinant slow virus of above-mentioned targeting CD30 is provided The construction method of transgene carrier, comprising the following steps:

(1) ampicillin resistance gene AmpR sequence (as shown in SEQ ID NO.1), prokaryotic replions pUC will be contained Ori sequence (as shown in SEQ ID NO.2), Viral Replicon SV40 Ori sequence (as shown in SEQ ID NO.3) are used for slow disease The slow virus of poison packaging packs cis element, ZsGreen1 green fluorescent protein (as shown in SEQ ID NO.11), IRES ribose Body binding sequence (as shown in SEQ ID NO.12), enhanced marmot hepatitis B posttranscriptional regulatory element (such as SEQ of eWPRE Shown in ID NO.13) it is stored on slow virus skeleton plasmid；

(2) integrate identification, transmitting, starting by people EF1 α promoter (as shown in SEQ ID NO.14), for forming Two generation CAR or the Chimeric antigen receptor of three generations CAR be combined into two generation CAR or three generations's CAR design scheme, by digestion, connection, Recombining reaction is cloned into slow virus skeleton plasmid, obtains the recombinant slow virus plasmid of two generation CAR or three generations CAR design；

(3) by obtained recombinant slow virus plasmid and slow virus packaging plasmid pPac-GP, pPac-R and memebrane protein plasmid PEnv-G transfects HEK293T/17 cell jointly, after carrying out gene transcript expression in HEK293T/17 cell, packs and successfully weighs Group slow virus carrier can be discharged into cells and supernatant, collect the supernatant for the recombined lentivirus vector for including；

(4) obtained recombinant slow virus supernatant is purified using the column purification mode for filtering, adsorbing, eluting, respectively Obtain recombined lentivirus vector.

In step (1), the slow virus packaging cis element includes: such as SEQ ID using second generation slow virus carrier 5 terminal LTR of slow virus, the 3 terminal Self- of slow virus as shown in SEQ ID NO.6 shown in NO.5 Inactivating LTR, the Gag cis element as shown in SEQ ID NO.7, the cis- member of RRE as shown in SEQ ID NO.8 Part, the env cis element as shown in SEQ ID NO.9, the cPPT cis element as shown in SEQ ID NO.10；The slow virus Packaging cis element using third generation slow virus carrier include: 5 terminal LTR of slow virus as shown in SEQ ID NO.5, 3 terminal Self-Inactivating LTR of slow virus as shown in SEQ ID NO.6, as shown in SEQ ID NO.7 Gag cis element, the RRE cis element as shown in SEQ ID NO.8, the env cis element as shown in SEQ ID NO.9, such as Slow virus described in cPPT cis element shown in SEQ ID NO.10 packs cis element, and as shown in SEQ ID NO.4 RSV promoter.

In step (1), the enhanced marmot hepatitis B posttranscriptional regulatory element of eWPRE has 6 nucleotide Enhancing mutation, specifically: g.396G > A, g.397C > T, g.398T > C, g.399G > A, g.400A > T, g.411A > T.

In step (2), entire CAR gene expression is started by people's EF1 α promoter；CD8 leader Chimerical receptor signal Peptide is located at the N-terminal of CAR coded sequence, for guiding CAR albumen to be positioned at cell membrane；CD30 single-chain antibody light chain VL, Optimal Linker C, CD30 single-chain antibody heavy chain VH are combined into the region scfv, for identification CD30 antigen；CD8 Hinge Chimerical receptor Hinge is used to for scfv being anchored on the outside of cell membrane；CD8 Transmembrane Chimerical receptor transmembrane region will be for will entirely be fitted into Receptor is fixed on cell membrane；CD137 Chimerical receptor costimulating factor is for stimulating T cell proliferation and cytokine secretion；TCR Chimerical receptor t cell activation domain is used to activate the expression of downstream signaling pathway；When the region scfv and CD30 antigen binding, signal It is transferred into the cell by Chimerical receptor, to generate T cell proliferation, cytokine secretion increases, Anti-apoptotic proteins point Secrete a series of biological effects such as increase, cell death delay, cracking target cell.

In step (4), the slow virus carrier has the version with fluorescence labels zsGreen1 and without fluorescence labels ZsGreen1 version, the version with fluorescence labels are used for experiment in vitro, are used for clinical trial without the version of fluorescence labels.

In step (4), it should be noted that several key points have, a: filter step to control supernatant volume (200ml~ 2000ml) with vacuum degree (- 0.5MPA~-0.9MPA), prevent due to plug-hole bring carrier loss；B: adsorption step needs to control The PH (6~8) of solution processed, prevents the variation of PH from carrier being caused to inactivate；C: elution step needs to control the ionic strength of eluent (0.5M~1.0M) prevents the variation of ionic strength from causing elution not exclusively or carrier inactivation.

In another aspect of this invention, above-mentioned carrier is provided and is preparing the application in adoptive cellular therapeutic agent.It is preferred that , the adoptive cellular therapeutic agent is Hodgkin lymphoma (HL) or non-Hodgkin lymphoma (NHL) therapeutic agent.Through facing Bed verification experimental verification, carrier of the present invention are applied to clinical treatment Hodgkin lymphoma (HL) and non-Hodgkin lymphoma (NHL), are suffering from The fully erased of tumour cell is realized in person's body, therefore carrier of the present invention possesses wide answer in CART therapy field Use prospect.

Compared with prior art, the invention has the following beneficial effects:

The linker for the scFV section that the present invention uses is designed, and is the Linkers pool using Shi Ao company, by albumen The analysis of matter Structure bioinformatics database (https: //www.predictprotein.org/), by protein two The comparison of the protein properties such as level structure, Solvent accessibility, protein flexibility, disulfide bridge, binding site, preferably Out.Detecting test and killing-efficiency test by cell in vitro cytokine secretion proves, can be significant compared with external design Improve the secretion of cell factor, the killing effect in vitro of CAR-T cell.Also, also face than foreign countries in the effect of clinical treatment The effect of bed experiment is good.

Slow virus carrier column purification system of the present invention is the slow virus large-scale production that the applicant develops Technique.Slow virus carrier column purification mode of the present invention is different from the ultracentrifugation or ultracentrifugal generallyd use Mode, common supercentrifugation or supercentrifugal process are to separate lentiviral particle using centrifugal sedimentation principle, unavoidably Meeting remain impurity similar in many sedimentation coefficients, adverse effect is brought to subsequent experimental.Also, tubulature process is complicated, operation Cumbersome, multiple conversions container brings more opportunities for contamination.And slow virus carrier column purification technique of the invention is semi-automation Operation, all processes are completed hundred grades of Experimental Areas, are avoided manually-operated cumbersome and are made mistakes and pollute probability, are recycled Clinical criteria is fully achieved in the indexs such as endotoxin, mycoplasma, titer determination in slow virus carrier.It is subsequent follow up develop it is complete from Dynamic purifying instrument.

Third generation slow virus skeleton plasmid pLenti-3G basic of the present invention, with University of Pennsylvania Carl H.June et al. (Porter DL, Levine BL, Kalos M, Bagg A, June CH.Chimeric antigen receptormodified T cells in chronic lymphoid leukemia.N Engl J Med 2011；365: Third generation slow virus carrier used by 725-33.) is compared, and bacteriophage f1 replication orgin is eliminated, using eukaryotic viral SV40 Replicon increases copy number of the target gene in eukaryocyte, enhances eukaryotic expression effect.

Third generation slow virus skeleton plasmid pLenti-3G basic of the present invention, using enhancedWPRE member Part (i.e. the enhanced marmot hepatitis B posttranscriptional regulatory element of eWPRE), with University of Pennsylvania Carl H.June et al. (Porter DL,Levine BL,Kalos M,Bagg A,June CH.Chimeric antigen receptormodified T cells in chronic lymphoid leukemia.N Engl J Med 2011；Used by 365:725-33.) WPRE element is compared, and has enhancing mutation (g.396G > A, g.397C > T, g.398T > C, g.399G > A, g.400A of 6 nucleotide > T, g.411A > T), the poly-adenosine of primary transcript can be enhanced, increase the content of intracellular mRNA, enhance transgenosis Expression efficiency.

The Lentival packaging system that the present invention uses is four plasmid packaging systems of non-auxiliary virus, passes through four kinds of plasmids Common transfection generates recombined lentivirus vector into HEK293T/17 cell.Slow virus carrier after recombination is replication defect type Exogenous sequences can be integrated into host gene by carrier, disposable, can not be replicated and be proliferated, safety improves a lot.

The slow virus carrier that the present invention uses has the version with fluorescence labels zsGreen1 and without fluorescence labels ZsGreen1 version, the version with fluorescence labels are used for experiment in vitro, are used for clinical trial without the version of fluorescence labels, are applicable in It is in extensive range.

Present invention preferably employs third generation slow virus carrier, 3 ' SIN LTR eliminate the region U3, eliminate slow virus carrier A possibility that self-replacation, substantially increases safety；CPPT and eWPRE element is increased, transduction efficiency is improved and turns base The expression efficiency of cause；The lasting efficient transcription of core RNA when ensure that slow virus carrier packaging using RSV promoter；Using people The EF1 α promoter of itself, enables CAR gene in human body long lasting for expression.

As it can be seen that recombined lentivirus vector of the present invention will give Hodgkin lymphoma (HL) and non-Hodgkin lymphoma (NHL) CAR-T treatment provides reliable transgenosis guarantee.

Detailed description of the invention

Fig. 1 is the schematic diagram of CAR of the present invention, and wherein Figure 1A is the basic block diagram of CAR, and Figure 1B is the generation of CAR Secondary improvement schematic diagram；

Fig. 2 is slow virus carrier structural schematic diagram of the present invention；Wherein Fig. 2A is that the third generation that the present invention uses is slow Viral vectors structural schematic diagram, Fig. 2 B are the second generation and third generation slow virus carrier structure comparison schematic diagram；

Fig. 3 is the building flow chart that recombined lentivirus vector of the present invention is constructed in the embodiment of the present invention 1.Wherein, Fig. 3 (A) is the structural schematic diagram of slow virus skeleton plasmid pLenti-3G basic；Fig. 3 (B) is the knot of pCAR30-CLA plasmid Structure schematic diagram；Fig. 3 (C) is the structural schematic diagram of pCAR30-CLB plasmid；Fig. 3 (D) is the structural representation of pCAR30-OLC plasmid Figure；Fig. 3 (E) is the structural schematic diagram of slow virus packaging plasmid pPac-GP；Fig. 3 (F) is the knot of slow virus packaging plasmid pPac-R Structure schematic diagram；Fig. 3 (G) is the structural schematic diagram of memebrane protein pEnv-G；

Fig. 4 is that the digestion prediction of recombinant slow virus plasmid pCAR30-CLA and digestion agarose are solidifying in the embodiment of the present invention 1 Gel electrophoresis figure；Wherein, Fig. 4 A is the digestion prediction schematic diagram of recombinant slow virus plasmid pCAR30-CLA, wherein lane1 is 1kb DNA ladder Marker: band is from top to bottom successively are as follows: 10kb, 8Kb, 6kb, 5Kb, 4kb, 3.5Kb, 3Kb, 2.5kb, 2Kb, 1.5kb, 1Kb, 750bp, 500bp, 250bp, lane2 be pCAR30-CLA BsrG I digestion prediction: band on to Under successively are as follows: 8466bp, 1298bp；Fig. 4 B is the digestion agarose gel electrophoresis figure of recombinant slow virus plasmid pCAR30-CLA, Wherein, lane1 is the electrophoresis result of 1kb DNA ladder Marker, and lane2 is the BsrG I restriction enzyme digestion and electrophoresis of pCAR30-CLA As a result；

Fig. 5 is that the digestion prediction of recombinant slow virus plasmid pCAR30-CLB and digestion agarose are solidifying in the embodiment of the present invention 1 Gel electrophoresis figure；Wherein, Fig. 5 A is the digestion prediction schematic diagram of recombinant slow virus plasmid pCAR30-CLB, wherein lane1 is 1kb DNA ladder Marker: band is from top to bottom successively are as follows: 10kb, 8Kb, 6kb, 5Kb, 4kb, 3.5Kb, 3Kb, 2.5kb, 2Kb, 1.5kb, 1Kb, 750bp, 500bp, 250bp, lane2 are the Sal I digestion predictions of pCAR30-CLB: band is from top to bottom Successively are as follows: 8487bp, 818bp, 459bp；Fig. 5 B is the digestion agarose gel electrophoresis of recombinant slow virus plasmid pCAR30-CLB Figure, wherein lane1 is the electrophoresis result of 1kb DNA ladder Marker, and lane2 is the Sal I digestion electricity of pCAR30-CLB Swimming result；

Fig. 6 is that the digestion prediction of recombinant slow virus plasmid pCAR30-OLC and digestion agarose are solidifying in the embodiment of the present invention 1 Gel electrophoresis figure；Wherein, Fig. 6 A is the digestion prediction schematic diagram of recombinant slow virus plasmid pCAR30-OLC, wherein lane1 is 1kb DNA ladder Marker: band is from top to bottom successively are as follows: 10kb, 8Kb, 6kb, 5Kb, 4kb, 3.5Kb, 3Kb, 2.5kb, 2Kb, 1.5kb, 1Kb, 750bp, 500bp, 250bp, lane2 are the NcoI digestion predictions of pCAR30-OLC: band is from top to bottom Successively are as follows: 5867bp, 3897bp；Fig. 6 B is the digestion agarose gel electrophoresis figure of recombinant slow virus plasmid pCAR30-OLC, In, lane1 is the electrophoresis result of 1kb DNA ladder Marker, and lane2 is the Nco I restriction enzyme digestion and electrophoresis knot of pCAR30-OLC Fruit；

Fig. 7 is the flow chart of 2 intermediate ion exchange chromatography of embodiment of the present invention purifying recombined lentivirus vector；

Fig. 8 is the titre testing result schematic diagram of the different way of purification of recombined lentivirus vector in the embodiment of the present invention 2；

Fig. 9 is the detection of mycoplasma result signal of the different way of purification of recombined lentivirus vector in the embodiment of the present invention 2 Figure, lane1 are DL2000 marker, and counterband tape is from top to bottom successively from top to bottom are as follows: 2kb, 1kb, 750bp, 500bp, 250bp,100bp；Lane2 is positive control；Lane3 is negative control；Lane4 is PBS；Lane5 is water；Lane6 is cracking Liquid；Lane7 is the slow virus of ultracentrifugation purifying；Lane8 is the slow virus of high speed centrifugation purifying；Lane9 is ion exchange color Compose the slow virus of purifying；Lane10 is ghost；

Figure 10 be the embodiment of the present invention 3 in mRNA relative expression quantity histogram, RT-QPCR the result shows that CAR in PBMC Intracellular efficient transcription；

Figure 11 is that the WB of CAR expressing quantity in the embodiment of the present invention 3 detects figure, the results showed that CAR albumen is thin in PBMC High efficient expression intracellular, in Figure 11 A, lane1 is PBMC ghost, and lane2 is control virus MOCK, lane3 lvCAR30- CLA, lane4 lvCAR30-CLB, lane5 lvCAR30-OLC；Figure 11 B is beta-actin internal reference band；

Figure 12 is the killing-efficiency that LDH detects under the conditions of different effect target ratios in the embodiment of the present invention 3, and E is effector cell, T For target cell；

Figure 13 is that qPCR detects Cytokine Expression Level schematic diagram under the conditions of different effect target ratios, E in the embodiment of the present invention 3 For effector cell, T is target cell；Wherein, Figure 13 A indicates the mRNA transcriptional level of IL-2；Figure 13 B indicates that the mRNA of IFN-γ turns Record is horizontal；

Figure 14 is the dosage and change of illness state situation schematic diagram that CAR30-T cell feeds back patient in the embodiment of the present invention 4； Wherein, Figure 14 A indicates that CAR30-T cell feeds back the dosage of 9 patients respectively；After Figure 14 B indicates that CAR30-T cell is fed back 6 weeks, The situation of change of conditions of patients；

Figure 15 is the titre of the second generation of continuous 3 batches and third generation recombined lentivirus vector in the embodiment of the present invention 5 As a result comparison schematic diagram；

Figure 16 is the killing-efficiency schematic diagram that LDH detects under the conditions of different effect target ratios in the embodiment of the present invention 6, and E is effect Cell, T are target cell.

Specific embodiment

Following embodiment is only illustrative of the invention and is not intended to limit the scope of the invention.It is not specified in embodiment specific The experimental method of condition, usually according to normal condition, or according to the normal condition proposed by manufacturer.

Embodiment 1 constructs recombined lentivirus vector

One, material

1, slow virus skeleton plasmid pLenti-3G basic, slow virus packaging plasmid pPac-GP, pPac-R and film egg White matter grain pEnv-G, HEK293T/17 cell, homologous recombination enzyme by generation take wing (Shanghai) biological medicine Science and Technology Ltd. provide；

2, primer: primer needed for designing amplification of DNA fragments and target site according to design of primers principle, the primer is by Shanghai Biotech firm's synthesis, specifically:

EF1 α-F:5 '-ATTCAAAATTTTATCGATGCTCCGGTGCCCGTCAGT-3 ' (SEQ ID NO.26)

EF1 α-R:5 '-TCACGACACCTGAAATGGAAGA-3 ' (SEQ ID NO.27)

CD8 leader-F:5 '-GGTGTCGTGAGGATCCGCCACCATGGCCTTACCAGTGACCGC-3 ' (SEQ ID NO.28)

CD8 leader-R:5 '-GTGTCATCTGGATGTCCGGCCTGGCGGCGTG-3 ' (SEQ ID NO.29)

VH-F:5 '-CACGCCGCCAGGCCGCAGGTACAGCTGCAGCAGTCA-3 ' (SEQ ID NO.30)

VH-R:5 '-ACTCGAGACGGTGACCGTGGT-3 ' (SEQ ID NO.31)

CLA-VL-F:5 '-GGTCACCGTCTCGAGT GGCGGTGGCTCGGGTGGTGGGTCGGGCGGCGGATCTGGG GGAGGTTCTGACATCGTGATGACCCAGTCT-3’(SEQ ID NO.32)

CLB-VL-F:5 '-GGTCACCGTCTCGAGTGGATCCACCTCCGGATCCGGAAAACCCGGATCCGGAGAAG GATCCACCAAAGGAGACATCGTGATGACCCAGTCT-3’(SEQ ID NO.33)

OLC-VL-F:5 '-GGTCACCGTCTCGAGT GGTGGCGGTGGCTCGGGCGGTGGTGGGTCGGGTGGCGGC GGATCTGACATCGTGATGACCCAGTCT-3’(SEQ ID NO.34)

VL-R:5 '-ACGTTTGATTTCCACCTTGGT-3 ' (SEQ ID NO.35)

CD8 Hinge-F:5 '-GTGGAAATCAAACGTACCACGACGCCAGCGCC-3 ' (SEQ ID NO.36)

CD8 Hinge-R:5 '-GTAGATATCACAGGCGAAGTCCA-3 ' (SEQ ID NO.37)

CD8 Transmembrane-F:5 '-CGCCTGTGATATCTACATCTGGGCGCCCTTGGC-3 ' (SEQ ID NO.38)

CD8 Transmembrane-R:5 '-TCTTTCTGCCCCGTTTGCAGTAAAGGGTGATA ACCAGTG-3 ' (SEQ ID NO.39)

CD137-F:5 '-AAACGGGGCAGAAAGAAACTC-3 ' (SEQ ID NO.40)

CD137-R:5 '-TGCTGAACTTCACTCTCAGTTCACATCCTCCTTCTTCTTC-3 ' (SEQ ID NO.41)

TCR-F:5 '-AGAGTGAAGTTCAGCAGGAGCG-3 ' (SEQ ID NO.42)

TCR-R:5 '-GGAGAGGGGCGTCGACTTAGCGAGGGGGCAGGGC-3 ' (SEQ ID NO.43)

WPRE-QPCR-F:5 '-CCTTTCCGGGACTTTCGCTTT-3 ' (SEQ ID NO.44)

WPRE-QPCR-R:5 '-GCAGAATCCAGGTGGCAACA-3 ' (SEQ ID NO.45)

Actin-QPCR-F:5 '-CATGTACGTTGCTATCCAGGC-3 ' (SEQ ID NO.46)

Actin-QPCR-R:5 '-CTCCTTAATGTCACGCACGAT-3 ' (SEQ ID NO.47)

CAR-QPCR-F:5 '-GACTTGTGGGGTCCTTCTCCT-3 ' (SEQ ID NO.48)

CAR-QPCR-R:5 '-GCAGCTACAGCCATCTTCCTC-3 ' (SEQ ID NO.49)

3、SEQ ID NO.14、SEQ ID NO.15、SEQ ID NO.16、SEQ ID NO.17、SEQ ID NO.18、 SEQ ID NO.19、SEQ ID NO.20、SEQ ID NO.21、SEQ ID NO.22、SEQ ID NO.23、SEQ ID NO.24、SEQ ID NO.25、SEQ ID NO.26、SEQ ID NO.27、SEQ ID NO.28、SEQ ID NO.29、SEQ ID NO.30、SEQ ID NO.31、、SEQ ID NO.32、SEQ ID NO.33、SEQ ID NO.34、SEQ ID NO.35、SEQ ID NO.36、SEQ ID NO.37、SEQ ID NO.38、SEQ ID NO.39、SEQ ID NO.40、SEQ ID NO.41、SEQ ID NO.42、SEQ ID NO.43、SEQ ID NO.44、SEQ ID NO.45、SEQ ID NO.46、SEQ ID NO.47、SEQ DNA sequence dna shown in ID NO.48, SEQ ID NO.49 is synthesized by Shanghai biotech firm, and with oligonucleotides dry powder or plasmid Form saves；

4, toolenzyme BsrG I, Nco I, ApaL I, Sac I, Cla I, Sal I, T4 DNA ligase are purchased from NEB public affairs Department；

5, high fidelity enzyme PrimeSTAR, RN is purchased from Takara company；

6,0.22 μm of -0.8 μm of PES filter is purchased from millipore company；

7, plasmid extraction kit, Ago-Gel QIAquick Gel Extraction Kit are purchased from MN company；

8, competent cell TOP10 is purchased from Tiangen company；

9、NaCl、KCl、Na₂HPO₄.12H₂O、KH₂PO₄、Trypsin、EDTA、CaCl₂, NaOH, PEG6000 be purchased from Hai Shenggong；

10, Opti-MEM, FBS, DMEM, 1640, Hepes, be purchased from invitrogen company；

11, Biotinylated protein L is purchased from GeneScript company；

12, the secondary antibody of horseradish peroxidase-labeled, DAB working solution are purchased from Beijing Zhong Shan Golden Bridge；

13, ECL+plusTM Western blotting system is purchased from Amersham company；

14, DNeasy kit is purchased from Shanghai JaRa company；

15, it is company that lymphocyte separation medium, which reaches section purchased from Shenzhen,；

16, phycoerythrin (PE)-conjugated streptavidin is purchased from BD Bioscience company；

17, SA-HRP is purchased from Shanghai Yi Sheng company；

18, mycoplasma test reagent box, endotoxin detection kit, CD30⁺K562 cell is taken wing (Shanghai) company purchased from generation；

19, LDH detection kit is purchased from promega company.

Two, the construction method of recombined lentivirus vector lvCAR30-CLA, lvCAR30-CLB, lvCAR30-OLC.

Referring to Fig. 3, the construction method of recombined lentivirus vector of the present invention is as follows:

1, by people EF1 α promoter, CD8 leader Chimerical receptor signal peptide, CD30 single-chain antibody light chain VL, Common Linker A, Common Linker B, Optimal Linker C, CD30 single-chain antibody heavy chain VH, CD8 Hinge it is chimeric by Body hinge, CD8 Transmembrane Chimerical receptor transmembrane region, CD137 Chimerical receptor costimulating factor, TCR Chimerical receptor T are thin Born of the same parents' activation domain segment is cloned into slow virus skeleton plasmid pLenti-3G basic, respectively obtains recombinant slow virus plasmid pCAR30- CLA, pCAR30-CLB, pCAR30-OLC.

(1) slow virus skeleton plasmid pLenti-3G basic is carried out using Cla I and Sal I restriction enzyme double Digestion, product pass through 1.5% agarose gel electrophoresis, confirm the segment V1 of 8303bp, and be tapped and recovered and be placed in Eppendorf In pipe, corresponding segment (being shown in Table 1) is recycled with the Ago-Gel QIAquick Gel Extraction Kit of MN company, and measures the purity of product and dense Degree；

1 Ago-Gel recycling step of table

(2) system in table 2, PCR are used using the SEQ ID NO.14 synthesized as template with primer EF1 α-F and EF1 α-R Cycling condition are as follows: 98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 2min) * 35cycle, 72 DEG C of 10min.Product passes through 1.5% agarose gel electrophoresis, confirms the segment a of 1208bp, and is tapped and recovered and is placed in Eppendorf pipe, with MN company Ago-Gel QIAquick Gel Extraction Kit recycle corresponding segment (being shown in Table 1), and measure the purity and concentration of product；

Reagent	Volume (μ l)
		H2O	32.5
5×Bμffer(with Mg2+)	10
		DNTP (each 2.5mM)	4
Primer1(+)(10μM)	1
		Primer2 (-) (10 μM)	1
Template	1
		PrimeSTAR	0.5

2 50 μ l PCR reaction system of table

(3) table 2 is used using the SEQ ID NO.15 synthesized as template with primer CD8 leader-F and CD8 leader-R In system, PCR cycle condition are as follows: 98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C 5min.Product passes through 1.5% agarose gel electrophoresis, confirms the segment b of 101bp, and is tapped and recovered and is placed in Eppendorf pipe It is interior, corresponding segment (being shown in Table 1) is recycled with the Ago-Gel QIAquick Gel Extraction Kit of MN company, and measure the purity of product and dense Degree；

(4) system in table 2, PCR cycle are used using the SEQ ID NO.16 synthesized as template with primer VH-F and VH-R Condition are as follows: 98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product passes through 1.5% agarose gel electrophoresis, confirms the segment c of 336bp, and is tapped and recovered and is placed in Eppendorf pipe, with MN company Ago-Gel QIAquick Gel Extraction Kit recycles corresponding segment (being shown in Table 1), and measures the purity and concentration of product；

(5) system in table 2, PCR are used using the SEQ ID NO.20 synthesized as template with primer CLA-VL-F and VL-R Cycling condition are as follows: 98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product passes through 1.5% agarose gel electrophoresis, confirms the segment d of 424bp, and is tapped and recovered and is placed in Eppendorf pipe, with MN company Ago-Gel QIAquick Gel Extraction Kit recycles corresponding segment (being shown in Table 1), and measures the purity and concentration of product；

(6) system in table 2, PCR are used using the SEQ ID NO.20 synthesized as template with primer CLB-VL-F and VL-R Cycling condition are as follows: 98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product passes through 1.5% agarose gel electrophoresis, confirms the segment e of 430bp, and is tapped and recovered and is placed in Eppendorf pipe, with MN company Ago-Gel QIAquick Gel Extraction Kit recycles corresponding segment (being shown in Table 1), and measures the purity and concentration of product；

(7) system in table 2, PCR are used using the SEQ ID NO.20 synthesized as template with primer OLC-VL-F and VL-R Cycling condition are as follows: 98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product passes through 1.5% agarose gel electrophoresis, confirms the segment f of 421bp, and is tapped and recovered and is placed in Eppendorf pipe, with MN company Ago-Gel QIAquick Gel Extraction Kit recycles corresponding segment (being shown in Table 1), and measures the purity and concentration of product；

(8) with primer CD8 Hinge-F and CD8 Hinge-R using the SEQ ID NO.21 synthesized as template, using in table 2 System, PCR cycle condition are as follows: 98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C 5min.Product passes through 1.5% agarose gel electrophoresis, confirms the segment g of 147bp, and is tapped and recovered and is placed in Eppendorf pipe It is interior, corresponding segment (being shown in Table 1) is recycled with the Ago-Gel QIAquick Gel Extraction Kit of MN company, and measure the purity of product and dense Degree；

(9) the SEQ ID NO.22 with primer CD8 Transmembrane-F and CD8 Transmembrane-R to synthesize For template, the system in table 2, PCR cycle condition are used are as follows: 98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C 30sec) * 35cycle, 72 DEG C of 5min.Product passes through 1.5% agarose gel electrophoresis, confirms the segment h of 100bp, and tap rubber Recycling is placed in Eppendorf pipe, recycles corresponding segment (being shown in Table 1) with the Ago-Gel QIAquick Gel Extraction Kit of MN company, and Measure the purity and concentration of product；

(10) with primer CD137-F and CD137-R using the SEQ ID NO.23 synthesized as template, using the system in table 2, PCR cycle condition are as follows: 98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product By 1.5% agarose gel electrophoresis, the segment i of 142bp is confirmed, and be tapped and recovered and be placed in Eppendorf pipe, with MN public affairs The Ago-Gel QIAquick Gel Extraction Kit of department recycles corresponding segment (being shown in Table 1), and measures the purity and concentration of product；

(11) system in table 2, PCR are used using the SEQ ID NO.24 synthesized as template with primer TCR-F and TCR-R Cycling condition are as follows: 98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product passes through 1.5% agarose gel electrophoresis, confirms the segment j of 355bp, and is tapped and recovered and is placed in Eppendorf pipe, with MN company Ago-Gel QIAquick Gel Extraction Kit recycles corresponding segment (being shown in Table 1), and measures the purity and concentration of product；

(12) Eppendorf is added in addition to primer using the system in table 3 using each 1 μ l of DNA fragmentation b, c, d as template In pipe, PCR cycle condition are as follows: primer is added in 98 DEG C of 3min, (98 DEG C of 10sec, 60 DEG C of 10sec, 72 DEG C of 30sec) * 6cycle CD8 leader-F/VL-R, (98 DEG C of 10sec, 60 DEG C of 10sec, 72 DEG C of 40sec) * 24cycle, 72 DEG C of 5min.Product passes through 1.5% agarose gel electrophoresis, confirms the segment k of 814bp, and is tapped and recovered and is placed in Eppendorf pipe, with MN company Ago-Gel QIAquick Gel Extraction Kit recycles corresponding segment (being shown in Table 1), and measures the purity and concentration of product；

Reagent	Volume (μ l)
		H2O	33.5-1* template number
5×Bμffer(with Mg2+)	10
		DNTP (each 2.5mM)	4
Primer1(+)(10μM)	1
		Primer2 (-) (10 μM)	1
Template	1* template number
		PrimeSTAR	0.5

3 50 μ l over-lap PCR reaction system of table

(13) Eppendorf is added in addition to primer using the system in table 3 using each 1 μ l of DNA fragmentation b, c, e as template In pipe, PCR cycle condition are as follows: primer is added in 98 DEG C of 3min, (98 DEG C of 10sec, 60 DEG C of 10sec, 72 DEG C of 30sec) * 6cycle CD8 leader-F/VL-R, (98 DEG C of 10sec, 60 DEG C of 10sec, 72 DEG C of 40sec) * 24cycle, 72 DEG C of 5min.Product passes through 1.5% agarose gel electrophoresis, confirms the segment l of 820bp, and is tapped and recovered and is placed in Eppendorf pipe, with MN company Ago-Gel QIAquick Gel Extraction Kit recycles corresponding segment (being shown in Table 1), and measures the purity and concentration of product；

(14) Eppendorf is added in addition to primer using the system in table 3 using each 1 μ l of DNA fragmentation b, c, f as template In pipe, PCR cycle condition are as follows: primer is added in 98 DEG C of 3min, (98 DEG C of 10sec, 60 DEG C of 10sec, 72 DEG C of 30sec) * 6cycle CD8 leader-F/VL-R, (98 DEG C of 10sec, 60 DEG C of 10sec, 72 DEG C of 40sec) * 24cycle, 72 DEG C of 5min.Product passes through 1.5% agarose gel electrophoresis, confirms the segment m of 811bp, and is tapped and recovered and is placed in Eppendorf pipe, with MN company Ago-Gel QIAquick Gel Extraction Kit recycles corresponding segment (being shown in Table 1), and measures the purity and concentration of product；

(15) it using each 1 μ l of DNA fragmentation g, h, i, j as template, using the system in table 3, is added in addition to primer In Eppendorf pipe, PCR cycle condition are as follows: 98 DEG C of 3min, (98 DEG C of 10sec, 60 DEG C of 10sec, 72 DEG C of 30sec) * 6cycle, Primer CD8 Hinge-F/TCR-R, (98 DEG C of 10sec, 60 DEG C of 10sec, 72 DEG C of 30sec) * 24cycle, 72 DEG C of 5min is added.It produces Object passes through 1.5% agarose gel electrophoresis, confirms the segment n of 704bp, and be tapped and recovered and be placed in Eppendorf pipe, uses MN The Ago-Gel QIAquick Gel Extraction Kit of company recycles corresponding segment (being shown in Table 1), and measures the purity and concentration of product；

(16) Eppendorf pipe is added with the ratio of 5 μ l total volumes and molar ratio 1:1:1:1 in DNA fragmentation V1, a, k, n It is interior, 15 μ l of homologous recombination enzyme reaction solution is added, is incubated for 30 minutes after mixing at 42 DEG C, is transferred to and places 2-3 minutes on ice, it will be anti- It answers liquid to be added in 50 μ l TOP10, gently rotates to mix content, placed 30 minutes in ice, pipe is put into pre-heating to 42 DEG C thermostat water bath in heat shock 90 seconds, quickly pipe is transferred in ice bath, makes cell cooling 2-3 minutes, every pipe adds 900 μ l Then pipe is transferred on 37 DEG C of shaking tables by LB culture solution, incubating 1 hour makes bacteria resuscitation, and the transformed bacteria solution of 100 μ l is taken to be coated on On Amp LB agar plate, it is inverted plate, 37 DEG C of cultures in constant incubator, 16 hours.Picked clones carry out bacterium colony PCR mirror It is fixed, it identifies that correctly clone is recombinant slow virus plasmid pCAR30-CLA, digestion identification is carried out (see figure to correct clone 4)；

(17) Eppendorf pipe is added with the ratio of 5 μ l total volumes and molar ratio 1:1:1:1 in DNA fragmentation V1, a, l, n It is interior, 15 μ l of homologous recombination enzyme reaction solution is added, is incubated for 30 minutes after mixing at 42 DEG C, is transferred to and places 2-3 minutes on ice, it will be anti- It answers liquid to be added in 50 μ l TOP10, gently rotates to mix content, placed 30 minutes in ice, pipe is put into pre-heating to 42 DEG C thermostat water bath in heat shock 90 seconds, quickly pipe is transferred in ice bath, makes cell cooling 2-3 minutes, every pipe adds 900 μ l Then pipe is transferred on 37 DEG C of shaking tables by LB culture solution, incubating 1 hour makes bacteria resuscitation, and the transformed bacteria solution of 100 μ l is taken to be coated on On Amp LB agar plate, it is inverted plate, 37 DEG C of cultures in constant incubator, 16 hours.Picked clones carry out bacterium colony PCR mirror It is fixed, it identifies that correctly clone is recombinant slow virus plasmid pCAR30-CLB, digestion identification is carried out (see figure to correct clone 5)；

(18) Eppendorf pipe is added with the ratio of 5 μ l total volumes and molar ratio 1:1:1:1 in DNA fragmentation V1, a, m, n It is interior, 15 μ l of homologous recombination enzyme reaction solution is added, is incubated for 30 minutes after mixing at 42 DEG C, is transferred to and places 2-3 minutes on ice, it will be anti- It answers liquid to be added in 50 μ l TOP10, gently rotates to mix content, placed 30 minutes in ice, pipe is put into pre-heating to 42 DEG C thermostat water bath in heat shock 90 seconds, quickly pipe is transferred in ice bath, makes cell cooling 2-3 minutes, every pipe adds 900 μ l Then pipe is transferred on 37 DEG C of shaking tables by LB culture solution, incubating 1 hour makes bacteria resuscitation, and the transformed bacteria solution of 100 μ l is taken to be coated on On Amp LB agar plate, it is inverted plate, 37 DEG C of cultures in constant incubator, 16 hours.Picked clones carry out bacterium colony PCR mirror It is fixed, it identifies that correctly clone is recombinant slow virus plasmid pCAR30-OLC, digestion identification is carried out (see figure to correct clone 6)。

2, the packaging of recombined lentivirus vector lvCAR30-CLA, lvCAR30-CLB, lvCAR30-OLC.

(1) complete medium: taking out preheated fresh culture, and 10%FBS+5ml Pen-Srep is added, runs up and down Mix；

(2) NaCl 8g, KCl 0.2, Na 1XPBS solution: are weighed₂HPO₄.12H₂O 3.58g, KH₂PO4 0.24g is placed in In 1000ml beaker, the dissolution of 900ml Milli-Q grade ultrapure water is added, after the completion of dissolution, uses 1000ml graduated cylinder constant volume To 1000ml, 121 DEG C of high-temperature heat sterilization 20min；

(3) 0.25%Trypsin solution: weighing Trypsin 2.5g, and EDTA 0.19729g is placed in 1000ml beaker, 900ml 1XPBS dissolution is added, after the completion of dissolution, is settled to 1000ml using 1000ml graduated cylinder, 0.22 μM of filtration sterilization, for a long time Using can be reserved for -20 DEG C of refrigerators；

(4) 0.5M CaCl2 solution: 36.75g CaCl is weighed₂It is dissolved with 400ml Milli-Q grade ultrapure water；With Total volume is settled to 500ml by Milli-Q grade ultrapure water, is mixed；0.22 μm of filtration sterilization, packing are saved in 50ml centrifugation Guan Zhong, every pipe 45ml or so, 4 DEG C of preservations.

(5) 4.09g NaCl, 0.269g Na 2XHBS solution: are weighed₂HPO4,5.96g Hepes, with 400ml Milli- The dissolution of Q grade ultrapure water；After calibrating pH instrument, the pH of HBS solution is transferred to 7.05 with 2M NaOH solution.Adjust every bottle of HBS's It is 3ml or so that PH, which consumes 2M NaOH,；

(6) the HEK293T/17 cell frozen is taken out from liquid nitrogen container, is quickly transferred in 37 DEG C of water-baths, after 1~2min It is transferred in super-clean bench, the liquid in cryopreservation tube is fully transferred to 10cm by sterile working²In culture dish, supply containing 10%FBS DMEM to 8mL/10cm²Dish, rear micro- sem observation cell, the degree of cell confluency are greater than 80% and are passed on for 24 hours；

(7) selection cell state is good, free of contamination HEK293T/17 cell, and every 2-6 culture dish is one group, by cell After pancreatin digestion, 4-12ml complete medium is drawn with electric pipettor, 2ml is added into each postdigestive culture dish, is avoided Culture dish dries out；All cells are blown and beaten into single cell suspension using 1ml pipettor, are transferred in medium bottle；

(8) remaining cell in above-mentioned 2-6 culture dish is transferred in medium bottle, and rinsed again with culture medium once Culture dish；

(9) culture medium bottle cap is covered tightly, turns upside down 10 times or so and mixes well cell suspension, cell is passed to 8-24 10cm²In culture dish, the cell density of every ware should about 4 × 10⁶A/10ml complete medium or so.If cell density and pre- The difference of phase is larger, then needs to count cell, then according to 4 × 10⁶The amount of a/ware is inoculated with；

(10) every 6 culture dishes arrange piles up for one, pays attention to keeping the cooperation between ware up and down.By culture dish or so, front and back It shakes for several times, spreads out cell sufficiently, be then placed in 5%CO₂Incubator.Remaining cell does same processing；

(11) checking that institute's passage cell, cell confluency degree should be 70-80%, profile is full, and it is adherent good, it is trained in cell It supports and is uniformly distributed in ware；

(12) liquid is changed for cell, culture medium is replaced with into fresh complete medium, every ware 9ml, and by the CO of incubator₂It is dense Degree setting value is increased to 8%；

(13) match DNA/CaCl according to N+0.5₂Solution.Every ware HEK293T/17 cell transfecting plasmid amount is according to following ratio It uses: recombinant slow virus plasmid (20 μ g), pPac-GP (15 μ g), pPac-R (10 μ g), pEnv-G (7.5 μ g).Take one it is new 0.5M CaCl2:0.25ml, 20 μ g:pPac-GP of recombinant slow virus plasmid, 15 μ g:pPac-R, 10 μ g is added in 5ml centrifuge tube: 7.5 μ g of pEnv-G, supplement ultrapure water close the lid to 0.5ml, mix well；

(14) a 5ml centrifuge tube is separately taken, 0.5ml DNA/CaCl2 solution is added.Turbula shaker is opened, a hand is taken The firmly upper end of 5ml centrifuge tube makes tube bottom contact oscillating end, and liquid is made to scatter on tube wall flowing, and another hand moves 1mL by one Liquid rifle is drawn 2 × HBS of 0.5mL solution, is slowly added dropwise into centrifuge tube, coutroi velocity, being dripped off with half a minute is advisable.2×HBS It after addition, after persistent oscillation 5 seconds, stops oscillation, can be directly added into the cell for needing to transfect；

(15) take a ware cell, the 1mL calcium in centrifuge tube turned into drop and is added, make as far as possible calcium turn reagent be distributed to it is whole In a culture dish；

(16) it after calcium turns liquid addition, is marked in ware lid, culture dish is released to another 5%CO₂In incubator. Ensure that culture dish is horizontal positioned, every pile culture dish does not exceed 6.In 5%CO₂(6-8h) is placed in incubator；

(17) by the CO of first incubator₂Concentration set point adjusts back to 5%；

After (18) 24 hours, cell state is checked.Cell confluency degree should be 80-85% or so, in good condition.It will culture Base siphons away, replacement 10ml fresh DMEM complete medium；

After (19) 48 hours, transfection efficiency is observed.Most cells are still adherent.It can be seen that thin more than 95% Born of the same parents can have green fluorescence.By the same virus packaging supernatant collection to together, and continue addition 10mL into culture dish Fresh culture；

After (20) 72 hours, the same vial supernatant is collected into the virus together, collected twice again to be placed on Together, culture dish is abandoned；Contained in the supernatant collected at this time recombined lentivirus vector lvCAR30-CLA, lvCAR30-CLB, lvCAR30-OLC。

The concentration and detection of 2 recombined lentivirus vector of embodiment

One, supercentrifugation purifies recombined lentivirus vector；

(1) supernatant of collection is dispensed into 50ml centrifuge tube, 500g room temperature is centrifuged 10min, removes cell and big Fragment；

(2) with 0.22 μm of -0.8 μm of filter filtering supernatant；

(3) 6 Hitachi 40PA ultracentrifugation pipes are taken, 70% ethanol disinfection is sprayed on surface, is placed on super-clean bench with ultraviolet Light irradiation is sterilized 30 minutes.High-temperature heat sterilization can also be passed through；

(4) the cell conditioned medium sample packing 32ml handled step 2 well is into centrifuge tube；

(5) metal cover is covered, by centrifuge tube together with metal cover trim, makes deviation of weight in 0.02g with 1XPBS adjustment In range；

(6) centrifuge tube of trim is symmetrically placed in ultracentrifugation rotor P50AT2.Centrifugal rotational speed 100,000g is set, 4 DEG C are centrifuged 2 hours；

(7) after being centrifuged, carefully centrifuge tube is taken out from rotor, it can be seen that have a small group heavy at centrifuge tube bottom It forms sediment, is made marks on outer tube wall with Marker, outwell supernatant.Centrifuge tube is tipped upside down on the paper handkerchief completed in advance, remnants are made Liquid pours off.The drop hung on wall can be siphoned away with liquid-transfering gun；

(8) Opti-MEM of 200 μ l is added into each centrifuge tube, dissolves precipitating with the piping and druming of 200 μ l pipettors, as far as possible Reduce the generation of foam；

(9) ultracentrifugation pipe is inserted into 50ml centrifuge tube, closes the lid, is put into 4 DEG C of refrigerator overnights；

(10) 500g, room temperature are centrifuged 1min, virus liquid are made to focus on tube bottom；

(11) all identical viral concentration liquid are brought together, are filtered with 0.22 μm -0.8 μm of PES filter；It will be sick Poison is divided into 25 to 50 μ l mono- pipe, freezes -80 DEG C of refrigerators, carries out long-term preservation；

Two, supercentrifugal process purifies recombined lentivirus vector；

(1) the supernatant 204ml of collection is filtered using 0.22 μm -0.8 μm of PES filter；

(2) 6000 solution of PEG of 51ml 50% is added；

(3) 21.7ml 4M NaCl solution is added；

(4) be added 23.3ml PBS solution, at this moment overall solution volume be 300ml.PEG 6000 final concentration 8.5%, NaCl final concentration 0.3M；

(5) solution is dispensed into 250ml wide-mouth bottle, every part of 150ml；

(6) 4 DEG C are placed 1.5 hours, and every 20-30 minutes mixes once；

(7) 4 DEG C, 7000g centrifugation 10min；

(8) it can see that tube bottom has white precipitate after being centrifuged；

(9) liquid is carefully discarded supernatant, it is heavy acutely to rock resuspension for every bottle of addition 1.2ml 50mM Tris-HCl (pH 7.4) It forms sediment；

(10) it is vortexed concussion 20-30 seconds and precipitating is further resuspended；

(11) virus is divided into 25 to 50 μ l mono- to manage, freezes -80 DEG C of refrigerators, carry out long-term preservation；

Three, ion exchange chromatography recombined lentivirus vector (as shown in Figure 7)；

(1) supernatant of collection is used into Thermo vacuum pump, is filtered through 0.22 μm -0.8 μm of PES filter, remove impurity elimination Matter；

(2) 1.5M NaCl 250mM Tris-HCl (pH 6-8) is added into supernatant in the ratio of 1:1~1:10；

(3) 2 ion exchange columns are placed in series, with 4ml 1M NaOH, 4ml 1M NaCl, 5ml 0.15M NaCl 25mM Tris-HCl (pH 6-8) solution successively crosses column；

(4) solution obtained in step 2 is given to ion exchange column loading with the speed of 1-10ml/min by peristaltic pump；

(5) it after whole supernatants cross column, is cleaned using 10ml 0.15M NaCl 25mM Tris-HCl (pH 6-8) solution One time；

(6) it is eluted according to applied sample amount using 1-5ml 1.5M NaCl 25mM Tris-HCl (pH 6-8), collection is washed De- liquid；

(7) eluent is divided into 25 to 50 μ l mono- to manage, freezes -80 DEG C of refrigerators, carry out long-term preservation.

Four, titer determination and compare；

(1) 24 orifice plates is taken to be inoculated with 293T cell.Every hole cell is 5 × 10⁴A, added culture volume is 500ul, different Difference, cell confluency when carrying out virus infection are 40%-60% to the vitro growth rates of type；

(2) prepare 3 sterile EP tubes, the fresh complete medium (DMEM in high glucose+10% of 90ul is added in each pipe FBS) after inoculating cell 24 hours, the cell in two holes is taken to be counted with blood counting chamber, the actual number of cell when determining infection, It is denoted as N；

(3) it takes virus stock solution used 10ul to be determined to be added in first pipe, after mixing gently, 10ul is taken to be added to second In a pipe, a to the last pipe is then successively operated；410ul complete medium (DMEM in high glucose+10% is added in every pipe ), FBS final volume 500ul；

(4) 20 hours after infection starts, culture supernatant is removed, 500 μ l complete medium (DMEM in high glucose+10% are changed to FBS), 5%CO₂Continue culture 48 hours；

After (5) 72 hours, luciferase expression situation is observed, under normal circumstances, fluorecyte number increases and phase with extension rate It should reduce, and take pictures；

(6) 0.25% pancreas enzyme -EDTA solution digestion cell of 0.2ml is used, is placed 1 minute at 37 DEG C.It is purged with culture medium whole A cell face, is collected by centrifugation cell.Illustrate extracting genomic DNA according to DNeasy kit.200 are added in each sample cell μ l eluent is washed lower DNA and is quantified；

(7) preparing target DNA detection qPCRmix general pipeline I, (QPCR primer sequence is SEQ ID NO.44---SEQ ID NO.45):

N=number of reactions. is for example: overall reaction number is 40, by 2 × TaqMan of 1ml Universal PCR Master Mix, 4 μ l forward primer, 4 μ l reverse primer, 4 μ l probe and 788 μ l H₂O is mixed With.It is placed on ice after concussion；

(8) preparing internal reference DNA detection qPCRmix pipe II, (QPCR primer sequence is SEQ ID NO.46---SEQ ID NO.47):

2×TaqMan Master Mix 25μl×n

10×RNaseP primer/probe mix 2.5μl×n

H₂O 17.5μl×n

N=number of reactions. is for example: overall reaction number is 40, by 2 × TaqMan of 1ml Universal PCR Master Mix, 100 μ l 10 × RNaseP primer/probe mix and 700 μ l H₂O is mixed.Ice is placed on after concussion On；

(9) PCR system is completed in 96 hole PCR plates of pre-cooling to establish.45 μ l are respectively taken to be added to each row of A-D from general pipeline I Hole in, from respectively taking 45 μ l to be added in the hole of each row of E-G in general pipeline II.

(10) 5 μ l plasmid standards and sample to be tested genomic DNA are taken to be added in A-D row respectively, each sample repeats 1 It is secondary.Separately stay 1 hole that the water of 5 μ l is added as no template control (no-template control).

(11) 5 μ l genome standard items and sample to be tested genomic DNA are taken to be added in E-G row respectively, each sample weight It is 1 time multiple.Separately stay 1 hole that the water of 5 μ l is added as no template control (no-template control).

(12) used quantitative PCR apparatus is 7000 quantitative system of ABI PRISM.Cycling condition setting are as follows: 50 DEG C 2 minutes, 95 DEG C 10 minutes, followed by 95 DEG C 15 seconds, 60 DEG C of 40 of 1 minute circulations.

Data analysis: the slow virus carrier copy number integrated in the DNA sample measured is demarcated with genome number, is obtained The viral copy number of every genome conformity.

Titre (integration units per ml, IU ml^-1) calculation formula it is as follows:

IU ml^-1=(C × N × D × 1000)/V

Wherein: C=is averaged the viral copy number of every genome conformity

The number (about 1 × 10 of cell when N=infects⁵)

The extension rate of D=viral vectors

The volume number for the dilution virus that V=is added

(13) titre results of recombined lentivirus vector lvCAR30-CLA, lvCAR30-CLB, lvCAR30-OLC such as Fig. 8 Shown, the result of ion-exchange chromatography is substantially better than supercentrifugation and supercentrifugal process.

Five, endotoxin measurement and compare；

(1), endotoxin working standard is 15EU/ branch；

(2), sensitivity of the limulus reagent λ=0.25EU/ml, 0.5ml/ pipe

(3), endotoxin standard dilutes: taking endotoxin standard one, is diluted to 4 λ and 2 λ in proportion with BET water respectively Dissolution, sealed membrane sealing, concussion dissolution 15min；One step of every dilution should all mix 30s on eddy mixer when dilution；

(4), it is loaded: taking reagents several, every addition BET water 0.5ml dissolution, packing to several endotoxin-frees tries Guan Zhong, every pipe 0.1ml.

Wherein 2 are negative control pipe, and BET water 0.1ml is added；

2 are positive control pipe, and the endotoxin working standard solution 0.1ml of 2 λ concentration is added；

2 be Sample Positive control tube, be added 0.1ml containing 2 λ endotoxin standards sample solution (dilution 20 times to The endotoxin standard solution 1ml=2ml of sample 1ml+4 λ contains 40 times of samples of dilution of 2 λ endotoxin standards).

Be added 0.1ml sample in sample cell, dilution ratio be shown in Table 4,37 ± 1 DEG C of water-baths (or incubator) heat preservation 60 ± 1min；

4 endotoxin dilution ratio of table and corresponding endotoxin content

(5), the endotoxin testing result of recombined lentivirus vector lvCAR30-CLA, lvCAR30-CLB, lvCAR30-OLC (as shown in table 5), between 20~40EU/ml, the endotoxin content of supercentrifugal process exists the endotoxin content of supercentrifugation Between 20~40EU/ml, the endotoxin content of ion-exchange chromatography be substantially better than between 1.25~2.5EU/ml hypervelocity from Heart method and supercentrifugal process.

The endotoxin testing result of the different way of purification of 5 recombined lentivirus vector of table

Six, mycoplasma measures and compares；

(1) first three day is being tested, cell sample is cultivated with antibiotic-free culture medium；

(2) (cell number is greater than 1*10 to collection 1ml cell suspending liquid⁵), it is placed in 1.5ml centrifuge tube；

(3) 13000 × g are centrifuged 1min, collect precipitating, discard culture medium；

(4) 500ul PBS pipette tips pressure-vaccum or vortex oscillation is added, precipitating is resuspended.13000 × g is centrifuged 5min；

(5) step 4 is repeated once；

(6) 50 μ l Cell Lysis Buffer are added after mixing well, to be incubated in 55 DEG C of water-baths with pipette tips pressure-vaccum 20min；

(7) sample is placed in 95 DEG C and heats 5min；

After (8) 13000 × g are centrifuged 5min, take 5 μ l supernatants as template, 25 μ lPCR reaction systems are as follows: 6.5 μ of ddH20 L, 1 μ l of Myco Mix, 2x Taq Plus Mix Master (Dye Plus) 12.5 μ l, 5 μ l of template；PCR cycle condition are as follows: 95 DEG C of 30sec, (95 DEG C of 30sec, 56 DEG C of 30sec, 72 DEG C of 30sec) * 30cycle, 72 DEG C of 5min.

(9) detection of mycoplasma as the result is shown (as shown in Figure 9), supercentrifugation, supercentrifugal process, ion-exchange chromatography The recombined lentivirus vector of purifying is free of mycoplasma.

As it can be seen that the present invention uses ion exchange chromatography recombined lentivirus vector, with traditional supercentrifugal process and Supercentrifugation purifying recombined lentivirus vector is compared, and titer determination result and endotoxin measurement result are significantly superior.

The Function detection of embodiment 3 recombined lentivirus vector lvCAR30-CLA, lvCAR30-CLB, lvCAR30-OLC.

One, the cellular level detection of expression of CAR gene:

(1) it after recombined lentivirus vector lvCAR30-CLA, lvCAR30-CLB, lvCAR30-OLC infection of PBMCs cell, receives Collect the detection that cell carries out CAR mRNA transcriptional level using RT-PCR, verify the expression of CAR gene, if CAR mRNA is transcribed Level increases, then illustrates that the transcriptional level of CAR gene is expressed successfully；

(2) it after recombined lentivirus vector lvCAR30-CLA, lvCAR30-CLB, lvCAR30-OLC infection of PBMCs cell, receives Collect the detection that cell carries out CAR protein expression level using western blot, the expression of CAR gene is verified, if CAR albumen Expression increases, then illustrates that the translation skill of CAR gene is expressed successfully；

(3) respectively by lvCAR30-CLA, lvCAR30-CLB, lvCAR30-OLC of MOI=15 and control virus MOCK sense Cell is contaminated, the total serum IgE of cell and total protein in 6 orifice plates are extracted after 48h and carries out fluorescent quantitative PCR experiment and immunoblotting reality respectively It tests.Specific steps: being coated with four holes of 6 orifice plates, and corresponding PBS and RN is added in each hole, and 4 DEG C overnight.MOI=is pressed after 12 hours 15 coating viruses, 37 DEG C of incubators place 5h；The 6 orifice plates of taking-up, discard viral supernatants, are washed twice with PBS, by 1*10⁶/ hole, It is coated with PBMC (being separated from people's blood with lymphocyte separation medium), 500ul culture medium is added and (contains 10% serum, 20U/ml IL- 2,Polybrene 8ug/ml).Stand 20min, 1000g 20 DEG C of centrifugations 30min, 37 DEG C of culture 48h.

(4) Trizol method extracts the total serum IgE of PBMC cell in 6 orifice plates, reverse transcription amplification cDNA, with QPCR primer (sequence Fluorescent quantitative PCR experiment is carried out for SEQ ID NO.46---SEQ ID NO.49), reaction system is shown in Table 6, is with internal reference Actin Control group verifies the transcription situation of its mRNA.

Reagent	Volume (μ l)
		SYBR premix ex taq:	10μl
ROX Reverse Dye(50x)	0.4μl
		Upstream primer (2.5 μM):	0.5μl
Downstream primer (2.5 μM):	0.5μl
		cDNA	1.0μl
ddH2O	7.6μl

6 20 μ l qPCR reaction system of table

(5) protein immunoblot (Western Blot) is total by what is extracted from PBMC by polyacrylamide gel electrophoresis Protein is separated by relative molecular mass.It, will be on protein delivery to pvdf membrane using wet turn (4 DEG C, 400mA, 120min).With envelope It closes the closing of liquid (the TBST solution containing 5% skim milk) room temperature pvdf membrane 1h, confining liquid 1:1000 and dilutes Biotinylated Then protein L is incubated at room temperature 4 DEG C overnight with the pvdf membrane closed.TBST washes film 3 times, each 10min.Confining liquid 1: The 500 corresponding SA-HRP of dilution, are incubated for pvdf membrane 2h, TBST washes film 3 times, each 10min at room temperature.Using Amersham company ECL+plusTM Western blotting system kit develops the color.X-ray development obtains the film of display band.

(6) RT-QPCR detection shows that the expression of the CAR after recombined lentivirus vector infection of PBMCs is than control virus MOCK and ghost are increased significantly (as shown in Figure 10), illustrate that the transcriptional level of CAR gene is expressed successfully.

(7) protein immunoblot (Western Blot) the result shows that, CAR albumen is expressed in recombinant slow virus system (as shown in figure 11) illustrates that the translation skill of CAR gene is expressed successfully.

Two, cytokine secretion and fragmentation effect assessment.

(1) cultivate respectively CD30+K562 cell and effector cell lvCAR30-CLA-PBMC, lvCAR30-CLB-PBMC, lvCAR30-OLC-PBMC；

(2) target cell (CD30+K562) 4x10 is collected⁵Cells and effector cell (CART cell) 2.8x10⁶Cells, 800g, 6min centrifugation, abandon supernatant；

(3) target cell and effector cell are resuspended respectively with 1ml 1xPBS solution, supernatant is abandoned in 800g, 6min centrifugation；

(4) it is primary to repeat step 3；

(5) effector cell is resuspended with 700ul culture medium (1640 culture medium+10%FBS), with (1640 cultures of 2ml culture medium Base+10%FBS) target cell is resuspended；

(6) setting effect target is than the experimental port for 1:1,5:1,10:1, and control group is arranged, every group of 3 multiple holes；

(7) centrifugation of 250xg, 5min plate；

It is cultivated 4 hours in (8) 37 DEG C of 5%CO2 incubators；

(9) centrifugation of 250xg, 5min plate；

(10) take the 50ul supernatant in each hole into new 96 orifice plate, and every hole is added 50ul substrate solution and (is protected from light behaviour Make)；

(11) it is protected from light incubation 25 minutes；

(12) 50ul terminate liquid is added in every hole；

(13) microplate reader detects 490nm absorbance；

(14) 3 multiple holes are averaged；The light absorption value of all experimental ports, Target cell wells and effector cell hole is subtracted into training Support the mean value of base background light absorption value；The light absorption value of target cell maximum value is subtracted to the mean value of volume correction control light absorption value.

(15) it brings the corrected value obtained in step 14 into following formula, it is thinner than generated to calculate each effect target Cellular toxicity percentage.As a result as shown in figure 12, the PBMC cell of recombined lentivirus vector lvCAR30-OLC transduction is in different effect targets Killing-efficiency is apparently higher than the PBMC cell of lvCAR30-CLA and lvCAR30-CLB transduction than under the conditions of；

Killing-efficiency=(experimental port-effector cell hole-Target cell wells)/(target cell largest hole-Target cell wells) X100%

(16) sample for repeating to prepare a step 6 detects Cytokine Expression Level for qPCR, as a result such as Figure 13 institute Show, the PBMC cell of recombined lentivirus vector lvCAR30-OLC transduction IL-2 and IFN-γ under the conditions of different effect target ratios MRNA transcriptional level is apparently higher than the PBMC cell of lvCAR30-CLA and lvCAR30-CLB transduction.

Embodiment 4, the clinic of recombined lentivirus vector lvCAR30-OLC (version of removal fluorescence labels zsGreen1) are answered With

(Carlos A.Ramos, et al.Chimeric T-Cells for Therapy of according to the literature CD30+Hodgkin and Non-Hodgkin Lymphomas(HL&NHL).Biology of Blood and MarrowTransplantation, 2016,22 (3): S145-S146.), CAR30 carrier pin to Hodgkin lymphoma (HL) and Non-Hodgkin lymphoma (NHL) has good effect.

This research is #NCT01316146 in the number of registration of www.clinicaltrials.gov.Expression is used in this research The T lymphocyte of CAR30 gene has well in patient's body for Hodgkin lymphoma (HL) and non-Hodgkin lymphoma (NHL) Inhibitory effect.One, which shares 9 patients, receives CAR30-T lymphocyte feedback, wherein it is DL1 (2* that 2 patients, which feed back dosage, 10⁷CD30.CAR+T cells/m2), it is DL2 (1*10 that 2 patients, which feed back dosage,⁸CD30.CAR+T cells/m2), 5 trouble It is DL3 (2*10 that person, which feeds back dosage,⁸CD30.CAR+T cells/m2) (as shown in Figure 14 A)；CAR30-T lymphocyte, which is fed back, suffers from After person 6 weeks, there is 1 patient's complete incidence graph, 1 patient has good part to alleviate, 4 patient experiences stable diseases, 3 conditions of patients Deteriorate (as shown in Figure 14B)；Adoptive CAR30-T cell therapy is being directed to Hodgkin lymphoma (HL) and non-Hodgkin lymphoma (NHL) possess good prospect in terms for the treatment of.

5 third generation slow virus skeleton carrier 3rdLV-CAR30 of embodiment and second generation slow virus skeleton carrier 2ndLV- CAR30 titre compares.

3rdLV-CAR30 and 2ndLV-CAR30 is constructed respectively；Plasmid construction, virus are packed, viral ultracentrifugation is concentrated, Titration procedure reference implementation example 1；The titre results of continuous 3 batches are as shown in figure 15, third generation slow virus skeleton carrier The titre of 3rdLV-CAR30 is better than second generation slow virus skeleton carrier 2ndLV-CAR30；Therefore, present invention preferably uses Carrying skeleton of the three generations slow virus skeleton carrier as CAR gene.

6 second generation CAR slow virus carrier 3rdLV-2ndCAR30 of embodiment and third generation CAR slow virus carrier 3rdLV- 3rd CAR30 killing-efficiency compares.

3rdLV-2ndCAR30 and 3rdLV-3rdCAR30 is constructed respectively；Plasmid construction, virus packaging, viral ultracentrifugation Concentration, titration procedure reference implementation example 1；Killing experiments reference implementation example 3；Second generation CAR slow virus carrier 3rdLV- 2ndCAR30 as shown in figure 16,3rdLV- compared with third generation CAR slow virus carrier 3rdLV-3rd CAR30 killing-efficiency result The ratio 3rdLV-2ndCAR30 that 3rd CAR30 is not showed under the conditions of different effect target ratios for the killing-efficiency of target cell is higher Effect；Therefore, present invention preferably uses the slow virus carriers of second generation CAR design as clinical trial carrier.

Claims (10)

1. a kind of CAR-T transgene carrier for the replication defective recombinant slow virus for targeting CD30 characterized by comprising such as It is used for the prokaryotic replions pUC Ori sequence of plasmid replication shown in SEQ ID NO.2, is used for as shown in SEQ ID NO.1 The sequence of AmpR containing ampicillin resistance gene of purpose bacterial strain massive amplification is true for enhancing as shown in SEQ ID NO.3 The Viral Replicon SV40 Ori sequence of duplication in nucleus, the slow virus for slow virus packaging pack cis element, such as The IRES ribosome binding sequence of common transcriptional expression protein is used for shown in SEQ ID NO.12, such as SEQ ID NO.14 institute People's EF1 α promoter of the eukaryotic transcription for Chimeric antigen receptor gene shown, for enhancing as shown in SEQ ID NO.13 The enhanced marmot hepatitis B posttranscriptional regulatory element of the eWPRE of the expression efficiency of transgenosis, and collect for composition and identify, Transmitting starts in the Chimeric antigen receptor of the two generation CAR or three generations CAR of one；

It is described for form the Chimeric antigen receptor for the two generation CAR for integrating identification, transmitting, starting to include: such as SEQ ID CD8 leader Chimerical receptor signal peptide shown in NO.15, the CD30 single-chain antibody light chain VL as shown in SEQ ID NO.20, such as Optimal Linker C shown in SEQ ID NO.19, the CD30 single-chain antibody heavy chain VH as shown in SEQ ID NO.16, such as CD8 Hinge Chimerical receptor hinge, the CD8 Transmembrane as shown in SEQ ID NO.22 shown in SEQ ID NO.21 Chimerical receptor transmembrane region, CD28, the CD137 Chimerical receptor costimulating factor as shown in SEQ ID NO.23 and such as SEQ ID TCR Chimerical receptor t cell activation domain shown in NO.24；

It is described for form the Chimeric antigen receptor for the three generations CAR for integrating identification, transmitting, starting to include: such as SEQ ID CD8 leader Chimerical receptor signal peptide shown in NO.15, the CD30 single-chain antibody light chain VL as shown in SEQ ID NO.20, such as Optimal Linker C shown in SEQ ID NO.19, the CD30 single-chain antibody heavy chain VH as shown in SEQ ID NO.16, such as CD8 Hinge Chimerical receptor hinge, the CD8 Transmembrane as shown in SEQ ID NO.22 shown in SEQ ID NO.21 Chimerical receptor transmembrane region, CD28, CD137 Chimerical receptor costimulating factor, such as SEQ ID as shown in SEQ ID NO.23 TCR Chimerical receptor t cell activation domain shown in NO.24 and the CD28 Chimerical receptor costimulation as shown in SEQ ID NO.25 The factor.

2. carrier as described in claim 1, which is characterized in that the slow virus packaging cis element includes: such as SEQ ID 5 terminal LTR of slow virus, the 3 terminal Self- of slow virus as shown in SEQ ID NO.6 shown in NO.5 Inactivating LTR, the Gag cis element as shown in SEQ ID NO.7, the cis- member of RRE as shown in SEQ ID NO.8 Part, the env cis element as shown in SEQ ID NO.9 and the cPPT cis element as shown in SEQ ID NO.10.

3. carrier as described in claim 1, which is characterized in that the slow virus packaging cis element includes: such as SEQ ID 5 terminal LTR of slow virus, the 3 terminal Self- of slow virus as shown in SEQ ID NO.6 shown in NO.5 Inactivating LTR, the Gag cis element as shown in SEQ ID NO.7, the cis- member of RRE as shown in SEQ ID NO.8 Part, the env cis element as shown in SEQ ID NO.9, the cPPT cis element as shown in SEQ ID NO.10, and such as SEQ RSV promoter shown in ID NO.4.

4. carrier as described in claim 1, which is characterized in that further include: eukaryocyte is used for as shown in SEQ ID NO.11 Express the ZsGreen1 green fluorescent protein of green fluorescence.

5. a kind of CAR-T transgene carrier of the replication defective recombinant slow virus of targeting CD30 as described in claim 1 Construction method, which comprises the following steps:

(1) the ampicillin resistance gene AmpR sequence as shown in SEQ ID NO.1 will be contained, as shown in SEQ ID NO.2 Prokaryotic replions pUC Ori sequence, is used for slow virus packet at the Viral Replicon SV40 Ori sequence as shown in SEQ ID NO.3 The slow virus of dress packs cis element, the IRES ribosome binding sequence as shown in SEQ ID NO.12, such as SEQ ID NO.13 Shown in the enhanced marmot hepatitis B posttranscriptional regulatory element of eWPRE be stored on slow virus skeleton plasmid；

(2) the people EF1 α promoter as shown in SEQ ID NO.14, and integrate identification, transmitting, starting for forming The Chimeric antigen receptor of two generation CAR or three generations CAR is combined into two generation CAR or three generations CAR, by digestion, connection, recombining reaction gram It is grand into slow virus skeleton plasmid, obtain two generation CAR or three generations CAR design recombinant slow virus plasmid；

(3) by obtained recombinant slow virus plasmid and slow virus packaging plasmid pPac-GP, pPac-R and memebrane protein plasmid PEnv-G transfects HEK293T/17 cell jointly, after carrying out gene transcript expression in HEK293T/17 cell, packs and successfully weighs Group slow virus carrier can be discharged into cells and supernatant, collect the supernatant for the recombined lentivirus vector for including；

(4) obtained recombinant slow virus supernatant is purified using the ion-exchange method for filtering, adsorbing, eluting, respectively To recombined lentivirus vector.

6. method as claimed in claim 5, which is characterized in that in step (1), the slow virus packaging cis element includes: 5 terminal LTR of slow virus, 3 terminal of slow virus as shown in SEQ ID NO.6 as shown in SEQ ID NO.5 Self-Inactivating LTR, the Gag cis element as shown in SEQ ID NO.7, as RRE shown in SEQ ID NO.8 it is suitable Formula element, the env cis element as shown in SEQ ID NO.9 and the cPPT cis element as shown in SEQ ID NO.10；Or The slow virus packaging cis element includes: slow virus 5 terminal LTR, such as SEQ ID as shown in SEQ ID NO.5 3 terminal Self-Inactivating LTR of slow virus, the cis- member of Gag as shown in SEQ ID NO.7 shown in NO.6 Part, the RRE cis element as shown in SEQ ID NO.8, the env cis element as shown in SEQ ID NO.9, such as SEQ ID CPPT cis element shown in NO.10, and the RSV promoter as shown in SEQ ID NO.4.

7. method as claimed in claim 5, which is characterized in that in step (2), start entire CAR base by people's EF1 α promoter Because of expression；CD8 leader Chimerical receptor signal peptide is located at the N-terminal of CAR coded sequence, for guiding CAR albumen to be positioned at cell Film；CD30 single-chain antibody light chain VL, Optimal Linker C, CD30 single-chain antibody heavy chain VH are combined into the region scfv, are used for Identify CD30 antigen；CD8 Hinge Chimerical receptor hinge is used to for scfv being anchored on the outside of cell membrane；CD8 Transmembrane Chimerical receptor transmembrane region is used to entire Chimerical receptor being fixed on cell membrane；CD137 Chimerical receptor pierces altogether The factor is swashed for stimulating T cell proliferation and cytokine secretion；The Chimerical receptor t cell activation domain TCR is for activating downstream signal The expression of access；When the region scfv and CD30 antigen binding, signal is transferred into the cell by Chimerical receptor, to generate packet T cell is included to be proliferated, cytokine secretion increase, Anti-apoptotic proteins secretion increase, cell death delay, crack target cell A series of biological effects.

8. method as claimed in claim 5, which is characterized in that in step (4), the slow virus carrier has band fluorescence labels The version of zsGreen1 and without fluorescence labels zsGreen1 version, the version with fluorescence labels is used for experiment in vitro, without glimmering The version of optical label is used for clinical trial；The version with fluorescence labels zsGreen1 is used as shown in SEQ ID NO.11 ZsGreen1 green fluorescent protein.

9. method as claimed in claim 5, which is characterized in that in step (4), the suction filtration step will control supernatant volume and exist 200ml ~ 2000ml controls vacuum degree in -0.5MPA ~ -0.9MPA, prevents due to plug-hole bring carrier loss；The absorption Step will control the pH value of solution 6 ~ 8, prevent the variation of PH from carrier being caused to inactivate；The elution step will control eluent Ionic strength prevents the variation of ionic strength from causing elution not exclusively or carrier inactivation in 0.5M ~ 1.0M.

10. carrier according to any one of claims 1-4 is preparing Hodgkin lymphoma or non-Hodgkin lymphoma medicine Application in object.