WO2018223601A1

WO2018223601A1 - Anti-psca and anti-pdl1 dual targeting chimeric antigen receptor based on octs-car, encoding gene and expression vector

Info

Publication number: WO2018223601A1
Application number: PCT/CN2017/110676
Authority: WO
Inventors: 祁伟; 俞磊; 康立清; 林高武; 余宙
Original assignee: 上海优卡迪生物医药科技有限公司
Priority date: 2017-06-06
Filing date: 2017-11-13
Publication date: 2018-12-13
Also published as: CN107325185B; CN107325185A

Abstract

Provided in the present invention are an anti-PSCA and anti-PDL1 dual targeting chimeric antigen receptor based on the OCTS-CAR, an encoding gene, an OCTS-CAR-T recombinant expression vector and a construction method and use thereof. The anti-PSCA and anti-PDL1 dual targeting chimeric antigen receptor comprises a CD8 leader membrane receptor signal peptide, a dual antigen binding region, a CD8 Hinge chimeric receptor hinge, a CD8 Transmembrane chimeric receptor transmembrane region, a CD28 chimeric receptor costimulatory factor, an OX40 chimeric receptor costimulatory factor and a TCR chimeric receptor T-cell activation domain sequentially connected in series, wherein the dual antigen binding region comprises a heavy chain VH and a light chain VL of the PSCA and PDL1 single chain antibodies connected in series or in a turn connection manner, the hinge Inner-Linker within the antibody, and the hinge Inter-Linker between the single chain antibodies. In addition, also provided are the gene encoding the anti-PSCA and anti-PDL1 dual targeting chimeric antigen receptor, the recombinant expression vector and the construction method and use thereof.

Description

Anti-PSCA and PDL1 dual-targeting chimeric antigen receptor, coding gene and expression vector based on OCTS-CAR

Technical field

The invention belongs to the technical field of tumor immunotherapy, and particularly relates to an anti-PSCA and PDL1 dual-targeting chimeric antigen receptor, a coding gene, a recombinant expression vector and a construction method thereof, and an OCTS-CAR-based immunotherapy for malignant tumors. application.

Background technique

The rationale for tumor immunotherapy is that the immune system has the ability to recognize tumor-associated antigens and regulate the body's attack on tumor cells (eg, highly specific cell lysis). In the 1950s, Burnet and Thomas proposed the theory of "immuno-monitoring", which believed that the mutant tumor cells that often appear in the body can be cleared by the immune system and lay a theoretical foundation for tumor immunotherapy [Burnet FM.Immunological aspects of malignant disease.Lancet, 1967; 1:171-4]. Subsequently, various tumor immunotherapy including cytokine therapy, monoclonal antibody therapy, adoptive immunotherapy, vaccine therapy, and the like are successively applied to the clinic.

In 2013, a more advanced tumor immunotherapy---CAR-T therapy was successfully used in clinical practice and showed unprecedented clinical efficacy. CAR-T, the full name is Chimeric Antigen Receptor T-Cell Immunotherapy, chimeric antigen receptor T cell immunotherapy. The therapy is a method of transgenic introduction of a chimeric molecule composed of a promoter, an antigen recognition region, a costimulatory factor, and an effector region into a T cell genome, thereby enabling T cell recognition and signal transduction of target cells. The killing and other functions are integrated to achieve specific killing of target cells [Eleanor J. Cheadle, et al. CAR T cells: driving the road from the laboratory to the clinic. Immunological Reviews 2014. Vol. 257: 91–106 ]. CAR-T therapy is the most clinically advanced Novartis CLT019. CLT019 is used to treat patients with relapsed and refractory acute lymphoblastic leukemia. The progression-free survival rate of tumors is 67% for six months, and the longest response time is more than two years. . Shanghai Youkadi Biomedical Technology Co., Ltd., headquartered in Shanghai, China, cooperated with the hospital. As of February 2017, 36 patients with relapsed and refractory acute lymphoblastic leukemia were treated, including 24 patients, with a remission rate of 66.6%. Therefore, CAR-T cell therapy is a disruptive breakthrough in anti-cancer research, and may be one of the most likely means of curing cancer, and was ranked first in the 2013 Top Ten Technology Breakthrough by Science magazine.

CAR-T is currently effective in treating several types of hematological tumors such as B-lymphocytic leukemia, but there are some limitations. For example, a chimeric antigen receptor can only recognize one antigen target, but the tumor cell is a tumor cell. In complex populations, tumor cells containing the corresponding antigen are cleared, and tumor cells that do not contain the corresponding antigen rapidly proliferate, causing tumor recurrence after a period of time.

In order for CAR-T recognition to recognize both antigens simultaneously, two options are available: one is to construct two sets of chimeric antigen receptors into a lentiviral transgenic vector and transduce the two sets of chimeric antigen receptors at one time. Enter the primary T lymphocytes; the second is to use two lentiviral transgenic vectors to transduce twice, and the two sets of chimeric antigen receptors are transduced into primary T lymphocytes.

The disadvantage of protocol 1 is that it takes up the valuable capacity of the lentiviral transgenic vector, which is not conducive to loading other functional elements; the transgenic vector has low packaging efficiency; the gene transduction efficiency is very low, and it is difficult to transduce into the primary T lymphocytes.

The shortcomings of protocol 2 require two transductions. The combined efficiency of the two transductions is low, the transduction cycle time is long, and the primary cells are prone to aging, leading to a decline in proliferative capacity, a decrease in killing function, and an effect on tumor clearance.

The study found that PSCA (prostate stem cell antigen) is an abbreviation for prostate stem cell antigen, which is a glycosylphosphatidylinositol-anchored cell surface glycoprotein. It is expressed in normal tissues such as human prostate, bladder, placenta, large intestine, kidney, stomach, etc. [Norihisa Saeki, Jian Gu, Teruhiko Yoshida, Xifeng Wu. Prostate stem cell antigen (PSCA): a Jekyll and Hyde molecule? Clin Cancer Res. 2010 Jul 15; 16(14): 3533–3538.]. In some bladder cancer, pancreatic cancer, prostate cancer, and gastric cancer, there are many non-synonymous mutations in the initiation codon of this antigen gene, which may be related to tumorigenesis.

PD-L1 is overexpressed in most cancer tissues, including NSCLC, melanoma, breast cancer, glioma, lymphoma, leukemia and various urological tumors, digestive tract tumors, germline tumors, etc. [Intlekofer AM, Thompson CB. At the bench: preclinical rationale for CTLA-4and PD-1blockade as cancer immunotherapy[J].J Leukoc Biol, 2013, 94(1): 25-39.]. Parsa found IFN-γ secreted by T cells in mouse and human tumor cells. IFN-γ can induce high expression of PD-L1 on tumor cells [Ding H, Wu X, Wu J, et al. Delivering PD- 1inhibitory signal concomitant with blocking ICOS co-stimulation suppresses lupus-like syndrome in autoimmune BXSB mice [J]. Clin Immunol, 2006, 118(2/3): 258-267.]. High expression of PD-L1 can inhibit the expression of cell cycle checkpoint proteins and cell proliferation-related proteins by inhibiting RAS and PI3K/AKT signaling pathways, ultimately leading to inhibition of T cell proliferation [11]. Dong et al. and in vitro models also found that activation of PD-1/PD-L1 signaling pathway can induce specific CTL apoptosis, which reduces the sensitivity of CTL cytotoxicity and promotes immune escape of tumor cells [Dong H , Strome SE, Salomao DR, et al. Tumor-associated B7-H1 promotes T-cell apoptosis: a potential mechanism of immune evasion [J]. Nat Med, 2002, 8(8): 793-800.].

Summary of the invention

The present invention has been made based on the above findings, and aims to provide an OCTS-CAR-based anti-PSCA and PDL1 dual-targeting chimeric antigen for malignant tumors, particularly bladder cancer, pancreatic cancer, prostate cancer, and gastric cancer immunotherapy. Receptor, coding gene, OCTS-CAR recombinant expression vector and its construction method and application.

The full name of OCTS is One CAR with Two ScFvs. By connecting OCTS (Series OCTS) or OCTS (Turn OCTS) in tandem, the two scFvs are integrated into one chimeric molecule (shown in Figure 1) to confer T lymphocytes. The HLA-independent way of recognizing the ability of two tumor antigens allows for the identification of a broader range of targets compared to traditional CAR-T cells, further expanding the range of tumor cell clearance.

The basic design of OCTS includes two tumor-associated antigen (TAA) binding regions (usually derived from the scFv segment of the monoclonal antibody antigen binding region), an extracellular hinge region, a transmembrane region, and two cells. Internal signal transduction zone and an effect element zone. The scFv region is a key determinant of the specificity, effectiveness, and safety of genomic T cells themselves.

The OCTS-CAR-T technology used in the present invention enables the chimeric antigen receptor to recognize PSCA and PDL1 by optimizing the chimeric antigen receptor (CAR) structure on the basis of current CAR-T cell therapy. The two antigens greatly expand the recognition range of CAR-T cells, and the removal of tumor populations is more thorough and the effect is more durable.

In a first aspect of the invention, there is provided an anti-PSCA and PDL1 dual targeting chimeric antigen receptor comprising a CD8leader membrane receptor signal peptide, a double antigen binding region, a CD8 Hinge chimeric receptor hinge, a CD8 Transmembrane chimeric receptor transmembrane region, CD28 chimeric receptor costimulatory factor, OX40 chimeric receptor costimulatory factor, and TCR chimeric receptor T cell activation domain. Among them, the double antigen-binding region includes PSCA linked in tandem or turn-angle, and heavy chain VH and light chain VL of PDL1 single-chain antibody, inner-linker inner-linker and single-chain antibody inter-linker.

In a second aspect of the invention, there is provided a gene encoding the above-mentioned OCTS-CAR-based anti-PSCA and PDL1 dual-targeting chimeric antigen receptor, and the sequence number of the gene encoding each of the above parts is as follows: CD8 leader membrane receptor signal Peptide (SEQ ID NO. 15), PSCA single chain antibody light chain VL (SEQ ID NO. 16), PSCA single chain antibody heavy chain VH (SEQ ID NO. 17), PDL1 single chain antibody light chain VL (SEQ ID NO) .18), PDL1 single-chain antibody heavy chain VH (SEQ ID NO. 19), antibody internal hinge Inner-Linker (SEQ ID NO. 20), single-chain antibody inter-linker Inter-Linker (SEQ ID NO. 21), CD8 Hinge chimeric receptor hinge (SEQ ID NO. 22), CD8 Transmembrane chimeric receptor transmembrane region (SEQ ID NO. 23), CD28 chimeric receptor costimulatory factor (SEQ ID NO. 24), OX40 chimeric Receptor costimulatory factor (SEQ ID NO. 25), TCR chimeric receptor T cell activation domain (SEQ ID NO. 26).

In a third aspect of the invention, the OCTS-CAR-based recombinant expression vector encoding the anti-PSCA and PDL1 dual-targeting chimeric antigen receptor gene is provided, and has such technical features, further comprising: an expression vector and human EF1α promoter child. Wherein, the gene sequence of the human EF1α promoter is as shown in SEQ ID NO. 14, and the expression vector is a lentivirus expression vector, a retrovirus expression vector, an adenovirus expression vector, an adenovirus-associated virus expression vector or a plasmid.

Further, the present invention provides another recombinant expression vector, which further comprises a gene encoding a PDL1 single-chain antibody, and the gene sequence thereof is shown in SEQ ID NO.

The expression vector backbone used in the present invention is a third generation lentiviral vector (shown in Figure 2A), and the 3' SIN LTR removes the U3 region. Domain, eliminating the possibility of lentiviral vector self-replication, greatly improving safety; increasing cPPT and WPRE elements, improving transduction efficiency and transgene expression efficiency; using RSV promoter to ensure core RNA in lentiviral vector packaging Continuous and efficient transcription; using human's own EF1α promoter, the CAR gene can be expressed continuously in human body for a long time.

The lentiviral expression vector includes an ampicillin resistance gene AmpR sequence, a prokaryotic replicon pUC Ori sequence, a viral replicon SV40Ori sequence, an RSV promoter, a lentivirus 5 terminal LTR, a lentivirus 3 terminal Self-Inactivating LTR, a Gag cis element, RRE cis element, env cis element, cPPT cis element, ZsGreen1 green fluorescent protein, IRES ribosome binding sequence, eWPRE enhanced woodchuck hepatitis B virus post-transcriptional regulatory element.

The present invention relates to a human EF1α promoter, a CD8 leader chimeric receptor signal peptide, a PSCA single chain antibody light chain VL, a PSCA single chain antibody heavy chain VH, a PDL1 single chain antibody light chain VL, a PDL1 single chain antibody heavy chain VH, Antibody internal hinge Inner-Linker, single-chain antibody inter-Linker, CD8 Hinge chimeric receptor hinge, CD8 Transmembrane chimeric receptor transmembrane region, CD28 chimeric receptor co-stimulatory factor, OX40 chimeric receptor co-stimulation The gene, the TCR chimeric receptor T cell activation domain, and the PDL1 single chain antibody expression gene were constructed into a recombinant lentiviral vector, and the entire OCTS structural gene expression was initiated by the human EF1α promoter.

The CD8 leader chimeric receptor signal peptide is located at the N-terminus of the OCTS protein and is used to direct OCTS protein localization to the cell membrane; PSCA single-chain antibody light chain VL, PSCA single-chain antibody heavy chain VH, PDL1 single-chain antibody light chain VL, PDL1 single The chain antibody heavy chain VH, the antibody inner hinge Inner-Linker, the single-chain antibody inter-linker Inter-Linker combine to form a double antigen recognition region for recognizing the corresponding target antigen; the CD8 Hinge chimeric receptor hinge is used to anchor the scFv to the cell membrane Outer; CD8 Transmembrane chimeric receptor transmembrane region is used to immobilize the entire chimeric receptor on the cell membrane; CD28 chimeric receptor costimulatory factor is used to stimulate T lymphocyte activation in vitro and tumor cell killing in vivo; OX40 chimerism Receptor costimulatory factor is used to promote T lymphocyte proliferation and factor secretion, enhance tumor immunity, and facilitate long-term survival of memory T cells; TCR chimeric receptor T cell activation domain is used to activate expression of downstream signaling pathway; PDL1 single The chain antibody can effectively block PDL1 and block the immunoregulatory signaling pathway. It can be used clinically to inhibit tumor immune escape and improve the therapeutic effect of CAR-T cell immunotherapy.

When the antigen recognition region binds to the target antigen, the signal is transmitted to the cell through the chimeric receptor, thereby producing a series of T cell proliferation, increased cytokine secretion, increased secretion of anti-apoptotic protein, delayed cell death, and lysis of target cells. Biological effects.

In the present invention, in the present invention, PSCA single-chain antibody light chain VL, PSCA single-chain antibody heavy chain VH, PDL1 single-chain antibody light chain VL, PDL1 single-chain antibody heavy chain VH, PDL1 single-chain antibody, and the indicated core Nucleoside sequence >=80% homology (preferably, >=90% homology; etc. preferably, >=95% homology; most preferably, >=97% homology;) nucleoside Acid sequence.

In the present invention, in the present invention, PSCA single-chain antibody light chain VL, PSCA single-chain antibody heavy chain VH, PDL1 single-chain antibody light chain VL, PDL1 single-chain antibody heavy chain VH, PDL1 single-chain antibody, and the indicated core Amino acid sequence corresponding to the amino acid sequence >=80% homology (preferably, >=90% homology; etc. preferably, >=95% homology; most preferably, >=97% homology) ;) The amino acid sequence.

In the present invention, in the present invention, the PSCA single-chain antibody light chain VL, the PSCA single-chain antibody heavy chain VH, the PDL1 single-chain antibody light chain VL, the PDL1 single-chain antibody heavy chain VH, and the PDL1 single-chain antibody are all humanized. It can effectively reduce the production of human anti-mouse antibodies (HAMA) and prolong the half-life and effect of scFv.

The transgenic vector used in the present invention is a recombinant replication-deficient lentiviral vector, which can integrate the exogenous fragment into the host gene, can be used at one time, cannot be replicated and propagated, and is safe and reliable.

The costimulatory factor region in the OCTS chimeric receptor of the present invention may be tumor necrosis factor supersynthesis such as 4-1BB, ICOS, CD27, OX40, CD28, MYD88, IL1R1, CD70, TNFRSF19L, TNFRSF27, TNFRSF1OD, TNFRSF13B, TNFRSF18, and the like. A combination of one, two, three, several, and dozens of tumor necrosis factor receptor superfamily (TNFRSF).

The replication-defective lentiviral transgenic vector used in the present invention may be a second or third generation lentiviral transgenic vector.

In a fourth aspect of the invention, a method for constructing an OCTS-CAR recombinant expression vector is provided, comprising the steps of:

A. Ampicillin-resistant gene AmpR sequence (SEQ ID NO. 1), prokaryotic replicon pUC Ori sequence (SEQ ID NO. 2), viral replicon SV40Ori sequence (SEQ ID NO. 3), RSV promoter ( SEQ ID NO. 4), lentiviral 5terminal LTR (SEQ ID NO. 5), lentivirus 3 terminal Self-Inactivating LTR (SEQ ID NO. 6), Gag cis-element (SEQ) ID NO. 7), RRE cis element (SEQ ID NO. 8), env cis element (SEQ ID NO. 9), cPPT cis element (SEQ ID NO. 10), ZsGreen1 green fluorescent protein (SEQ ID NO) .11), IRES ribosomal binding sequence (SEQ ID NO. 12), eWPRE-enhanced woodchuck hepatitis B virus post-transcriptional regulatory element (SEQ ID NO. 13) was stored on the third generation lentiviral backbone plasmid pLenti-3G basic The method has been developed and constructed by the company and disclosed in "2016---------------

B. will encode CD8 leader membrane receptor signal peptide, PSCA single chain antibody light chain VL, PSCA single chain antibody heavy chain VH, PDL1 single chain antibody light chain VL, PDL1 single chain antibody heavy chain VH, antibody inner hinge Inner-Linker Single-chain antibody inter-linker Inter-Linker, CD8 Hinge chimeric receptor hinge, CD8 Transmembrane chimeric receptor transmembrane region, CD28 chimeric receptor costimulatory factor, OX40 chimeric receptor costimulatory factor, and TCR chimeric receptor The gene of the T cell activation domain was cloned into the lentiviral backbone plasmid pLenti-3G basic by restriction enzyme digestion, ligation and recombination to obtain the third generation OCTS-designed recombinant lentiviral plasmid: pOCTS-PDL1PSCAs, pOCTS-PDL1PSCAt, element sequence And the number is shown in Figure 4. In the name, the last letter "s" represents two segments of scFv connected in series, and the letter "t" represents two segments of scFv corner connections.

C. The recombinant lentiviral plasmid obtained in step B was co-transfected into HEK293T/17 cells with lentiviral packaging plasmids pPac-GP, pPac-R and membrane protein granule pEnv-G, and gene transcription was performed in HEK293T/17 cells. After expression, the packaged recombinant recombinant lentiviral vector is released into the cell culture supernatant, and the supernatant of the recombinant lentiviral vector contained is collected;

D. The obtained recombinant lentiviral supernatant was purified by column filtration, adsorption and elution, and the CAR-T recombinant lentiviral expression vector (named lvOCTS-PDL1PSCAs, lvOCTS-PDL1PSCAt) was obtained.

In addition, in step B, the gene encoding the PDL1 single-chain antibody can be cloned, ligated, and recombined with other genes into the lentiviral backbone plasmid pLenti-3G basic to obtain a third generation OCTS-based recombination. Lentiviral plasmid.

According to a fifth aspect of the present invention, there is provided an OCTS-CAR-T cell which is a recombinant expression vector into which OCTS-CAR is introduced into the genome or a double-targeted chimeric antigen receptor which is anti-PSCA and PDL1. Modified T lymphocytes.

The OCTS-CAR-T cells used in the present invention can be used in human clinical experiments after being produced by a GMP-level workshop.

In a sixth aspect of the invention, there is provided the use of OCTS-CAR-T cells for the preparation of a medicament for the treatment of malignant tumors.

Further, the malignant tumor therapeutic agent is a medicament for treating bladder cancer, pancreatic cancer, prostate cancer or gastric cancer.

The beneficial effects of the invention are:

The invention adopts OCTS technology to optimize the chimeric antigen receptor (CAR) structure on the basis of the current conventional CAR-T cell therapy, so that the chimeric antigen receptor can recognize both PSCA and PDL1 antigens. It has expanded the recognition range of CAR-T cells, and the removal of tumor populations is more thorough and more effective. On the other hand, it avoids the batch culture of CAR-T cells, which greatly saves costs and avoids multiple return of different targeted CARs. T cells save the patient's economic expenditure, reduce the chance of recurrence, and indirectly improve the quality of life of patients.

Integration of two scFvs into a chimeric molecule by tandem OCTS (Series OCTS) or OCTS (Turn OCTS), confers HLA-independent ability to recognize two tumor antigens in a TLA-dependent manner, compared to traditional CAR-T cells are able to recognize a wider range of targets and further expand the range of tumor cell clearance. As OCTS-CAR-T is about to enter the clinical research phase, CAR-T cell therapy is about to enter the 2.0 era.

The PSCA single-chain antibody light chain VL, the PSCA single-chain antibody heavy chain VH, the PDL1 single-chain antibody light chain VL, the PDL1 single-chain antibody heavy chain VH, and the PDL1 single-chain antibody are all humanized and can be effectively modified. Reduce the production of human anti-mouse antibodies (HAMA) in vivo, prolong the half-life and effect of scFv, and increase the survival time of OCTS-CAR-T cells.

One or several combinations of co-stimulatory factors used in the present invention can increase the proliferation rate, survival time, killing efficiency, immune memory and the like of the cells after transduction.

Therefore, the OCTS-CAR-T cells of the present invention will provide a reliable guarantee for the treatment of tumor cells.

DRAWINGS

Figure 1 is a schematic representation of the OCTS-CAR-based anti-PSCA and PDL1 dual-targeting chimeric antigen receptor (OCTS) of the present invention. Figure (A) is a schematic diagram of a series OCTS (Series OCTS), and (B) is a schematic diagram of a corner OCTS (Turn OCTS).

2 is a schematic diagram showing the structure of a lentiviral vector of the present invention; wherein (A) is a schematic diagram showing the structure of a third generation lentiviral vector used in the present invention, and (B) is a schematic diagram showing a comparison of the structures of the second generation and third generation lentiviral vectors.

Figure 3 is a flow chart showing the construction of the recombinant lentiviral vector of the present invention; wherein (A) is a schematic diagram of the structure of the lentiviral backbone plasmid pLenti-3G basic; (B) is a schematic diagram of two OCTS plasmids; (C) is a diagram Schematic diagram of the lentiviral packaging plasmid pPac-GP plasmid; (D) is a schematic diagram of the structure of the lentiviral packaging plasmid pPac-R; (E) is a schematic diagram of the structure of the membrane protein granule pEnv-G.

Figure 4 is a schematic diagram showing the sequence of elements of the CAR dual-targeting chimeric antigen receptor (OCTS), wherein (A) is a schematic diagram of the structure of a series OCTS (Series OCTS), and (B) is a schematic diagram of the structure of a corner OCTS (Turn OCTS). .

Figure 5 is a restriction diagram of the recombinant lentiviral plasmids pOCTS-PDL1PSCAs, pOCTS-PDL1PSCAt, and an enzyme-cut agarose gel electrophoresis pattern.

Among them, A is the enzyme digestion prediction map of recombinant lentiviral plasmid pOCTS-PDL1PSCAs and the enzyme digestion agarose gel electrophoresis map: lane1 is the restriction map of 1kb DNA ladder Marker, the bands are from top to bottom: 10kb, 8kb , 6kb, 5kb, 4kb, 3.5kb, 3kb, 2.5kb, 2kb, 1.5kb, 1kb, 750bp, 500bp, 250bp; lane2 is the Pvu I restriction of pOCTS-PDL1PSCAs, and the bands are from top to bottom: 11978bp , 883 bp, 248 bp; lane3 is a 1 kb DNA ladder Marker digestion agarose gel electrophoresis map; lane 4 is a Pvu I digestion agarose gel electrophoresis map of pOCTS-PDL1PSCAs.

B is the restriction endonuclease map of the recombinant lentiviral plasmid pOCTS-PDL1PSCAt and the enzyme-cut agarose gel electrophoresis map: lane1 is the restriction map of the 1 kb DNA ladder Marker, and the bands are from top to bottom: 10 kb, 8 kb, 6 kb. 5kb, 4kb, 3.5kb, 3kb, 2.5kb, 2kb, 1.5kb, 1kb, 750bp, 500bp, 250bp; lane2 is the Sac I restriction of pOCTS-PDL1PSCAt, and the bands are: 6798bp and 3443bp from top to bottom. 1756 bp, 193 bp; lane3 is a 1 kb DNA ladder Marker digestion agarose gel electrophoresis map; lane 4 is a Sac I digestion agarose gel electrophoresis map of pOCTS-PDL1PSCAt.

Figure 6 is a graph showing the results of titer detection of recombinant lentiviral vectors.

Figure 7 is a schematic flow diagram of the OCTS-CAR-T cell construction of the present invention, including the stages of isolation culture, activation, gene transduction, and OCTS-CAR-T cell identification.

Figure 8 shows the results of mycoplasma detection in OCTS-CAR-T cells. Lane1 is DL2000marker, and the bands from top to bottom are from top to bottom: 2kb, 1kb, 750bp, 500bp, 250bp, 100bp; lane2 is a positive control; Lane3 is a negative control; lane4 is PBS; lane5 is lysate; lane6 is OCTS-PDL1PSCAs-CAR-T cells; lane7 is OCTS-PDL1PSCAt-CAR-T cells.

Figure 9 is a flow cytometry analysis of the transduction efficiency of OCTS-CAR-T cells and the results of immunophenotyping. Panel A shows the results of transduction efficiency of OCTS-PDL1PSCAs-CAR-T cells; Panel B shows the results of immunophenotyping of OCTS-PDL1PSCAs-CAR-T cells; Panel C shows the results of transduction efficiency of OCTS-PDL1PSCAt-CAR-T cells Figure D shows the immunophenotyping results of OCTS-PDL1PSCAt-CAR-T cells;

Figure 10 is a bar graph showing the killing efficiency of target cells by OCTS-PDL1PSCAs-CAR-T cells and OCTS-PDL1PSCAt-CAR-T cells under different potency ratio conditions.

detailed description

The following examples are merely illustrative of the invention and are not intended to limit the scope of the invention. The experimental methods in the examples which do not specify the specific conditions are usually carried out according to conventional conditions or according to the conditions recommended by the manufacturer.

The experimental materials used in the examples are as follows:

(1) Lentiviral backbone plasmid pLenti-3G basic, lentiviral packaging plasmid pPac-GP, pPac-R and membrane protein granule pEnv-G, HEK293T/17 cells, homologous recombinase, Oligo Annealing Buffer, Mycoplasma detection kit, Endotoxin test kit, BCMA+K562, CD319+K562, CD38+K562, PDL1+K562, CD123+K562, BCMA+CD123+K562, BCMA+CD319+K562, BCMA+CD38+K562, BCMA+PDL1+K562, K562 cells were purchased from Shiyi (Shanghai) Biomedical Technology Co., Ltd.;

(2) Fresh peripheral blood is provided by healthy donors;

(3) The combination of OCTS-PDL1PSCAs and OCTS-PDL1PSCAtDNA DNA sequences was designed by itself (see Table 1), and submitted to Shanghai Jierui Bioengineering Co., Ltd. for synthesis and storage in the form of oligonucleotide dry powder or plasmid;

Table 1 Lentiviral recombinant plasmid design

(4) Tool enzymes Cla I, EcoR I, Pvu I, Sac I, T4 DNA ligase were purchased from NEB;

(5) 0.22 μm-0.8 μm PES filter was purchased from Millipore; D-PBS (-), 0.4% trypan blue, sieve, various types of cell culture dishes, culture bags, and culture plates were purchased from Corning;

(6) Opti-MEM, Pen-Srep, Hepes, FBS, AIM-V, RPMI 1640, DMEM, lipofectamine 3000 were purchased from Invitrogen; Biotinylated protein L was purchased from GeneScript; LDH assay kit was purchased from Promega; Ficoll lymph The cell separation solution was purchased from GE; 20% human albumin injection was purchased from Jeter Bellin; CryoPremium cryopreservation solution and sorting buffer were self-configured; rIL-2, rIL-7, rIL-15, rIL -21 purchased from peprotech; CD3 monoclonal antibody, CD28 monoclonal antibody, CD3/CD28 magnetic beads CD4/CD8 magnetic beads were purchased from Miltenyi, Germany;

(7) The refrigerated centrifuge was purchased from Thermo Scientific, USA; the FACS flow cytometer was purchased from Thermo Corporation; the fluorescent inverted microscope was purchased from Olympus.

(8) CD4-FITC, CD8-APC were purchased from BioLegend; 0.9% saline was purchased from Jinmai; ProteinL Magnetic Beads was purchased from BioVision; PrimeSTAR and RetroNectin were purchased from Takara; phycoerythrin (PE)-conjugated streptavidin was purchased from BD Bioscience; plasmid extraction kit, agarose gel recovery kit were purchased from MN company; competent cells TOP10 were purchased from tiangen; NaCl, KCl, Na ₂ HPO ₄ .12H ₂ O, KH ₂ PO ₄ , Trypsin, EDTA, CaCl ₂ , NaOH, and PEG 6000 were purchased from Shanghai Biotech.

(9) DNeasy kit was purchased from Shanghai Jierui Company; SA-HRP was purchased from Shanghai Yusheng Company;

(10) Primers: Primers designed to amplify DNA fragments and target sites according to primer design principles. The primers were synthesized by Shanghai Biotech Co., Ltd., specifically:

EF1α-F: 5'-ATTCAAAATTTTATCGATGCTCCGGTGCCCGTCAGT-3' (SEQ ID NO. 28)

EF1α-R: 5'-TCACGACACCTGAAATGGAAGA-3' (SEQ ID NO. 29)

OCTS-F: CATTTCAGGTGTCGTGAGGATCCGCCACCATGGCGCTGCCGGTGAC (SEQ ID NO. 30)

OCTS-R: GGGGAGGGAGAGGGGCTTAGCGCGGCGGCAGCG (SEQ ID NO. 31)

IRES-F: GCCCCTCTCCCTCCCCC (SEQ ID NO. 32)

IRES-R: ATTATCATCGTGTTTTTCAAAGGAA (SEQ ID NO. 33)

PDL1scab-F: AAAACACGATGATAATGCCACCATGAACTCCTTCTCCACAAGCG (SEQ ID NO. 34)

PDL1scab-R: AATCCAGAGGTTGATTGTCGACGAATTCTCATTTGCCCGGGCTCAG (SEQ ID NO. 35)

WPRE-QPCR-F: 5'-CCTTTCCGGGACTTTCGCTTT-3' (SEQ ID NO. 36)

WPRE-QPCR-R: 5'-GCAGAATCCAGGTGGCAACA-3' (SEQ ID NO. 37)

Actin-QPCR-F: 5'-CATGTACGTTGCTATCCAGGC-3' (SEQ ID NO. 38)

Actin-QPCR-R: 5'-CTCCTTAATGTCACGCACGAT-3' (SEQ ID NO. 39)

Example 1 OCTS-CAR-T cell construction

I. Construction, purification and detection of recombinant lentiviral vectors lvOCTS-PDL1PSCAs and lvOCTS-PDL1PSCAt

As shown in Figure 3, the construction method of the recombinant lentiviral vector of the present invention is as follows:

1. The human EF1α promoter, OCTS structure [OCTS-PDL1PSCAs, OCTS-PDL1PSCAt], and PDL1 single-chain antibody were cloned into the lentiviral backbone plasmid pLenti-3G basic to obtain recombinant lentiviral plasmids pOCTS-PDL1PSCAs and pOCTS-PDL1PSCAt, respectively.

(1) The lentiviral backbone plasmid pLenti-3G basic was digested with Cla I and EcoR I restriction enzymes, and the product was subjected to 1.5% agarose gel electrophoresis to confirm the 5623 bp fragment V1, and the gel was recovered and placed. In the Eppendorf tube, the corresponding fragment was recovered using MN's agarose gel recovery kit (see Table 2), and the purity and concentration of the product were determined;

Table 2 Agarose gel recovery steps

步骤step	具体操作Specific operation
溶胶Sol	按200μl NTI/100mg gel比例加入溶胶液，50℃水浴放置5-10分钟。The sol solution was added in a ratio of 200 μl NTI/100 mg gel, and placed in a water bath at 50 ° C for 5-10 minutes.
结合DNABinding DNA	11000g离心30秒，弃去滤液。Centrifuge at 11,000 g for 30 seconds and discard the filtrate.
洗膜Wash film	加入700μl NT3，11000g离心30秒，弃去滤液。700 μl of NT3 was added and centrifuged at 11,000 g for 30 seconds, and the filtrate was discarded.
洗膜Wash film	重复第三步一次Repeat the third step once
晾干Dry	11000g离心1分钟，换新的收集管，室温放置1分钟。Centrifuge at 11000g for 1 minute, replace with a new collection tube and leave it at room temperature for 1 minute.
洗脱DNAElution of DNA	加入15-30μl NE，室温放置1分钟，11000g离心1分钟，收集滤液。15-30 μl of NE was added, and the mixture was allowed to stand at room temperature for 1 minute, centrifuged at 11,000 g for 1 minute, and the filtrate was collected.

(2) Using the primers EF1α-F and EF1α-R with the synthesized SEQ ID NO. 14 as a template, the system in Table 3 was used, and the PCR cycle conditions were: 98 ° C for 3 min, (98 ° C for 10 sec, 55 ° C for 15 sec, 72 ° C). 2min) *35cycle, 72 ° C for 10 min. The product was electrophoresed on a 1.5% agarose gel to confirm the 1208 bp fragment a, and the gel was recovered and placed in an Eppendorf tube. The corresponding fragment was recovered by MN's agarose gel recovery kit (see Table 2), and the product was determined. Purity and concentration.

Table 3 50 μL PCR reaction system

试剂Reagent	体积(μL)Volume (μL)
H₂OH ₂ O	32.532.5
5×Buffer(with Mg²⁺)5×Buffer(with Mg ²⁺ )	1010
dNTP(各2.5mM)dNTP (2.5mM each)	44
Primer1(+)(10μM)Primer1(+)(10μM)	11
Primer2(－)(10μM)Primer2(-)(10μM)	11
Template Template	11
PrimeSTARPrimeSTAR	0.50.5

(3) Using the primers OCTS-F and OCTS-R with the synthesized OCTS-PDL1PSCAs as the template, the system in Table 3 was used, and the PCR cycle conditions were: 98 ° C for 3 min, (98 ° C for 10 sec, 55 ° C for 15 sec, 72 ° C for 30 sec) *35cycle, 72 ° C for 5 min. The product was subjected to 1.5% agarose gel electrophoresis, and the 2373 bp fragment b was confirmed, and the gel was recovered and placed in an Eppendorf tube, and the corresponding fragment was recovered by MN's agarose gel recovery kit (see Table 2), and the product was determined. Purity and concentration;

(4) Using the primers OCTS-F and OCTS-R with the synthesized OCTS-PDL1PSCAt as the template, the system in Table 3 was used, and the PCR cycle conditions were: 98 ° C for 3 min, (98 ° C for 10 sec, 55 ° C for 15 sec, 72 ° C for 30 sec) *35cycle, 72 ° C for 5 min. The product was electrophoresed on a 1.5% agarose gel to confirm the 2448 bp fragment c, and the tapping recovery was placed in an Eppendorf tube. MN's agarose gel recovery kit recovers the corresponding fragment (see Table 2) and determines the purity and concentration of the product;

(5) Using the primers IRES-F and IRES-R with the synthesized SEQ ID NO. 12 as a template, using the system in Table 3, the PCR cycle conditions were: 98 ° C for 3 min, (98 ° C for 10 sec, 55 ° C for 15 sec, 72 ° C) 30 sec) * 35 cycles, 72 ° C for 5 min. The product was subjected to 1.5% agarose gel electrophoresis, and the 575 bp fragment d was confirmed, and the gel was collected and placed in an Eppendorf tube, and the corresponding fragment was recovered by MN's agarose gel recovery kit (see Table 2), and the product was determined. Purity and concentration;

(6) Using the primers PDL1scab-F and PDL1scab-R with the synthesized SEQ ID NO. 27 as a template, using the system in Table 3, the PCR cycle conditions were: 98 ° C for 3 min, (98 ° C for 10 sec, 55 ° C for 15 sec, 72 ° C) 30 sec) * 35 cycles, 72 ° C for 5 min. The product was electrophoresed on a 1.5% agarose gel to confirm the 1557 bp fragment e, and the gel was recovered and placed in an Eppendorf tube. The corresponding fragment was recovered by MN's agarose gel recovery kit (see Table 2), and the product was determined. Purity and concentration;

(7) Combine the recombinant lentiviral plasmid DNA fragments (see Table 4) into the Eppendorf tube in a total volume of 5 μl and a molar ratio of 1:1:1:1, add 15 μl of the homologous recombinase reaction solution, and mix at 42 Incubate at °C for 30 minutes, transfer to ice for 2-3 minutes, add the reaction solution to 50 μl of TOP10, gently rotate to mix the contents, place on ice for 30 minutes, and place the tube to pre-warm to 42 °C. Heat the water in a constant temperature water bath for 90 seconds, quickly transfer the tube to the ice bath, allow the cells to cool for 2-3 minutes, add 900 μl of LB medium to each tube, then transfer the tube to a 37 ° C shaker and incubate for 1 hour to allow bacteria For resuscitation, 100 μl of the transformed bacterial solution was applied to an Amp LB agar plate, inverted, and cultured in a constant temperature incubator at 37 ° C for 16 hours.

Table 4 Recombinant lentiviral plasmid DNA fragment combination

重组慢病毒质粒Recombinant lentiviral plasmid	片段组合Fragment combination
pOCTS-PDL1PSCAspOCTS-PDL1PSCAs	a、b、d、ea, b, d, e
pOCTS-PDL1PSCAtpOCTS-PDL1PSCAt	a、c、d、ea, c, d, e

The clones were picked for colony PCR identification. The correct clones were identified as recombinant lentiviral plasmids pOCTS-PDL1PSCAs and pOCTS-PDL1PSCAt. The correct clones were identified by enzyme digestion (see Figure 5), and the results of sequencing were sent.

As shown in FIG. 5, the results of the enzyme digestion electrophoresis of the two recombinant lentiviral plasmids to be tested are basically the same as those of the enzyme digestion prediction, and the construction method of the above recombinant lentiviral plasmid is effective.

2. Packaging of recombinant lentiviral vector lvOCTS-PDL1PSCAs and lvOCTS-PDL1PSCAt

2.1 solution configuration

(1) Complete medium: Take out the pre-warmed fresh medium, add 10% FBS + 5ml Pen-Srep, and mix upside down;

(2) 1XPBS solution: Weigh NaCl 8g, KCl 0.2, Na ₂ HPO ₄ .12H ₂ O 3.58g, KH ₂ PO4 0.24g in 1000ml beaker, add 900ml Milli-Q grade ultrapure water to dissolve, after dissolution is completed , using 1000ml measuring cylinder to make up to 1000ml, 121 ° C high temperature moist heat sterilization for 20min;

(3) 0.25% Trypsin solution: Weigh Trypsin 2.5g, EDTA 0.19729g in 1000ml beaker, add 900ml 1XPBS to dissolve, dissolve it, use 1000ml measuring cylinder to make up to 1000ml, 0.22μM filter sterilization, long-term use can be saved to -20 ° C refrigerator;

(4) 0.5M CaCl2 solution: Weigh 36.75g CaCl ₂ dissolved in 400ml Milli-Q grade ultrapure water; make the total volume to 500ml with Milli-Q grade ultrapure water, mix; 0.22μm filter sterilization, Store in a 50 ml centrifuge tube at a volume of about 45 ml each and store at 4 °C.

(5) 2XHBS solution: Weigh 4.09g NaCl, 0.269g Na ₂ HPO4, 5.96g Hepes, dissolved in 400ml Milli-Q grade ultrapure water; after calibrating the pH meter, adjust the pH of HBS solution to 7.05 with 2M NaOH solution. . Adjust the pH of each bottle of HBS to 2M NaOH to about 3ml.

2.2 HEK293T/17 cell culture

(1) Remove the frozen HEK293T/17 cells from the liquid nitrogen tank, transfer them to a 37 ° C water bath, transfer to a clean bench in 1-2 min, and transfer the liquid in the cryotube to 10 cm ² aseptically. In the culture dish, make up DMEM containing 10% FBS to 8 mL/10 cm ² dish, and observe the cells under microscope after 24 hours. The degree of cell confluence is greater than 80% for passage;

(2) Select HEK293T/17 cells with good cell status and no pollution, and set up a group of 2-6 culture dishes. After trypsinizing the cells, pipette 4-12ml of complete medium with an electric pipette. Add 2ml to the digested dish to avoid drying the dish; use a 1ml pipettor to blow all the cells into a single cell suspension and transfer to the medium bottle;

(3) transferring the remaining cells in the above 2-6 culture dishes to a medium bottle, and rinsing the disposable culture dish with the medium;

(4) Close the medium bottle cap, mix the cell suspension upside down about 10 times, and transfer the cells to 8-24 10cm ² culture dishes. The cell density of each dish should be about 4×10 ⁶ /10ml. Complete medium around. If the cell density differs from the expected one, the cells need to be counted and then inoculated in an amount of 4 × 10 ⁶ / dish;

(5) Organize each of the six culture dishes into one, and keep the fit between the upper and lower dishes. The culture dish was left and right, shaken back and forth several times, the cells were fully spread, and then placed in a 5% CO ₂ incubator. The remaining cells are treated the same;

(6) Examine the passaged cells, the cell confluence should be 70-80%, the contour is full, the adherence is good, and it is evenly distributed in the cell culture dish;

(7) changing the cells for the cells, replacing the medium with fresh complete medium, 9 ml per dish, and increasing the CO ₂ concentration setting of the incubator to 8%;

2.3 cell transfection

(1) A DNA/CaCl ₂ solution was prepared in accordance with N + 0.5. The amount of HEK293T/17 cell transfection plasmid per dish was used in the following ratios: recombinant lentiviral plasmid (20 μg), pPac-GP (15 μg), pPac-R (10 μg), pEnv-G (7.5 μg). Take a new 5ml centrifuge tube, add 0.5M CaCl2: 0.25ml, recombinant lentiviral plasmid 20μg: pPac-GP 15μg: pPac-R 10μg: pEnv-G 7.5μg, add ultrapure water to 0.5ml cover, fully Mix well;

(2) Take another 5mL centrifuge tube and add 0.5ml DNA/CaCl2 solution. Open the vortex shaker, hold the upper end of the 5ml centrifuge tube with one hand, and make the bottom of the tube contact the oscillating head, so that the liquid spreads on the tube wall, and the other hand takes a 1mL pipette and draws 0.5mL 2 ×HBS solution, slowly drop into the centrifuge tube, control the flow rate, and drop it in half a minute. After 2×HBS is added, continue to shake for 5 seconds, stop shaking, and directly add to the cells that need to be transfected;

(3) Take a dish of cells, add 1 mL of calcium in a centrifuge tube, and distribute the calcium transfer reagent to the entire culture dish as much as possible;

(4) After the calcium transfusion was added, mark on the lid and return the dish to another 5% CO ₂ incubator. Make sure the Petri dishes are placed horizontally, no more than 6 per Petri dish. Placed in a 5% CO ₂ incubator (6–8h);

(5) Adjusting the CO ₂ concentration setting value of the first incubator back to 5%;

(6) After 24 hours, the state of the cells was examined. The cell confluence should be around 80–85% and in good condition. The medium was aspirated and 10 ml of fresh DMEM complete medium was replaced;

(7) After 48 hours, the transfection efficiency was observed. Most cells are still adherent. It can be seen that more than 95% of the cells will have green fluorescence. Collect the same virus packaging supernatant together and continue adding 10 mL of fresh medium to the Petri dish;

(8) After 72 hours, the same virus supernatant was collected again, and the two collected viruses could be put together and the culture dish discarded; the supernatant collected at this time contained the recombinant lentiviral vector lvOCTS-PDL1PSCAs, lvOCTS -PDL1PSCAt.

3. Purification of recombinant lentiviral vector by ion exchange chromatography;

(1) The collected supernatant was subjected to suction filtration through a 0.22 μm-0.8 μm PES filter using a Thermo vacuum pump to remove impurities;

(2) adding 1.5M NaCl 250 mM Tris-HCl (pH 6-8) to the supernatant at a ratio of 1:1 to 1:10;

(3) placing two ion exchange columns in series, and sequentially passing the column with 4 ml of 1 M NaOH, 4 ml of 1 M NaCl, 5 ml of 0.15 M NaCl 25 mM Tris-HCl (pH 6-8);

(4) The solution obtained in the step 2 is applied to the ion exchange column by a peristaltic pump at a rate of 1-10 ml/min;

(5) After all the supernatant was passed through the column, it was washed once with 10 ml of 0.15 M NaCl 25 mM Tris-HCl (pH 6-8) solution;

(6) eluting with 1-5 ml of 1.5 M NaCl 25 mM Tris-HCl (pH 6-8) according to the amount of the sample, and collecting the eluate;

(7) The eluate is divided into 25 to 50 μL tubes, frozen and stored in a -80 ° C refrigerator for long-term storage;

4. Determination of recombinant lentiviral vector titer;

(1) A 24-well plate was used to inoculate 293T cells. The cell volume per well is 5×10 ⁴ , the volume of the added medium is 500 ul, the growth rate of different kinds of cells is different, and the cell fusion rate when the virus is infected is 40%-60%;

(2) Three sterile EP tubes were prepared, and after inoculation of cells with 90 ul of fresh complete medium (high glucose DMEM + 10% FBS) for 24 hours in each tube, cells of two wells were counted using a hemocytometer. Determine the actual number of cells at the time of infection, denoted as N;

(3) 10 ul of the virus stock to be determined is added to the first tube, and after gently mixing, 10 ul is added to the second tube, and then sequentially operated until the last tube; 410 ul of complete culture is added to each tube. Base (high glucose DMEM + 10% FBS), the final volume is 500ul;

(4) 20 hours after the start of infection, the culture supernatant was removed, and replaced with 500 μl of complete medium (high glucose DMEM + 10% FBS), and 5% CO _{2 was} further cultured for 48 hours;

(5) After 72 hours, the fluorescence expression was observed. Under normal conditions, the number of fluorescent cells decreased with the increase of the dilution factor, and photographed;

(6) The cells were digested with 0.2 ml of 0.25% trypsin-EDTA solution and allowed to stand at 37 ° C for 1 minute. The entire cell surface was washed with a medium, and the cells were collected by centrifugation. Genomic DNA was extracted according to the instructions of the DNeasy kit. 200 μl of eluate was added to each sample tube to wash the DNA and quantify;

(7) Preparation of target DNA detection qPCRmix manifold I (QPCR primer sequence is SEQ ID NO. 42 - SEQ ID NO. 43):

Table 5 components of qPCRmix manifold I

2×TaqMan Master Mix2×TaqMan Master Mix	25μl×n25μl×n
Forward primer(100pmol ml-1)Forward primer (100pmol ml-1)	0.1μl×n0.1μl×n
Reverse primer(100pmol ml-1)Reverse primer (100pmol ml-1)	0.1μl×n0.1μl×n
Probe(100pmol ml-1)Probe(100pmol ml-1)	0.1μl×n0.1μl×n
H₂OH ₂ O	19.7μl×n19.7μl×n

For example, the total number of reactions is 40. 1 ml of 2×TaqMan Universal PCR Master Mix, 4 μl of forward primer, 4 μl of reverse primer, 4 μl of probe and 788 μl of H 2 O were mixed, shaken and placed on ice.

(8) Preparation of internal reference DNA detection qPCRmix tube II (QPCR primer sequence is SEQ ID NO. 44 - SEQ ID NO. 45):

Table 6 components of qPCRmix manifold II

2×TaqMan Master Mix2×TaqMan Master Mix	25μl×n25μl×n
10×RNaseP primer/probe mix10×RNaseP primer/probe mix	2.5μl×n2.5μl×n
H₂OH ₂ O	17.5μl×n17.5μl × n

For example, the total number of reactions is 40. 1 ml of 2×TaqMan Universal PCR Master Mix, 100 μl of 10×RNaseP primer/probe mix and 700 μl of H ₂ O were mixed, shaken and placed on ice.

(9) The establishment of the PCR system was completed on a pre-cooled 96-well PCR plate. 45 μl of each of the tubes I was added to the wells of each row of A-D, and 45 μl of each of the tubes II was added to the wells of each row of E-G.

(10) 5 μl of the plasmid standard and the genomic DNA of the test sample were separately added to the A-D row, and each sample was repeated once. Another well was added with 5 μl of water as a no-template control.

(11) 5 μl of the genomic standard and the genomic DNA of the sample to be tested were added to the E-G row, and each sample was repeated once. Another well was added with 5 μl of water as a no-template control.

(12) The quantitative PCR instrument used was the ABI PRISM 7500 quantitative system. The cycle conditions were set to: 50 ° C for 2 minutes, 95 ° C for 10 minutes, then 95 ° C for 15 seconds, 60 ° C for 1 minute of 40 cycles.

(13) Data analysis: The integrated lentiviral vector copy number in the measured DNA sample was calibrated with the number of genomes to obtain the virus copy number integrated per genome.

The formula for calculating the titer (integration units per ml, IU ml ^-1 ) is as follows:

IU ml ^-1 = (C × N × D × 1000) / V

Where: C = average number of virus copies per genome integration

N = number of cells at the time of infection (approximately 1 × 10 ⁵ )

D = dilution factor of viral vector

V = volume of diluted virus added

The titer results of the recombinant lentiviral vectors lvOCTS-PDL1PSCAs and lvOCTS-PDL1PSCAt are shown in Fig. 6.

Second, OCTS-CAR-T cell construction

Figure 7 shows the OCTS-CAR-T cell construction process. The construction method of OCTS-CAR-T cells in this example is as follows:

1. Separate PBMC.

(1) Extract 50 ml of fresh peripheral blood from healthy donors;

(2) Spray the blood bag twice to the alcohol and wipe it dry.

(3) Aspirate the blood cells in the bag with a 50 ml syringe and transfer to a new 50 ml tube.

(4) 400 g, centrifuged at 20 ° C for 10 min.

(5) The upper layer of plasma was transferred to a new 50 ml centrifuge tube, the plasma was inactivated at 56 ° C for 30 min, returned to room temperature, 2000 g, centrifuged for 30 min, and the supernatant was taken to a 50 ml centrifuge tube for use.

(6) Make up to 50 ml with D-PBS (-), tighten the lid and mix by inversion.

(7) Take two new 50 ml centrifuge tubes, and add 15 ml of Ficoll lymphocyte separation solution to each tube.

(8) Carefully add 25 ml of blood cell dilution to each tube of Ficoll. 800 g, centrifuge at 20 ° C for 20 min.

(9) The liquid in the centrifuge tube is divided into four layers, from top to bottom: a yellow plasma layer (recovered for use), a white film layer, a colorless transparent Ficoll layer, and a red-black mixed cell layer.

(10) Carefully pipette the white membrane layer into a new 50 ml centrifuge tube, add D-PBS (-) to 50 ml, invert 500 ml after mixing, and centrifuge at 20 ° C for 10 min.

(11) 25 ml of 5% human albumin was added and the cells were resuspended, 400 g, and centrifuged at 20 ° C for 10 min.

(12) Discard the supernatant, resuspend the cell pellet by adding 25 ml of 5% human albumin, and pass through a 70 um sieve and count.

(13) Take 1 part containing 1.25x10 ⁸ cells for activation; the remaining cell suspension 400g, centrifuge at 20 ° C for 10min, add CryoPremium and freeze.

2. CD4/CD8 positive T cell sorting.

(1) The obtained PBMC count was added to the sorting buffer at a ratio of 80 ul/10 ⁷ cells, and the cell pellet was resuspended.

(2) Add CD4/CD8 magnetic beads in a ratio of 20uL/10 ⁷ cells, mix by pipetting, and incubate at 4 °C for 15 min.

(3) The magnetic bead-cell mixture was taken out, added to the sorting buffer at a ratio of 2 ml/10 ⁷ cells, and mixed by inversion, 250 g, and centrifuged at 4 ° C for 10 min.

(4) Add the sorting buffer at a ratio of 500 ul/10 ⁸ cells and resuspend the cell pellet.

(5) Use a pair of tweezers to clamp the LS separation column onto the magnetic stand.

(6) Two 15 ml centrifuge tubes were prepared simultaneously, labeled: CD4-/CD8-cell fluid (A tube), CD4+/CD8+ cell solution (B tube).

(7) Rinse the LS with 3 ml of the separation buffer and connect the buffer with the A tube.

(8) The cell-magnetic bead mixture was added, and after the completion of the dropwise addition, the column was washed by adding 3 ml of a buffer (new liquid was added every time no liquid remained), and a total of three times, CD4/CD8- cells were collected.

(9) The LS separation column was separated from the magnetic frame. The cell suspension was connected with a B tube, 5 ml of buffer solution was added, and the column was stoppered with a little force to collect CD4+/CD8+ cells, and the samples were counted.

(10) The cell pellet was resuspended in AIM-V medium at a cell density of 1 × 10 ⁶ /ml - 4 × 10 ⁶ /ml, and 2 × 10 ⁵ - 1 × 10 ⁶ U / L IFN-γ factor was added.

3. T cell activation.

(1) Add 1×10 ³ ug/L to 1×10 ⁴ ug/L CD3 monoclonal antibody and 1×10 ³ ug/L to 1×10 ⁴ ug/L CD28 monoclonal antibody to a 24-well plate one day in advance. The sealing film was sealed and coated at 4 ° C overnight;

(2) Remove the coated T75 bottle, pour off the coating solution, wash once with D-PBS (-), and inoculate the sorted cell suspension into T75 bottle, shake well, and put in 37 ° C, 5 Culture in a %CO ₂ incubator.

4. CAR gene transduction and OCTS-CAR-T cell induction culture.

(1) 1×10 ³ ug/L to 1×10 ⁴ ug/L RetroNectin was coated in a 24-well plate one day in advance, and the sealing film was sealed and coated overnight at 4°C.

(2) In a 24-well plate, according to the amount of 5×10 ⁵ cells per well, add lvOCTS123BCMAs, lvOCTS319BCMAs, lvOCTS38BCMAs, lvOCTS-PDL1BCMAs, lvOCTS123BCMAt, lvOCTS319BCMAt, lvOCTS38BCMAt, lvOCTS-PDL1BCMAt slowly according to MOI=5-20. The viral transgenic vector is simultaneously added with 2×10 ⁵ to 5×10 ⁵ U/L rIL-2, 5×10 ³ ng/L to 1×10 ⁴ ng/L rIL-7, ⁵ ×10 ³ ng/L～ 1×10 ⁴ ng/L rIL-15, 5×10 ³ ng/L～1×10 ⁴ ng/L rIL-21 and AIM-V medium containing 10% autologous serum continued culture at 37° C., 5% CO ₂ .

5. OCTS-CAR-T cells were expanded in vitro.

(1) Add 2×10 ⁵ to 5×10 ⁵ U/L rIL-2 every 2 days, 5×10 ³ ng/L～1×10 ⁴ ng/L rIL-7, ⁵ ×10 ³ Ng/L～1×10 ⁴ ng/L rIL-15, 5×10 ³ ng/L～1×10 ⁴ ng/L rIL-21 and AIM-V medium containing 10% autologous serum to maintain pH Between 6.5 and 7.5, the cell density was maintained between 5 x 10 ⁵ and 2 x 10 ⁶ /ml, and incubation was continued for 10-14 days at 37 ° C, 5% CO ₂ .

(2) On day 7 or so, cryopreserved OCTS-CAR-T cells were used for subsequent detection.

Example 2 OCTS-CAR-T cell pathogen detection and expression detection

1. Endotoxin testing;

(1) The endotoxin working standard is 15 EU/piece;

(2) 鲎 reagent sensitivity λ = 0.25 EU / ml, 0.5 ml / tube

(3) Dilution of endotoxin standard: Take one endotoxin standard, dilute it to 4λ and 2λ by BET water, seal the sealing film, and vortex for 15min; dilute each step should be in vortex mixer Mix up for 30s;

(4) Adding: Take several branches of sputum reagent, add 0.5ml of BET water per solution, and dispense into several endotoxin-free tubes, 0.1ml per tube. Two of them were negative control tubes, adding 0.1 ml of BET water; two were positive control tubes, adding 0.1 ml of endotoxin working standard solution with 2λ concentration; two were positive control tubes for samples, and adding 0.1 ml of endotoxin containing 2λ A sample solution of the product (diluted 20 times the sample to be tested 1 ml + 4 λ endotoxin standard solution 1 ml = 2 ml diluted 40-fold sample containing 2 λ endotoxin standard).

Add 0.1mL sample to the sample tube, the dilution ratio is shown in Table 7, 37 ± 1 ° C water bath (or incubator) for 60 ± 1min;

Table 7 Endotoxin dilution ratio and endotoxin test results of OCTS-CAR-T cells

稀释倍数Dilution factor		原液Stock solution	55	1010	2020	4040	8080	160160
对应EU/mlCorresponding EU/ml	0.250.25	1.251.25	2.52.5	55	1010	2020	4040
OCTS-PDL1PSCAs-CAR-TOCTS-PDL1PSCAs-CAR-T	(+)(+)	(+)(+)	(-)(-)	(-)(-)	(-)(-)	(-)(-)	(-)(-)
OCTS-PDL1PSCAt-CAR-TOCTS-PDL1PSCAt-CAR-T	(+)(+)	(+)(+)	(-)(-)	(-)(-)	(-)(-)	(-)(-)	(-)(-)

As shown in Table 7, the endotoxin content of all cells was less than 2.5 EU/ml, which was in compliance with the standard of less than 10 EU/ml in the Pharmacopoeia of the People's Republic of China.

Second, mycoplasma detection

(1) Three days before the experiment, the cell samples were cultured in an antibiotic-free medium;

(2) collecting 1 ml of cell suspension (cell number greater than 1 * 10 ⁵ ), placed in a 1.5 ml centrifuge tube;

(3) Centrifuge at 13000 g for 1 min, collect the precipitate, and discard the medium;

(4) Add 500 ul of PBS with a pipette or vortex and resuspend the pellet. Centrifuge at 13000g for 5min;

(5) Step 4 is repeated once;

(6) Add 50 μl Cell Lysis Buffer, pipette with a pipette, mix well, and incubate in a 55 ° C water bath for 20 min;

(7) The sample was heated at 95 ° C for 5 min;

(8) After centrifugation at 13,000 g for 5 min, 5 μl of the supernatant was used as a template. The 25 μl PCR reaction system was: ddH20 6.5 μl, Myco Mix 1 μl, 2× Taq Plus Mix Master (Dye Plus) 12.5 μl, template 5 μl; PCR cycle conditions were: 95 °C30sec, (95°C30sec, 56°C30sec, 72°C30sec)*30cycle, 72°C for 5min.

See the results of mycoplasma test, see Figure 8, the positive control, negative control and sample judgment in Figure 8.

Table 8. As shown in Figure 8, none of the OCTS-CAR-T cells contained mycoplasma.

Table 8 Determination of positive control, negative control and sample

3. OCTS gene transduction efficiency detection and immunophenotyping detection;

(1) The virus-transduced T cells were collected, and the cells were resuspended in a D-PBS(-) solution containing 1 to 4% human albumin and adjusted to 1 × 10 ⁶ /ml.

(2) 1 ml of a D-PBS(-) solution containing 1 to 4% human albumin was added to the centrifuge tube and mixed, centrifuged at 350 g for 5 min, and the supernatant was discarded.

(3) Repeat step 2 once.

(4) Resuspend the cells with 0.2 ml of D-PBS(-) solution containing 1-4% human albumin, and add 1 ul of 1 mg/ul protein L, 5 ul CD4-FITC, 5 ul CD8- to the centrifuge tube. APC, mix and incubate for 45 min at 4 °C.

(5) To the centrifuge tube, 1 ml of a D-PBS(-) solution containing 1 to 4% human albumin was added and mixed, centrifuged at 350 g for 5 min, and the supernatant was discarded.

(6) Repeat step 5 twice.

(7) Resuspend the cells with 0.2 ml of D-PBS(-) solution containing 1 to 4% human albumin, and add 0.2 ul of PE-SA to the centrifuge tube, mix, and incubate at 37 ° C for 15 min in the dark.

(8) Add 1 ml of D-PBS(-) solution containing 1 to 4% human albumin to the centrifuge tube and mix well, centrifuge at 350 g for 5 min, and discard the supernatant.

(9) The cell pellet was resuspended in 1 ml of D-PBS(-) solution, centrifuged at 350 g for 5 min, and the supernatant was discarded.

(10) Repeat step 9 twice.

(11) The cell pellet was resuspended in 0.4 ml of D-PBS(-) solution and detected by flow cytometry.

The results of OCTS gene transduction efficiency and immunophenotyping assay are shown in Figure 9. The infection efficiency of the prepared OCTS-CAR-T cells is mostly between 37% and 50%, and the ratio of CD4 positive cells to CD8 positive cells is located. Between 1:3 and 3:1, you can Perform subsequent functional tests.

Example 3 Functional Testing of OCTS-CAR-T Cells

First, the evaluation of target cell killing effect.

(1) Target cells [PSCA+K562, PDL1+K562, PDL1+PSCA+K562, K562 cells] and effector cells [OCTS-CAR-T cells] were cultured separately, and effector cells were co-incubated with single-target cells and dual-target cells, respectively. See Table 9 for the grouping.

Table 9 List of groups in which effector cells are incubated with single-target cells and dual-target cells, respectively

效应细胞Effector cell		靶细胞1Target cell 1	靶细胞2 Target cell 2	靶细胞3 Target cell 3
OCTS-PDL1PSCAs-CAR-TOCTS-PDL1PSCAs-CAR-T	PDL1⁺K562PDL1 ⁺ K562	PSCA⁺K562PSCA ⁺ K562	PDL1⁺PSCA⁺K562PDL1 ⁺ PSCA ⁺ K562
OCTS-PDL1PSCAt-CAR-TOCTS-PDL1PSCAt-CAR-T	PDL1⁺K562PDL1 ⁺ K562	PSCA⁺K562PSCA ⁺ K562	PDL1⁺PSCA⁺K562PDL1 ⁺ PSCA ⁺ K562

(2) collecting target cells ⁴ × ^{10 5} cells and OCTS-CAR-T cells 2.8× ^{10 6} cells, 800 g, centrifugation at 6 min, discarding the supernatant;

(3) Resuspend the target cells and effector cells with 1 ml of D-PBS(-) solution, 800 g, centrifuge for 6 min, discard the supernatant;

(4) repeat step 3 once;

(5) resuspending the effector cells with 700 ul of medium (AIM-V medium + 10% FBS), and resuspending the target cells with 2 ml of medium (AIM-V medium + 10% FBS);

(6) Set the experimental wells with the effective target ratio of 1:1, 5:1, 10:1, grouping as shown in Figure 11, and set the control group (K562 cells), each group of 3 duplicate wells;

(7) 250 g, 5 min plate centrifugation;

(8) Incubate for 4 hours at 37 ° C in a 5% CO 2 incubator;

(9) 250 g, 5 min plate centrifugation;

(10) Take 50 ul of supernatant from each well into a new 96-well plate, and add 50 ul of substrate solution per well (protected from light);

(11) Incubate for 25 min in the dark;

(12) adding 50 ul of stop solution per well;

(13) measuring the absorbance at 490 nm by a microplate reader;

(14) averaging the three replicate wells; subtracting the absorbance of all the experimental wells, target cell wells, and effector wells from the mean value of the background absorbance; subtracting the absorbance of the target cells from the volume-corrected control The average of the absorbance values.

(15) The corrected values obtained in the step (14) are brought to the following formula to calculate the percentage of cytotoxicity produced by each of the target ratios.

Killing efficiency = (experimental well - effector cell pore - target cell well) / (target cell maximal pore - target cell well) × 100%

The results are shown in Figure 10. OCTS-CAR-T has a good killing effect on each of the single target cells and the dual target cells. The killing efficiency of the Turn OCTS-structured CAR-T cells to the target cells is slightly higher than that of the Series OCTS structure. CAR-T cells.

The above experimental results indicate that the OCTS structure formed by the modification of the antigen recognition region in the traditional CAR structure can significantly increase the range of OCTS-CAR-T cell recognition and killing of target cells, so OCTS-CAR-T cells will be in the future BCMA. Positive/CD319-positive/CD38-positive/CD123-positive/PDL1-positive/BCMA, CD319 double positive/BCMA, CD38 double positive/BCMA, CD123 double positive/BCMA, PDL1 double positive multiple myeloma and other malignant tumors Great role.

The basic principles, main features, and advantages of the present invention are shown and described above. It should be understood by those skilled in the art that the present invention is not limited by the foregoing embodiments, and that the present invention is described in the foregoing description and the description of the present invention. Such changes and modifications are intended to fall within the scope of the invention as claimed. The scope of the invention is defined by the appended claims and their equivalents.

Claims

An OCTS-CAR-based PSCA and PDL1 dual-targeting chimeric antigen receptor characterized by comprising a CD8 leader membrane receptor signal peptide, a double antigen binding region, a CD8 Hinge chimeric receptor hinge, and a CD8 Transmembrane chimeric receptor transmembrane region, CD28 chimeric receptor costimulatory factor, OX40 chimeric receptor costimulatory factor, and TCR chimeric receptor T cell activation domain,

Wherein, the double antigen-binding region comprises PSCA linked in tandem or turn-angle, and heavy chain VH and light chain VL of PDL1 single-chain antibody, inner-linker inner-linker and single-chain antibody inter-linker.
The OCTS-CAR-based anti-PSCA and PDL1 dual-targeting chimeric antigen receptor gene of claim 1 characterized by:

The gene sequence encoding the CD8 leader membrane receptor signal peptide is set forth in SEQ ID NO. 15; the gene sequence encoding the PSCA single-chain antibody light chain VL is set forth in SEQ ID NO. 16, encoding the PSCA single-chain antibody heavy chain VH The gene sequence is set forth in SEQ ID NO. 17; the gene sequence encoding the PDL1 single-chain antibody light chain VL is set forth in SEQ ID NO. 18, and the gene sequence encoding the PDL1 single-chain antibody heavy chain VH is set forth in SEQ ID NO. The gene sequence encoding the antibody inner hinge Inner-Linker is shown in SEQ ID NO. 20; the gene sequence encoding the single-chain antibody inter-linker Inter-Linker is shown in SEQ ID NO. 21; encoding the CD8 Hinge chimeric receptor The gene sequence of the hinge is set forth in SEQ ID NO. 22; the gene sequence encoding the transmembrane region of the CD8 Transmembrane chimeric receptor is set forth in SEQ ID NO. 23; the gene sequence encoding the CD28 chimeric receptor costimulatory factor As shown in SEQ ID NO. 24; the gene sequence encoding the OX40 chimeric receptor costimulatory factor is set forth in SEQ ID NO. 25; the gene sequence encoding the TCR chimeric receptor T cell activation domain is SEQ ID NO: Shown in NO.26.
The recombinant expression vector comprising the OCTS-CAR-based anti-PSCA and PDL1 dual-targeting chimeric antigen receptor gene of claim 2, further comprising:

Expression vector and human EF1α promoter,

Wherein, the gene sequence of the human EF1α promoter is as shown in SEQ ID NO.

The expression vector is a lentiviral expression vector, a retroviral expression vector, an adenovirus expression vector, an adenovirus-associated virus expression vector or a plasmid.
The recombinant expression vector comprising the OCTS-CAR-based anti-PSCA and PDL1 dual-targeting chimeric antigen receptor gene of claim 2, further comprising:

An expression vector, a human EF1α promoter, and a gene encoding a PDL1 single chain antibody,

Wherein, the gene sequence of the human EF1α promoter is as shown in SEQ ID NO. 14, and the gene sequence encoding the PDL1 single-chain antibody is shown in SEQ ID NO.

The expression vector is a lentiviral expression vector, a retroviral expression vector, an adenovirus expression vector, an adenovirus-associated virus expression vector or a plasmid.
The recombinant expression vector comprising the OCTS-CAR-based coding anti-PSCA and PDL1 dual-targeting chimeric antigen receptor gene according to claim 2, according to claim 3 or 4, wherein:

Wherein the expression vector is a third generation lentiviral expression vector pLenti-3G basic, the lentiviral expression vector comprises an ampicillin resistance gene AmpR sequence, a prokaryotic replicon pUC Ori sequence, a viral replicon SV40 Ori sequence, and an RSV promoter , lentivirus 5 terminal LTR, lentivirus 3 terminal Self-Inactivating LTR, Gag cis element, RRE cis element, env cis element, cPPT cis element, ZsGreen1 green fluorescent protein, IRES ribosome binding sequence, eWPRE enhancement Type groundhog hepatitis B virus post-transcriptional regulatory element.
A method for constructing a recombinant expression vector according to claim 3, comprising the steps of:

A. Ampicillin-resistant gene AmpR sequence, prokaryotic replicon pUC Ori sequence, viral replicon SV40 Ori sequence, RSV promoter, lentivirus 5 terminal LTR, lentivirus 3 terminal Self-Inactivating LTR, Gag cis element, RRE cis element, env cis element, cPPT cis element, ZsGreen1 green fluorescent protein, IRES ribosome binding sequence, eWPRE enhanced woodchuck hepatitis B virus post-transcriptional regulatory element stored in the third generation lentiviral backbone plasmid pLenti-3G Basic

B. will encode CD8 leader membrane receptor signal peptide, PSCA single chain antibody light chain VL, PSCA single chain antibody heavy chain VH, PDL1 single chain antibody light chain VL, PDL1 single chain antibody heavy chain VH, antibody inner hinge Inner-Linker Single-chain antibody inter-linker Inter-Linker, CD8 Hinge chimeric receptor hinge, CD8 Transmembrane chimeric receptor transmembrane region, CD28 chimeric receptor costimulatory factor, OX40 chimeric receptor costimulatory factor, and TCR chimeric receptor The gene of the T cell activation domain was cloned into the lentiviral backbone plasmid pLenti-3G basic by restriction enzyme digestion, ligation and recombination, and the third generation OCTS-designed recombinant lentiviral plasmid was obtained.

C. The recombinant lentiviral plasmid obtained in step B was co-transfected into HEK293T/17 cells with lentiviral packaging plasmids pPac-GP, pPac-R and membrane protein granule pEnv-G, and gene transcription was performed in HEK293T/17 cells. After expression, the packaged recombinant recombinant lentiviral vector is released into the cell culture supernatant, and the supernatant of the recombinant lentiviral vector contained is collected;

D. The obtained recombinant lentiviral supernatant was purified by column filtration, adsorption and elution, and the CAR-T recombinant lentiviral expression vector was obtained.
A method for constructing a recombinant expression vector according to claim 4, comprising the steps of:

A. Ampicillin-resistant gene AmpR sequence, prokaryotic replicon pUC Ori sequence, viral replicon SV40 Ori sequence, RSV promoter, lentivirus 5 terminal LTR, lentivirus 3 terminal Self-Inactivating LTR, Gag cis element, RRE cis element, env cis element, cPPT cis element, ZsGreen1 green fluorescent protein, IRES ribosome binding sequence, eWPRE enhanced woodchuck hepatitis B virus post-transcriptional regulatory element stored in the third generation lentiviral backbone plasmid pLenti-3G Basic

B. will encode CD8 leader membrane receptor signal peptide, PSCA single chain antibody light chain VL, PSCA single chain antibody heavy chain VH, PDL1 single chain antibody light chain VL, PDL1 single chain antibody heavy chain VH, antibody inner hinge Inner-Linker Single-chain antibody inter-linker Inter-Linker, CD8 Hinge chimeric receptor hinge, CD8 Transmembrane chimeric receptor transmembrane region, CD28 chimeric receptor costimulatory factor, OX40 chimeric receptor costimulatory factor, and TCR chimeric receptor The gene of the T cell activation domain and the gene encoding the PDL1 single-chain antibody were cloned, ligated and recombined into the lentiviral backbone plasmid pLenti-3G basic to obtain a third generation OCTS-designed recombinant lentiviral plasmid;

C. The recombinant lentiviral plasmid obtained in step B was co-transfected into HEK293T/17 cells with lentiviral packaging plasmids pPac-GP, pPac-R and membrane protein granule pEnv-G, and gene transcription was performed in HEK293T/17 cells. After expression, the packaged recombinant recombinant lentiviral vector is released into the cell culture supernatant, and the supernatant of the recombinant lentiviral vector contained is collected;

D. The obtained recombinant lentiviral supernatant was purified by column filtration, adsorption and elution, and the CAR-T recombinant lentiviral expression vector was obtained.
An OCTS-CAR-T cell into which a recombinant expression vector according to claim 3 or 4 is introduced into the genome or a T lymphocyte modified with the anti-PSCA and PDL1 dual-targeting chimeric antigen receptor according to claim 1. .
Use of the OCTS-CAR-T cell of claim 8 for the preparation of a medicament for the treatment of malignant tumors.
The use of the OCTS-CAR-T cell according to claim 9, for the preparation of a medicament for treating malignant tumor, characterized in that the malignant tumor therapeutic agent is a medicament for treating bladder cancer, pancreatic cancer, prostate cancer or gastric cancer.