WO2018218878A1 - Octs technology-based myeloid leukemia car-t therapeutic vector, construction method therefor and application thereof - Google Patents

Abstract

Provided is an OCTS technology-based myeloid leukemia chimeric antigen receptor T-cell immunotherapy (CAR-T) therapeutic vector, which comprises: a lentiviral backbone plasmid, a human elongation factor 1 alpha (EF1α) promoter, an OCTS chimeric receptor area and a programmed death-ligand 1 (PDL1) single chain antibody; the OCTS chimeric receptor area comprises: a cluster of differentiation 8 (CD8) leader chimeric receptor signal peptide, a CD33 single-chain antibody light chain VL and heavy chain VH, a CD123 single chain antibody light chain VL and heavy chain VH, an intra-antibody hinge Inner-Linker, an inter-single chain antibody hinge Inter-Linker, a CD8 Hinge chimeric receptor hinge, a CD8 Transmembrane chimeric receptor transmembrane region, a T cell receptor (TCR) chimeric receptor T cell activation area, and a chimeric receptor co-stimulatory factor zone. Further provided are a method for constructing the vector and an application thereof in the preparation of a medicament for treating myeloid leukemia.

Description

Myeloid leukemia CAR-T therapeutic vector based on OCTS technology, construction method and application thereof Technical field

The invention belongs to the field of medical biology, and particularly relates to a carrier, in particular to a myeloid leukemia CAR-T therapeutic vector based on OCTS technology. Furthermore, the invention relates to a method and application of the construction of the vector.

Background technique

The theoretical basis of tumor immunotherapy is that the immune system has the ability to recognize tumor-associated antigens and regulate the body's attack on tumor cells (highly specific cell lysis). In the 1950s, Burnet and Thomas proposed the theory of "immuno-monitoring", which believed that the mutant tumor cells that often appear in the body can be cleared by the immune system and lay a theoretical foundation for tumor immunotherapy [Burnet FM.Immunological aspects of malignant disease.Lancet, 1967; 1:171-4]. Subsequently, various tumor immunotherapy including cytokine therapy, monoclonal antibody therapy, adoptive immunotherapy, vaccine therapy, and the like are successively applied to the clinic.

In 2013, a more advanced tumor immunotherapy---CAR-T therapy was successfully used in clinical practice and showed unprecedented clinical efficacy. CAR-T, the full name is Chimeric Antigen Receptor T-Cell Immunotherapy, chimeric antigen receptor T cell immunotherapy. The therapy is a method of transgenic introduction of a chimeric molecule composed of a promoter, an antigen recognition region, a costimulatory factor, and an effector region into a T cell genome, thereby enabling T cell recognition and signal transduction of target cells. The killing and other functions are integrated to achieve specific killing of target cells [Eleanor J. Cheadle, et al. CAR T cells: driving the road from the laboratory to the clinic. Immunological Reviews 2014. Vol. 257: 91–106 ]. CAR-T therapy is the most clinically advanced Novartis CLT019. CLT019 is used to treat patients with relapsed and refractory acute lymphoblastic leukemia. The progression-free survival rate of tumors is 67% for six months, and the longest response time is more than two years. . Shanghai Youkadi Biomedical Technology Co., Ltd., headquartered in Shanghai, China, cooperated with the hospital. As of February 2017, 36 patients with relapsed and refractory acute lymphoblastic leukemia were treated, including 24 patients, with a remission rate of 66.6%. This is a disruptive breakthrough in anti-cancer research. CAR-T cell therapy is probably one of the most likely means of curing cancer, and was named the top of the 2013 Top Ten Technology Breakthrough by Science.

CAR-T is currently effective in the treatment of several types of hematological tumors such as B-lymphocytic leukemia, but there are some limitations. Currently, a chimeric antigen receptor can only recognize one antigen target, and tumor cells are a complex group. After the tumor cells containing the corresponding antigen are cleared, the tumor cells that do not contain the corresponding antigen rapidly proliferate, and the tumor relapses after a period of time. Therefore, in order for the CAR-T recognition to recognize both antigens simultaneously, there are two options: one is to construct two sets of chimeric antigen receptors into a lentiviral transgenic vector, and the two sets of chimeric antigen receptors are used at one time. Transduction into primary T lymphocytes; second, two lentiviral transgenic vectors were transduced twice, and the two sets of chimeric antigen receptors were transduced into primary T lymphocytes, respectively.

The disadvantage of protocol 1 is that it takes up the valuable capacity of the lentiviral transgenic vector, which is not conducive to loading other functional elements; the transgenic vector has low packaging efficiency; the gene transduction efficiency is very low, and it is difficult to transduce into the primary T lymphocytes.

The disadvantage of the second scheme is that it requires two transductions. The combined efficiency of the two transductions is low, the transduction cycle time is long, and the primary cells are prone to aging, resulting in a decline in proliferative capacity, a decrease in killing function, and an effect on tumor clearance.

CD33 is expressed in approximately 90% of cases of acute myeloid leukemia and has been shown to be useful as a therapeutic target. CAR33 chimeric antigen receptor-modified T cells can effectively kill leukemia cell lines and primary tumor cells in vitro. Specific CD33 acts to fight leukemia by regulating T cell function, and the target ratio can be as low as 1:20. In addition, after administration of mice, CAR33-T returned in vivo is equally effective in preventing the development of leukemia and delaying the progression of the disease; these data are the effectiveness and continued development of CAR33-T lymphocytes as a treatment for myeloid leukemia in clinical practice. Provide verification and support. (Carol o’hear Joshua-F.-Heiber-et-al. Anti-CD33chimeric antigen receptor targeting of acute myeloid leukemia [J]. Acute Myeloid Leukemia, 2015, 100(3): 336-344.)

CD123 is the alpha chain of human interleukin 3 receptor and is expressed on the surface of most acute myeloid leukemia (AML) cells and many hematopoietic cells. CD123 is a very good target for immunotherapy because even in CD123 expression is rare. In the cells, its expression will gradually increase with time, and acute myeloid leukemia is likely due to the clonal evolution of hematopoietic stem cells in the pre-leukemia stage, with CD123 as the target, it can play a role in clearing the marrow ( Saar Gill, Carl H. June et al. Preclinical targeting of human acute myeloid leukemia and myeloablation using chimeric antigen receptor-modified T cells. Blood. 2014; 123(15): 2343-2354.).

PD-L1 is overexpressed in most cancer tissues, including NSCLC, melanoma, breast cancer, glioma, lymphoma, leukemia and various urological tumors, digestive tract tumors, germline tumors, etc. [Intlekofer AM, Thompson CB. At the bench: preclinical rationale for CTLA-4 and PD-1blockade as cancer immunotherapy [J]. J Leukoc Biol, 2013, 94(1): 25-39.]. Parsa found T cells in mouse and human tumor cells Abnormally secreted IFN-γ, IFN-γ can induce high expression of PD-L1 on tumor cells [Ding H, Wu X, Wu J, et al. Delivering PD-1 inhibitory signal concomitant with blocking ICOS co-stimulation suppresses lupus-like Syndrome in autoimmune BXSB mice [J]. Clin Immunol, 2006, 118 (2/3): 258-267.]. High expression of PD-L1 can inhibit the expression of cell cycle checkpoint proteins and cell proliferation-related proteins by inhibiting RAS and PI3K/AKT signaling pathways, ultimately leading to inhibition of T cell proliferation [11]. Dong et al. and in vitro models also found that activation of PD-1/PD-L1 signaling pathway can induce specific CTL apoptosis, which reduces the sensitivity of CTL cytotoxicity and promotes immune escape of tumor cells [Dong H , Strome SE, Salomao DR, et al. Tumor-associated B7-H1 promotes T-cell apoptosis: a potential mechanism of immune evasion [J]. Nat Med, 2002, 8(8): 793-800.].

At present, there have been no reports on CAR-T treatment for CD33 and CD123 antigens that overcome the above disadvantages.

Summary of the invention

One of the technical problems to be solved by the present invention is to provide a myeloid leukemia CAR-T therapeutic vector based on OCTS technology. First, it only requires one transduction, and the transduction efficiency is high, which does not affect the therapeutic effect of CAR-T treatment. Secondly, it does not occupy the valuable capacity of the lentiviral transgenic vector, and is advantageous for loading other functional elements. Third, it can effectively block PDL1 and block the immunoregulatory signaling pathway. It can be used clinically to inhibit tumor immune escape and improve the efficacy of CAR-T cell immunotherapy.

The second technical problem to be solved by the present invention is to provide a method for constructing the carrier.

The third technical problem to be solved by the present invention is to provide an application of the carrier.

In order to solve the above technical problem, the present invention adopts the following technical solutions:

In one aspect of the invention, a myeloid leukemia CAR-T therapeutic vector based on OCTS technology is provided, comprising a lentiviral backbone plasmid, a human EF1α promoter, an OCTS chimeric receptor domain, and a PDL1 single chain antibody;

The lentiviral backbone plasmid comprises: an ampicillin resistance gene AmpR sequence for large-scale amplification of a strain of interest, as shown in SEQ ID NO. 1; a prokaryotic replicon pUC Ori sequence for plasmid replication, such as SEQ ID NO .2; a viral replicon SV40Ori sequence for enhancing replication in eukaryotic cells, as set forth in SEQ ID NO. 3; a lentiviral packaging cis element for lentiviral packaging; ZsGreen1 green fluorescent protein, such as SEQ ID NO.11; IRES ribosome binding sequence, as shown in SEQ ID NO. 12; eWPRE-enhanced woodchuck hepatitis B virus post-transcriptional regulatory element for enhancing the expression efficiency of the transgene, as set forth in SEQ ID NO. Show

The sequence of the human EF1α promoter is shown in SEQ ID NO.

The OCTS chimeric receptor domain comprises: a CD8 leader chimeric receptor signal peptide as set forth in SEQ ID NO. 15, a CD33 single chain antibody light chain VL set forth in SEQ ID NO. 16, as SEQ ID NO. a CD33 single-chain antibody heavy chain VH as shown in Figure 17, a CD123 single-chain antibody light chain VL as shown in SEQ ID NO. 18, a CD123 single-chain antibody heavy chain VH as shown in SEQ ID NO. 19, as SEQ ID NO The antibody internal hinge Inner-Linker shown in .20, the single-chain antibody inter-linker Inter-Linker as shown in SEQ ID NO. 21, the CD8 Hinge chimeric receptor hinge as shown in SEQ ID NO. 22, as SEQ ID a transmembrane region of the CD8 Transmembrane chimeric receptor represented by NO. 23, a TCR chimeric receptor T cell activation domain as set forth in SEQ ID NO. 26, and a chimeric receptor costimulatory factor region; said chimeric receptor The costimulatory factor region is selected from the group consisting of 4-1BB, ICOS, CD27, OX40, CD28, MYD88, IL1R1, CD70, TNFRSF19L, TNFRSF27, TNFRSF1OD, A combination of any one or more of tumor necrosis factor receptor superfamily (TNFRSF) such as TNFRSF13B, TNFRSF18, and CD134.

The lentiviral packaging cis element can be a second generation lentiviral vector or a third generation lentiviral vector. The lentiviral packaging cis element comprises a second generation lentiviral vector comprising: a lentivirus 5 terminal LTR as set forth in SEQ ID NO. 5, a lentivirus 3 terminal Self-Inactivating LTR as set forth in SEQ ID NO. a Gag cis element as shown in SEQ ID NO. 7, an RRE cis element as shown in SEQ ID NO. 8, an env cis element as shown in SEQ ID NO. 9, as shown in SEQ ID NO. cPPT cis component. The lentiviral packaging cis element employs a third generation lentiviral vector comprising: a lentiviral 5terminal LTR as set forth in SEQ ID NO. 5, a lentivirus 3 terminal Self-Inactivating LTR as set forth in SEQ ID NO. 6, such as a Gag cis element as shown in SEQ ID NO. 7, an RRE cis element as shown in SEQ ID NO. 8, an env cis element as shown in SEQ ID NO. 9, as shown in SEQ ID NO. cPPT cis element, and the RSV promoter as shown in SEQ ID NO. The third generation of lentiviral vectors are preferably employed in the present invention.

Preferably, the CD33 single-chain antibody light chain VL as shown in SEQ ID NO. 16, the CD33 single-chain antibody heavy chain VH as shown in SEQ ID NO. 17, the CD123 single as shown in SEQ ID NO. Chain antibody light chain VL, CD123 single chain antibody heavy chain VH as shown in SEQ ID NO. 19, antibody internal hinge Inner-Linker as shown in SEQ ID NO. 20, single strand as shown in SEQ ID NO. The inter-antibody hinge Inter-Linker adopts a tandem connection method or a corner connection method; the tandem connection method is specifically: CD123 single-chain antibody light chain VL and CD33 single-chain antibody light chain VL adopt single-chain antibody inter-linkage Inter-Linker connection, CD123 The single-chain antibody light chain VL and the CD123 single-chain antibody heavy chain VH are linked by an antibody internal hinge Inner-Linker, and the CD33 single-chain antibody light chain VL and the CD33 single-chain antibody heavy chain VH are linked by an antibody internal hinge Inner-Linker, ie, pOCTS12333s ( See Figure 4A, Figure 4C); the corner connection is specifically: CD33 single-chain antibody light chain VL and CD33 single-chain antibody heavy chain VH using antibody internal hinge Inner-Linker linkage, CD123 single-chain antibody light chain VL and CD33 single Chain antibody heavy chain VH adopts single-chain antibody inter-linker Inter-Linker linkage, CD123 single-stranded antibody CD33 heavy chain VH and light chain VL single chain antibody Inter-Linker a hinge connection between a single chain antibody, i.e. pOCTS12333t (see FIG. 4B, 4C).

Preferably, the sequence of the PDL1 single chain antibody is shown in SEQ ID NO.

Preferably, the eWPRE-enhanced woodchuck hepatitis B virus post-transcriptional regulatory element has a 6-nucleotide enhancing mutation, specifically: g.396G>A, g.397C>T, g.398T>C, g. 399G>A, g.400A>T, g.411A>T.

Preferably, the entire OCTS structural gene expression is initiated by the human EF1α promoter, which is located at the N-terminus of the OCTS coding sequence for directing the OCTS protein localization to the cell membrane; the CD33 single-chain antibody The light chain VL, CD33 single chain antibody heavy chain VH, CD123 single chain antibody light chain VL, CD123 single chain antibody heavy chain VH, the two sets of single chain antibodies are combined into a double antigen recognition region for identifying the corresponding target antigen; Hinge chimeric receptor hinges are used to anchor the scFv to the outside of the cell membrane; the CD8 Transmembrane chimeric receptor transmembrane region is used to immobilize the entire chimeric receptor on the cell membrane; the CD28 chimeric receptor costimulatory factor It is used to stimulate T lymphocyte activation in vitro and tumor cell killing effect in vivo; the CD134 chimeric receptor costimulatory factor is used to promote T lymphocyte proliferation and factor secretion, enhance tumor immunity, and facilitate long-term survival of memory T cells; The TCR chimeric receptor T cell activation domain is used to activate the expression of a downstream signaling pathway; the PDL1 single-chain antibody can effectively block PDL1, block the immunoregulatory signaling pathway, and can be used clinically to inhibit swelling. The immune escape enhances the efficacy of CAR-T cell immunotherapy; when the antigen recognition region binds to the target antigen, the signal is transmitted to the cell through the chimeric receptor, thereby producing T cell proliferation, increased cytokine secretion, and anti-apoptosis. Increased protein secretion, delayed cell death, and a series of biological effects that lyse target cells.

Preferably, the chimeric receptor costimulatory factor region employs a CD28 chimeric receptor costimulatory factor as set forth in SEQ ID NO. 24 and a CD134 chimeric receptor costimulatory factor combination as set forth in SEQ ID NO. .

Preferably, the CD123 single-chain antibody light chain VL, CD123 single-chain antibody heavy chain VH, and PDL1 single-chain antibody are all humanized.

In a second aspect of the present invention, there is provided a method for constructing a myeloid leukemia CAR-T therapeutic vector based on the above OCTS technology, comprising the steps of:

(1) a ampicillin-resistant gene AmpR sequence as shown in SEQ ID NO. 1, a prokaryotic replicon pUC Ori sequence as shown in SEQ ID NO. 2, a viral replicon as shown in SEQ ID NO. SV40Ori sequence, lentiviral packaging cis element for lentiviral packaging, ZsGreen1 green fluorescent protein as set forth in SEQ ID NO. 11, an IRES ribosome binding sequence as set forth in SEQ ID NO. 12, as SEQ ID NO. The eWPRE-enhanced woodchuck hepatitis B virus post-transcriptional regulatory element shown in 13 is stored on the lentiviral backbone plasmid;

(2) Combining the human EF1α promoter as shown in SEQ ID NO. 14, the OCTS chimeric receptor domain, and the PDL1 single-chain antibody as shown in SEQ ID NO. 27 into an OCTS chimeric receptor design After cleavage, ligation, and recombination, the plasmid was cloned into a lentiviral backbone plasmid to obtain a recombinant lentiviral plasmid designed by the third generation OCTS;

(3) The obtained recombinant lentiviral plasmid was co-transfected into HEK293T/17 cells together with the lentiviral packaging plasmids pPac-GP, pPac-R and membrane protein granule pEnv-G, and then expressed in HEK293T/17 cells. The successfully packaged lentiviral vector is released into the cell culture supernatant, and the supernatant of the recombinant lentiviral vector contained is collected;

(4) The obtained recombinant lentiviral supernatant was purified by column filtration using suction filtration, adsorption and elution to obtain recombinant lentiviral vectors, respectively.

Preferably, in the step (4), the filtration step is to control the supernatant volume to be 200 ml to 2000 ml, and the control vacuum degree is -0.5 MPA to -0.9 MPA to prevent carrier loss due to plugging; the adsorption step To control the pH of the solution at 6-8, prevent the pH change from causing the carrier to be inactivated; the elution step should control the ionic strength of the eluent from 0.5M to 1.0M to prevent the ionic strength change from causing incomplete elution. Or the carrier is inactivated.

In a third aspect of the invention, the use of the vector in the manufacture of a medicament for the treatment of myeloid leukemia is provided.

Compared with the prior art, the present invention has the following beneficial effects:

The OCTS-CAR-T technology used in the present invention is based on the current conventional CAR-T cell therapy, and the chimeric antigen receptor can recognize two kinds of structures by optimizing the chimeric antigen receptor (CAR) structure. The antigen greatly expands the recognition range of CAR-T cells, and the removal of the tumor population is more thorough and the effect is more durable; avoiding the batch culture of CAR-T cells, greatly saving costs; avoiding multiple return of different targeted CAR-T cells by patients It saves patients' economic expenditure, reduces the chance of recurrence, and indirectly improves the quality of life of patients. Only one transduction is needed, the transduction efficiency is high, and the therapeutic effect of CAR-T treatment is not affected; the valuable capacity of the lentiviral transgenic vector is not occupied, which is advantageous for loading other functional elements, and the transgenic vector has high packaging efficiency and high gene transduction efficiency.

The full name of OCTS is One CAR with Two ScFvs, which combines two scFvs into one chimeric molecule (as shown in Figure 1) by tandem OCTS (Series OCTS) or OCTS (Turn OCTS) connection, giving T lymph The ability of cellular HLA-independent ways to recognize two tumor antigens allows for the identification of a broader range of targets than traditional CAR-T cells, further expanding the range of tumor cell clearance. The basic design of OCTS includes two tumor-associated antigen (TAA) binding regions (usually derived from the scFv segment of the monoclonal antibody antigen binding region), an extracellular hinge region, a transmembrane region, and two cells. Internal signal transduction zone and an effect element zone. The scFv region is a key determinant of the specificity, effectiveness, and safety of genomic T cells themselves. With the upcoming entry into the clinical research phase of OCTS-CAR-T, CAR-T cell therapy is about to enter the 2.0 era.

The vector backbone used in the present invention can be applied to the structure of the third generation lentiviral vector, and can also be applied to the structure of the second generation lentiviral vector. The structural differences between the second and third generation lentiviral vectors are shown in Figure 2B. The third generation lentiviral vector (shown in Figure 2A) is preferred in the present invention. The 3'SIN LTR removes the U3 region, eliminating the possibility of lentiviral vector self-replication, greatly improving safety; adding cPPT and WPRE elements, The transduction efficiency and the expression efficiency of the transgene are improved; the RSV promoter ensures the sustained and efficient transcription of the core RNA when the lentiviral vector is packaged; and the human EF1α promoter is used to enable the CAR gene to be continuously expressed in the human body for a long time.

The CD123 single-chain antibody light chain VL, CD123 single-chain antibody heavy chain VH, PDL1 single-chain antibody of the present invention are humanized and can effectively reduce human anti-mouse antibodies (HAMA) in vivo. The production, prolong the half-life and effect of scFv, and increase the time of OCTS-CAR-T cells.

One or several combinations of co-stimulatory factors used in the present invention can increase the proliferation rate, survival time, killing efficiency, immune memory and the like of the cells after transduction.

The OCTS-CAR-T cells used in the present invention can be used in human clinical experiments after being produced by a GMP-level workshop.

The recombinant lentiviral vector of the invention can realize the dual-targeting chimeric antigen receptor which expresses CD33, CD123 and the like on human T lymphocytes, and guides and activates the killing effect of T lymphocytes on CD33, CD123 and other positive cells in clinical practice. It can be used to treat the treatment of myeloid lymphocytic leukemia.

The present invention constructs a recombinant lentiviral vector by recombinant lentiviral vector backbone, OCTS domain, PD1 ligand (PD-L1) single chain antibody (single-chain antibody), and the recombinant lentiviral vector obtained in this manner can be realized in human T Single-chain antibody expressing programmed cell death 1 ligand (PDL1) in lymphocytes can effectively block PDL1 and block the negative signal of immune regulation. It can be used clinically to inhibit tumor immune escape and improve CAR- The efficacy of T cell immunotherapy.

It can be seen that the OCTS-CAR-T cells of the present invention will provide a reliable guarantee for the treatment of tumor cells.

DRAWINGS

1 is a schematic diagram of an OCTS chimeric receptor according to the present invention, including a schematic diagram of a series OCTS (Series OCTS) and a corner OCTS (Turn OCTS);

2 is a schematic diagram showing the structure of a lentiviral vector according to the present invention; wherein FIG. 2A is a schematic diagram showing the structure of a third generation lentiviral vector used in the present invention, and FIG. 2B is a schematic diagram showing a comparison of the structures of the second generation and third generation lentiviral vectors;

3 is a flow chart showing the construction of the recombinant lentiviral vector of the present invention in Example 1 of the present invention. (A) is a schematic diagram of the structure of the lentiviral backbone plasmid pLenti-3G basic; (B) is a schematic diagram of two OCTS plasmids; (C) is a schematic diagram of the structure of the pPac-GP plasmid; (D) is a diagram of pPac Schematic diagram of the structure of the -R plasmid; (E) is a schematic diagram of the structure of the pEnv-G packaging plasmid;

4 is a schematic diagram showing the sequence of components of an OCTS structure in Embodiment 1 of the present invention, wherein A is a schematic diagram of a series OCTS (Series OCTS), Figure B is a schematic diagram of a corner OCTS (Turn OCTS), and C is a plasmid of an OCTS structure. a list of numbers (OCTS Symbol);

Figure 5 is a diagram showing the restriction enzyme digestion and enzymatic cleavage agarose gel electrophoresis of the recombinant lentiviral plasmids pOCTS12333s and pOCTS12333t in Example 1 of the present invention; wherein Figure 5A is a schematic diagram of enzymatic cleavage prediction of pOCTS12333s, and Figure 5B is an enzymatic cleavage agarose of pOCTS12333s. Figure 5C is a schematic diagram of enzymatic cleavage prediction of pOCTS12333t, Fig. 5D is an enzymatic cleavage agarose gel electrophoresis pattern of pOCTS12333t; lane1 of Fig. 5A is 1 kb DNA ladder Marker: strips from top to bottom are: 10 kb , 8 kb, 6 kb, 5 kb, 4 kb, 3.5 kb, 3 kb, 2.5 kb, 2 kb, 1.5 kb, 1 kb, 750 bp, 500 bp, 250 bp; lane2 in Fig. 5A is a BsrG I digestion prediction of pOCTS12333s: band from top to bottom The order is: 8986 bp, 3214 bp; the lane1 in Fig. 5B is the electrophoresis result of the 1 kb DNA ladder Marker; the lane2 in Fig. 5B is the result of BsrG I digestion of pOCTS12333s; the lane1 in Fig. 5C is the 1 kb DNA ladder Marker: strip from Top to bottom are: 10kb, 8kb, 6kb, 5kb, 4kb, 3.5kb, 3kb, 2.5kb, 2kb, 1.5kb, 1kb, 750bp, 500bp, 250bp; Lane2 in Figure 5C is the Kpn I digestion prediction of pOCTS12333t : The strips are from top to bottom: 6926bp, 43 55bp, 989; lane1 in Fig. 5D is the electrophoresis result of 1kb DNA ladder Marker; lane2 in Fig. 5D is the result of Kpn I digestion of pOCTS12333t;

6 is a schematic diagram showing the results of titer detection of the recombinant lentiviral vector in Example 1 of the present invention;

7 is a flow chart showing the steps of constructing OCTS-CAR-T cells according to Example 1 of the present invention, comprising the steps of isolation culture, activation, gene transduction, and OCTS-CAR-T cell identification;

8 is a schematic diagram showing the results of mycoplasma detection of OCTS-CAR-T cells in Example 2 of the present invention, wherein lane1 is DL2000marker, and the strips from top to bottom are from top to bottom: 2 kb, 1 kb, 750 bp, 500 bp, 250bp, 100bp; lane2 is a positive control; lane3 is a negative control; lane4 is PBS; lane5 is a lysate; lane6 is OCTS12333s-CAR-T cells; lane7 is OCTS12333t-CAR-T cells;

Figure 9 is a schematic diagram showing the transduction efficiency and immunological typing results of flow detection OCTS-CAR-T cells in Example 2 of the present invention; wherein, Figure 9A shows the transduction efficiency results of OCTS12333s-CAR-T cells; and Figure 9B shows OCTS12333s- Immunophenotyping results of CAR-T cells; Figure 9C shows the results of transduction efficiency of OCTS12333t-CAR-T cells; Figure 9D shows the results of immunophenotyping of OCTS12333t-CAR-T cells;

Figure 10 is a schematic diagram showing the killing results of OCTS12333s-CAR-T cells and OCTS12333t-CAR-T cells against different target cells under different conditions of different target ratios in Example 3 of the present invention.

detailed description

The invention is further illustrated below in conjunction with specific embodiments. It is understood that the specific embodiments described herein are shown by way of example and not as a limitation of the invention. The main features of the present invention can be applied to various embodiments without departing from the scope of the invention.

material

1. Lentiviral backbone plasmid pLenti-3G basic, lentiviral packaging plasmid pPac-GP, pPac-R and membrane protein granule pEnv-G, HEK293T/17 cells, homologous recombinase, Oligo Annealing Buffer, Mycoplasma detection kit, Toxin detection kit, CD33 ⁺ K562, CD123 ⁺ K562, CD33 ⁺ CD123 ⁺ K562, K562 cells were purchased from Shiyi (Shanghai) Biomedical Technology Co., Ltd.; the specific preparation method of lentiviral backbone plasmid pLenti-3G basic has been disclosed in the invention The name is "a CAR-T transgenic vector based on replication-defective recombinant lentivirus and its construction method and application", and the patent application number is 201610008360.5 in the patent application specification;

2. Human fresh peripheral blood is provided by a healthy donor;

3. The OCTS12333s and OCTS12333t DNA sequence combinations were designed by Shanghai Youkadi Company (see Figure 4C) and submitted to Shanghai Jierui Bioengineering Co., Ltd. for synthesis and storage in the form of oligonucleotide dry powder or plasmid;

4. The tool enzymes Cla I, EcoR I, Kpn I, BsrG I, and T4 DNA ligase were purchased from NEB Corporation;

5. 0.22μm-0.8μm PES filter was purchased from millipore company;

6, D-PBS (-), 0.4% trypan blue, mesh, various types of cell culture dishes, culture bags, culture plates are purchased from Corning;

7. Opti-MEM, Pen-Srep, Hepes, FBS, AIM-V, RPMI 1640, DMEM, lipofectamine 3000 were purchased from Invitrogen;

8. Biotinylated protein L was purchased from GeneScript;

9. The LDH test kit was purchased from Promega;

10. Ficoll lymphocyte separation solution was purchased from GE;

11, 20% human albumin injection was purchased from Jeter Bellin;

12. CryoPremium cryopreservation solution and sorting buffer are from Shanghai Youkadi Company;

13, rIL-2, rIL-7,, rIL-15, rIL-21 were purchased from peprotech;

14, CD3 monoclonal antibody, CD28 monoclonal antibody, CD3/CD28 magnetic beads CD4/CD8 magnetic beads purchased from Germany Miltenyi company;

15. Refrigerated centrifuge (American Thermo Scientific);

16. FACS flow cytometer was purchased from Thermo Corporation;

17. A fluorescent inverted microscope was purchased from Olympus;

18. CD4-FITC and CD8-APC were purchased from BioLegend;

19. 0.9% saline was purchased from Jinmai Company;

20. ProteinL Magnetic Beads was purchased from BioVision;

21, PrimeSTAR, RetroNectin purchased from Takara company;

22. phycoerythrin (PE)-conjugated streptavidin was purchased from BD Bioscience;

23. The plasmid extraction kit and the agarose gel recovery kit were purchased from MN Corporation;

24. Competent cells TOP10 were purchased from tiangen;

25, NaCl, KCl, Na ₂ HPO ₄ .12H ₂ O, KH ₂ PO ₄ , Trypsin, EDTA, CaCl ₂ , NaOH, PEG 6000 were purchased from Shanghai Shenggong;

26, DNeasy kit was purchased from Shanghai Jierui Company;

27. SA-HRP was purchased from Shanghai Shengsheng Company;

28. Primers: Design primers for amplifying DNA fragments and target sites according to the design principles of primers. The primers were synthesized by Shanghai Biotech Co., Ltd., specifically:

EF1α-F: 5'-ATTCAAAATTTTATCGATGCTCCGGTGCCCGTCAGT-3' (SEQ ID NO. 28)

EF1α-R: 5'-TCACGACACCTGAAATGGAAGA-3' (SEQ ID NO. 29)

OCTS-F: CATTTCAGGTGTCGTGAGGATCCGCCACCATGGCGCTGCCGGTGAC (SEQ ID NO. 30)

OCTS-R: GGGGAGGGAGAGGGGCTTAGCGCGGCGGCAGCG (SEQ ID NO. 31)

IRES-F: GCCCCTCTCCCTCCCCC (SEQ ID NO. 32)

IRES-R: ATTATCATCGTGTTTTTCAAAGGAA (SEQ ID NO. 33)

PDL1scab-F: AAAACACGATGATAATGCCACCATGAACTCCTTCTCCACAAGCG (SEQ ID NO. 34)

PDL1scab-R: AATCCAGAGGTTGATTGTCGACGAATTCTCATTTGCCCGGGCTCAG (SEQ ID NO. 35)

WPRE-QPCR-F: 5'-CCTTTCCGGGACTTTCGCTTT-3' (SEQ ID NO. 36)

WPRE-QPCR-R: 5'-GCAGAATCCAGGTGGCAACA-3' (SEQ ID NO. 37)

Actin-QPCR-F: 5'-CATGTACGTTGCTATCCAGGC-3' (SEQ ID NO. 38)

Actin-QPCR-R: 5'-CTCCTTAATGTCACGCACGAT-3' (SEQ ID NO. 39)

29. In the present invention, the SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO 12, SEQ ID NO. 13, SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID NO. 17, SEQ ID NO. 18, SEQ ID NO. 19, SEQ ID NO. 20, SEQ ID NO. 21, SEQ ID NO. 22, SEQ ID NO. 23, SEQ ID NO. The DNA fragment shown by SEQ ID NO. 25, SEQ ID NO. 26, and SEQ ID NO. 27 was synthesized by Shanghai Jierui Bioengineering Co., Ltd. according to the sequence provided by the present inventors.

Example 1 OCTS-CAR-T cell construction

First, the construction, purification and detection methods of recombinant lentiviral vectors lvOCTS12333s and lvOCTS12333t.

Referring to Figure 3, the construction method of the recombinant lentiviral vector of the present invention is as follows:

1. Human EF1α promoter (SEQ ID NO. 14), OCTS structure [OCTS12333s, OCTS12333t] (CD8 leader chimeric receptor signal peptide (SEQ ID NO. 15), CD33 single chain antibody light chain VL (SEQ ID NO) .16), CD33 single-chain antibody heavy chain VH (SEQ ID NO. 17), CD123 single-chain antibody light chain VL (SEQ ID NO. 18), CD123 single-chain antibody heavy chain VH (SEQ ID NO. 19), antibody Inner hinge Inner-Linker (SEQ ID NO. 20), single-chain antibody inter-linker Inter-Linker (SEQ ID NO. 21), CD8 Hinge chimeric receptor hinge (SEQ ID NO. 22), CD8 Transmembrane chimeric receptor Transmembrane region (SEQ ID NO. 23), CD28 chimeric receptor costimulatory factor (SEQ ID NO. 24), CD134 chimeric receptor costimulatory factor (SEQ ID NO. 25), TCR chimeric receptor T cell The activation domain (SEQ ID NO. 26)), PDL1 single-chain antibody (SEQ ID NO. 27) were combined into an OCTS chimeric receptor design, and cloned, ligated, and recombined into the lentiviral backbone plasmid pLenti-3G basic The recombinant lentiviral plasmids pOCTS12333s and pOCTS12333t were obtained, respectively, and the order and number of elements are shown in Fig. 4.

(1) The lentiviral backbone plasmid pLenti-3G basic was digested with Cla I and EcoR I restriction enzymes, and the product was subjected to 1.5% agarose gel electrophoresis to confirm the 5623 bp fragment V1, and the gel was recovered and placed. In the Eppendorf tube, The corresponding fragment was recovered using MN's agarose gel recovery kit (see Table 1), and the purity and concentration of the product were determined;

1, sol	The sol solution was added in a ratio of 200 μl NTI/100 mg gel, and placed in a water bath at 50 ° C for 5-10 minutes.
2, combined with DNA	Centrifuge at 11,000 g for 30 seconds and discard the filtrate.
3, wash the film	700 μl of NT3 was added and centrifuged at 11,000 g for 30 seconds, and the filtrate was discarded.
4, wash the film	Repeat the third step once
5, dry	Centrifuge at 11000g for 1 minute, replace with a new collection tube and leave it at room temperature for 1 minute.
6, eluting DNA	15-30 μl of NE was added, and the mixture was allowed to stand at room temperature for 1 minute, centrifuged at 11,000 g for 1 minute, and the filtrate was collected.

Table 1 Agarose gel recovery steps

(2) Using the primers EF1α-F and EF1α-R with the synthetic human EF1α promoter (SEQ ID NO. 14) as a template, using the system in Table 2, the PCR cycle conditions were: 98 ° C for 3 min, (98 ° C for 10 sec, 55 ° C 15 sec, 72 ° C 2 min) * 35 cycles, 72 ° C 10 min. The product was electrophoresed on a 1.5% agarose gel to confirm the 1208 bp fragment a, and the gel was recovered and placed in an Eppendorf tube. The corresponding fragment was recovered by MN's agarose gel recovery kit (see Table 1), and the product was determined. Purity and concentration;

Reagent	Volume (μl)
H2O	32.5
5×Buffer(with Mg2+)	10
dNTP (2.5mM each)	4
Primer1(+)(10μM)	1
Primer2(-)(10μM)	1
Template	1
PrimeSTAR	0.5

Table 2 50μl PCR reaction system

(3) Using the primers OCTS-F and OCTS-R with the synthesized OCTS12333s as the template, the system in Table 2 was used, and the PCR cycle conditions were: 98 ° C for 3 min, (98 ° C for 10 sec, 55 ° C for 15 sec, 72 ° C for 30 sec) * 35cycle , 72 ° C 5 min. The product was subjected to 1.5% agarose gel electrophoresis, and the 2363 bp fragment b was confirmed, and the gel was recovered and placed in an Eppendorf tube, and the corresponding fragment was recovered by MN's agarose gel recovery kit (see Table 1), and the product was determined. Purity and concentration;

(4) Using the primers OCTS-F and OCTS-R with the synthesized OCTS12333t as the template, the system in Table 2 was used, and the PCR cycle conditions were: 98 ° C for 3 min, (98 ° C for 10 sec, 55 ° C for 15 sec, 72 ° C for 30 sec) * 35 cycles , 72 ° C 5 min. The product was electrophoresed on a 1.5% agarose gel to confirm the 2388 bp fragment c, and the gel was recovered and placed in an Eppendorf tube. The corresponding fragment was recovered by MN's agarose gel recovery kit (see Table 1), and the product was determined. Purity and concentration;

(5) Using the primers IRES-F and IRES-R with the synthetic IRES ribosomal binding sequence (SEQ ID NO. 12) as a template, using the system in Table 2, the PCR cycling conditions were: 98 ° C for 3 min, (98 ° C for 10 sec) , 55 ° C 15 sec, 72 ° C 30 sec) * 35 cycles, 72 ° C 5 min. The product was subjected to 1.5% agarose gel electrophoresis, and the 575 bp fragment d was confirmed, and the gel was recovered and placed in an Eppendorf tube, and the corresponding fragment was recovered by MN's agarose gel recovery kit (see Table 1), and the product was determined. Purity and concentration;

(6) Using the primers PDL1scab-F and PDL1scab-R with the synthesized PDL1 single-chain antibody (SEQ ID NO. 27) as a template, using the system in Table 2, the PCR cycle conditions were: 98 ° C for 3 min, (98 ° C for 10 sec, 55 ° C 15 sec, 72 ° C 30 sec) * 35 cycles, 72 ° C 5 min. The product was subjected to 1.5% agarose gel electrophoresis, and the 1557 bp fragment e was confirmed, and the gel was recovered and placed in an Eppendorf tube, and the corresponding fragment was recovered by MN's agarose gel recovery kit (see Table 1), and the product was determined. Purity and concentration;

(7) Combine the recombinant lentiviral plasmid DNA fragments (see Table 3) into the Eppendorf tube in a total volume of 5 μl and a molar ratio of 1:1:1:1, add 15 μl of the homologous recombinase reaction solution, and mix at 42 Incubate at °C for 30 minutes, transfer to ice for 2-3 minutes, add the reaction solution to 50 μl of TOP10, gently rotate to mix the contents, place on ice for 30 minutes, and place the tube to pre-warm to 42 °C. Heat the heat bath for 90 seconds, quickly transfer the tube to the ice bath, and cool the cells 2-3 In minutes, add 900 μl of LB medium to each tube, then transfer the tube to a 37 ° C shaker, incubate for 1 hour to resuscitate the bacteria, take 100 μl of the transformed bacterial solution onto Amp LB agar plates, invert the plate, and incubate the incubator. Incubate at 37 ° C for 16 hours.

Recombinant lentiviral plasmid	Fragment combination
pOCTS12333s	a, b, d, e
pOCTS12333t	a, c, d, e

Table 3 Recombinant lentiviral plasmid DNA fragment combination

The clones were picked for colony PCR identification. The correct clones were identified as recombinant lentiviral plasmids pOCTS12333s and pOCTS12333t. The correct clones were identified by enzyme digestion (see Figure 5), and the results of sequencing were sent.

2. Packing of recombinant lentiviral vector lvOCTS12333s and lvOCTS12333t.

(1) Complete medium: Take out the pre-warmed fresh medium, add 10% FBS + 5ml Pen-Srep, and mix upside down;

(2) 1XPBS solution: Weigh NaCl 8g, KCl 0.2, Na ₂ HPO ₄ .12H ₂ O 3.58g, KH ₂ PO4 0.24g in 1000ml beaker, add 900ml Milli-Q grade ultrapure water to dissolve, after dissolution is completed , using 1000ml measuring cylinder to make up to 1000ml, 121 ° C high temperature moist heat sterilization for 20min;

(3) 0.25% Trypsin solution: Weigh Trypsin 2.5g, EDTA 0.19729g in 1000ml beaker, add 900ml 1XPBS to dissolve, dissolve it, use 1000ml measuring cylinder to make up to 1000ml, 0.22μM filter sterilization, long-term use can save To -20 ° C refrigerator;

(4) 0.5M CaCl2 solution: Weigh 36.75g CaCl ₂ dissolved in 400ml Milli-Q grade ultrapure water; make the total volume to 500ml with Milli-Q grade ultrapure water, mix; 0.22μm filter sterilization, Store in a 50 ml centrifuge tube at a volume of about 45 ml each and store at 4 °C.

(5) 2XHBS solution: Weigh 4.09g NaCl, 0.269g Na ₂ HPO4, 5.96g Hepes, dissolved in 400ml Milli-Q grade ultrapure water; after calibrating the pH meter, adjust the pH of HBS solution to 7.05 with 2M NaOH solution. . Adjust the PH consumption of each bottle of HBS to 2M NaOH to about 3ml;

(6) Remove the frozen HEK293T/17 cells from the liquid nitrogen tank, transfer them to a 37 °C water bath, transfer to a clean bench in 1-2 min, and transfer the liquid in the cryotube to 10 cm ² aseptically. In the culture dish, make up DMEM containing 10% FBS to 8 mL/10 cm ² dish, and observe the cells under microscope after 24 hours. The degree of cell confluence is greater than 80% for passage;

(7) Select HEK293T/17 cells with good cell status and no pollution, and set up a group of 2-6 culture dishes. After trypsinizing the cells, pipette 4-12ml of complete medium with an electric pipette. Add 2ml to the digested dish to avoid drying the dish; use a 1ml pipettor to blow all the cells into a single cell suspension and transfer to the medium bottle;

(8) transferring the remaining cells in the above 2-6 culture dishes to a medium bottle, and rinsing the disposable culture dish with the medium;

(9) Close the medium bottle cap, mix the cell suspension upside down about 10 times, and transfer the cells to 8-24 10cm ² culture dishes. The cell density of each dish should be about 4×10 ⁶ /10ml. Complete medium around. If the cell density differs from the expected one, the cells need to be counted and then inoculated in an amount of 4 × 10 ⁶ / dish;

(10) Organize each of the six culture dishes into one, and pay attention to the cooperation between the upper and lower dishes. The culture dish was left and right, shaken back and forth several times, the cells were fully spread, and then placed in a 5% CO ₂ incubator. The remaining cells are treated the same;

(11) Examine the passaged cells, the cell confluence should be 70-80%, the contour is full, the adherence is good, and it is evenly distributed in the cell culture dish;

(12) changing the cells for the cells, replacing the medium with fresh complete medium, 9 ml per dish, and increasing the CO ₂ concentration setting of the incubator to 8%;

(13) A DNA/CaCl ₂ solution was prepared in accordance with N + 0.5. The amount of HEK293T/17 cell transfection plasmid per dish was used in the following ratios: recombinant lentiviral plasmid (20 μg), pPac-GP (15 μg), pPac-R (10 μg), pEnv-G (7.5 μg). Take a new 5ml centrifuge tube, add 0.5M CaCl2: 0.25ml, recombinant lentiviral plasmid 20μg: pPac-GP 15μg: pPac-R 10μg: pEnv-G 7.5μg, add ultrapure water to 0.5ml cover, fully Mix well;

(14) Take another 5ml centrifuge tube and add 0.5ml DNA/CaCl2 solution. Open the vortex shaker, hold the upper end of the 5ml centrifuge tube with one hand, and make the bottom of the tube contact the oscillating head, so that the liquid spreads on the tube wall, and the other hand takes a 1mL pipette and draws 0.5mL 2 ×HBS solution, slowly drop into the centrifuge tube, control the flow rate, and drop it in half a minute. After 2×HBS is added, continue to shake for 5 seconds, stop shaking, and directly add to the cells that need to be transfected;

(15) Take a dish of cells, add 1 mL of calcium in a centrifuge tube, and distribute the calcium transfer reagent to the entire culture dish as much as possible;

(16) After the calcium transfusion was added, mark on the lid and return the dish to another 5% CO ₂ incubator. Make sure the Petri dishes are placed horizontally, no more than 6 per Petri dish. Placed in a 5% CO ₂ incubator (6–8h);

(17) Adjusting the CO ₂ concentration setting of the first incubator back to 5%;

(18) After 24 hours, the state of the cells was examined. The cell confluence should be around 80–85% and in good condition. The medium was aspirated and 10 ml of fresh DMEM complete medium was replaced;

(19) After 48 hours, the transfection efficiency was observed. Most cells are still adherent. It can be seen that more than 95% of the cells will have green fluorescence. Collect the same virus packaging supernatant together and continue adding 10 mL of fresh medium to the Petri dish;

(20) After 72 hours, the same virus supernatant was collected again, and the two collected viruses could be put together and the culture dish discarded; the supernatant collected at this time contained the recombinant lentiviral vectors lvOCTS12333s and lvOCTS12333t.

3. Purification of recombinant lentiviral vector by ion exchange chromatography;

(1) The collected supernatant was subjected to suction filtration through a 0.22 μm-0.8 μm PES filter using a Thermo vacuum pump to remove impurities;

(2) adding 1.5M NaCl 250 mM Tris-HCl (pH 6-8) to the supernatant at a ratio of 1:1 to 1:10;

(3) placing two ion exchange columns in series, and sequentially passing the column with 4 ml of 1 M NaOH, 4 ml of 1 M NaCl, 5 ml of 0.15 M NaCl 25 mM Tris-HCl (pH 6-8);

(4) The solution obtained in the step 2 is applied to the ion exchange column by a peristaltic pump at a rate of 1-10 ml/min;

(5) After all the supernatant was passed through the column, it was washed once with 10 ml of 0.15 M NaCl 25 mM Tris-HCl (pH 6-8) solution;

(6) eluting with 1-5 ml of 1.5 M NaCl 25 mM Tris-HCl (pH 6-8) according to the amount of the sample, and collecting the eluate;

(7) The eluate is divided into 25 to 50 μl tubes, frozen and stored in a -80 ° C refrigerator for long-term storage;

4. Determination of recombinant lentiviral vector titer;

(1) A 24-well plate was used to inoculate 293T cells. The cell volume per well is 5×10 ⁴ , the volume of the added medium is 500 ul, the growth rate of different kinds of cells is different, and the cell fusion rate when the virus is infected is 40%-60%;

(2) Three sterile EP tubes were prepared, and after inoculation of cells with 90 ul of fresh complete medium (high glucose DMEM + 10% FBS) for 24 hours in each tube, cells of two wells were counted using a hemocytometer. Determine the actual number of cells at the time of infection, denoted as N;

(3) 10 ul of the virus stock to be determined is added to the first tube, and after gently mixing, 10 ul is added to the second tube, and then sequentially operated until the last tube; 410 ul of complete culture is added to each tube. Base (high glucose DMEM + 10% FBS), the final volume is 500ul;

(4) 20 hours after the start of infection, the culture supernatant was removed, and replaced with 500 μl of complete medium (high glucose DMEM + 10% FBS), and 5% CO _{2 was} further cultured for 48 hours;

(5) After 72 hours, the fluorescence expression was observed. Under normal conditions, the number of fluorescent cells decreased with the increase of the dilution factor, and photographed;

(6) The cells were digested with 0.2 ml of 0.25% trypsin-EDTA solution and allowed to stand at 37 ° C for 1 minute. The entire cell surface was washed with a medium, and the cells were collected by centrifugation. Genomic DNA was extracted according to the instructions of the DNeasy kit. 200 μl of eluate was added to each sample tube to wash the DNA and quantify;

(7) Preparation of target DNA detection qPCRmix manifold I (QPCR primer sequence is SEQ ID NO. 36 - SEQ ID NO. 37):

For example, the total number of reactions is 40, and 1 ml of 2×TaqMan Universal PCR Master Mix, 4 μl of forward primer, 4 μl of reverse primer, 4 μl of probe and 788 μl of H 2 O are mixed. Put on the ice after the shock;

(8) Preparation of internal reference DNA detection qPCRmix tube II (QPCR primer sequence is SEQ ID NO. 38 - SEQ ID NO. 39):

2×TaqMan Master Mix 25μl×n

10×RNaseP primer/probe mix 2.5μl×n

H ₂ O 17.5μl×n

For example, the total number of reactions is 40, and 1 ml of 2×TaqMan Universal PCR Master Mix, 100 μl of 10×RNaseP primer/probe mix and 700 μl of H ₂ O are mixed. Put on the ice after the shock;

(9) The establishment of the PCR system was completed on a pre-cooled 96-well PCR plate. 45 μl of each of the tubes I was added to the wells of each row of A-D, and 45 μl of each of the tubes II was added to the wells of each row of E-G.

(10) 5 μl of the plasmid standard and the genomic DNA of the test sample were separately added to the A-D row, and each sample was repeated once. Another well was added with 5 μl of water as a no-template control.

(11) 5 μl of the genomic standard and the genomic DNA of the sample to be tested were added to the E-G row, and each sample was repeated once. Another well was added with 5 μl of water as a no-template control.

(12) The quantitative PCR instrument used was the ABI PRISM 7500 quantitative system. The cycle conditions were set to: 50 ° C for 2 minutes, 95 ° C for 10 minutes, then 95 ° C for 15 seconds, 60 ° C for 1 minute of 40 cycles.

Data analysis: The number of integrated lentiviral vector copies in the measured DNA samples was calibrated using the number of genomes to obtain the viral copy number integrated per genome.

The formula for calculating the titer (integration units per ml, IU ml ^-1 ) is as follows:

IU ml ^-1 = (C × N × D × 1000) / V

Where: C = average number of virus copies per genome integration

N = number of cells at the time of infection (approximately 1 × 10 ⁵ )

D = dilution factor of viral vector

V = volume of diluted virus added

(13) Titer results of recombinant lentiviral vectors lvOCTS12333s and lvOCTS12333t (shown in Figure 6);

Second, OCTS-CAR-T cell construction

Referring to Figure 7, the construction method of the OCTS-CAR-T cells of the present invention is as follows:

1. Separate PBMC.

(1) Extract 50 ml of fresh peripheral blood from healthy donors;

(2) Spray the blood bag twice to the alcohol and wipe it dry.

(3) Aspirate the blood cells in the bag with a 50 ml syringe and transfer to a new 50 ml tube.

(4) 400 g, centrifuged at 20 ° C for 10 min.

(5) The upper layer of plasma was transferred to a new 50 ml centrifuge tube, the plasma was inactivated at 56 ° C for 30 min, returned to room temperature, 2000 g, centrifuged for 30 min, and the supernatant was taken to a 50 ml centrifuge tube for use.

(6) Make up to 50 ml with D-PBS (-), tighten the lid and mix by inversion.

(7) Take two new 50 ml centrifuge tubes, and add 15 ml of Ficoll lymphocyte separation solution to each tube.

(8) Carefully add 25 ml of blood cell dilution to each tube of Ficoll. 800 g, centrifuge at 20 ° C for 20 min.

(9) The liquid in the centrifuge tube is divided into four layers, from top to bottom: a yellow plasma layer (recovered for use), a white film layer, a colorless transparent Ficoll layer, and a red-black mixed cell layer.

(10) Carefully absorb the white membrane layer into a new 50ml centrifuge tube, add D-PBS (-) to 50ml, and mix 500g after inversion, 20 °C Centrifuge for 10 min.

(11) 25 ml of 5% human albumin was added and the cells were resuspended, 400 g, and centrifuged at 20 ° C for 10 min.

(12) Discard the supernatant, resuspend the cell pellet by adding 25 ml of 5% human albumin, and pass through a 70 um sieve and count.

(13) Take 1 part containing 1.25x10 ⁸ cells for activation; the remaining cell suspension 400g, centrifuge at 20 ° C for 10min, add CryoPremium and freeze.

2. CD4/CD8 positive T cell sorting.

(1) The obtained PBMC count was added to the sorting buffer at a ratio of 80 ul/10 ⁷ cells, and the cell pellet was resuspended.

(2) Add CD4/CD8 magnetic beads in a ratio of 20ul/10 ⁷ cells, mix by pipetting, and incubate at 4 °C for 15 min.

(3) The magnetic bead-cell mixture was taken out, added to the sorting buffer at a ratio of 2 ml/10 ⁷ cells, and mixed by inversion, 250 g, and centrifuged at 4 ° C for 10 min.

(4) Add the sorting buffer at a ratio of 500 ul/10 ⁸ cells and resuspend the cell pellet.

(5) Use a pair of tweezers to clamp the LS separation column onto the magnetic stand.

(6) Two 15 ml centrifuge tubes were prepared simultaneously, labeled: CD4-/CD8-cell fluid (A tube), CD4+/CD8+ cell solution (B tube).

(7) Rinse the LS with 3 ml of the separation buffer and connect the buffer with the A tube.

(8) The cell-magnetic bead mixture was added, and after the completion of the dropwise addition, the column was washed by adding 3 ml of a buffer (new liquid was added every time no liquid remained), and a total of three times, CD4/CD8- cells were collected.

(9) The LS separation column was separated from the magnetic frame. The cell suspension was connected with a B tube, 5 ml of buffer solution was added, and the column was stoppered with a little force to collect CD4+/CD8+ cells, and the samples were counted.

(10) The cell pellet was resuspended in AIM-V medium at a cell density of 1 x 10 ⁶ /ml - ⁴ x 10 ⁶ /ml, and 2 × 10 ⁵ - 1 × 10 ⁶ U / L IFN-γ factor was added.

3. T cell activation.

(1) Add 1×10 ³ ug/L to 1×10 ⁴ ug/L CD3 monoclonal antibody and 1×10 ³ ug/L to 1×10 ⁴ ug/L CD28 monoclonal antibody to a 24-well plate one day in advance. The parafilm was sealed and coated overnight at 4 °C.

(2) Remove the coated T75 bottle, pour off the coating solution, wash once with D-PBS (-), and inoculate the sorted cell suspension into T75 bottle, shake well, and put in 37 ° C, 5 Culture in a %CO ₂ incubator.

4. CAR gene transduction and OCTS-CAR-T cell induction culture.

(1) 1×10 ³ ug/L to 1×10 ⁴ ug/L RetroNectin was coated in a 24-well plate one day in advance, and the sealing film was sealed and coated overnight at 4°C.

(2) In a 24-well plate, according to the amount of 5×10 ⁵ cells per well, add lvOCTS12333s and lvOCTS12333t lentiviral transgenic vectors according to the amount of MOI=5-20, and add 2×10 ⁵ ～5×10 ⁵ at the same time. U/L rIL-2, 5×10 ³ ng/L～1×10 ⁴ ng/LrIL-7, ⁵ ×10 ³ ng/L～1×10 ⁴ ng/L rIL-15, 5×10 ³ ng/ L ~ 1 × 10 ⁴ ng / L rIL-21 and AIM-V medium containing 10% autologous serum were further cultured at 37 ° C, 5% CO ₂ .

5. OCTS-CAR-T cells were expanded in vitro.

(1) Add 2×10 ⁵ to 5×10 ⁵ U/L rIL-2 every 2 days, 5×10 ³ ng/L～1×10 ⁴ ng/L rIL-7, ⁵ ×10 ³ Ng/L～1×10 ⁴ ng/L rIL-15, 5×10 ³ ng/L～1×10 ⁴ ng/L rIL-21 and AIM-V medium containing 10% autologous serum to maintain pH Between 6.5 and 7.5, the cell density was maintained between 5 x 10 ⁵ and 2 x 10 ⁶ /ml, and incubation was continued for 10-14 days at 37 ° C, 5% CO ₂ .

(2) On day 7 or so, cryopreserved OCTS-CAR-T cells were used for subsequent detection.

Example 2

OCTS-CAR-T cell pathogen detection and expression detection.

1. Endotoxin testing;

(1) The endotoxin working standard is 15EU/piece;

(2), 鲎 reagent sensitivity λ = 0.25EU / ml, 0.5ml / tube

(3) Dilution of endotoxin standard: Take one endotoxin standard, dilute it to 4λ and 2λ by BET water, seal the sealing film and swell for 15min; dilute each step should be mixed in vortex Mix on the device for 30s;

(4), loading: take a few sputum reagents, each added BET water 0.5ml dissolved, dispensed into several endotoxin-free tubes, 0.1ml per tube. Two of them were negative control tubes, and BET water was added to 0.1 ml;

2 tubes were positive control tubes, and 0.1 ml of endotoxin working standard solution with 2λ concentration was added;

2 samples were positive control tubes, and 0.1 ml of sample solution containing 2λ endotoxin standard was added (diluted 20 times of the sample to be tested 1ml + 4λ endotoxin standard solution 1ml = 2ml diluted with the 2λ endotoxin standard 40 times sample).

Add 0.1ml sample to the sample tube, the dilution ratio is shown in Table 4, 37 ± 1 ° C water bath (or incubator) for 60 ± 1min;

Table 4 Endotoxin dilution ratio and corresponding endotoxin content

(5) Endotoxin test results of OCTS-CAR-T cells (as shown in Table 5), the endotoxin content of all cells is less than 2.5 EU/ml, which is in line with the standard of less than 10 EU/ml in the Pharmacopoeia of the People's Republic of China. ;

table 5

Dilution factor		Stock solution	5	10	20	40	80	160
Corresponding EU/ml	0.25	1.25	2.5	5	10	20	40
OCTS12333s-CAR-T	(+)	(+)	(-)	(-)	(-)	(-)	(-)
OCTS12333t-CAR-T	(+)	(+)	(-)	(-)	(-)	(-)	(-)

Second, mycoplasma testing;

(1) Three days before the experiment, the cell samples were cultured in an antibiotic-free medium;

(2) collecting 1 ml of cell suspension (cell number greater than 1 * 10 ⁵ ), placed in a 1.5 ml centrifuge tube;

(3) Centrifuge at 13000 g for 1 min, collect the precipitate, and discard the medium;

(4) Add 500 ul of PBS with a pipette or vortex and resuspend the pellet. Centrifuge at 13000g for 5min;

(5) Step 4 is repeated once;

(6) Add 50 μl Cell Lysis Buffer, pipette with a pipette, mix well, and incubate in a 55 ° C water bath for 20 min;

(7) The sample was heated at 95 ° C for 5 min;

(8) After centrifugation at 13,000 g for 5 min, 5 μl of the supernatant was used as a template. The 25 μl PCR reaction system was: ddH20 6.5 μl, Myco Mix 1 μl, 2× Taq Plus Mix Master (Dye Plus) 12.5 μl, template 5 μl; PCR cycle conditions were: 95 °C 30 sec, (95 ° C 30 sec, 56 ° C 30 sec, 72 ° C 30 sec) * 30 cycles, 72 ° C 5 min.

(9) The results of mycoplasma test showed (as shown in Fig. 8) that OCTS-CAR-T cells did not contain mycoplasma.

3. OCTS gene transduction efficiency detection and immunophenotyping detection;

(1) The virus-transduced T cells were collected, and the cells were resuspended in a D-PBS(-) solution containing 1 to 4% human albumin and adjusted to 1 × 10 ⁶ /ml.

(2) 1 ml of a D-PBS(-) solution containing 1 to 4% human albumin was added to the centrifuge tube and mixed, centrifuged at 350 g for 5 min, and the supernatant was discarded.

(3) Repeat step 2 once.

(4) Resuspend the cells with 0.2 ml of D-PBS(-) solution containing 1-4% human albumin, and add 1 ul of 1 mg/ul protein L, 5 ul CD4-FITC, 5 ul CD8- to the centrifuge tube. APC, mix and incubate for 45 min at 4 °C.

(5) To the centrifuge tube, 1 ml of a D-PBS(-) solution containing 1 to 4% human albumin was added and mixed, centrifuged at 350 g for 5 min, and the supernatant was discarded.

(6) Repeat step 5 twice.

(7) Resuspend the cells with 0.2 ml of D-PBS(-) solution containing 1 to 4% human albumin, and add 0.2 ul of PE-SA to the centrifuge tube, mix, and incubate at 37 ° C for 15 min in the dark.

(8) Add 1 ml of D-PBS(-) solution containing 1 to 4% human albumin to the centrifuge tube and mix well, centrifuge at 350 g for 5 min, and discard the supernatant.

(9) The cell pellet was resuspended in 1 ml of D-PBS(-) solution, centrifuged at 350 g for 5 min, and the supernatant was discarded.

(10) Repeat step 9 twice.

(11) The cell pellet was resuspended in 0.4 ml of D-PBS(-) solution and detected by flow cytometry.

(12) The results of OCTS gene transduction efficiency and immunophenotyping assay are shown in Figure 9. The infection efficiency of the prepared OCTS-CAR-T cells is mostly between 30% and 40%, and CD4 positive cells and CD8 are positive. The ratio of cells is between 1:3 and 3:1 for subsequent functional testing.

Example 3 Functional assay of OCTS-CAR-T cells.

First, the evaluation of target cell killing effect.

(1) culturing target cells [CD33 ⁺ K562, CD123 ⁺ K562, CD33 ⁺ CD123 ⁺ K562, K562 cells] and effector cells [OCTS-CAR-T cells];

(2) collecting target cells ⁴ × ^{10 5} cells and OCTS-CAR-T cells 2.8×106 cells, 800 g, centrifugation at 6 min, discarding the supernatant;

(3) Resuspend the target cells and effector cells with 1 ml of D-PBS(-) solution, 800 g, centrifuge for 6 min, discard the supernatant;

(4) repeat step 3 once;

(5) resuspending the effector cells with 700 ul of medium (AIM-V medium + 10% FBS), and resuspending the target cells with 2 ml of medium (AIM-V medium + 10% FBS);

(6) Set the experimental wells with the effective target ratio of 1:1, 5:1, and 10:1, and the grouping of effector cells with single-target cells and double-target cells, respectively, as shown in Table 6, and set the control group ( K562 cells), 3 replicate wells per group;

Table 6

Effector cell		Target cell 1	Target cell 2	Target cell 3
OCTS12333s-CAR-T	CD123 + K562	CD33 + K562	CD33 + CD123 + K562
OCTS12333t-CAR-T	CD123-K562	CD33 + K562	CD33 + CD123 + K562

(7) 250 g, 5 min plate centrifugation;

(8) Incubate for 4 hours at 37 ° C in a 5% CO 2 incubator;

(9) 250 g, 5 min plate centrifugation;

(10) Take 50 ul of supernatant from each well into a new 96-well plate, and add 50 ul of substrate solution per well (protected from light);

(11) Incubate for 25 min in the dark;

(12) adding 50 ul of stop solution per well;

(13) measuring the absorbance at 490 nm by a microplate reader;

(14) averaging the three replicate wells; subtracting the absorbance of all the experimental wells, target cell wells, and effector wells from the mean value of the background absorbance; subtracting the absorbance of the target cells from the volume-corrected control The average of the absorbance values.

(15) The corrected values obtained in step 14 are taken to the following formula to calculate the percentage of cytotoxicity produced by each of the target ratios. The results are shown in Figure 10. OCTS-CAR-T has a good killing effect on each of the single target cells and the dual target cells. The killing efficiency of the Turn OCTS-structured CAR-T cells to the target cells is slightly higher than that of the Series OCTS structure. CAR-T cells;

Killing efficiency = (experimental well - effector cell hole - target cell well) / (target cell maximum pore - target cell well) X100%

(16) The above experimental results show that the OCTS structure formed by the modification of the antigen recognition region in the traditional CAR structure can significantly increase the range of recognition and killing of target cells by OCTS-CAR-T cells, so OCTS-CAR-T cells will Future cancer cells play a huge role in cell therapy.

Claims (11)

1. A myeloid leukemia CAR-T therapeutic vector based on OCTS technology, which comprises a lentiviral skeleton plasmid, a human EF1α promoter, an OCTS chimeric receptor domain and a PDL1 single chain antibody;

   The lentiviral backbone plasmid comprises: an ampicillin resistance gene AmpR sequence for large-scale amplification of a strain of interest, as shown in SEQ ID NO. 1; a prokaryotic replicon pUC Ori sequence for plasmid replication, such as SEQ ID NO .2; a viral replicon SV40 Ori sequence for enhancing replication in eukaryotic cells, as set forth in SEQ ID NO. 3; a lentiviral packaging cis element for lentiviral packaging; ZsGreen1 green fluorescent protein, eg SEQ ID NO. 11; IRES ribosomal binding sequence, as set forth in SEQ ID NO. 12; eWPRE-enhanced woodchuck hepatitis B virus post-transcriptional regulatory element for enhancing expression efficiency of the transgene, such as SEQ ID NO. Shown

   The sequence of the human EF1α promoter is shown in SEQ ID NO.

   The OCTS chimeric receptor domain comprises: a CD8 leader chimeric receptor signal peptide as set forth in SEQ ID NO. 15, a CD33 single chain antibody light chain VL as set forth in SEQ ID NO. 16, as SEQ ID NO CD33 single-chain antibody heavy chain VH shown in .17, CD123 single-chain antibody light chain VL as shown in SEQ ID NO. 18, CD123 single-chain antibody heavy chain VH as shown in SEQ ID NO. 19, as SEQ ID The antibody internal hinge Inner-Linker shown in NO. 20, the single-chain antibody inter-linker Inter-Linker as shown in SEQ ID NO. 21, and the CD8 Hinge chimeric receptor hinge as shown in SEQ ID NO. 22, such as SEQ a CD8 Transmembrane chimeric receptor transmembrane region represented by ID NO. 23, a TCR chimeric receptor T cell activation domain as set forth in SEQ ID NO. 26, and a chimeric receptor costimulatory factor region; The co-stimulatory factor region is selected from any one or more of the tumor necrosis factor superfamilies such as 4-1BB, ICOS, CD27, OX40, CD28, MYD88, IL1R1, CD70, TNFRSF19L, TNFRSF27, TNFRSF1OD, TNFRSF13B, TNFRSF18, CD134, and the like. The combination.
2. The vector of claim 1 wherein said lentiviral packaging cis element comprises a second generation lentiviral vector or a third generation lentiviral vector; said second generation lentiviral vector comprising: SEQ ID NO a lentivirus 5 terminal LTR as shown in .5, a lentivirus 3 terminal Self-Inactivating LTR as shown in SEQ ID NO. 6, a Gag cis element as set forth in SEQ ID NO. 7, as set forth in SEQ ID NO. An RRE cis element as shown, an env cis element as set forth in SEQ ID NO. 9, a cPPT cis element as set forth in SEQ ID NO. 10; said third generation lentiviral vector comprising: SEQ ID NO. Lentivirus 5 terminal LTR shown in 5, lentivirus 3 terminal Self-Inactivating LTR as shown in SEQ ID NO. 6, Gag cis element as shown in SEQ ID NO. 7, as shown in SEQ ID NO. An RRE cis element, an env cis element as set forth in SEQ ID NO. 9, a cPPT cis element as set forth in SEQ ID NO. 10, and an RSV promoter as set forth in SEQ ID NO.
3. The vector according to claim 1, wherein the CD33 single-chain antibody light chain VL as shown in SEQ ID NO. 16 and the CD33 single-chain antibody heavy chain VH as shown in SEQ ID NO. The CD123 single-chain antibody light chain VL shown in SEQ ID NO. 18, the CD123 single-chain antibody heavy chain VH as shown in SEQ ID NO. 19, the antibody internal hinge Inner-Linker as shown in SEQ ID NO. 20, The single-chain antibody inter-linker Inter-Linker shown in SEQ ID NO. 21 adopts a tandem junction manner or a horn junction method; the tandem junction manner is specifically: CD123 single-chain antibody light chain VL and CD33 single-chain antibody light chain VL adopt single Chain-antibody hinge Inter-Linker linkage, CD123 single-chain antibody light chain VL and CD123 single-chain antibody heavy chain VH using antibody internal hinge Inner-Linker linkage, CD33 single-chain antibody light chain VL and CD33 single-chain antibody heavy chain VH antibody Internal hinge Inner-Linker linkage; the corner connection is specifically: CD33 single-chain antibody light chain VL and CD33 single-chain antibody heavy chain VH using antibody internal hinge Inner-Linker linkage, CD123 single-chain antibody light chain VL and CD33 single-strand Antibody heavy chain VH uses single-chain antibody inter-linker Inter-Linker connection, CD123 single CD33 antibody heavy chain VH and light chain VL single chain antibody Inter-Linker a hinge connection between a single chain antibody.
4. The vector according to claim 1, wherein the sequence of the PDL1 single-chain antibody is set forth in SEQ ID NO.
5. The vector according to claim 1, wherein said eWPRE-enhanced woodchuck hepatitis B virus post-transcriptional regulatory element has a 6-nucleotide enhancing mutation, specifically: g.396G>A, g.397C> T, g.398T>C, g.399G>A, g.400A>T, g.411A>T.
6. The vector according to claim 1, wherein the entire OCTS structural gene expression is initiated by said human EF1α promoter, said CD8 leader chimeric receptor signal peptide being located at the N-terminus of the OCTS coding sequence for directing OCTS protein Located in the cell membrane; the CD33 single-chain antibody light chain VL, CD33 single-chain antibody heavy chain VH, CD123 single-chain antibody light chain VL, CD123 single-chain antibody heavy chain VH, the two sets of single-chain antibodies are combined into a double antigen recognition region, For identifying a corresponding target antigen; the CD8 Hinge chimeric receptor hinge is used to anchor the scFv to the outside of the cell membrane; the CD8 Transmembrane chimeric receptor transmembrane region is used to immobilize the entire chimeric receptor on the cell membrane; The CD28 chimeric receptor costimulatory factor is used for stimulating T lymphocyte activation in vitro and tumor cell killing effect in vivo; the CD134 chimeric receptor costimulatory factor is used for promoting T lymphocyte proliferation and factor secretion, and enhancing tumor immunity, Conducive to the long-term survival of memory T cells; the TCR chimeric receptor T cell activation domain is used to activate the expression of downstream signaling pathways; the PDL1 single-chain antibody can effectively block PDL1 and block the immunoregulatory signal No. pathway, clinically used to inhibit tumor immune escape, improve the efficacy of CAR-T cell immunotherapy; when the antigen recognition region binds to the target antigen, the signal is transmitted to the cell through the chimeric receptor, thereby producing T cell proliferation, Increased secretion of cytokines, increased secretion of anti-apoptotic proteins, delayed cell death, and a series of biological effects of lytic target cells.
7. The vector according to claim 1, wherein said chimeric receptor costimulatory factor region employs a CD28 chimeric receptor costimulatory factor as set forth in SEQ ID NO. 24 and is set forth in SEQ ID NO. CD134 chimeric receptor co-stimulatory factor combination.
8. The vector according to claim 1, wherein said CD123 single-chain antibody light chain VL, CD123 single-chain antibody heavy chain VH, and PDL1 single-chain antibody are all humanized.
9. A method for constructing a myeloid leukemia CAR-T therapeutic vector based on OCTS technology according to any one of claims 1-8, comprising the steps of:

   (1) a ampicillin-resistant gene AmpR sequence as shown in SEQ ID NO. 1, a prokaryotic replicon pUC Ori sequence as shown in SEQ ID NO. 2, a viral replicon as shown in SEQ ID NO. SV40 Ori sequence, lentiviral packaging cis element for lentiviral packaging, ZsGreen1 green fluorescent protein as set forth in SEQ ID NO. 11, an IRES ribosome binding sequence as set forth in SEQ ID NO. 12, as SEQ ID NO The eWPRE-enhanced woodchuck hepatitis B virus post-transcriptional regulatory element shown in .13 is stored on the lentiviral backbone plasmid;

   (2) Combining the human EF1α promoter as shown in SEQ ID NO. 14, the OCTS chimeric receptor domain, and the PDL1 single-chain antibody as shown in SEQ ID NO. 27 into an OCTS chimeric receptor design After cleavage, ligation, and recombination, the plasmid was cloned into a lentiviral backbone plasmid to obtain a recombinant lentiviral plasmid designed by the third generation OCTS;

   (3) The obtained recombinant lentiviral plasmid was co-transfected into HEK293T/17 cells together with the lentiviral packaging plasmids pPac-GP, pPac-R and membrane protein granule pEnv-G, and then expressed in HEK293T/17 cells. The successfully packaged lentiviral vector is released into the cell culture supernatant, and the supernatant of the recombinant lentiviral vector contained is collected;

   (4) The obtained recombinant lentiviral supernatant was purified by column filtration using suction filtration, adsorption and elution to obtain recombinant lentiviral vectors, respectively.
10. The method according to claim 9, wherein in the step (4), the filtration step is controlled to control the supernatant volume from 200 ml to 2000 ml, and the control vacuum degree is from -0.5 MPA to -0.9 MPA to prevent plugging. Carrying carrier loss; the adsorption step is to control the pH of the solution to be 6-8, to prevent the pH change from causing the carrier to be inactivated; the elution step is to control the ionic strength of the eluent to be 0.5M to 1.0M, Preventing changes in ionic strength results in incomplete elution or inactivation of the carrier.
11. Use of the vector according to any one of claims 1-8 for the preparation of a medicament for the treatment of myeloid leukemia.

Images