CN107325185B

CN107325185B - The bis- targeting Chimeric antigen receptors of anti-PSCA and PDL1, encoding gene and expression vector based on OCTS-CAR

Info

Publication number: CN107325185B
Application number: CN201710418911.XA
Authority: CN
Inventors: 祁伟; 俞磊; 康立清; 林高武; 余宙
Original assignee: Shanghai Unicar Therapy Bio Medicine Technology Co Ltd
Current assignee: Shanghai Unicar Therapy Bio Medicine Technology Co Ltd
Priority date: 2017-06-06
Filing date: 2017-06-06
Publication date: 2019-09-20
Anticipated expiration: 2037-06-06
Also published as: CN107325185A; WO2018223601A1

Abstract

The present invention provides a kind of bis- targeting Chimeric antigen receptors of PSCA based on OCTS-CAR and PDL1, encoding gene, OCTS-CAR-T recombinant expression carrier and its construction method and applications.The bis- targeting Chimeric antigen receptors of the anti-PSCA and PDL1 include the CD8 leader membrane receptor signal peptide being sequentially connected in series, double antigen binding domains, CD8 Hinge Chimerical receptor hinge, CD8 Transmembrane Chimerical receptor transmembrane region, CD28 Chimerical receptor costimulating factor, OX40 Chimerical receptor costimulating factor and TCR Chimerical receptor t cell activation domain, wherein, double antigen binding domains include with the heavy chain VH and light chain VL of PSCA the and PDL1 single-chain antibody of series connection or the connection of corner connection type, hinge Inter-Linker between antibody inner hinge Inner-Linker and single-chain antibody.In addition, additionally providing the gene for encoding the bis- targeting Chimeric antigen receptors of the anti-PSCA and PDL1, recombinant expression carrier and its construction method and application.

Description

The bis- targeting Chimeric antigen receptors of anti-PSCA and PDL1, coding base based on OCTS-CAR Cause and expression vector

Technical field

The invention belongs to immunotherapy of tumors technical fields, and in particular to a kind of for malignant tumour immunization therapy, base In the bis- targeting Chimeric antigen receptors of the anti-PSCA and PDL1 of OCTS-CAR, encoding gene, recombinant expression carrier and its construction method And application.

Background technique

The theoretical basis of immunotherapy of tumors is that immune system has identification tumor associated antigen, regulation body attack tumour The ability of cell (e.g., the cell dissolution of high degree of specificity).Generation nineteen fifty, Burnet and Thomas propose " immunosurveillance " reason By, it is believed that the tumour cell for the mutation that often will appear in body can be identified by immune system and be removed, and be controlled for tumour immunity Treatment established theoretical basis [Burnet FM.Immunological aspects of malignant disease.Lancet, 1967；1:1171-4].Then, various tumour immunotherapies include cytokine therapy, monoclonal antibody therapy, adoptive immunity The sequential uses such as therapy, vaccine therapy are in clinic.

A kind of more advanced tumour immunotherapy in 2013 --- CAR-T therapy is used successfully to clinic, and is demonstrated by preceding institute not Some clinical efficacies.CAR-T, full name are Chimeric Antigen Receptor T-Cell Immunotherapy, are fitted into Antigen receptor T cell immunotherapy.The therapy is the means by transgenosis, by promoter, antigen recognizing district, costimulation because The chimeric molecule that son, effect area etc. collectively constitute imports in T cell genome, to make T cell to the identification of target cell, letter Number transduction, killing etc. functions combine together, realize specific killing [the Eleanor J.Cheadle, et to target cell al.CAR T cells:driving the road from the laboratory to the clinic.Immunological Reviews 2014.Vol.257:91–106].CAR-T therapy is clinically most leading to be had The CLT019 of Novartis recurs refractory Patients With Acute Lymphoblastic Leukemia using CLT019 treatment, and six months tumours get nowhere Survival rate reaches 67%, wherein longest response time reached more than 2 years.General headquarters are located at the excellent card enlightening biology in Shanghai of Chinese Shanghai Pharmaceutical Technology Co., Ltd cooperates with hospital, and by the end of 2 months 2017, treatment was recurred refractory acute lymphoblastic leukemia and suffered from altogether Person 36, wherein complete 24, alleviation ratio reaches 66.6%.Therefore, CAR-T cell therapy is that the subversiveness of anticancer research is prominent It is broken, it may be possible to most possible one of the means for curing cancer, and 2013 annual ten big technological breakthroughs are chosen as by " Science " magazine First of.

CAR-T at present significant in efficacy in terms of the neoplastic hematologic disorder of the treatment several types such as B- lymphocytic leukemia, but It is that there is also some limitations, such as the previous Chimeric antigen receptor of mesh can only identify a kind of antigenic targets, but tumour cell is The group of a complexity, after the tumour cell containing corresponding antigens is removed, the tumour cell without corresponding antigens can increase rapidly It grows, tumor recurrence is caused after a period of time.

Make CAR-T identification that can identify two kinds of antigens simultaneously, there are two scheme is optional: first is that by two groups of Chimeric antigen receptors Building enters a slow virus transgene carrier, and two groups of Chimeric antigen receptor transductions are disposably entered primary T lymphocyte；Two It is to be transduceed in two times with two slow virus transgene carriers, two groups of Chimeric antigen receptors is transduceed respectively thin into primary T lymph Born of the same parents.

The shortcomings that scheme one, is to occupy the valuable capacity of slow virus transgene carrier, is unfavorable for loading other Functional Units Part；Transgene carrier packaging efficiency is low；Gene transduction efficiency is very low, is difficult transduction and enters in primary T lymphocyte.

The shortcomings that scheme two, is needing by transduceing twice, and the overall efficiency transduceed twice is lower, and transduction cycle time is long, Primary cell is easy aging, and proliferative capacity is caused to fail, and killing ability decline influences tumor clearance curative effect.

The study found that PSCA (prostate stem cell antigen) is the abbreviation of prostate stem cell antigen, it should Antigen is a kind of cell surface glycoprotein that glycosyl-phosphatidyl inositol anchor is fixed.The prostate of people, bladder, placenta, large intestine, kidney, There are certain expression [Norihisa Saeki, Jian Gu, Teruhiko Yoshida, Xifeng in the normal tissues such as stomach Wu.Prostate stem cell antigen (PSCA): aJekyll and Hyde molecule? Clin Cancer Res.2010 Jul 15；16(14):3533–3538.].There is up-regulation in portion of bladder cancer, cancer of pancreas, prostate cancer, gastric cancer, There are a variety of nonsynonymous mutations for the initiation codon of this antigen gene, thus it is speculated that may be related with tumour generation.

PD-L1 overexpression in most cancerous tissues, including NSCLC, melanoma, breast cancer, glioma, lymph [the Intlekofer AM, Thompson such as tumor, leukaemia and various urological cancers, tumor in digestive tract, system genitale tumour CB.At the bench:preclinical rationale for CTLA-4 and PD-1 blockade as cancer immunotherapy[J].J Leukoc Biol,2013,94(1):25-39.].Parsa in the tumour cell of mouse and people, It was found that the IFN-γ of T cell abnormal secretion, IFN-γ can induce the PD-L1 high on tumour cell express [Ding H, Wu X, Wu J,et al.Delivering PD-1 inhibitory signal concomitant with blocking ICOS co-stimulation suppresses lupus-like syndrome in autoimmune BXSB mice[J].Clin Immunol,2006,118(2/3):258-267.].PD-L1 high expression, can be by inhibiting RAS and PI3K/AKT signal logical Road, and then cell cycle regulation checkpoint albumen and cell multiplication related protein expression, eventually lead to the inhibition of T cell proliferation [11].The experiment in vitro such as Dong and mouse model also found that the activation of PD-1/PD-L1 signal path can be with inducing specific CTL Tune is died, and the cell toxicant lethal effect sensibility of CTL is declined, and promotes tumour cell that immunologic escape [Dong H, Strome occurs SE,Salomao DR,et al.Tumor-associated B7-H1 promotes T-cell apoptosis:a potential mechanism of immune evasion[J].Nat Med,2002,8(8):793-800.]。

Summary of the invention

The present invention be based on above-mentioned discovery and carry out, and it is an object of the present invention to provide a kind of for malignant tumour, especially bladder Cancer, cancer of pancreas, prostate cancer, the anti-PSCA based on OCTS-CAR of immunotherapy for gastric cancer and the bis- targeting chimeric antigens of PDL1 by Body, encoding gene, OCTS-CAR recombinant expression carrier and its construction method and application.

The full name of OCTS is One CAR with Two ScFvs, passes through series connection OCTS (Series OCTS) or corner The connection type of OCTS (Turn OCTS) by two sections of scFv and is integrated into a chimeric molecule (shown in Fig. 1), it is thin to assign T lymph Born of the same parents HLA non-dependent mode identifies the ability of two kinds of tumour antigens, can identify widely relative to traditional CAR-T cell Target, the further expansion removing range of tumour cell.

It include two tumor associated antigen (tumor-associated antigen, TAA) knots in the basic engineering of OCTS It closes area (the scFv section for being typically derived from monoclonal antibody antigen bond area), an extracellular hinge area, a transmembrane region, two Intracellular signal transduction area and a response element area.The region scFv is thin for the specificity of OCTS, validity and genetic modification T It is crucial determinant for the safety of born of the same parents itself.

OCTS-CAR-T technology of the present invention is on the basis of current CAR-T cell therapy, by chimeric The Optimizing Reconstruction of antigen receptor (CAR) structure enables Chimeric antigen receptor to identify two kinds of antigens of PSCA and PDL1, expands significantly The identification range for having opened up CAR-T cell, the removing for cancer colonies is more thorough, and curative effect is more longlasting.The first aspect of the present invention, A kind of bis- targeting Chimeric antigen receptors of anti-PSCA and PDL1 are provided, including the CD8 leader membrane receptor letter being sequentially connected in series Number peptide, double antigen binding domains, CD8 Hinge Chimerical receptor hinge, CD8 Transmembrane Chimerical receptor transmembrane region, CD28 Chimerical receptor costimulating factor, OX40 Chimerical receptor costimulating factor and TCR Chimerical receptor t cell activation domain.Wherein, dual anti- Former combined area includes with the heavy chain VH and light chain VL of PSCA the and PDL1 single-chain antibody of series connection or the connection of corner connection type, resists Hinge Inter-Linker between internal hinge Inner-Linker and single-chain antibody.

It is chimeric to provide the bis- targetings of the above-mentioned anti-PSCA and PDL1 based on OCTS-CAR of coding for the second aspect of the invention The gene of antigen receptor, the sequence number control for encoding the gene of each part mentioned above are as follows: CD8 leader membrane receptor signal peptide (SEQ ID NO.15), PSCA single-chain antibody light chain VL (SEQ ID NO.16), PSCA single-chain antibody heavy chain VH (SEQ ID NO.17), PDL1 single-chain antibody light chain VL (SEQ ID NO.18), PDL1 single-chain antibody heavy chain VH (SEQ ID NO.19), antibody Hinge Inter-Linker (SEQ ID NO.21), CD8 between inner hinge Inner-Linker (SEQ ID NO.20), single-chain antibody Hinge Chimerical receptor hinge (SEQ ID NO.22), CD8 Transmembrane Chimerical receptor transmembrane region (SEQ ID NO.23), CD28 Chimerical receptor costimulating factor (SEQ ID NO.24), OX40 Chimerical receptor costimulating factor (SEQ ID NO.25), TCR Chimerical receptor t cell activation domain (SEQ ID NO.26).

It is chimeric to provide the bis- targetings of the anti-PSCA and PDL1 of the above-mentioned coding based on OCTS-CAR for the third aspect of the present invention The recombinant expression carrier of antigen receptor gene has such technical characteristic, further includes: expression vector and people EF1 α starting Son.Wherein, the gene order of people EF1 α promoter is as shown in SEQ ID NO.14, and expression vector is Lentiviral, inverse Retroviral expression vector, adenovirus expression carrier, adeno-associated virus (AAV) expression vector or plasmid.

Further, the present invention also provides another recombinant expression carriers, and relative to above-mentioned recombinant expression carrier, this is heavy Group expression vector further includes the gene for encoding PDL1 single-chain antibody, and gene order is as shown in SEQ ID NO.27.

Expression vector skeleton of the present invention is third generation slow virus carrier (shown in Fig. 2A), 3 ' SIN LTR removal The region U3, substantially increases safety at a possibility that eliminating slow virus carrier self-replacation；Increase cPPT and WPRE member Part improves the expression efficiency of transduction efficiency and transgenosis；Core when ensure that slow virus carrier packaging using RSV promoter The lasting efficient transcription of RNA；Using the EF1 α promoter of people itself, enable CAR gene in human body long lasting for expression.

The Lentiviral includes the sequence of AmpR containing ampicillin resistance gene, prokaryotic replions pUC Ori sequence Column, Viral Replicon SV40 Ori sequence, RSV promoter, 5 terminal LTR of slow virus, 3 terminal of slow virus Self-Inactivating LTR, Gag cis element, RRE cis element, env cis element, cPPT cis element, The enhanced marmot hepatitis B post-transcriptional control member of ZsGreen1 green fluorescent protein, IRES ribosome binding sequence, eWPRE Part.

The present invention be by people EF1 α promoter, CD8 leader Chimerical receptor signal peptide, PSCA single-chain antibody light chain VL, PSCA single-chain antibody heavy chain VH, PDL1 single-chain antibody light chain VL, PDL1 single-chain antibody heavy chain VH, antibody inner hinge Inner- Hinge Inter-Linker between Linker, single-chain antibody, CD8 Hinge Chimerical receptor hinge, CD8 Transmembrane are chimeric Receptor transmembrane area, CD28 Chimerical receptor costimulating factor, OX40 Chimerical receptor costimulating factor, TCR Chimerical receptor t cell activation The building of the expressing gene of domain and PDL1 single-chain antibody enters recombined lentivirus vector, is started by people's EF1 α promoter entire OCTS expression of structural gene.

CD8 leader Chimerical receptor signal peptide is located at the N-terminal of OCTS albumen, for guiding OCTS albumen to be positioned at cell Film；PSCA single-chain antibody light chain VL, PSCA single-chain antibody heavy chain VH, PDL1 single-chain antibody light chain VL, PDL1 single-chain antibody heavy chain Hinge Inter-Linker is combined into double antigen recognizing districts between VH, antibody inner hinge Inner-Linker, single-chain antibody, for knowing Not corresponding target antigen；CD8 Hinge Chimerical receptor hinge is used to for scFv being anchored on the outside of cell membrane；CD8 Transmembrane Chimerical receptor transmembrane region is used to entire Chimerical receptor being fixed on cell membrane；CD28 Chimerical receptor pierces altogether The factor is swashed for stimulating T lymphocyte Activation In Vitro and interior tumor cell lethal effect；OX40 Chimerical receptor costimulating factor For promoting T lymphocyte to be proliferated and cytokine secretion, enhances tumour immunity, be conducive to the long-term surviving of memory T cell；TCR is embedding Close the expression that recipient T cells activation domain is used to activate downstream signaling pathway；The single-chain antibody of PDL1 can effectively close PDL1, resistance Disconnected immune negative regulator signal path, can be clinically used for the immune escape for inhibiting tumour, improves the treatment of CAR-T cellular immunotherapy Effect.

When antigen recognition region is in conjunction with target antigen, signal is transferred into the cell by Chimerical receptor, so that it is thin to generate T One systems such as born of the same parents' proliferation, cytokine secretion increase, Anti-apoptotic proteins secretion increases, cell death delay, cracking target cell Column biological effect.

In the present invention, in the present invention, PSCA single-chain antibody light chain VL, PSCA single-chain antibody heavy chain VH, PDL1 single-chain antibody Light chain VL, PDL1 single-chain antibody heavy chain VH, PDL1 single-chain antibody has with shown nucleotide sequence >=80% homology (preferably Ground, >=90% homology；Deng preferably, >=95% homology；Most preferably, >=97% homology；) nucleotide sequence.

In the present invention, in the present invention, PSCA single-chain antibody light chain VL, PSCA single-chain antibody heavy chain VH, PDL1 single-chain antibody Light chain VL, PDL1 single-chain antibody heavy chain VH, PDL1 single-chain antibody has amino acid sequence corresponding with shown nucleotide sequence The homology of >=80% (preferably, >=90% homology；Deng preferably, >=95% homology；Most preferably, >=97% same Source property；) amino acid sequence.

In the present invention, in the present invention, PSCA single-chain antibody light chain VL, PSCA single-chain antibody heavy chain VH, PDL1 single-chain antibody Light chain VL, PDL1 single-chain antibody heavy chain VH, PDL1 single-chain antibody passes through humanization modified, and it is anti-to effectively reduce the anti-mouse of internal people The generation of (Human anti-mouse antibodies, HAMA), extends half-life period and the function and effect of scFv.

The transgene carrier that the present invention uses is the replication defect type slow virus carrier after recombination, can integrate exogenous sequences Enter host gene, it is disposable, it can not replicate and be proliferated, securely and reliably.

The costimulating factor region in OCTS Chimerical receptor in the present invention can be 4-1BB, ICOS, CD27, OX40, CD28, MYD88, IL1R1, CD70, TNFRSF19L, TNFRSF27, TNFRSF1OD, the tumours such as TNFRSF13B, TNFRSF18 One of necrosis factor superfamily (tumor necrosis factor receptor superfamily, TNFRSF), two Kind, three kinds, several, tens kinds of combination.

The replication defect type slow virus transgene carrier used in the present invention can be two generations or the slow virus of three generations Transgene carrier.

The fourth aspect of the invention provides the construction method of OCTS-CAR recombinant expression carrier, comprising the following steps:

A. it will contain ampicillin resistance gene AmpR sequence (SEQ ID NO.1), prokaryotic replions pUC Ori sequence (SEQ ID NO.2), Viral Replicon SV40 Ori sequence (SEQ ID NO.3), RSV promoter (SEQ ID NO.4), slow disease 5 terminal LTR of poison (SEQ ID NO.5), 3 terminal Self-Inactivating LTR (SEQ ID of slow virus NO.6), Gag cis element (SEQ ID NO.7), RRE cis element (SEQ ID NO.8), env cis element (SEQ ID NO.9), cPPT cis element (SEQ ID NO.10), ZsGreen1 green fluorescent protein (SEQ ID NO.11), IRES ribose Body binding sequence (SEQ ID NO.12), enhanced marmot hepatitis B posttranscriptional regulatory element (the SEQ ID of eWPRE NO.13 it) being stored on third generation slow virus skeleton plasmid pLenti-3G basic, this method is developed by our company and is constructed, and It is disclosed in " a kind of based on the CAR-T transgene carrier and its construction method of replication defective recombinant slow virus and application " 201610008360.5 in patent；

B. will coding CD8 leader membrane receptor signal peptide, PSCA single-chain antibody light chain VL, PSCA single-chain antibody heavy chain VH, Hinge between PDL1 single-chain antibody light chain VL, PDL1 single-chain antibody heavy chain VH, antibody inner hinge Inner-Linker, single-chain antibody Inter-Linker, CD8 Hinge Chimerical receptor hinge, CD8 Transmembrane Chimerical receptor transmembrane region, CD28 it is chimeric by The gene of body costimulating factor, OX40 Chimerical receptor costimulating factor and TCR Chimerical receptor t cell activation domain by digestion, Connection, recombining reaction are cloned into slow virus skeleton plasmid pLenti-3G basic, obtain the weight that the third generation is designed based on OCTS Group slow virus plasmid: pOCTS-PDL1PSCAs, pOCTS-PDL1PSCAt, element orders and number are as shown in Figure 4.In title, The last letter " s " represents two sections of scFv and is connected in series, and alphabetical " t " represents two sections of scFv corner connections.

C. recombinant slow virus plasmid step B obtained respectively with slow virus packaging plasmid pPac-GP, pPac-R with And memebrane protein plasmid pEnv-G transfects HEK293T/17 cell jointly, and gene transcript expression is carried out in HEK293T/17 cell Afterwards, packing successfully recombined lentivirus vector can be discharged into cells and supernatant, collect the upper of the recombined lentivirus vector for including Clear liquid；

D. obtained recombinant slow virus supernatant is purified using the column purification mode for filtering, adsorbing, eluting, respectively To CAR-T recombinant slow virus expression vector, (being named as lvOCTS-PDL1PSCAs, lvOCTS-PDL1PSCAt).

In addition, in stepb, the gene that encode PDL1 single-chain antibody can also be passed through together with other genes digestion, Connection, recombining reaction are cloned into slow virus skeleton plasmid pLenti-3G basic, obtain the weight that the third generation is designed based on OCTS Group slow virus plasmid.

The fifth aspect of the present invention provides a kind of OCTS-CAR-T cell, which is in genome It is imported with OCTS-CAR recombinant expression carrier or the T lymphocyte through the bis- targeting Chimeric antigen receptor modifications of anti-PSCA and PDL1.

After Workshop Production of the OCTS-CAR-T cell that the present invention uses by GMP rank, it can be used for human clinical trial.

The sixth aspect of the present invention provides OCTS-CAR-T cell and is preparing the application in treating malignant tumor drug.

Further, the treating malignant tumor drug is the drug for treating bladder cancer, cancer of pancreas, prostate cancer or gastric cancer.

The action and effect of invention

The present invention uses OCTS technology on the basis of current tradition CAR-T cell therapy, by Chimeric antigen receptor (CAR) Optimizing Reconstruction of structure enables Chimeric antigen receptor to identify two kinds of antigens of PSCA and PDL1, on the one hand expands significantly The identification range of CAR-T cell, the removing for cancer colonies is more thorough, and curative effect is more longlasting；On the other hand it avoids in batches CAR-T cell is cultivated, cost is greatlyd save, so that patient be avoided repeatedly to feed back different targeting CAR-T cells, has saved patient's Economic expenditure reduces the probability of recurrence, improves life in patients indirectly.

By series connection OCTS (Series OCTS) or the connection type of corner OCTS (Turn OCTS), by two sections of scFv It is integrated into a chimeric molecule, assigns the ability that the non-dependent mode of T lymphocyte HLA identifies two kinds of tumour antigens, relative to Traditional CAR-T cell can identify wider target, the further expansion removing range of tumour cell, with OCTS- The clinical investigation phase that will enter of CAR-T indicates that CAR-T cell therapy will enter for 2.0 epoch.

PSCA single-chain antibody light chain VL, PSCA single-chain antibody heavy chain VH, PDL1 single-chain antibody light chain VL of the present invention, PDL1 single-chain antibody heavy chain VH, PDL1 single-chain antibody pass through it is humanization modified, can effectively reduce the anti-mouse of internal people resist (Human Anti-mouse antibodies, HAMA) generation, extend half-life period and the function and effect of scFv, it is thin to increase OCTS-CAR-T Born of the same parents there are the times.

One kind of costimulating factor used in the present invention or several combination can increase the proliferation speed of cell after transduction The characteristics such as rate, time-to-live, killing-efficiency, immunological memory.

Therefore, OCTS-CAR-T cell of the present invention will treat to tumour cell and provide reliable guarantee.

Detailed description of the invention

Fig. 1 is the signal of bis- targetings Chimeric antigen receptor (OCTS) of the anti-PSCA based on OCTS-CAR and PDL1 of the invention Figure, wherein (A) is the schematic diagram of series connection OCTS (Series OCTS), (B) is the schematic diagram of corner OCTS (Turn OCTS).

Fig. 2 is slow virus carrier structural schematic diagram of the invention；Wherein (A) figure is the third generation slow virus that the present invention uses Carrier structure schematic diagram, (B) figure are the second generation and third generation slow virus carrier structure comparison schematic diagram.

Fig. 3 is the building flow chart of recombined lentivirus vector of the invention；Wherein (A) figure is slow virus skeleton plasmid The structural schematic diagram of pLenti-3G basic；(B) figure is the schematic diagram of two OCTS plasmids；(C) figure is slow virus packaging plasmid The structural schematic diagram of pPac-GP plasmid；(D) figure is the structural schematic diagram of slow virus packaging plasmid pPac-R plasmid；(E) figure is film The structural schematic diagram of albumen plasmid pEnv-G.

Fig. 4 is the element orders schematic diagram of bis- targetings Chimeric antigen receptor (OCTS) of CAR, wherein (A) figure is series connection OCTS The structural schematic diagram of (Series OCTS), (B) figure are the structural schematic diagrams of corner OCTS (Turn OCTS).

Fig. 5 is digestion prognostic chart and the digestion of recombinant slow virus plasmid pOCTS-PDL1PSCAs, pOCTS-PDL1PSCAt Agarose gel electrophoresis figure.

Wherein, A is the digestion prognostic chart and digestion agarose gel electrophoresis of recombinant slow virus plasmid pOCTS-PDL1PSCAs Figure: lane1 is the digestion prognostic chart of 1kb DNA ladder Marker, and band is from top to bottom successively are as follows: 10kb, 8kb, 6kb, 5kb,4kb,3.5kb,3kb,2.5kb,2kb,1.5kb,1kb,750bp,500bp,250bp；Lane2 is pOCTS- The Pvu I digestion of PDL1PSCAs predicts, band is from top to bottom successively are as follows: 11978bp, 883bp, 248bp；Lane3 is 1kb DNAladder Marker digestion agarose gel electrophoresis figure；Lane4 is the Pvu I digestion agarose of pOCTS-PDL1PSCAs Gel electrophoresis figure.

B is the digestion prognostic chart and digestion agarose gel electrophoresis figure of recombinant slow virus plasmid pOCTS-PDL1PSCAt: Lane1 is the digestion prognostic chart of 1kb DNA ladder Marker, and band is from top to bottom successively are as follows: 10kb, 8kb, 6kb, 5kb, 4kb,3.5kb,3kb,2.5kb,2kb,1.5kb,1kb,750bp,500bp,250bp；Lane2 is pOCTS-PDL1PSCAt Sac I digestion prediction, band is from top to bottom successively are as follows: 6798bp, 3443bp, 1756bp, 193bp；Lane3 is 1kb DNA Ladder Marker digestion agarose gel electrophoresis figure；Lane4 is the Sac I digestion Ago-Gel of pOCTS-PDL1PSCAt Electrophoretogram.

Fig. 6 is the titre testing result of recombined lentivirus vector.

Fig. 7 is the flow diagram of OCTS-CAR-T cell construction of the invention, comprising being separately cultured, activating, gene turn It leads, the stages such as OCTS-CAR-T cellular identification.

Fig. 8 is the detection of mycoplasma of OCTS-CAR-T cell as a result, lane1 is DL2000 marker, from top to bottom band Band is from top to bottom successively are as follows: 2kb, 1kb, 750bp, 500bp, 250bp, 100bp；Lane2 is positive control；Lane3 is yin Property control；Lane4 is PBS；Lane5 is lysate；Lane6 is OCTS-PDL1PSCAs-CAR-T cell；Lane7 is OCTS- PDL1PSCAt-CAR-T cell.

Fig. 9 is the transduction efficiency and immunophenotyping result of flow cytometer detection OCTS-CAR-T cell.Scheming A indicates OCTS- The transduction efficiency result of PDL1PSCAs-CAR-T cell；Scheming B indicates the immunophenotyping knot of OCTS-PDL1PSCAs-CAR-T cell Fruit；Scheming C indicates the transduction efficiency result of OCTS-PDL1PSCAt-CAR-T cell；Scheming D indicates OCTS-PDL1PSCAt-CAR-T The immunophenotyping result of cell；

Figure 10 is OCTS-PDL1PSCAs-CAR-T cell and OCTS-PDL1PSCAt-CAR-T under the conditions of different effect target ratios Cell is to target cell killing-efficiency histogram.

Specific embodiment

Following embodiment is merely to illustrate the present invention, and does not have to and limit the scope of the invention.Tool is not specified in embodiment The experimental method of concrete conditions in the establishment of a specific crime, usually according to normal condition, or according to the normal condition proposed by manufacturer.

Experimental material used in embodiment is as follows:

(1) slow virus skeleton plasmid pLenti-3G basic, slow virus packaging plasmid pPac-GP, pPac-R and film egg White matter grain pEnv-G, HEK293T/17 cell, homologous recombination enzyme, Oligo Annealing Buffer, mycoplasma test reagent Box, endotoxin detection kit, BCMA+K562, CD319+K562, CD38+K562, PDL1+K562, CD123+K562, BCMA+ CD123+K562, BCMA+CD319+K562, BCMA+CD38+K562, BCMA+PDL1+K562, K562 cell take wing purchased from generation (on Sea) biological medicine Science and Technology Ltd.；

(2) people's fresh peripheral blood is provided by health donors；

(3) OCTS-PDL1PSCAs, OCTS-PDL1PSCAtDNA DNA sequence dna combination designed, designed (referring to table 1), gives Shanghai Jierui Biology Engineering Co., Ltd's synthesis, and saved with oligonucleotides dry powder or plasmid form；

The design of 1 slow virus recombinant plasmid of table

(4) toolenzyme Cla I, EcoR I, Pvu I, Sac I, T4 DNA ligase are purchased from NEB company；

(5) 0.22 μm of -0.8 μm of PES filters are purchased from millipore company；It is D-PBS (-), 0.4% trypan blue, sieve, each Cell type culture dish, culture bag, culture plate are purchased from corning company；

(6)Opti-MEM、Pen-Srep、Hepes、FBS、AIM-V、RPMI 1640、DMEM、lipofectamine 3000 are purchased from invitrogen company；Biotinylated proteinL is purchased from GeneScript company；LDH detection kit Purchased from promega company；Ficoll lymphocyte separation medium is purchased from GE company；20% human serum albumin injection is purchased from Ztel shellfish Lin company；CryoPremium frozen stock solution, sorting buffer voluntarily configure；RIL-2, rIL-7, rIL-15, rIL-21 is purchased from Peprotech company；CD3 monoclonal antibody, CD28 monoclonal antibody, CD3/CD28 magnetic bead CD4/CD8 magnetic bead is purchased from Germany Miltenyi company；

(7) refrigerated centrifuge is purchased from U.S. ThermoScientific company；FACS flow cytometer is public purchased from Thermo Department；Fluorescence inverted microscope is purchased from Olympus company.

(8) CD4-FITC, CD8-APC are purchased from BioLegend company；0.9% physiological saline is purchased from Jin Mai company； ProteinL Magnetic Beads is purchased from BioVision company；PrimeSTAR, RetroNectin are purchased from Takara company； Phycoerythrin (PE)-conjugated streptavidin is purchased from BD Bioscience company；Plasmid extraction reagent Box, Ago-Gel QIAquick Gel Extraction Kit are purchased from MN company；Competent cell TOP10 is purchased from tiangen company；NaCl,KCl, Na₂HPO₄.12H₂O、KH₂PO₄、Trypsin、EDTA、CaCl₂, NaOH, PEG6000 be purchased from the raw work in Shanghai.

(9) DNeasy kit is purchased from Shanghai JaRa company；SA-HRP is purchased from Shanghai Yi Sheng company；

(10) primer: primer needed for designing amplification of DNA fragments and target site according to design of primers principle, the primer is by upper The synthesis of marine growth company, specifically:

EF1 α-F:5 '-ATTCAAAATTTTATCGATGCTCCGGTGCCCGTCAGT-3 ' (SEQ ID NO.28)

EF1 α-R:5 '-TCACGACACCTGAAATGGAAGA-3 ' (SEQ ID NO.29)

OCTS-F:CATTTCAGGTGTCGTGAGGATCCGCCACCATGGCGCTGCCGGTGAC (SEQ ID NO.30)

OCTS-R:GGGGAGGGAGAGGGGCTTAGCGCGGCGGCAGCG (SEQ ID NO.31)

IRES-F:GCCCCTCTCCCTCCCCC (SEQ ID NO.32)

IRES-R:ATTATCATCGTGTTTTTCAAAGGAA (SEQ ID NO.33)

PDL1scab-F:AAAACACGATGATAATGCCACCATGAACTCCTTCTCCACAAGCG (SEQ ID NO.34)

PDL1scab-R:AATCCAGAGGTTGATTGTCGACGAATTCTCATTTGCCCGGGCTCA G (SEQ ID NO.35)

WPRE-QPCR-F:5 '-CCTTTCCGGGACTTTCGCTTT-3 ' (SEQ ID NO.36)

WPRE-QPCR-R:5 '-GCAGAATCCAGGTGGCAACA-3 ' (SEQ ID NO.37)

Actin-QPCR-F:5 '-CATGTACGTTGCTATCCAGGC-3 ' (SEQ ID NO.38)

Actin-QPCR-R:5 '-CTCCTTAATGTCACGCACGAT-3 ' (SEQ ID NO.39)

One OCTS-CAR-T cell construction of embodiment

One, building, purifying, the detection of recombined lentivirus vector lvOCTS-PDL1PSCAs, lvOCTS-PDL1PSCAt

As shown in figure 3, the construction method of recombined lentivirus vector of the invention is as follows:

1, by people EF1 α promoter, OCTS structure [OCTS-PDL1PSCAs, OCTS-PDL1PSCAt], PDL1 single-chain antibody Be cloned into slow virus skeleton plasmid pLenti-3G basic, respectively obtain recombinant slow virus plasmid pOCTS-PDL1PSCAs, pOCTS-PDL1PSCAt。

(1) slow virus skeleton plasmid pLenti-3G basic is carried out using Cla I and EcoR I restriction enzyme double Digestion, product pass through 1.5% agarose gel electrophoresis, confirm the segment V1 of 5823bp, and be tapped and recovered and be placed in Eppendorf In pipe, corresponding segment (being shown in Table 2) is recycled with the Ago-Gel QIAquick Gel Extraction Kit of MN company, and measures the purity of product and dense Degree；

2 Ago-Gel recycling step of table

Step	Concrete operations
		Colloidal sol	Sol solutions are added in 200 μ l NTI/100mg gel ratios, 50 DEG C of water-baths are placed 5-10 minutes.
In conjunction with DNA	11000g is centrifuged 30 seconds, discards filtrate.
		Wash film	700 μ l NT3,11000g is added centrifugation 30 seconds, discards filtrate.
Wash film	It is primary to repeat third step
		It dries	11000g is centrifuged 1 minute, and the collecting pipe renewed is placed at room temperature for 1 minute.
Eluted dna	15-30 μ l NE is added, is placed at room temperature for 1 minute, 11000g is centrifuged 1 minute, collects filtrate.

(2) system in table 3, PCR are used using the SEQ ID NO.14 synthesized as template with primer EF1 α-F and EF1 α-R Cycling condition are as follows: 98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 2min) * 35cycle, 72 DEG C of 10min.Product passes through 1.5% agarose gel electrophoresis, confirms the segment a of 1208bp, and is tapped and recovered and is placed in Eppendorf pipe, with MN company Ago-Gel QIAquick Gel Extraction Kit recycle corresponding segment (being shown in Table 2), and measure the purity and concentration of product.

3 50 μ L PCR reaction system of table

(3) with primer OCTS-F and OCTS-R using the OCTS-PDL1PSCAs synthesized as template, using the system in table 3, PCR cycle condition are as follows: 98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product By 1.5% agarose gel electrophoresis, the segment b of 2373bp is confirmed, and be tapped and recovered and be placed in Eppendorf pipe, use MN The Ago-Gel QIAquick Gel Extraction Kit of company recycles corresponding segment (being shown in Table 2), and measures the purity and concentration of product；

(4) with primer OCTS-F and OCTS-R using the OCTS-PDL1PSCAt synthesized as template, using the system in table 3, PCR cycle condition are as follows: 98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product By 1.5% agarose gel electrophoresis, the segment c of 2448bp is confirmed, and be tapped and recovered and be placed in Eppendorf pipe, use MN The Ago-Gel QIAquick Gel Extraction Kit of company recycles corresponding segment (being shown in Table 2), and measures the purity and concentration of product；

(5) system in table 3, PCR are used using the SEQ ID NO.12 synthesized as template with primer I RES-F and IRES-R Cycling condition are as follows: 98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product passes through 1.5% agarose gel electrophoresis, confirms the segment d of 575bp, and is tapped and recovered and is placed in Eppendorf pipe, with MN company Ago-Gel QIAquick Gel Extraction Kit recycles corresponding segment (being shown in Table 2), and measures the purity and concentration of product；

(6) with primer PDL1scab-F and PDL1scab-R using the SEQ ID NO.27 synthesized as template, using in table 3 System, PCR cycle condition are as follows: 98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min. Product passes through 1.5% agarose gel electrophoresis, confirms the segment e of 1557bp, and be tapped and recovered and be placed in Eppendorf pipe, Corresponding segment (being shown in Table 2) is recycled with the Ago-Gel QIAquick Gel Extraction Kit of MN company, and measures the purity and concentration of product；

(7) by recombinant slow virus Plasmid DNA fragment combination (being shown in Table 4) with the ratio of 5 μ l total volumes and molar ratio 1:1:1:1 It is added in Eppendorf pipe, 15 μ l of homologous recombination enzyme reaction solution is added, be incubated for 30 minutes, be transferred on ice at 42 DEG C after mixing It places 2-3 minutes, reaction solution is added in 50 μ l TOP10, gently rotates to mix content, is placed 30 minutes in ice, it will Pipe is put into pre-heating into 42 DEG C of thermostat water bath heat shock 90 seconds, and quickly pipe is transferred in ice bath, makes cooling 2-3 points of cell Clock, every pipe add 900 μ l LB culture solutions, then pipe are transferred on 37 DEG C of shaking tables, and incubating 1 hour makes bacteria resuscitation, take 100 μ l Transformed bacteria solution be coated on Amp LB agar plate, be inverted plate, in constant incubator 37 DEG C culture, 16 hours.

4 recombinant slow virus Plasmid DNA fragment combination of table

Recombinant slow virus plasmid	Fragment combination
		pOCTS-PDL1PSCAs	a、b、d、e
pOCTS-PDL1PSCAt	a、c、d、e

Picked clones carry out bacterium colony PCR identification, identify that correctly clone is recombinant slow virus plasmid pOCTS- PDL1PSCAs, pOCTS-PDL1PSCAt carry out digestion identification (see Fig. 5) to correct clone, and send sequencing review result.

As shown in figure 5, the restriction enzyme digestion and electrophoresis result and digestion prediction result of two recombinant slow virus plasmids to be measured are almost the same, The construction method of above-mentioned recombinant slow virus plasmid is effective.

2, the packaging of recombined lentivirus vector lvOCTS-PDL1PSCAs, lvOCTS-PDL1PSCAt

2.1 solution allocation

(1) complete medium: taking out preheated fresh culture, and 10%FBS+5ml Pen-Srep is added, runs up and down Mix；

(2) NaCl 8g, KCl 0.2, Na 1XPBS solution: are weighed₂HPO₄.12H₂O 3.58g, KH₂PO4 0.24g is placed in In 1000ml beaker, the dissolution of 900ml Milli-Q grade ultrapure water is added, after the completion of dissolution, uses 1000ml graduated cylinder constant volume To 1000ml, 121 DEG C of high-temperature heat sterilization 20min；

(3) 0.25%Trypsin solution: weighing Trypsin 2.5g, and EDTA 0.19729g is placed in 1000ml beaker, 900ml 1XPBS dissolution is added, after the completion of dissolution, is settled to 1000ml using 1000ml graduated cylinder, 0.22 μM of filtration sterilization, for a long time Using can be reserved for -20 DEG C of refrigerators；

(4) 0.5M CaCl2 solution: 36.75g CaCl is weighed₂It is dissolved with 400ml Milli-Q grade ultrapure water；With Total volume is settled to 500ml by Milli-Q grade ultrapure water, is mixed；0.22 μm of filtration sterilization, packing are saved in 50ml centrifugation Guan Zhong, every pipe 45ml or so, 4 DEG C of preservations.

(5) 4.09g NaCl, 0.269g Na 2XHBS solution: are weighed₂HPO4,5.96g Hepes, with 400ml Milli- The dissolution of Q grade ultrapure water；After calibrating pH instrument, the pH of HBS solution is transferred to 7.05 with 2M NaOH solution.Adjust every bottle of HBS's It is 3ml or so that PH, which consumes 2M NaOH,.

2.2 HEK293T/17 cell culture

(1) the HEK293T/17 cell frozen is taken out from liquid nitrogen container, is quickly transferred in 37 DEG C of water-baths, after 1~2min It is transferred in super-clean bench, the liquid in cryopreservation tube is fully transferred to 10cm by sterile working²In culture dish, supply containing 10%FBS DMEM to 8mL/10cm²Dish, rear micro- sem observation cell, the degree of cell confluency are greater than 80% and are passed on for 24 hours；

(2) selection cell state is good, free of contamination HEK293T/17 cell, and every 2-6 culture dish is one group, by cell After pancreatin digestion, 4-12ml complete medium is drawn with electric pipettor, 2ml is added into each postdigestive culture dish, is avoided Culture dish dries out；All cells are blown and beaten into single cell suspension using 1ml pipettor, are transferred in medium bottle；

(3) remaining cell in above-mentioned 2-6 culture dish is transferred in medium bottle, and rinsed again with culture medium once Culture dish；

(4) culture medium bottle cap is covered tightly, turns upside down 10 times or so and mixes well cell suspension, cell is passed to 8-24 10cm²In culture dish, the cell density of every ware should about 4 × 10⁶A/10ml complete medium or so.If cell density and pre- The difference of phase is larger, then needs to count cell, then according to 4 × 10⁶The amount of a/ware is inoculated with；

(5) every 6 culture dishes arrange piles up for one, pays attention to keeping the cooperation between ware up and down.By culture dish or so, front and back is shaken It moves for several times, spreads out cell sufficiently, be then placed in 5%CO₂Incubator.Remaining cell does same processing；

(6) checking that institute's passage cell, cell confluency degree should be 70-80%, profile is full, and it is adherent good, it is trained in cell It supports and is uniformly distributed in ware；

(7) liquid is changed for cell, culture medium is replaced with into fresh complete medium, every ware 9ml, and by the CO of incubator₂It is dense Degree setting value is increased to 8%；

2.3 cell transfecting

(1) match DNA/CaCl according to N+0.5₂Solution.Every ware HEK293T/17 cell transfecting plasmid amount is according to following ratio It uses: recombinant slow virus plasmid (20 μ g), pPac-GP (15 μ g), pPac-R (10 μ g), pEnv-G (7.5 μ g).Take one it is new 0.5M CaCl2:0.25ml, 20 μ g:pPac-GP of recombinant slow virus plasmid, 15 μ g:pPac-R, 10 μ g is added in 5ml centrifuge tube: 7.5 μ g of pEnv-G, supplement ultrapure water close the lid to 0.5ml, mix well；

(2) a 5mL centrifuge tube is separately taken, 0.5ml DNA/CaCl2 solution is added.Turbula shaker is opened, a hand is taken The firmly upper end of 5ml centrifuge tube makes tube bottom contact oscillating end, and liquid is made to scatter on tube wall flowing, and another hand moves 1mL by one Liquid rifle is drawn 2 × HBS of 0.5mL solution, is slowly added dropwise into centrifuge tube, coutroi velocity, being dripped off with half a minute is advisable.2×HBS It after addition, after persistent oscillation 5 seconds, stops oscillation, can be directly added into the cell for needing to transfect；

(3) take a ware cell, the 1mL calcium in centrifuge tube turned into drop and is added, make as far as possible calcium turn reagent be distributed to it is whole In a culture dish；

(4) it after calcium turns liquid addition, is marked in ware lid, culture dish is released to another 5%CO₂In incubator. Ensure that culture dish is horizontal positioned, every pile culture dish does not exceed 6.In 5%CO₂(6-8h) is placed in incubator；

(5) by the CO of first incubator₂Concentration set point adjusts back to 5%；

After (6) 24 hours, cell state is checked.Cell confluency degree should be 80-85% or so, in good condition.It will culture Base siphons away, replacement 10ml fresh DMEM complete medium；

After (7) 48 hours, transfection efficiency is observed.Most cells are still adherent.It can be seen that thin more than 95% Born of the same parents can have green fluorescence.By the same virus packaging supernatant collection to together, and continue addition 10mL into culture dish Fresh culture；

After (8) 72 hours, the same vial supernatant is collected into the virus together, collected twice again can be placed on one It rises, abandons culture dish；Recombined lentivirus vector lvOCTS-PDL1PSCAs, lvOCTS- are contained in the supernatant collected at this time PDL1PSCAt。

3, ion exchange chromatography recombined lentivirus vector；

(1) supernatant of collection is used into Thermo vacuum pump, is filtered through 0.22 μm -0.8 μm of PES filter, remove impurity elimination Matter；

(2) 1.5M NaCl 250mM Tris-HCl (pH6-8) is added into supernatant in the ratio of 1:1~1:10；

(3) 2 ion exchange columns are placed in series, with 4ml 1M NaOH, 4ml 1M NaCl, 5ml 0.15M NaCl 25mM Tris-HCl (pH6-8) solution successively crosses column；

(4) solution obtained in step 2 is given to ion exchange column loading with the speed of 1-10ml/min by peristaltic pump；

(5) it after whole supernatants cross column, is cleaned using 10ml 0.15M NaCl 25mM Tris-HCl (pH6-8) solution One time；

(6) it is eluted according to applied sample amount using 1-5ml 1.5M NaCl 25mM Tris-HCl (pH6-8), collection is washed De- liquid；

(7) eluent is divided into 25 to 50 μ L mono- to manage, freezes -80 DEG C of refrigerators, carry out long-term preservation；

4, recombined lentivirus vector titer determination；

(1) 24 orifice plates is taken to be inoculated with 293T cell.Every hole cell is 5 × 10⁴A, added culture volume is 500ul, different Difference, cell confluency when carrying out virus infection are 40%-60% to the vitro growth rates of type；

(2) prepare 3 sterile EP tubes, the fresh complete medium (DMEM in high glucose+10% of 90ul is added in each pipe FBS) after inoculating cell 24 hours, the cell in two holes is taken to be counted with blood counting chamber, the actual number of cell when determining infection, It is denoted as N；

(3) it takes virus stock solution used 10ul to be determined to be added in first pipe, after mixing gently, 10ul is taken to be added to second In a pipe, a to the last pipe is then successively operated；410ul complete medium (DMEM in high glucose+10% is added in every pipe ), FBS final volume 500ul；

(4) 20 hours after infection starts, culture supernatant is removed, 500 μ l complete medium (DMEM in high glucose+10% are changed to FBS), 5%CO₂Continue culture 48 hours；

After (5) 72 hours, luciferase expression situation is observed, under normal circumstances, fluorecyte number increases and phase with extension rate It should reduce, and take pictures；

(6) 0.2ml0.25% pancreas enzyme -EDTA solution digestion cell is used, is placed 1 minute at 37 DEG C.It is purged with culture medium whole A cell face, is collected by centrifugation cell.Illustrate extracting genomic DNA according to DNeasy kit.200 are added in each sample cell μ l eluent is washed lower DNA and is quantified；

(7) preparing target DNA detection qPCRmix general pipeline I, (QPCR primer sequence is SEQ ID NO.42---SEQ ID NO.43):

Component in 5 qPCRmix general pipeline I of table

2×TaqMan Master Mix	25μl×n
		Forward primer(100pmol ml-1)	0.1μl×n
Reverse primer(100pmol ml-1)	0.1μl×n
		Probe(100pmol ml-1)	0.1μl×n
H₂O	19.7μl×n

N=number of reactions. is for example: overall reaction number is 40, by 2 × TaqMan of 1ml Universal PCR Master Mix, 4 μ l forward primer, 4 μ l reverse primer, 4 μ l probe and 788 μ l H2O is mixed Be placed on ice after concussion.

(8) preparing internal reference DNA detection qPCRmix pipe II, (QPCR primer sequence is SEQ ID NO.44---SEQ ID NO.45):

Component in 6 qPCRmix general pipeline II of table

2×TaqMan Master Mix	25μl×n
		10×RNaseP primer/probe mix	2.5μl×n
H₂O	17.5μl×n

N=number of reactions. is for example: overall reaction number is 40, by 2 × TaqMan of 1ml Universal PCR Master Mix, 100 μ l 10 × RNaseP primer/probe mix and 700 μ l H₂O is mixed, and is placed on ice after concussion On.

(9) PCR system is completed in 96 hole PCR plates of pre-cooling to establish.45 μ l are respectively taken to be added to each row of A-D from general pipeline I Hole in, from respectively taking 45 μ l to be added in the hole of each row of E-G in general pipeline II.

(10) 5 μ l plasmid standards and sample to be tested genomic DNA are taken to be added in A-D row respectively, each sample repeats 1 It is secondary.Separately stay 1 hole that the water of 5 μ l is added as no template control (no-template control).

(11) 5 μ l genome standard items and sample to be tested genomic DNA are taken to be added in E-G row respectively, each sample weight It is 1 time multiple.Separately stay 1 hole that the water of 5 μ l is added as no template control (no-template control).

(12) used quantitative PCR apparatus is 7500 quantitative system of ABI PRISM.Cycling condition setting are as follows: 50 DEG C 2 minutes, 95 DEG C 10 minutes, followed by 95 DEG C 15 seconds, 60 DEG C of 40 of 1 minute circulations.

(13) data are analyzed: the slow virus carrier copy number integrated in the DNA sample measured is demarcated with genome number, Obtain the viral copy number of every genome conformity.

Titre (integration units per ml, IU ml^-1) calculation formula it is as follows:

IU ml^-1=(C × N × D × 1000)/V

Wherein: C=is averaged the viral copy number of every genome conformity

The number (about 1 × 10 of cell when N=infects⁵)

The extension rate of D=viral vectors

The volume number for the dilution virus that V=is added

The titre results of recombined lentivirus vector lvOCTS-PDL1PSCAs, lvOCTS-PDL1PSCAt are as shown in Figure 6.

Two, OCTS-CAR-T cell construction

Fig. 7 shows OCTS-CAR-T cell construction process, the construction method of the OCTS-CAR-T cell in the present embodiment It is as follows:

1, PBMC is separated.

(1) health donors fresh peripheral blood 50ml is extracted；

(2) blood taking bag spray is wiped twice of alcohol, and dried.

(3) haemocyte in bag is sucked out with 50ml syringe and is moved in new 50ml pipe.

(4) 400g, 20 DEG C of centrifugation 10min.

(5) upper plasma being moved on in new 50ml centrifuge tube, 56 DEG C, 30min inactivates blood plasma, restores to room temperature, 2000g is centrifuged 30min, takes supernatant stand-by into 50ml centrifuge tube.

(6) it is mended with D-PBS (-) to 50ml, tightens lid, be mixed by inversion.

(7) 2 new 50ml centrifuge tubes are taken, 15ml Ficoll lymphocyte separation medium is added in every pipe.

(8) haemocyte dilution 25ml is carefully added on every pipe Ficoll.800g, 20 DEG C of centrifugation 20min.

(9) liquid is divided into four layers in centrifuge tube, be respectively as follows: from top to bottom the plasma layer (recycling stand-by) of yellow, tunica albuginea layer, The cell mixing layer of colorless and transparent Ficoll layer, reddish black.

(10) tunica albuginea layer is carefully drawn into new 50ml centrifuge tube, is added D-PBS (-) to 50ml, is mixed by inversion rear 500g, 20 DEG C of centrifugation 10min.

(11) 25ml5% human serum albumin is added and cell, 400g, 20 DEG C of centrifugation 10min are resuspended.

(12) supernatant is abandoned, 25ml5% human serum albumin is added, cell precipitation is resuspended, and cross 70um sieve, count.

(13) 1 part is taken to contain 1.25x10⁸Cells is for activating；Remaining cell suspension 400g, 20 DEG C of centrifugation 10min add CryoPremium simultaneously freezes.

2, CD4/CD8 positive T cell sorts.

(1) PBMC of acquisition is counted, with 80ul/10⁷Sorting buffer is added in the ratio of cells, and cell precipitation is resuspended.

(2) again with 20uL/10⁷CD4/CD8 magnetic bead is added in the ratio of cells, and piping and druming is put into 4 DEG C after mixing and is incubated for 15min。

(3) magnetic bead-cell mixture is taken out, with 2ml/10⁷Sorting buffer is added in the ratio of cells, after being mixed by inversion, 250g, 4 DEG C of centrifugation 10min.

(4) with 500ul/10⁸Sorting buffer is added in the ratio of cells, and cell precipitation is resuspended.

(5) on tweezers clamping LS splitter to magnetic frame.

(6) prepare 2 15ml centrifuge tubes simultaneously, mark respectively: CD4-/CD8- cell liquid (A pipe), CD4+/CD8+ cell Liquid (B pipe).

(7) 3ml dissociating buffer rinse LS is used, and connects buffer with A pipe.

(8) cell-magnetic bead mixed liquor is added, 3ml buffer is added after dripping off and rinses pillar (when each no liquid remains again New liquid is added), in total three times, collection obtains CD4/CD8- cell.

(9) LS splitter is separated with magnetic frame, connects cell suspension with B pipe, 5ml buffer is added, by and with pillar internal plug It slightly firmly rinses, is collected as CD4+/CD8+ cell, sampling counts.

(10) 1 × 10 is pressed⁶/ml-4×10⁶The cell density of/ml AIM-V culture medium resuspension cell precipitation, and addition 2 × 10⁵~1 × 10⁶The U/L IFN-γ factor.

3, t cell activation.

(1) the previous day is mentioned by 1 × 10³Ug/L~1 × 10⁴Ug/L CD3 monoclonal antibody and 1 × 10³Ug/L~1 × 10⁴24 orifice plates are added in ug/L CD28 monoclonal antibody, and sealed membrane sealing, 4 DEG C are coated with overnight；

(2) coated T75 bottles is taken out, coating buffer is outwelled, washed once with D-PBS (-), and the cell that sorting obtains is hanged Liquid is inoculated into T75 bottles, is shaken up, and 37 DEG C, 5%CO are put into₂It is cultivated in incubator.

4, CAR gene transfer and OCTS-CAR-T cell Fiber differentiation.

(1) the previous day coating 1 × 10 is proposed³Ug/L~1 × 10⁴In in 24 orifice plates, sealed membrane seals ug/L RetroNectin Mouthful, 4 DEG C are coated with overnight.

(2) into 24 orifice plates, according to every hole 5 × 10⁵Cell concentration is separately added by the amount of MOI=5~20 lvOCTS123BCMAs、lvOCTS319BCMAs、lvOCTS38BCMAs、lvOCTS-PDL1BCMAs、lvOCTS123BCMAt、 LvOCTS319BCMAt, lvOCTS38BCMAt, lvOCTS-PDL1BCMAt slow virus transgene carrier, while adding containing 2 × 10⁵~5 × 10⁵U/L rIL-2,5 × 10³Ng/L~1 × 10⁴Ng/L rIL-7,5 × 10³Ng/L~1 × 10⁴ng/L rIL- 15,5 × 10³Ng/L~1 × 10⁴Ng/L rIL-21 and 37 DEG C of AIM-V culture medium, 5%CO containing 10% autoserum₂Continue to train It supports.

5, OCTS-CAR-T cell expansion ex vivo.

(1) every 2 days equivalent is added containing 2 × 10⁵~5 × 10⁵U/LrIL-2,5 × 10³Ng/L~1 × 10⁴Ng/LrIL-7,5 ×10³Ng/L~1 × 10⁴Ng/LrIL-15,5 × 10³Ng/L~1 × 10⁴Ng/LrIL-21 and AIM- containing 10% autoserum V culture medium, maintains pH value between 6.5~7.5, and cell density maintains 5 × 10⁵~2 × 10⁶Between/ml, 37 DEG C, 5% CO₂Continue culture 10-14 days.

(2) the 7th days or so, the OCTS-CAR-T cell of culture was frozen for subsequent detection.

2 OCTS-CAR-T cell Pathogen test of embodiment and detection of expression

One, endotoxin detects；

(1) endotoxin working standard is 15EU/ branch；

(2) sensitivity of the limulus reagent λ=0.25EU/ml, 0.5ml/ pipe

(3) endotoxin standard dilutes: taking endotoxin standard one, is diluted to 4 λ and 2 λ in proportion with BET water respectively Dissolution, sealed membrane sealing, concussion dissolution 15min；One step of every dilution should all mix 30s on eddy mixer when dilution；

(4) it is loaded: taking reagents several, every addition BET water 0.5ml dissolution, packing to several endotoxin-frees tries Guan Zhong, every pipe 0.1ml.Wherein 2 are negative control pipe, and BET water 0.1ml is added；2 are positive control pipe, and 2 λ concentration are added Endotoxin working standard solution 0.1ml；2 are Sample Positive control tube, and the sample that 0.1ml contains 2 λ endotoxin standards is added (the endotoxin standard solution 1ml=2ml of the sample to be tested 1ml+4 λ of 20 times of dilution is dilute containing 2 λ endotoxin standards for product solution Release 40 times of samples).

Be added 0.1mL sample in sample cell, dilution ratio be shown in Table 7,37 ± 1 DEG C of water-baths (or incubator) heat preservation 60 ± 1min；

The endotoxin testing result of 7 endotoxin dilution ratio of table and OCTS-CAR-T cell

Extension rate	Stoste	5	10	20	40	80	160
								Corresponding EU/ml	0.25	1.25	2.5	5	10	20	40
OCTS-PDL1PSCAs-CAR-T	(+)	(+)	(-)	(-)	(-)	(-)	(-)
								OCTS-PDL1PSCAt-CAR-T	(+)	(+)	(-)	(-)	(-)	(-)	(-)

As shown in table 7, the endotoxin content of all cells is respectively less than 2.5EU/ml, meets the Pharmacopoeia of the People's Republic of China In be less than 10EU/ml standard.

Two, detection of mycoplasma

(1) first three day is being tested, cell sample is cultivated with antibiotic-free culture medium；

(2) (cell number is greater than 1*10 to collection 1ml cell suspending liquid⁵), it is placed in 1.5ml centrifuge tube；

(3) 13000g is centrifuged 1min, collects precipitating, discards culture medium；

(4) 500ul PBS pipette tips pressure-vaccum or vortex oscillation is added, precipitating is resuspended.13000g is centrifuged 5min；

(5) step 4 is repeated once；

(6) 50 μ l Cell Lysis Buffer are added after mixing well, to be incubated in 55 DEG C of water-baths with pipette tips pressure-vaccum 20min；

(7) sample is placed in 95 DEG C and heats 5min；

(8) after 13000g is centrifuged 5min, take 5 μ l supernatants as template, 25 μ l PCR reaction systems are as follows: 6.5 μ l of ddH20, 1 μ l of Myco Mix, 2x Taq Plus Mix Master (Dye Plus) 12.5 μ l, 5 μ l of template；PCR cycle condition are as follows: 95 DEG C 30sec, (95 DEG C of 30sec, 56 DEG C of 30sec, 72 DEG C of 30sec) * 30cycle, 72 DEG C of 5min.

Detection of mycoplasma is as the result is shown see Fig. 8, the judgement explanation of positive control, negative control and sample in Fig. 8 It is shown in Table 8.As shown in figure 8, being free of mycoplasma in OCTS-CAR-T cell.

The judgement explanation of 8 positive control of table, negative control and sample

Three, the detection of OCTS gene transduction efficiency and immunophenotyping detection；

(1) T cell after viral transduction is collected, cell is resuspended with D-PBS (-) solution containing 1~4% human serum albumin And it is adjusted to 1 × 10⁶/ml。

(2) D-PBS (-) solution 1ml containing 1~4% human serum albumin is added into centrifuge tube and mixes, 350g centrifugation 5min abandons supernatant.

(3) it is primary to repeat step 2.

(4) cell is resuspended with D-PBS (-) solution containing 1~4% human serum albumin of 0.2ml, and is added into centrifuge tube 1mg/ul proteinL, 5ulCD4-FITC, the 5ul CD8-APC of 1ul is mixed, 4 DEG C of incubation 45min.

(5) D-PBS (-) solution of the 1ml containing 1~4% human serum albumin is added into centrifuge tube and mixes, 350g centrifugation 5min abandons supernatant.

(6) step 5 is repeated twice.

(7) cell is resuspended in D-PBS (-) solution with 0.2ml containing 1~4% human serum albumin, and is added into centrifuge tube 0.2ul PE-SA is mixed, and 37 DEG C are protected from light incubation 15min.

(8) D-PBS (-) solution of 1ml containing 1~4% human serum albumin is added into centrifuge tube to weigh and mix, 350g centrifugation 5min abandons supernatant.

(9) cell precipitation is resuspended with 1ml D-PBS (-) solution, 350g is centrifuged 5min, abandons supernatant.

(10) step 9 is repeated twice.

(11) cell precipitation is resuspended with 0.4ml D-PBS (-) solution, flow cytometer is detected.

OCTS gene transduction efficiency and immunophenotyping test result are as shown in figure 9, the OCTS-CAR-T cell prepared Most of efficiency of infection between 37%~50%, the ratio of CD4 positive cell and CD8 positive cell is located at 1: 3~3: 1 Between, follow-up function detection can be carried out.

The Function detection of 3 OCTS-CAR-T cell of embodiment

One, target cell fragmentation effect is assessed.

(1) target cell [PSCA+K562, PDL1+K562, PDL1+PSCA+K562, K562 cell] and effect are cultivated respectively Cell [OCTS-CAR-T cell], the grouping that effector cell is incubated for single target cell and double target cells altogether respectively are shown in Table 9.

The group list that 9 effector cell of table is incubated for single target cell and double target cells altogether respectively

Effector cell	Target cell 1	Target cell 2	Target cell 3
				OCTS-PDL1PSCAs-CAR-T	PDL1⁺K562	PSCA⁺K562	PDL1⁺PSCA⁺K562
OCTS-PDL1PSCAt-CAR-T	PDL1⁺K562	PSCA⁺K562	PDL1⁺PSCA⁺K562

(2) target cell 4x10 is collected⁵Cells and OCTS-CAR-T cell 2.8x10⁶Cells, 800g, 6min are centrifuged, in abandoning Clearly；

(3) target cell and effector cell are resuspended respectively with 1ml D-PBS (-) solution, supernatant is abandoned in 800g, 6min centrifugation；

(4) it is primary to repeat step 3；

(5) effector cell is resuspended with 700ul culture medium (+1~10%FBS of AIM-V culture medium), with 2ml culture medium (AIM- + 1~10%FBS of V culture medium) target cell is resuspended；

(6) experimental port that setting effect target ratio is 1: 1,5: 1,10: 1, grouping situation is as shown in table 9, and control group is arranged (K562 cell), every group of 3 multiple holes；

(7) centrifugation of 250g, 5min plate；

It (8) 37 DEG C, is cultivated 4 hours in 5%CO2 incubator；

(9) centrifugation of 250g, 5min plate；

(10) take the 50ul supernatant in each hole into new 96 orifice plate, and every hole is added 50ul substrate solution and (is protected from light behaviour Make)；

(11) it is protected from light and is incubated for 25min；

(12) 50ul terminate liquid is added in every hole；

(13) microplate reader detects 490nm absorbance；

(14) 3 multiple holes are averaged；The light absorption value of all experimental ports, Target cell wells and effector cell hole is subtracted into training Support the mean value of base background light absorption value；The light absorption value of target cell maximum value is subtracted to the mean value of volume correction control light absorption value.

(15) it brings the corrected value obtained in step (14) into following formula, calculates caused by each effect target ratio Percentage of cytotoxicity.

Killing-efficiency=(experimental port-effector cell hole-Target cell wells)/(target cell largest hole-Target cell wells) × 100%

The results are shown in Figure 10, and OCTS-CAR-T has preferable killing effect to respective single target cell and double target cells Fruit, the CAR-T that the CAR-T cell of Turn OCTS structure is slightly above Series OCTS structure to the killing-efficiency of target cell are thin Born of the same parents.

It is above-mentioned the experimental results showed that, pass through in traditional CAR structure antigen recognizing district transformation formed OCTS structure, energy It enough significantly improves OCTS-CAR-T cell recognition and kills the range of target cell, therefore OCTS-CAR-T cell will be in future The bis- sun of the BCMA positive/CD319 positive/CD38 positive/CD123 positive/bis- positives of the PDL1 positive/BCMA, CD319/BCMA, CD38 It is played in the cell therapies of malignant tumours such as the property/bis- positives of BCMA, CD123/BCMA, PDL1 bis- positives Huppert's disease huge Big effect.

The basic principles, main features and advantages of the present invention have been shown and described above.The technology of the industry Personnel are it should be appreciated that the present invention is not limited to the above embodiments, and the above embodiments and description only describe this The principle of invention, various changes and improvements may be made to the invention without departing from the spirit and scope of the present invention, these changes Change and improvement all fall within the protetion scope of the claimed invention.The claimed scope of the invention by appended claims and its Equivalent defines.

SEQUENCE LISTING

<110>Shanghai You Kadi biological medicine Science and Technology Ltd.

<120>the bis- targeting Chimeric antigen receptors of the anti-PSCA based on OCTS-CAR and PDL1, encoding gene and expression vector

<130>claims specification

<160> 39

<170> PatentIn version 3.5

<210> 1

<211> 861

<212> DNA

<213>artificial sequence

<400> 1

atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt ttgccttcct 60

gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca gttgggtgca 120

cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag ttttcgcccc 180

gaagaacgtt ttccaatgat gagcactttt aaagttctgc tatgtggcgc ggtattatcc 240

cgtattgacg ccgggcaaga gcaactcggt cgccgcatac actattctca gaatgacttg 300

gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt aagagaatta 360

tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct gacaacgatc 420

ggaggaccga aggagctaac cgcttttttg cacaacatgg gggatcatgt aactcgcctt 480

gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga caccacgatg 540

cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg gcgaactact tactctagct 600

tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc acttctgcgc 660

tcggcccttc cggctggctg gtttattgct gataaatctg gagccggtga gcgtgggtct 720

cgcggtatca ttgcagcact ggggccagat ggtaagccct cccgtatcgt agttatctac 780

acgacgggga gtcaggcaac tatggatgaa cgaaatagac agatcgctga gataggtgcc 840

tcactgatta agcattggta a 861

<210> 2

<211> 674

<212> DNA

<213>artificial sequence

<400> 2

cccgtagaaa agatcaaagg atcttcttga gatccttttt ttctgcgcgt aatctgctgc 60

ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt tgccggatca agagctacca 120

actctttttc cgaaggtaac tggcttcagc agagcgcaga taccaaatac tgtccttcta 180

gtgtagccgt agttaggcca ccacttcaag aactctgtag caccgcctac atacctcgct 240

ctgctaatcc tgttaccagt ggctgctgcc agtggcgata agtcgtgtct taccgggttg 300

gactcaagac gatagttacc ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc 360

acacagccca gcttggagcg aacgacctac accgaactga gatacctaca gcgtgagcta 420

tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca ggtatccggt aagcggcagg 480

gtcggaacag gagagcgcac gagggagctt ccagggggaa acgcctggta tctttatagt 540

cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg 600

cggagcctat ggaaaaacgc cagcaacgcg gcctttttac ggttcctggc cttttgctgg 660

ccttttgctc acat 674

<210> 3

<211> 147

<212> DNA

<213>artificial sequence

<400> 3

atcccgcccc taactccgcc cagttccgcc cattctccgc cccatggctg actaattttt 60

tttatttatg cagaggccga ggccgcctcg gcctctgagc tattccagaa gtagtgagga 120

ggcttttttg gaggcctaga cttttgc 147

<210> 4

<211> 228

<212> DNA

<213>artificial sequence

<400> 4

gtagtcttat gcaatactct tgtagtcttg caacatggta acgatgagtt agcaacatgc 60

cttacaagga gagaaaaagc accgtgcatg ccgattggtg gaagtaaggt ggtacgatcg 120

tgccttatta ggaaggcaac agacgggtct gacatggatt ggacgaacca ctgaattgcc 180

gcattgcaga gatattgtat ttaagtgcct agctcgatac aataaacg 228

<210> 5

<211> 180

<212> DNA

<213>artificial sequence

<400> 5

ggtctctctg gttagaccag atctgagcct gggagctctc tggctaacta gggaacccac 60

tgcttaagcc tcaataaagc ttgccttgag tgcttcaagt agtgtgtgcc cgtctgttgt 120

gtgactctgg taactagaga tccctcagac ccttttagtc agtgtggaaa atctctagca 180

<210> 6

<211> 234

<212> DNA

<213>artificial sequence

<400> 6

tgctagagat tttccacact gactaaaagg gtctgaggga tctctagtta ccagagtcac 60

acaacagacg ggcacacact acttgaagca ctcaaggcaa gctttattga ggcttaagca 120

gtgggttccc tagttagcca gagagctccc aggctcagat ctggtctaac cagagagacc 180

cagtacaagc aaaaagcaga tcttattttc gttgggagtg aattagccct tcca 234

<210> 7

<211> 353

<212> DNA

<213>artificial sequence

<400> 7

atgggtgcga gagcgtcagt attaagcggg ggagaattag atcgcgatgg gaaaaaattc 60

ggttaaggcc agggggaaag aaaaaatata aattaaaaca tatagtatgg gcaagcaggg 120

agctagaacg attcgcagtt aatcctggcc tgttagaaac atcagaaggc tgtagacaaa 180

tactgggaca gctacaacca tcccttcaga caggatcaga agaacttaga tcattatata 240

atacagtagc aaccctctat tgtgtgcatc aaaggataga gataaaagac accaaggaag 300

ctttagacaa gatagaggaa gagcaaaaca aaagtaagac caccgcacag caa 353

<210> 8

<211> 233

<212> DNA

<213>artificial sequence

<400> 8

aggagctttg ttccttgggt tcttgggagc agcaggaagc actatgggcg cagcctcaat 60

gacgctgacg gtacaggcca gacaattatt gtctggtata gtgcagcagc agaacaattt 120

gctgagggct attgaggcgc aacagcatct gttgcaactc acagtctggg gcatcaagca 180

gctccaggca agaatcctgg ctgtggaaag atacctaaag gatcaacagc tcc 233

<210> 9

<211> 489

<212> DNA

<213>artificial sequence

<400> 9

tggggatttg gggttgctct ggaaaactca tttgcaccac tgctgtgcct tggaatgcta 60

gttggagtaa taaatctctg gaacagattg gaatcacacg acctggatgg agtgggacag 120

agaaattaac aattacacaa gcttaataca ctccttaatt gaagaatcgc aaaaccagca 180

agaaaagaat gaacaagaat tattggaatt agataaatgg gcaagtttgt ggaattggtt 240

taacataaca aattggctgt ggtatataaa attattcata atgatagtag gaggcttggt 300

aggtttaaga atagtttttg ctgtactttc tatagtgaat agagttaggc agggatattc 360

accattatcg tttcagaccc acctcccaac cccgagggga cccgacaggc ccgaaggaat 420

agaagaagaa ggtggagaga gagacagaga cagatccatt cgattagtga acggatctcg 480

acggttaac 489

<210> 10

<211> 119

<212> DNA

<213>artificial sequence

<400> 10

ttttaaaaga aaagggggga ttggggggta cagtgcaggg gaaagaatag tagacataat 60

agcaacagac atacaaacta aagaattaca aaaacaaatt acaaaaattc aaaatttta 119

<210> 11

<211> 696

<212> DNA

<213>artificial sequence

<400> 11

atggcccagt ccaagcacgg cctgaccaag gagatgacca tgaagtaccg catggagggc 60

tgcgtggacg gccacaagtt cgtgatcacc ggcgagggca tcggctaccc cttcaagggc 120

aagcaggcca tcaacctgtg cgtggtggag ggcggcccct tgcccttcgc cgaggacatc 180

ttgtccgccg ccttcatgta cggcaaccgc gtgttcaccg agtaccccca ggacatcgtc 240

gactacttca agaactcctg ccccgccggc tacacctggg accgctcctt cctgttcgag 300

gacggcgccg tgtgcatctg caacgccgac atcaccgtga gcgtggagga gaactgcatg 360

taccacgagt ccaagttcta cggcgtgaac ttccccgccg acggccccgt gatgaagaag 420

atgaccgaca actgggagcc ctcctgcgag aagatcatcc ccgtgcccaa gcagggcatc 480

ttgaagggcg acgtgagcat gtacctgctg ctgaaggacg gtggccgctt gcgctgccag 540

ttcgacaccg tgtacaaggc caagtccgtg ccccgcaaga tgcccgactg gcacttcatc 600

cagcacaagc tgacccgcga ggaccgcagc gacgccaaga accagaagtg gcacctgacc 660

gagcacgcca tcgcctccgg ctccgccttg ccctga 696

<210> 12

<211> 575

<212> DNA

<213>artificial sequence

<400> 12

gcccctctcc ctcccccccc cctaacgtta ctggccgaag ccgcttggaa taaggccggt 60

gtgcgtttgt ctatatgtta ttttccacca tattgccgtc ttttggcaat gtgagggccc 120

ggaaacctgg ccctgtcttc ttgacgagca ttcctagggg tctttcccct ctcgccaaag 180

gaatgcaagg tctgttgaat gtcgtgaagg aagcagttcc tctggaagct tcttgaagac 240

aaacaacgtc tgtagcgacc ctttgcaggc agcggaaccc cccacctggc gacaggtgcc 300

tctgcggcca aaagccacgt gtataagata cacctgcaaa ggcggcacaa ccccagtgcc 360

acgttgtgag ttggatagtt gtggaaagag tcaaatggct cacctcaagc gtattcaaca 420

aggggctgaa ggatgcccag aaggtacccc attgtatggg atctgatctg gggcctcggt 480

gcacatgctt tacatgtgtt tagtcgaggt taaaaaacgt ctaggccccc cgaaccacgg 540

ggacgtggtt ttcctttgaa aaacacgatg ataat 575

<210> 13

<211> 592

<212> DNA

<213>artificial sequence

<400> 13

aatcaacctc tggattacaa aatttgtgaa agattgactg gtattcttaa ctatgttgct 60

ccttttacgc tatgtggata cgctgcttta atgcctttgt atcatgctat tgcttcccgt 120

atggctttca ttttctcctc cttgtataaa tcctggttgc tgtctcttta tgaggagttg 180

tggcccgttg tcaggcaacg tggcgtggtg tgcactgtgt ttgctgacgc aacccccact 240

ggttggggca ttgccaccac ctgtcagctc ctttccggga ctttcgcttt ccccctccct 300

attgccacgg cggaactcat cgccgcctgc cttgcccgct gctggacagg ggctcggctg 360

ttgggcactg acaattccgt ggtgttgtcg gggaaatcat cgtcctttcc ttggctgctc 420

gcctgtgttg ccacctggat tctgcgcggg acgtccttct gctacgtccc ttcggccctc 480

aatccagcgg accttccttc ccgcggcctg ctgccggctc tgcggcctct tccgcgtctt 540

cgccttcgcc ctcagacgag tcggatctcc ctttgggccg cctccccgcc tg 592

<210> 14

<211> 1178

<212> DNA

<213>artificial sequence

<400> 14

gctccggtgc ccgtcagtgg gcagagcgca catcgcccac agtccccgag aagttggggg 60

gaggggtcgg caattgaacc ggtgcctaga gaaggtggcg cggggtaaac tgggaaagtg 120

atgtcgtgta ctggctccgc ctttttcccg agggtggggg agaaccgtat ataagtgcag 180

tagtcgccgt gaacgttctt tttcgcaacg ggtttgccgc cagaacacag gtaagtgccg 240

tgtgtggttc ccgcgggcct ggcctcttta cgggttatgg cccttgcgtg ccttgaatta 300

cttccacctg gctgcagtac gtgattcttg atcccgagct tcgggttgga agtgggtggg 360

agagttcgag gccttgcgct taaggagccc cttcgcctcg tgcttgagtt gaggcctggc 420

ctgggcgctg gggccgccgc gtgcgaatct ggtggcacct tcgcgcctgt ctcgctgctt 480

tcgataagtc tctagccatt taaaattttt gatgacctgc tgcgacgctt tttttctggc 540

aagatagtct tgtaaatgcg ggccaagatc tgcacactgg tatttcggtt tttggggccg 600

cgggcggcga cggggcccgt gcgtcccagc gcacatgttc ggcgaggcgg ggcctgcgag 660

cgcggccacc gagaatcgga cgggggtagt ctcaagctgg ccggcctgct ctggtgcctg 720

gcctcgcgcc gccgtgtatc gccccgccct gggcggcaag gctggcccgg tcggcaccag 780

ttgcgtgagc ggaaagatgg ccgcttcccg gccctgctgc agggagctca aaatggagga 840

cgcggcgctc gggagagcgg gcgggtgagt cacccacaca aaggaaaagg gcctttccgt 900

cctcagccgt cgcttcatgt gactccactg agtaccgggc gccgtccagg cacctcgatt 960

agttctcgag cttttggagt acgtcgtctt taggttgggg ggaggggttt tatgcgatgg 1020

agtttcccca cactgagtgg gtggagactg aagttaggcc agcttggcac ttgatgtaat 1080

tctccttgga atttgccctt tttgagtttg gatcttggtt cattctcaag cctcagacag 1140

tggttcaaag tttttttctt ccatttcagg tgtcgtga 1178

<210> 15

<211> 63

<212> DNA

<213>artificial sequence

<400> 15

atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60

ccg 63

<210> 16

<211> 318

<212> DNA

<213>artificial sequence

<400> 16

gatattcagc tgacccagag cccgagcagc ctgagcgcga gcgtgggcga tcgcgtgacc 60

attacctgca gcgcgagcag cagcgtgcgc tttattcatt ggtatcagca gaaaccgggc 120

aaagcgccga aacgcctgat ttatgatacc agcaaactgg cgagcggcgt gccgagccgc 180

tttagcggca gcggcagcgg caccgatttt accctgacca ttagcagcct gcagccggaa 240

gattttgcga cctattattg ccagcagtgg ggcagcagcc cgtttacctt tggccagggc 300

accaaagtgg aaattaaa 318

<210> 17

<211> 336

<212> DNA

<213>artificial sequence

<400> 17

gaagtgcagc tggtggaaag cggcggcggc ctggtgcagc cgggcggcag cctgcgcctg 60

agctgcgcgg cgagcggctt taacattaaa gattattata ttcattgggt gcgccaggcg 120

ccgggcaaag gcctggaatg ggtggcgtgg attgatccgg aatatggcga tagcgaattt 180

gtgccgaaat ttcagggccg cgcgaccatg agcgcggata ccagcaaaaa caccgcgtat 240

ctgcagatga acagcctgcg cgcggaagat accgcggtgt attattgcaa aaccggcggc 300

ttttggggcc gcggcaccct ggtgaccgtg agcagc 336

<210> 18

<211> 333

<212> DNA

<213>artificial sequence

<400> 18

gatattgtgc tgacccagag cccggcgagc ctggcggtga gcccgggcca gcgcgcgacc 60

attacctgcc gcgcgagcca gagcgtgagc accagcagca gcagctttat gcattggtat 120

cagcagaaac cgggccagcc gccgaaactg ctgattaaat atgcgagcaa cctggaaagc 180

ggcgtgccgg cgcgctttag cggcagcggc agcggcaccg attttaccct gaccattaac 240

ccggtggaag cgaacgatac cgcgaactat tattgccagc atagctggga aattccgtat 300

acctttggcc agggcaccaa actggaaatt aaa 333

<210> 19

<211> 348

<212> DNA

<213>artificial sequence

<400> 19

gaagtgcagc tggtggaaag cggcggcggc ctggtgaaac cgggcggcag cctgcgcctg 60

agctgcgcgg cgagcggctt tatttttcgc agctatggca tgagctgggt gcgccaggcg 120

ccgggcaaag gcctggaatg ggtggcgagc attagcagcg gcggcagcac ctattatccg 180

gatagcgtga aaggccgctt taccattagc cgcgataacg cgaaaaacag cctgtatctg 240

cagatgaaca gcctgcgcgc ggaagatacc gcggtgtatg attgcgcgcg cggctatgat 300

agcggctttg cgtattgggg ccagggcacc ctggtgaccg tgagcagc 348

<210> 20

<211> 45

<212> DNA

<213>artificial sequence

<400> 20

ggtggcggtg gctcgggcgg tggtgggtcg ggtggcggcg gatct 45

<210> 21

<211> 57

<212> DNA

<213>artificial sequence

<400> 21

gcctccacca agggcccatc tgtcttcccc ctggccccca gctcctctgg ctccgga 57

<210> 22

<211> 141

<212> DNA

<213>artificial sequence

<400> 22

accacgacgc cagcgccgcg accaccaaca ccggcgccca ccatcgcgtc gcagcccctg 60

tccctgcgcc cagaggcgtg ccggccagcg gcggggggcg cagtgcacac gagggggctg 120

gacttcgcct gtgatatcta c 141

<210> 23

<211> 66

<212> DNA

<213>artificial sequence

<400> 23

atctgggcgc ccttggccgg gacttgtggg gtccttctcc tgtcactggt tatcaccctt 60

tactgc 66

<210> 24

<211> 123

<212> DNA

<213>artificial sequence

<400> 24

aggagtaaga ggagcaggct cctgcacagt gactacatga acatgactcc ccgccgcccc 60

gggcccaccc gcaagcatta ccagccctat gccccaccac gcgacttcgc agcctatcgc 120

tcc 123

<210> 25

<211> 111

<212> DNA

<213>artificial sequence

<400> 25

cgccgcgatc agcgcctgcc gccggatgcg cataaaccgc cgggcggcgg cagctttcgc 60

accccgattc aggaagaaca ggcggatgcg catagcaccc tggcgaaaat t 111

<210> 26

<211> 336

<212> DNA

<213>artificial sequence

<400> 26

cgcgtgaaat ttagccgcag cgcggatgcg ccggcgtatc agcagggcca gaaccagctg 60

tataacgaac tgaacctggg ccgccgcgaa gaatatgatg tgctggataa acgccgcggc 120

cgcgatccgg aaatgggcgg caaaccgcgc cgcaaaaacc cgcaggaagg cctgtataac 180

gaactgcaga aagataaaat ggcggaagcg tatagcgaaa ttggcatgaa aggcgaacgc 240

cgccgcggca aaggccatga tggcctgtat cagggcctga gcaccgcgac caaagatacc 300

tatgatgcgc tgcatatgca ggcgctgccg ccgcgc 336

<210> 27

<211> 1557

<212> DNA

<213>artificial sequence

<400> 27

atgaactcct tctccacaag cgccttcggt ccagttgcct tctccctggg gctgctcctg 60

gtgttgcctg ctgccttccc tgccccagat attgtgctga cccagagccc ggcgagcctg 120

gcggtgagcc cgggccagcg cgcgaccatt acctgccgcg cgagccagag cgtgagcacc 180

agcagcagca gctttatgca ttggtatcag cagaaaccgg gccagccgcc gaaactgctg 240

attaaatatg cgagcaacct ggaaagcggc gtgccggcgc gctttagcgg cagcggcagc 300

ggcaccgatt ttaccctgac cattaacccg gtggaagcga acgataccgc gaactattat 360

tgccagcata gctgggaaat tccgtatacc tttggccagg gcaccaaact ggaaattaaa 420

ggtggcggtg gctcgggcgg tggtgggtcg ggtggcggcg gatctgaagt gcagctggtg 480

gaaagcggcg gcggcctggt gaaaccgggc ggcagcctgc gcctgagctg cgcggcgagc 540

ggctttattt ttcgcagcta tggcatgagc tgggtgcgcc aggcgccggg caaaggcctg 600

gaatgggtgg cgagcattag cagcggcggc agcacctatt atccggatag cgtgaaaggc 660

cgctttacca ttagccgcga taacgcgaaa aacagcctgt atctgcagat gaacagcctg 720

cgcgcggaag ataccgcggt gtatgattgc gcgcgcggct atgatagcgg ctttgcgtat 780

tggggccagg gcaccctggt gaccgtgagc agcggtggcg gtggctcggg cggtggtggg 840

tcgggtggcg gcggatctga accgaaaagc tgcgacaaaa ctcacacatg cccaccgtgc 900

ccagcacctg aactcctggg gggaccgtca gtcttcctct tccccccaaa acccaaggac 960

accctcatga tctcccggac ccctgaggtc acatgcgtgg tggtggacgt gagccacgaa 1020

gaccctgagg tcaagttcaa ctggtacgtg gacggcgtgg aggtgcataa tgccaagaca 1080

aagccgcggg aggagcagta caacagcacg taccgtgtgg tcagcgtcct caccgtcctg 1140

caccaggact ggctgaatgg caaggagtac aagtgcaagg tctccaacaa agccctccca 1200

gcccccatcg agaaaaccat ctccaaagcc aaagggcagc cccgagaacc acaggtgtac 1260

accctgcccc catcccggga ggagatgacc aagaaccagg tcagcctgac ctgcctggtc 1320

aaaggcttct atcccagcga catcgccgtg gagtgggaga gcaatgggca gccggagaac 1380

aactacaaga ccacgcctcc cgtgctggac tccgacggct ccttcttcct ctacagcaag 1440

ctcaccgtgg acaagagcag gtggcagcag gggaacgtct tctcatgctc cgtgatgcac 1500

gaggctctgc acaaccacta cacgcagaag agcctctccc tgtctccggg taaatga 1557

<210> 28

<211> 36

<212> DNA

<213>artificial sequence

<400> 28

attcaaaatt ttatcgatgc tccggtgccc gtcagt 36

<210> 29

<211> 22

<212> DNA

<213>artificial sequence

<400> 29

tcacgacacc tgaaatggaa ga 22

<210> 30

<211> 46

<212> DNA

<213>artificial sequence

<400> 30

catttcaggt gtcgtgagga tccgccacca tggcgctgcc ggtgac 46

<210> 31

<211> 33

<212> DNA

<213>artificial sequence

<400> 31

ggggagggag aggggcttag cgcggcggca gcg 33

<210> 32

<211> 17

<212> DNA

<213>artificial sequence

<400> 32

gcccctctcc ctccccc 17

<210> 33

<211> 25

<212> DNA

<213>artificial sequence

<400> 33

attatcatcg tgtttttcaa aggaa 25

<210> 34

<211> 44

<212> DNA

<213>artificial sequence

<400> 34

aaaacacgat gataatgcca ccatgaactc cttctccaca agcg 44

<210> 35

<211> 46

<212> DNA

<213>artificial sequence

<400> 35

aatccagagg ttgattgtcg acgaattctc atttgcccgg gctcag 46

<210> 36

<211> 21

<212> DNA

<213>artificial sequence

<400> 36

cctttccggg actttcgctt t 21

<210> 37

<211> 20

<212> DNA

<213>artificial sequence

<400> 37

gcagaatcca ggtggcaaca 20

<210> 38

<211> 21

<212> DNA

<213>artificial sequence

<400> 38

catgtacgtt gctatccagg c 21

<210> 39

<211> 21

<212> DNA

<213>artificial sequence

<400> 39

ctccttaatg tcacgcacga t 21

Claims

1. a kind of bis- targeting Chimeric antigen receptors of anti-PSCA and PDL1 based on OCTS-CAR, which is characterized in that including successively going here and there Join CD8 leader membrane receptor signal peptide, the double antigen binding domains, CD8 Hinge Chimerical receptor hinge, CD8 of connection Transmembrane Chimerical receptor transmembrane region, CD28 Chimerical receptor costimulating factor, OX40 Chimerical receptor costimulating factor and TCR Chimerical receptor t cell activation domain,

Wherein, double antigen binding domains include PSCA the and PDL1 single-chain antibody to connect or corner connection type connects Hinge Inter-Linker between heavy chain VH and light chain VL, antibody inner hinge Inner-Linker and single-chain antibody；

The gene order of the CD8 leader membrane receptor signal peptide is encoded as shown in SEQ ID NO.15；It is single-stranded anti-to encode PSCA The gene order of body light chain VL encodes the gene order such as SEQ ID of PSCA single-chain antibody heavy chain VH as shown in SEQ ID NO.16 Shown in NO.17；The gene order of PDL1 single-chain antibody light chain VL is encoded as shown in SEQ ID NO.18, encodes PDL1 single-chain antibody The gene order of heavy chain VH is as shown in SEQ ID NO.19；The gene order such as SEQ of encoding antibody inner hinge Inner-Linker Shown in ID NO.20；The gene order of hinge Inter-Linker is as shown in SEQ ID NO.21 between coding single-chain antibody；Coding The gene order of the CD8 Hinge Chimerical receptor hinge is as shown in SEQ ID NO.22；Encode the CD8 The gene order of Transmembrane Chimerical receptor transmembrane region is as shown in SEQ ID NO.23；Encode the CD28 Chimerical receptor The gene order of costimulating factor is as shown in SEQ ID NO.24；Encode the gene sequence of the OX40 Chimerical receptor costimulating factor Column are as shown in SEQ ID NO.25；Encode the gene order such as SEQ ID NO.26 institute in the TCR Chimerical receptor t cell activation domain Show.

2. including anti-PSCA and PDL1 bis- targeting Chimeric antigen receptor genes of the coding based on OCTS-CAR described in claim 1 Recombinant expression carrier, which is characterized in that further include:

Expression vector and people's EF1 α promoter,

Wherein, the gene order of people EF1 α promoter is as shown in SEQ ID NO.14,

The expression vector is Lentiviral, retrovirus expression vector, adenovirus expression carrier, adenovirus correlation Virus expression carrier or plasmid.

3. including anti-PSCA and PDL1 bis- targeting Chimeric antigen receptor genes of the coding based on OCTS-CAR described in claim 1 Recombinant expression carrier, which is characterized in that further include:

Expression vector, people's EF1 α promoter and the gene for encoding PDL1 single-chain antibody,

Wherein, the gene order of people EF1 α promoter encodes the gene order of PDL1 single-chain antibody as shown in SEQ ID NO.14 As shown in SEQ ID NO.27,

4. according to claim 2 or 3 includes the anti-PSCA and PDL1 of the coding described in claim 1 based on OCTS-CAR The recombinant expression carrier of double targeting Chimeric antigen receptor genes, it is characterised in that:

Wherein, the expression vector is third generation Lentiviral pLenti-3G basic, the Lentiviral packet Include the sequence of AmpR containing ampicillin resistance gene, prokaryotic replions pUC Ori sequence, Viral Replicon SV40 Ori sequence, RSV promoter, 5 terminal LTR of slow virus, 3 terminal Self-Inactivating LTR of slow virus, Gag are cis- Element, RRE cis element, env cis element, cPPT cis element, ZsGreen1 green fluorescent protein, IRES ribosomes combine The enhanced marmot hepatitis B posttranscriptional regulatory element of sequence, eWPRE.

5. a kind of construction method for constructing recombinant expression carrier as claimed in claim 2, which comprises the following steps:

A. it will contain ampicillin resistance gene AmpR sequence, prokaryotic replions pUC Ori sequence, Viral Replicon SV40 Ori Sequence, RSV promoter, 5 terminal LTR of slow virus, 3 terminal Self-Inactivating LTR of slow virus, Gag cis element, RRE cis element, env cis element, cPPT cis element, ZsGreen1 green fluorescent protein, IRES core The enhanced marmot hepatitis B posttranscriptional regulatory element of sugared body binding sequence, eWPRE is stored in third generation slow virus skeleton matter On grain pLenti-3G basic；

B. CD8 leader membrane receptor signal peptide, PSCA single-chain antibody light chain VL, PSCA single-chain antibody heavy chain VH, PDL1 will be encoded Hinge Inter- between single-chain antibody light chain VL, PDL1 single-chain antibody heavy chain VH, antibody inner hinge Inner-Linker, single-chain antibody Linker, CD8 Hinge Chimerical receptor hinge, CD8 Transmembrane Chimerical receptor transmembrane region, CD28 Chimerical receptor pierce altogether The gene of the factor, OX40 Chimerical receptor costimulating factor and TCR Chimerical receptor t cell activation domain is swashed by digestion, connection, again Group reaction is cloned into slow virus skeleton plasmid pLenti-3G basic, obtains the recombinant lentiviral disease that the third generation is designed based on OCTS Toxin grain；

C. recombinant slow virus plasmid step B obtained respectively with slow virus packaging plasmid pPac-GP, pPac-R and film Albumen plasmid pEnv-G transfects HEK293T/17 cell jointly, after carrying out gene transcript expression in HEK293T/17 cell, packet Dressing up function recombined lentivirus vector can be discharged into cells and supernatant, collect the supernatant for the recombined lentivirus vector for including；

D. obtained recombinant slow virus supernatant is purified using the column purification mode for filtering, adsorbing, eluting, is respectively obtained CAR-T recombinant slow virus expression vector.

6. a kind of construction method for constructing recombinant expression carrier as claimed in claim 3, which comprises the following steps:

B. CD8 leader membrane receptor signal peptide, PSCA single-chain antibody light chain VL, PSCA single-chain antibody heavy chain VH, PDL1 will be encoded Hinge Inter- between single-chain antibody light chain VL, PDL1 single-chain antibody heavy chain VH, antibody inner hinge Inner-Linker, single-chain antibody Linker, CD8 Hinge Chimerical receptor hinge, CD8 Transmembrane Chimerical receptor transmembrane region, CD28 Chimerical receptor pierce altogether It is single-stranded to swash the factor, the gene of OX40 Chimerical receptor costimulating factor and TCR Chimerical receptor t cell activation domain and coding PDL1 The gene of antibody is cloned into slow virus skeleton plasmid pLenti-3G basic by digestion, connection, recombining reaction, obtains the The recombinant slow virus plasmid that three generations is designed based on OCTS；

7. a kind of OCTS-CAR-T cell is to be imported with recombinant expression carrier described in claim 3 or 4 in genome or through weighing Benefit require 1 described in anti-PSCA and PDL1 it is bis- targeting Chimeric antigen receptors modification T lymphocytes.

8. OCTS-CAR-T cell as claimed in claim 7 is preparing the application in treating malignant tumor drug.

9. OCTS-CAR-T cell according to claim 8 is preparing the application in treating malignant tumor drug, feature It is, the treating malignant tumor drug is the drug for treating bladder cancer, cancer of pancreas, prostate cancer or gastric cancer.