CN107164410B - It is a kind of based on the prostate cancer CAR-T therapy vector and its construction method of OCTS technology and application - Google Patents

Abstract

The prostate cancer CAR-T therapy vector based on OCTS technology that the invention discloses a kind of, including slow virus skeleton plasmid, people EF1 α promoter (SEQ ID NO.14), OCTS Chimerical receptor structural domain and PDL1 single-chain antibody；OCTS Chimerical receptor structural domain includes: CD8 leader Chimerical receptor signal peptide (SEQ ID NO.15), PSMA single-chain antibody light chain VL (SEQ ID NO.16), PSMA single-chain antibody heavy chain VH (SEQ ID NO.17), PDL1 single-chain antibody light chain VL (SEQ ID NO.18), PDL1 single-chain antibody heavy chain VH (SEQ ID NO.19), antibody inner hinge Inner-Linker (SEQ ID NO.20), hinge Inter-Linker (SEQ ID NO.21) between single-chain antibody, CD8 Hinge Chimerical receptor hinge (SEQ ID NO.22), CD8 Tr Ansmembrane Chimerical receptor transmembrane region (SEQ ID NO.23), TCR Chimerical receptor t cell activation domain (SEQ ID NO.26) and Chimerical receptor costimulating factor region.In addition, the invention also discloses the construction method of the carrier and its applications in the drug of preparation treatment prostate cancer.

Description

A kind of prostate cancer CAR-T therapy vector and its construction method based on OCTS technology And application

Technical field

The invention belongs to field of medical biotechnology, and in particular to before a kind of carrier more particularly to a kind of technology based on OCTS Column gland cancer CAR-T therapy vector.Moreover, it relates to construction method and the application of the carrier.

Background technique

The theoretical basis of immunotherapy of tumors is that immune system has identification tumor associated antigen, regulation body attack tumour The ability of cell (cell dissolution of high degree of specificity).Generation nineteen fifty, Burnet and Thomas propose " immunosurveillance " theory, Think that the tumour cell for the mutation that often will appear in body can be identified by immune system and be removed, is established for immunotherapy of tumors Determined theoretical basis [Burnet FM.Immunological aspects of malignant disease.Lancet, 1967；1:1171-4].Then, various tumour immunotherapies include cytokine therapy, monoclonal antibody therapy, adoptive immunity The sequential uses such as therapy, vaccine therapy are in clinic.

A kind of more advanced tumour immunotherapy in 2013 --- CAR-T therapy is used successfully to clinic, and is demonstrated by preceding institute not Some clinical efficacies.CAR-T, full name are Chimeric Antigen Receptor T-Cell Immunotherapy, are fitted into Antigen receptor T cell immunotherapy.The therapy is the means by transgenosis, by promoter, antigen recognizing district, costimulation because The chimeric molecule that son, effect area etc. collectively constitute imports in T cell genome, to make T cell to the identification of target cell, letter Number transduction, killing etc. functions combine together, realize specific killing [the Eleanor J.Cheadle, et to target cell al.CAR T cells:driving the road from the laboratory to the clinic.Immunological Reviews 2014.Vol.257:91–106].CAR-T therapy is clinically most leading to be had The CLT019 of Novartis recurs refractory Patients With Acute Lymphoblastic Leukemia using CLT019 treatment, and six months tumours get nowhere Survival rate reaches 67%, wherein longest response time reached more than 2 years.General headquarters are located at the excellent card enlightening biology in Shanghai of Chinese Shanghai Pharmaceutical Technology Co., Ltd cooperates with hospital, and by the end of 2 months 2017, treatment was recurred refractory acute lymphoblastic leukemia and suffered from altogether Person 36, wherein complete 24, alleviation ratio reaches 66.6%.This is that the subversiveness of anticancer research is broken through.CAR-T cell therapy May be most possible one of the means for curing cancer, and by " Science " magazine be chosen as 2013 annual ten big technological breakthroughs it It is first.

CAR-T is significant in efficacy in terms of the neoplastic hematologic disorder of the several types such as treatment B- lymphocytic leukemia at present, still There is also some limitations, the previous Chimeric antigen receptor of mesh can only identify that a kind of antigenic targets, tumour cell are a complexity Group, after the tumour cell containing corresponding antigens is removed, the tumour cell without corresponding antigens can be proliferated rapidly, at one section Between after lead to tumor recurrence.So to make CAR-T identification that can identify two kinds of antigens simultaneously, just there are two scheme is optional: first is that will Two groups of Chimeric antigen receptor buildings enter a slow virus transgene carrier, disposably enter two groups of Chimeric antigen receptor transductions Primary T lymphocyte；Second is that being transduceed in two times with two slow virus transgene carriers, two groups of Chimeric antigen receptors are transduceed respectively Into primary T lymphocyte.

The shortcomings that scheme one, is to occupy the valuable capacity of slow virus transgene carrier, is unfavorable for loading other Functional Units Part；Transgene carrier packaging efficiency is low；Gene transduction efficiency is very low, is difficult transduction and enters in primary T lymphocyte.

The shortcomings that scheme two, is to need by transduceing twice, and the overall efficiency transduceed twice is lower, transduces cycle time Long, primary cell is easy aging, proliferative capacity is caused to fail, and killing ability decline influences tumor clearance curative effect.

PSMA is expressed in preceding gland cancer with special height.With 7El l-C5 all 184 parts of prostates detected In sample, [Bostwick DG, Pacelli A, Blute M, the et al.Prostate specific such as Bostwick membrane antigen expression in prostatic intraepithelial neoplasia and adenocarcinoma.Cancer.1998；82 (11): 2256-2261] therefrom have found that positive immune reacts, Benign Epithelial Tissue and prostate cancer high malignancy cell, positive rate is respectively 69.5% and 80.2%, wherein the staining power in cancerous tissue Most strong, they also also obtain similar results in the cohort study of other 200 parts of prostate samples.

PD-L1 overexpression in most cancerous tissues, including NSCLC, melanoma, breast cancer, glioma, lymph [the Intlekofer AM, Thompson such as tumor, leukaemia and various urological cancers, tumor in digestive tract, system genitale tumour CB.At the bench:preclinical rationale for CTLA-4 and PD-1 blockade as cancer Immunotherapy [J] .J Leukoc Biol, 2013,94 (1): 25-39.] .Parsa in the tumour cell of mouse and people, It was found that the IFN-γ of T cell abnormal secretion, IFN-γ can induce the PD-L1 high on tumour cell express [Ding H, Wu X, Wu J,et al.Delivering PD-1 inhibitory signal concomitant with blocking ICOS co-stimulation suppresses lupus-like syndrome in autoimmune BXSB mice[J].Clin Immunol,2006,118(2/3):258-267.].PD-L1 high expression, can be by inhibiting RAS and PI3K/AKT signal logical Road, and then cell cycle regulation checkpoint albumen and cell multiplication related protein expression, eventually lead to the inhibition of T cell proliferation [11].The experiment in vitro such as Dong and mouse model also found that the activation of PD-1/PD-L1 signal path can be with inducing specific CTL Tune is died, and the cell toxicant lethal effect sensibility of CTL is declined, and promotes tumour cell that immunologic escape [Dong H, Strome occurs SE,Salomao DR,et al.Tumor-associated B7-H1 promotes T-cell apoptosis:a potential mechanism of immune evasion[J].Nat Med,2002,8(8):793-800.]。

Currently, there has been no the relevant reports for overcoming CAR-T of the disadvantages mentioned above for two kinds of antigens of PSMA, PD-L1 to treat.

Summary of the invention

One of the technical problem to be solved in the present invention is to provide a kind of prostate cancer CAR-T treatment load based on OCTS technology Body.Firstly, it only needs once to transduce, transduction efficiency is high, does not influence the curative effect of CAR-T treatment；Secondly, it is not take up slow virus The valuable capacity of transgene carrier is conducive to load other function element.Third can effectively close PDL1, blocking immunity negative regulator Signal path can be clinically used for the immune escape for inhibiting tumour, improve the curative effect of CAR-T cellular immunotherapy.

The second technical problem to be solved by the present invention is to provide the construction method of the carrier.

The third technical problem to be solved by the present invention is to provide the application of the carrier.

In order to solve the above technical problems, the present invention adopts the following technical scheme:

In one aspect of the invention, a kind of prostate cancer CAR-T therapy vector based on OCTS technology, including slow disease are provided Malicious skeleton plasmid, people EF1 α promoter, OCTS Chimerical receptor structural domain and PDL1 single-chain antibody；

The slow virus skeleton plasmid includes: the AmpR containing ampicillin resistance gene for purpose bacterial strain massive amplification Sequence, as shown in SEQ ID NO.1；For the prokaryotic replions pUC Ori sequence of plasmid replication, as shown in SEQ ID NO.2； For enhancing the Viral Replicon SV40 Ori sequence of the duplication in eukaryocyte, as shown in SEQ ID NO.3；For slow virus The slow virus of packaging packs cis element；ZsGreen1 green fluorescent protein, as shown in SEQ ID NO.11；IRES ribosomes knot Sequence is closed, as shown in SEQ ID NO.12；The enhanced marmot hepatitis B of eWPRE for enhancing the expression efficiency of transgenosis Posttranscriptional regulatory element, as shown in SEQ ID NO.13；

The sequence of the people EF1 α promoter is as shown in SEQ ID NO.14；

The OCTS Chimerical receptor structural domain includes: the CD8 leader Chimerical receptor signal as shown in SEQ ID NO.15 Peptide, PSMA single-chain antibody light chain VL, the PSMA single-chain antibody weight as shown in SEQ ID NO.17 as shown in SEQ ID NO.16 Chain VH, PDL1 single-chain antibody light chain VL, the PDL1 single-chain antibody as shown in SEQ ID NO.19 as shown in SEQ ID NO.18 It is heavy chain VH, the antibody inner hinge Inner-Linker as shown in SEQ ID NO.20, single-stranded anti-as shown in SEQ ID NO.21 Hinge Inter-Linker, CD8 Hinge Chimerical receptor hinge, such as SEQ ID NO.23 as shown in SEQ ID NO.22 between body Shown in CD8 Transmembrane Chimerical receptor transmembrane region, the TCR Chimerical receptor T cell as shown in SEQ ID NO.26 swash Domain and Chimerical receptor costimulating factor region living；Chimerical receptor costimulating factor region be selected from 4-1BB, ICOS, CD27, OX40、CD28、MYD88、IL1R1、CD70、TNFRSF19L、TNFRSF27、TNFRSF1OD、TNFRSF13B、TNFRSF18、 The tumor necrosis factor superfamilies such as CD134 (tumor necrosis factor receptor superfamily, TNFRSF) In the combination of any one or more.

The slow virus packaging cis element can use second generation slow virus carrier, can also use third generation slow virus Carrier.The slow virus packaging cis element includes: the slow virus as shown in SEQ ID NO.5 using second generation slow virus carrier 5terminal LTR, slow virus 3terminal Self-Inactivating LTR, such as SEQ as shown in SEQ ID NO.6 Gag cis element shown in ID NO.7, the RRE cis element as shown in SEQ ID NO.8, as shown in SEQ ID NO.9 Env cis element, the cPPT cis element as shown in SEQ ID NO.10.The slow virus packaging cis element uses the third generation Slow virus carrier includes: slow virus 5terminal LTR as shown in SEQ ID NO.5, the slow disease as shown in SEQ ID NO.6 Malicious 3terminal Self-Inactivating LTR, the Gag cis element as shown in SEQ ID NO.7, such as SEQ ID RRE cis element shown in NO.8, the env cis element as shown in SEQ ID NO.9, the cPPT as shown in SEQ ID NO.10 Cis element, and the RSV promoter as shown in SEQ ID NO.4.Present invention preferably employs third generation slow virus carriers.

Preferably, the PSMA single-chain antibody light chain VL as shown in SEQ ID NO.16, as shown in SEQ ID NO.17 PSMA single-chain antibody heavy chain VH, the PDL1 single-chain antibody light chain VL as shown in SEQ ID NO.18, such as SEQ ID NO.19 institute PDL1 single-chain antibody heavy chain VH, antibody inner hinge Inner-Linker, such as SEQ ID as shown in SEQ ID NO.20 shown Hinge Inter-Linker uses series connection mode or corner connection type between single-chain antibody shown in NO.21；The string Join connection type specifically: PDL1 single-chain antibody light chain VL and PSMA single-chain antibody light chain VL uses hinge between single-chain antibody Inter-Linker connection, PDL1 single-chain antibody light chain VL and PDL1 single-chain antibody heavy chain VH use antibody inner hinge Inner- Linker connection, PSMA single-chain antibody light chain VL and PSMA single-chain antibody heavy chain VH are connected using antibody inner hinge Inner-Linker It connects, i.e. pOCTS-PDL1PSMAs (see Fig. 4 A and Fig. 4 C)；The corner connection type specifically: PSMA single-chain antibody light chain VL It is connect with PSMA single-chain antibody heavy chain VH using antibody inner hinge Inner-Linker, PDL1 single-chain antibody light chain VL and PSMA are mono- Chain antibody heavy chain VH uses hinge Inter-Linker connection between single-chain antibody, and PDL1 single-chain antibody heavy chain VH and PSMA are single-stranded anti- Body light chain VL uses hinge Inter-Linker connection between single-chain antibody, i.e. pOCTS-PDL1PSMAt (see Fig. 4 B and Fig. 4 C).

Preferably, the sequence of the PDL1 single-chain antibody is as shown in SEQ ID NO.27.

Preferably, the enhanced marmot hepatitis B posttranscriptional regulatory element of the eWPRE has the enhancing of 6 nucleotide prominent Become, specifically: g.396G > A, g.397C > T, g.398T > C, g.399G > A, g.400A > T, g.411A > T.

Preferably, entire OCTS expression of structural gene is started by the people EF1 α promoter, the CD8 leader is chimeric Receptor signal peptide is located at the N-terminal of OCTS coded sequence, for guiding OCTS albumen to be positioned at cell membrane；The PSMA single-chain antibody This two groups of single-chain antibodies of light chain VL, PSMA single-chain antibody heavy chain VH, PDL1 single-chain antibody light chain VL, PDL1 single-chain antibody heavy chain VH Double antigen recognizing districts are combined into, for identification corresponding target antigen；The CD8Hinge Chimerical receptor hinge is for scFv to be anchored On the outside of cell membrane；The CD8 Transmembrane Chimerical receptor transmembrane region is used to entire Chimerical receptor being fixed on cell On film；The CD28 Chimerical receptor costimulating factor is made for stimulating T lymphocyte Activation In Vitro and interior tumor cell to kill With；For promoting, T lymphocyte is proliferated the CD134 Chimerical receptor costimulating factor and cytokine secretion, enhancing tumour immunity have Conducive to the long-term surviving of memory T cell；The TCR Chimerical receptor t cell activation domain is used to activate the expression of downstream signaling pathway； The PDL1 single-chain antibody, can effectively close PDL1, and blocking immunity negative regulator signal path can be clinically used for inhibiting tumour Immune escape improves the curative effect of CAR-T cellular immunotherapy；When antigen recognition region is in conjunction with target antigen, signal passes through embedding Close receptor be transferred into the cell, thus generate T cell proliferation, cytokine secretion increase, Anti-apoptotic proteins secretion increase, A series of biological effects such as cell death delay, cracking target cell.

Preferably, Chimerical receptor costimulating factor region uses the CD28 Chimerical receptor as shown in SEQ ID NO.24 Costimulating factor and the combination of the CD134 Chimerical receptor costimulating factor as shown in SEQ ID NO.25.

Preferably, PDL1 single-chain antibody light chain VL, PDL1 single-chain antibody heavy chain VH, PDL1 single-chain antibody passes through It is humanization modified.

In the second aspect of the present invention, the above-mentioned prostate cancer CAR-T therapy vector based on OCTS technology of one kind is provided Construction method, comprising the following steps:

(1) sequence of AmpR containing ampicillin resistance gene as shown in SEQ ID NO.1, such as SEQ ID NO.2 institute The prokaryotic replions pUC Ori sequence shown, the Viral Replicon SV40Ori sequence as shown in SEQ ID NO.3, for slow virus The slow virus of packaging packs cis element, the ZsGreen1 green fluorescent protein as shown in SEQ ID NO.11, such as SEQ ID IRES ribosome binding sequence shown in NO.12, as the enhanced marmot hepatitis B of eWPRE shown in SEQ ID NO.13 turn Controlling element is stored on slow virus skeleton plasmid after record；

(2) the people EF1 α promoter as shown in SEQ ID NO.14, the OCTS Chimerical receptor structural domain and such as SEQ PDL1 single-chain antibody shown in ID NO.27 is combined into OCTS Chimerical receptor design scheme, by digestion, connection, recombining reaction gram It is grand into slow virus skeleton plasmid, obtain the third generation OCTS design recombinant slow virus plasmid；

(3) by obtained recombinant slow virus plasmid respectively with slow virus packaging plasmid pPac-GP, pPac-R and memebrane protein Plasmid pEnv-G transfects HEK293T/17 cell jointly, after carrying out gene transcript expression in HEK293T/17 cell, is packaged into Function recombined lentivirus vector can be discharged into cells and supernatant, collect the supernatant for the recombined lentivirus vector for including；

(4) obtained recombinant slow virus supernatant is purified using the column purification mode for filtering, adsorbing, eluting, respectively Obtain recombined lentivirus vector.

Preferably, in step (4), the suction filtration step will control supernatant volume in 200ml~2000ml, control vacuum degree In -0.5MPA~-0.9MPA, prevent due to plug-hole bring carrier loss；The adsorption step will control the pH value of solution 6 ~8, prevent the variation of PH from carrier being caused to inactivate；The elution step will control the ionic strength of eluent in 0.5M~1.0M, Prevent the variation of ionic strength from causing elution not exclusively or carrier inactivation.

In the third aspect of the present invention, application of the carrier in the drug of preparation treatment prostate cancer is provided.

Compared with prior art, the invention has the following beneficial effects:

OCTS-CAR-T technology of the present invention is on the basis of current tradition CAR-T cell therapy, by right The Optimizing Reconstruction of Chimeric antigen receptor (CAR) structure enables Chimeric antigen receptor to identify two kinds of antigens, expands significantly The identification range of CAR-T cell, the removing for cancer colonies is more thorough, and curative effect is more longlasting；Avoid batch culture CAR-T thin Born of the same parents greatly save cost；It avoids patient from repeatedly feeding back different targeting CAR-T cells, has saved the economic expenditure of patient, reduce multiple The probability of hair, improves life in patients indirectly.It only needs once to transduce, transduction efficiency is high, does not influence the treatment of CAR-T treatment Effect；It is not take up the valuable capacity of slow virus transgene carrier, is conducive to load other function element, transgene carrier packaging efficiency Height, gene transduction efficiency are high.

The full name of OCTS is One CAR with Two ScFvs, passes through series connection OCTS (Series OCTS) or corner The connection type of OCTS (Turn OCTS) by two sections of scFv and is integrated into a chimeric molecule (as shown in Figure 1), assigns T lymph Cell HLA non-dependent mode identifies the ability of two kinds of tumour antigens, can identify more extensively relative to traditional CAR-T cell Target, the further expansion removing range of tumour cell.It include two tumor associated antigens in the basic engineering of OCTS The combined area (tumor-associated antigen, TAA) (is typically derived from the scFv of monoclonal antibody antigen bond area Section), an extracellular hinge area, a transmembrane region, Liang Ge intracellular signal transduction area and a response element area.The region scFv for It is crucial determinant for the safety of specificity, validity and the genetic modification T cell of OCTS itself.With The clinical investigation phase that will enter of OCTS-CAR-T indicates that CAR-T cell therapy will enter for 2.0 epoch.

Carrier framework of the present invention can be applied in third generation slow virus carrier structure, also can be applied to In two generation slow virus carrier structures.The difference of the second generation and third generation slow virus carrier in structure is as shown in Figure 2 B.The present invention It is preferred that third generation slow virus carrier (as shown in Figure 2 A), 3 ' SIN LTR eliminate the region U3, eliminate slow virus carrier and self answer A possibility that processed, substantially increases safety；CPPT and WPRE element is increased, the expression of transduction efficiency and transgenosis is improved Efficiency；The lasting efficient transcription of core RNA when ensure that slow virus carrier packaging using RSV promoter；Using the EF1 of people itself α promoter enables CAR gene in human body long lasting for expression.

PDL1 single-chain antibody light chain VL, PDL1 single-chain antibody heavy chain VH, PDL1 single-chain antibody of the present invention passes through It is humanization modified, the generation that the anti-mouse of internal people resists (Human anti-mouse antibodies, HAMA) can be effectively reduced, Extend scFv half-life period and function and effect, increase OCTS-CAR-T cell there are the times.

One kind of costimulating factor used in the present invention or several combination can increase the proliferation speed of cell after transduction The characteristics such as rate, time-to-live, killing-efficiency, immunological memory.

After Workshop Production of the OCTS-CAR-T cell that the present invention uses by GMP rank, it can be used for human clinical trial.

Recombined lentivirus vector of the invention may be implemented to express the double of the combinations such as PSMA, PDL1 on human T lymphocyte Target Chimeric antigen receptor, guidance and activated T lymphocytes to the lethal effect of the positive cells such as PSMA, PDL1, clinically It can be used for the treatment of the malignant tumours such as prostate cancer, melanoma, carcinoma of endometrium.

The present invention passes through the single chain of recombined lentivirus vector skeleton, OCTS structural domain, PD1 ligand (PD-L1) Antibody (single-chain antibody) building forms recombined lentivirus vector, and the recombined lentivirus vector which obtains may be implemented The list of expression cell formula death ligand 1 (Programmed cell death 1ligand 1, PDL1) in human T lymphocyte Chain antibody can effectively close PDL1, and blocking immunity negative regulator signal path can be clinically used for the immune escape for inhibiting tumour, Improve the curative effect of CAR-T cellular immunotherapy.

As it can be seen that OCTS-CAR-T cell of the present invention will be treated to tumour cell provides reliable guarantee.

Detailed description of the invention

Fig. 1 is the schematic diagram of OCTS Chimerical receptor of the present invention, contains series connection OCTS (Series OCTS) and turns Angle OCTS (Turn OCTS) schematic diagram；

Fig. 2 slow virus carrier structural schematic diagram of the present invention；Wherein Fig. 2A is that the third generation that the present invention uses is sick slowly Poisonous carrier structural schematic diagram, Fig. 2 B are the second generation and third generation slow virus carrier structure comparison schematic diagram；

Fig. 3 is the building flow chart that recombined lentivirus vector of the present invention is constructed in the embodiment of the present invention 1.Wherein, (A) figure is the structural schematic diagram of slow virus skeleton plasmid pLenti-3G basic；(B) figure is the schematic diagram of 2 OCTS plasmids； (C) figure is the structural schematic diagram of pPac-GP plasmid；(D) figure is the structural schematic diagram of pPac-R plasmid；(E) figure is pEnv-G packet Fill the structural schematic diagram of plasmid；

Fig. 4 is the element orders schematic diagram of OCTS structure in the embodiment of the present invention 1, wherein A figure is series connection OCTS The structural schematic diagram of (Series OCTS), B figure are the structural schematic diagrams of corner OCTS (Turn OCTS), and C figure is OCTS structure Plasmid number (OCTS Symbol) list schematic diagram；

Fig. 5 is the enzyme of recombinant slow virus plasmid pOCTS-PDL1PSMAs, pOCTS-PDL1PSMAt in the embodiment of the present invention 1 Cut prediction and digestion agarose gel electrophoresis figure；Wherein Fig. 5 A is the digestion prediction schematic diagram of pOCTS-PDL1PSMAs, and Fig. 5 B is The digestion agarose gel electrophoresis figure of pOCTS-PDL1PSMAs；Fig. 5 C is the digestion prediction schematic diagram of pOCTS-PDL1PSMAt, Fig. 5 D is the digestion agarose gel electrophoresis figure of pOCTS-PDL1PSMAt；Lane1 in Fig. 5 A is 1kb DNA ladder Marker: band is from top to bottom successively are as follows: 10kb, 8kb, 6kb, 5kb, 4kb, 3.5kb, 3kb, 2.5kb, 2kb, 1.5kb, 1kb, 750bp,500bp,250bp；Lane2 in Fig. 5 A is the Sac II digestion prediction of pOCTS-PDL1PSMAs: band is from top to bottom Successively are as follows: 7158bp, 2437bp, 1863bp, 557bp；Lane1 in Fig. 5 B is the electrophoresis of 1kb DNA ladder Marker As a result；Lane2 in Fig. 5 B is the Sac II restriction enzyme digestion and electrophoresis result of pOCTS-PDL1PSMAs；Lane1 in Fig. 5 C is 1kb DNA ladder Marker: band is from top to bottom successively are as follows: 10kb, 8kb, 6kb, 5kb, 4kb, 3.5kb, 3kb, 2.5kb, 2kb,1.5kb,1kb,750bp,500bp,250bp；Lane2 in Fig. 5 C is that the EcoR I digestion of pOCTS-PDL1PSMAt is pre- Survey: band is from top to bottom successively are as follows: 8988bp, 1934bp, 1355bp；Lane1 in Fig. 5 D is 1kb DNA ladder The electrophoresis result of Marker；Lane2 in Fig. 5 D is the EcoR I restriction enzyme digestion and electrophoresis result of pOCTS-PDL1PSMAt；

Fig. 6 is the titre testing result schematic diagram of recombined lentivirus vector in the embodiment of the present invention 1；

Fig. 7 is the step flow chart of OCTS-CAR-T cell construction described in the embodiment of the present invention 1, includes separation training The stages such as feeding, activation, gene transfer, OCTS-CAR-T cellular identification；

Fig. 8 is the detection of mycoplasma result schematic diagram of OCTS-CAR-T cell in the embodiment of the present invention 2, wherein lane1 is DL2000marker, counterband tape is from top to bottom successively from top to bottom are as follows: 2kb, 1kb, 750bp, 500bp, 250bp, 100bp； Lane2 is positive control；Lane3 is negative control；Lane4 is PBS；Lane5 is lysate；Lane6 is OCTS- PDL1PSMAs-CAR-T cell；Lane7 is OCTS-PDL1PSMAt-CAR-T cell；

Fig. 9 is the transduction efficiency and immunophenotyping result of flow cytometer detection OCTS-CAR-T cell in the embodiment of the present invention 2 Schematic diagram；Wherein, Fig. 9 A indicates the transduction efficiency result of OCTS-PDL1PSMAs-CAR-T cell；Fig. 9 B indicates OCTS- The immunophenotyping result of PDL1PSMAs-CAR-T cell；The transduction efficiency of Fig. 9 C expression OCTS-PDL1PSMAt-CAR-T cell As a result；The immunophenotyping result of Fig. 9 D expression OCTS-PDL1PSMAt-CAR-T cell；

Figure 10 is OCTS-PDL1PSMAs-CAR-T cell and OCTS- in the embodiment of the present invention 3 under the conditions of different effect target ratios Mortaility results comparison schematic diagram of the PDL1PSMAt-CAR-T cell to different target cells.

Specific embodiment

The invention is further described combined with specific embodiments below.It should be understood that particular implementation described herein It indicates by way of example, is not intended as limitation of the present invention.Without departing from the scope of the invention, of the invention Main feature can be used for various embodiments.Material

1, slow virus skeleton plasmid pLenti-3G basic, slow virus packaging plasmid pPac-GP, pPac-R and film egg White matter grain pEnv-G, HEK293T/17 cell, homologous recombination enzyme, Oligo Annealing Buffer, mycoplasma test reagent Box, endotoxin detection kit, PSMA⁺K562、PDL1⁺K562、PDL1⁺PSMA⁺K562, K562 cell take wing (Shanghai) purchased from generation Biological medicine Science and Technology Ltd.；The specific preparation method of slow virus skeleton plasmid pLenti-3G basic has been proposed in hair It is bright entitled " a kind of based on the CAR-T transgene carrier and its construction method of replication defective recombinant slow virus and application ", specially Application No. is in 201610008360.5 patent application specification for benefit；

2, people's fresh peripheral blood is provided by health donors；

3, OCTS-PDL1PSMAs, OCTS-PDL1PSMAtDNA combined sequence are designed by Shanghai You Kadi company (referring to figure 4C), Shanghai Jierui Biology Engineering Co., Ltd's synthesis is given, and is saved with oligonucleotides dry powder or plasmid form；

4, toolenzyme Cla I, EcoR I, Sac II, T4DNA ligase are purchased from NEB company；

5,0.22 μm of -0.8 μm of PES filter is purchased from millipore company；

6, D-PBS (-), 0.4% trypan blue, sieve, all types of Tissue Culture Dish, culture bag, culture plate are purchased from Corning company；

7、Opti-MEM、Pen-Srep、Hepes、FBS、AIM-V、RPMI 1640、DMEM、lipofectamine 3000 Purchased from invitrogen company；

8, Biotinylated protein L is purchased from GeneScript company；

9, LDH detection kit is purchased from promega company；

10, Ficoll lymphocyte separation medium is purchased from GE company；

11,20% human serum albumin injection is purchased from Ztel's Belling company；

12, CryoPremium frozen stock solution, sorting buffer come from Shanghai You Kadi company；

13, rIL-2, rIL-7, rIL-15, rIL-21 are purchased from peprotech company；

14, CD3 monoclonal antibody, CD28 monoclonal antibody, CD3/CD28 magnetic bead CD4/CD8 magnetic bead is purchased from Germany Miltenyi company；

15, refrigerated centrifuge (ThermoScientific company, the U.S.；

16, FACS flow cytometer is purchased from Thermo company；

17, fluorescence inverted microscope is purchased from Olympus company；

18, CD4-FITC, CD8-APC are purchased from BioLegend company；

19,0.9% physiological saline is purchased from Jin Mai company；

20, ProteinL Magnetic Beads is purchased from BioVision company；

21, PrimeSTAR, RetroNectin are purchased from Takara company；

22, phycoerythrin (PE)-conjugated streptavidin is purchased from BD Bioscience company；

23, plasmid extraction kit, Ago-Gel QIAquick Gel Extraction Kit are purchased from MN company；

24, competent cell TOP10 is purchased from tiangen company；

25、NaCl、KCl、Na₂HPO₄.12H₂O、KH₂PO₄、Trypsin、EDTA、CaCl₂, NaOH, PEG6000 be purchased from Give birth to work in Shanghai；

26, DNeasy kit is purchased from Shanghai JaRa company；

27, SA-HRP is purchased from Shanghai Yi Sheng company；

28, primer: primer needed for designing amplification of DNA fragments and target site according to design of primers principle, the primer is by upper The synthesis of marine growth company, specifically:

EF1 α-F:5 '-ATTCAAAATTTTATCGATGCTCCGGTGCCCGTCAGT-3 ' (SEQ ID NO.28)

EF1 α-R:5 '-TCACGACACCTGAAATGGAAGA-3 ' (SEQ ID NO.29)

OCTS-F:CATTTCAGGTGTCGTGAGGATCCGCCACCATGGCGCTGCCGGTGAC (SEQ ID NO.30)

OCTS-R:GGGGAGGGAGAGGGGCTTAGCGCGGCGGCAGCG (SEQ ID NO.31)

IRES-F:GCCCCTCTCCCTCCCCC (SEQ ID NO.32)

IRES-R:ATTATCATCGTGTTTTTCAAAGGAA (SEQ ID NO.33)

PDL1scab-F:AAAACACGATGATAATGCCACCATGAACTCCTTCTCCACAAGCG (SEQ ID NO.34)

PDL1scab-R:AATCCAGAGGTTGATTGTCGACGAATTCTCATTTGCCCGGGCTCA G (SEQ ID NO.35)

WPRE-QPCR-F:5 '-CCTTTCCGGGACTTTCGCTTT-3 ' (SEQ ID NO.36)

WPRE-QPCR-R:5 '-GCAGAATCCAGGTGGCAACA-3 ' (SEQ ID NO.37)

Actin-QPCR-F:5 '-CATGTACGTTGCTATCCAGGC-3 ' (SEQ ID NO.38)

Actin-QPCR-R:5 '-CTCCTTAATGTCACGCACGAT-3 ' (SEQ ID NO.39)

29, in the present invention, SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ the ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.22, SEQ ID DNA fragmentation shown in NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27 is by Shanghai victory The auspicious bioengineering Co., Ltd sequent synthesis that people provides according to the present invention.

1 OCTS-CAR-T cell construction of embodiment

One, the building, purifying, detection side of recombined lentivirus vector lvOCTS-PDL1PSMAs, lvOCTS-PDL1PSMAt Method.

Referring to Fig. 3, the construction method of recombined lentivirus vector of the present invention is as follows:

1, by people EF1 α promoter (SEQ ID NO.14), OCTS structure [OCTS-PDL1PSMAs, OCTS- PDL1PSMAt] (CD8 leader Chimerical receptor signal peptide (SEQ ID NO.15), PSMA single-chain antibody light chain VL (SEQ ID NO.16), PSMA single-chain antibody heavy chain VH (SEQ ID NO.17), PDL1 single-chain antibody light chain VL (SEQ ID NO.18), PDL1 Between single-chain antibody heavy chain VH (SEQ ID NO.19), antibody inner hinge Inner-Linker (SEQ ID NO.20), single-chain antibody Hinge Inter-Linker (SEQ ID NO.21), CD8Hinge Chimerical receptor hinge (SEQ ID NO.22), CD8Transmembrane Chimerical receptor transmembrane region (SEQ ID NO.23), CD28 Chimerical receptor costimulating factor (SEQ ID NO.24), CD134 Chimerical receptor costimulating factor (SEQ ID NO.25), TCR Chimerical receptor t cell activation domain (SEQ ID NO.26)), PDL1 single-chain antibody (SEQ ID NO.27) is combined into OCTS Chimerical receptor design scheme, by digestion, connection, again Group reaction is cloned into slow virus skeleton plasmid pLenti-3G basic, respectively obtains recombinant slow virus plasmid pOCTS- PDL1PSMAs, pOCTS-PDL1PSMAt, element orders and number are as shown in Figure 4.

(1) slow virus skeleton plasmid pLenti-3G basic is carried out using Cla I and EcoR I restriction enzyme double Digestion, product pass through 1.5% agarose gel electrophoresis, confirm the segment V1 of 5823bp, and be tapped and recovered and be placed in Eppendorf In pipe, corresponding segment (being shown in Table 1) is recycled with the Ago-Gel QIAquick Gel Extraction Kit of MN company, and measures the purity of product and dense Degree；

1, colloidal sol	Sol solutions are added in 200 μ l NTI/100mg gel ratios, 50 DEG C of water-baths are placed 5-10 minutes.
		2, in conjunction with DNA	11000g is centrifuged 30 seconds, discards filtrate.
3, film is washed	700 μ l NT3,11000g is added centrifugation 30 seconds, discards filtrate.
		4, film is washed	It is primary to repeat third step
5, it dries	11000g is centrifuged 1 minute, and the collecting pipe renewed is placed at room temperature for 1 minute.
		6, eluted dna	15-30 μ l NE is added, is placed at room temperature for 1 minute, 11000g is centrifuged 1 minute, collects filtrate.

1 Ago-Gel recycling step of table

(2) with primer EF1 α-F and EF1 α-R with the people EF1 α promoter (SEQ ID NO.14) that synthesizes for template, use System in table 2, PCR cycle condition are as follows: 98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 2min) * 35cycle, 72 ℃10min.Product passes through 1.5% agarose gel electrophoresis, confirms the segment a of 1208bp, and be tapped and recovered and be placed in In Eppendorf pipe, corresponding segment (being shown in Table 1) is recycled with the Ago-Gel QIAquick Gel Extraction Kit of MN company, and measure product Purity and concentration；

2 50 μ l PCR reaction system of table

(3) with primer OCTS-F and OCTS-R using the OCTS-PDL1PSMAs synthesized as template, using the system in table 2, PCR cycle condition are as follows: 98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product By 1.5% agarose gel electrophoresis, the segment b of 2352bp is confirmed, and be tapped and recovered and be placed in Eppendorf pipe, use MN The Ago-Gel QIAquick Gel Extraction Kit of company recycles corresponding segment (being shown in Table 1), and measures the purity and concentration of product；

(4) with primer OCTS-F and OCTS-R using the OCTS-PDL1PSMAt synthesized as template, using the system in table 2, PCR cycle condition are as follows: 98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product By 1.5% agarose gel electrophoresis, the segment c of 2406bp is confirmed, and be tapped and recovered and be placed in Eppendorf pipe, use MN The Ago-Gel QIAquick Gel Extraction Kit of company recycles corresponding segment (being shown in Table 1), and measures the purity and concentration of product；

(5) with primer I RES-F and IRES-R with the IRES ribosome binding sequence (SEQ ID NO.12) that synthesizes for mould Plate uses the system in table 2, PCR cycle condition are as follows: 98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product passes through 1.5% agarose gel electrophoresis, confirms the segment d of 575bp, and be tapped and recovered and set In in Eppendorf pipe, corresponding segment (being shown in Table 1) is recycled with the Ago-Gel QIAquick Gel Extraction Kit of MN company, and measure production The purity and concentration of object；

(6) with primer PDL1scab-F and PDL1scab-R with the PDL1 single-chain antibody (SEQ ID NO.27) that synthesizes for mould Plate uses the system in table 2, PCR cycle condition are as follows: 98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product passes through 1.5% agarose gel electrophoresis, confirms the segment e of 1557bp, and be tapped and recovered and set In in Eppendorf pipe, corresponding segment (being shown in Table 1) is recycled with the Ago-Gel QIAquick Gel Extraction Kit of MN company, and measure production The purity and concentration of object；

(7) by recombinant slow virus Plasmid DNA fragment combination (being shown in Table 3) with the ratio of 5 μ l total volumes and molar ratio 1:1:1:1 It is added in Eppendorf pipe, 15 μ l of homologous recombination enzyme reaction solution is added, be incubated for 30 minutes, be transferred on ice at 42 DEG C after mixing It places 2-3 minutes, reaction solution is added in 50 μ l TOP10, gently rotates to mix content, is placed 30 minutes in ice, it will Pipe is put into pre-heating into 42 DEG C of thermostat water bath heat shock 90 seconds, and quickly pipe is transferred in ice bath, makes cooling 2-3 points of cell Clock, every pipe add 900 μ l LB culture solutions, then pipe are transferred on 37 DEG C of shaking tables, and incubating 1 hour makes bacteria resuscitation, take 100 μ l Transformed bacteria solution be coated on Amp LB agar plate, be inverted plate, in constant incubator 37 DEG C culture, 16 hours.

Recombinant slow virus plasmid	Fragment combination
		pOCTS-PDL1PSMAs	a、b、d、e
pOCTS-PDL1PSMAt	a、c、d、e

3 recombinant slow virus Plasmid DNA fragment combination of table

Picked clones carry out bacterium colony PCR identification, identify that correctly clone is recombinant slow virus plasmid pOCTS- PDL1PSMAs, pOCTS-PDL1PSMAt carry out digestion identification (see Fig. 5) to correct clone, and send sequencing review result.

2, the packaging of recombined lentivirus vector lvOCTS-PDL1PSMAs, lvOCTS-PDL1PSMAt.

(1) complete medium: taking out preheated fresh culture, and 10%FBS+5ml Pen-Srep is added, runs up and down Mix；

(2) NaCl 8g, KCl 0.2, Na 1XPBS solution: are weighed₂HPO₄.12H₂O 3.58g, KH₂PO4 0.24g is placed in In 1000ml beaker, the dissolution of 900ml Milli-Q grade ultrapure water is added, after the completion of dissolution, uses 1000ml graduated cylinder constant volume To 1000ml, 121 DEG C of high-temperature heat sterilization 20min；

(3) 0.25%Trypsin solution: weighing Trypsin 2.5g, and EDTA 0.19729g is placed in 1000ml beaker, 900ml 1XPBS dissolution is added, after the completion of dissolution, is settled to 1000ml using 1000ml graduated cylinder, 0.22 μM of filtration sterilization, for a long time Using can be reserved for -20 DEG C of refrigerators；

(4) 0.5M CaCl2 solution: 36.75g CaCl is weighed₂It is dissolved with 400ml Milli-Q grade ultrapure water；With Total volume is settled to 500ml by Milli-Q grade ultrapure water, is mixed；0.22 μm of filtration sterilization, packing are saved in 50ml centrifugation Guan Zhong, every pipe 45ml or so, 4 DEG C of preservations.

(5) 4.09g NaCl, 0.269g Na 2XHBS solution: are weighed₂HPO4,5.96g Hepes, with 400ml Milli- The dissolution of Q grade ultrapure water；After calibrating pH instrument, the pH of HBS solution is transferred to 7.05 with 2M NaOH solution.Adjust every bottle of HBS's It is 3ml or so that PH, which consumes 2M NaOH,；

(6) the HEK293T/17 cell frozen is taken out from liquid nitrogen container, is quickly transferred in 37 DEG C of water-baths, after 1~2min It is transferred in super-clean bench, the liquid in cryopreservation tube is fully transferred to 10cm by sterile working²In culture dish, supply containing 10%FBS DMEM to 8mL/10cm²Dish, rear micro- sem observation cell, the degree of cell confluency are greater than 80% and are passed on for 24 hours；

(7) selection cell state is good, free of contamination HEK293T/17 cell, and every 2-6 culture dish is one group, by cell After pancreatin digestion, 4-12ml complete medium is drawn with electric pipettor, 2ml is added into each postdigestive culture dish, is avoided Culture dish dries out；All cells are blown and beaten into single cell suspension using 1ml pipettor, are transferred in medium bottle；

(8) remaining cell in above-mentioned 2-6 culture dish is transferred in medium bottle, and rinsed again with culture medium once Culture dish；

(9) culture medium bottle cap is covered tightly, turns upside down 10 times or so and mixes well cell suspension, cell is passed to 8-24 10cm²In culture dish, the cell density of every ware should about 4 × 10⁶A/10ml complete medium or so.If cell density and pre- The difference of phase is larger, then needs to count cell, then according to 4 × 10⁶The amount of a/ware is inoculated with；

(10) every 6 culture dishes arrange piles up for one, pays attention to keeping the cooperation between ware up and down.By culture dish or so, front and back It shakes for several times, spreads out cell sufficiently, be then placed in 5%CO₂Incubator.Remaining cell does same processing；

(11) checking that institute's passage cell, cell confluency degree should be 70-80%, profile is full, and it is adherent good, it is trained in cell It supports and is uniformly distributed in ware；

(12) liquid is changed for cell, culture medium is replaced with into fresh complete medium, every ware 9ml, and by the CO of incubator₂It is dense Degree setting value is increased to 8%；

(13) match DNA/CaCl according to N+0.5₂Solution.Every ware HEK293T/17 cell transfecting plasmid amount is according to following ratio It uses: recombinant slow virus plasmid (20 μ g), pPac-GP (15 μ g), pPac-R (10 μ g), pEnv-G (7.5 μ g).Take one it is new 0.5M CaCl2:0.25ml, 20 μ g:pPac-GP of recombinant slow virus plasmid, 15 μ g:pPac-R, 10 μ g is added in 5ml centrifuge tube: 7.5 μ g of pEnv-G, supplement ultrapure water close the lid to 0.5ml, mix well；

(14) a 5ml centrifuge tube is separately taken, 0.5ml DNA/CaCl2 solution is added.Turbula shaker is opened, a hand is taken The firmly upper end of 5ml centrifuge tube makes tube bottom contact oscillating end, and liquid is made to scatter on tube wall flowing, and another hand moves 1mL by one Liquid rifle is drawn 2 × HBS of 0.5mL solution, is slowly added dropwise into centrifuge tube, coutroi velocity, being dripped off with half a minute is advisable.2×HBS It after addition, after persistent oscillation 5 seconds, stops oscillation, can be directly added into the cell for needing to transfect；

(15) take a ware cell, the 1mL calcium in centrifuge tube turned into drop and is added, make as far as possible calcium turn reagent be distributed to it is whole In a culture dish；

(16) it after calcium turns liquid addition, is marked in ware lid, culture dish is released to another 5%CO₂In incubator. Ensure that culture dish is horizontal positioned, every pile culture dish does not exceed 6.In 5%CO₂(6-8h) is placed in incubator；

(17) by the CO of first incubator₂Concentration set point adjusts back to 5%；

After (18) 24 hours, cell state is checked.Cell confluency degree should be 80-85% or so, in good condition.It will culture Base siphons away, replacement 10ml fresh DMEM complete medium；

After (19) 48 hours, transfection efficiency is observed.Most cells are still adherent.It can be seen that thin more than 95% Born of the same parents can have green fluorescence.By the same virus packaging supernatant collection to together, and continue addition 10mL into culture dish Fresh culture；

After (20) 72 hours, the same vial supernatant is collected into the virus together, collected twice again to be placed on Together, culture dish is abandoned；Recombined lentivirus vector lvOCTS-PDL1PSMAs, lvOCTS- are contained in the supernatant collected at this time PDL1PSMAt。

3, ion exchange chromatography recombined lentivirus vector；

(1) supernatant of collection is used into Thermo vacuum pump, is filtered through 0.22 μm -0.8 μm of PES filter, remove impurity elimination Matter；

(2) 1.5M NaCl 250mM Tris-HCl (pH 6-8) is added into supernatant in the ratio of 1:1~1:10；

(3) 2 ion exchange columns are placed in series, with 4ml 1M NaOH, 4ml 1M NaCl, 5ml 0.15M NaCl 25mM Tris-HCl (pH6-8) solution successively crosses column；

(4) solution obtained in step 2 is given to ion exchange column loading with the speed of 1-10ml/min by peristaltic pump；

(5) it after whole supernatants cross column, is cleaned using 10ml 0.15M NaCl 25mM Tris-HCl (pH 6-8) solution One time；

(6) it is eluted according to applied sample amount using 1-5ml 1.5M NaCl 25mM Tris-HCl (pH 6-8), collection is washed De- liquid；

(7) eluent is divided into 25 to 50 μ l mono- to manage, freezes -80 DEG C of refrigerators, carry out long-term preservation；

4, recombined lentivirus vector titer determination；

(1) 24 orifice plates is taken to be inoculated with 293T cell.Every hole cell is 5 × 10⁴A, added culture volume is 500ul, different Difference, cell confluency when carrying out virus infection are 40%-60% to the vitro growth rates of type；

(2) prepare 3 sterile EP tubes, the fresh complete medium (DMEM in high glucose+10% of 90ul is added in each pipe FBS) after inoculating cell 24 hours, the cell in two holes is taken to be counted with blood counting chamber, the actual number of cell when determining infection, It is denoted as N；

(3) it takes virus stock solution used 10ul to be determined to be added in first pipe, after mixing gently, 10ul is taken to be added to second In a pipe, a to the last pipe is then successively operated；410ul complete medium (DMEM in high glucose+10% is added in every pipe ), FBS final volume 500ul；

(4) 20 hours after infection starts, culture supernatant is removed, 500 μ l complete medium (DMEM in high glucose+10% are changed to FBS), 5%CO₂Continue culture 48 hours；

After (5) 72 hours, luciferase expression situation is observed, under normal circumstances, fluorecyte number increases and phase with extension rate It should reduce, and take pictures；

(6) 0.25% pancreas enzyme -EDTA solution digestion cell of 0.2ml is used, is placed 1 minute at 37 DEG C.It is purged with culture medium whole A cell face, is collected by centrifugation cell.Illustrate extracting genomic DNA according to DNeasy kit.200 are added in each sample cell μ l eluent is washed lower DNA and is quantified；

(7) preparing target DNA detection qPCRmix general pipeline I, (QPCR primer sequence is SEQ ID NO.36---SEQ ID NO.37):

N=number of reactions. is for example: overall reaction number is 40, by 2 × TaqMan of 1ml Universal PCR Master Mix, 4 μ l forward primer, 4 μ l reverse primer, 4 μ l probe and 788 μ l H2O is mixed With.It is placed on ice after concussion；

(8) preparing internal reference DNA detection qPCRmix pipe II, (QPCR primer sequence is SEQ ID NO.38---SEQ ID NO.39):

2×TaqMan Master Mix 25μl×n

10×RNaseP primer/probe mix 2.5μl×n

H₂O 17.5μl×n

N=number of reactions. is for example: overall reaction number is 40, by 2 × TaqMan of 1ml Universal PCR Master Mix, 100 μ l 10 × RNaseP primer/probe mix and 700 μ l H₂O is mixed.Ice is placed on after concussion On；

(9) PCR system is completed in 96 hole PCR plates of pre-cooling to establish.45 μ l are respectively taken to be added to each row of A-D from general pipeline I Hole in, from respectively taking 45 μ l to be added in the hole of each row of E-G in general pipeline II.

(10) 5 μ l plasmid standards and sample to be tested genomic DNA are taken to be added in A-D row respectively, each sample repeats 1 It is secondary.Separately stay 1 hole that the water of 5 μ l is added as no template control (no-template control).

(11) 5 μ l genome standard items and sample to be tested genomic DNA are taken to be added in E-G row respectively, each sample weight It is 1 time multiple.Separately stay 1 hole that the water of 5 μ l is added as no template control (no-template control).

(12) used quantitative PCR apparatus is 7500 quantitative system of ABI PRISM.Cycling condition setting are as follows: 50 DEG C 2 minutes, 95 DEG C 10 minutes, followed by 95 DEG C 15 seconds, 60 DEG C of 40 of 1 minute circulations.

Data analysis: the slow virus carrier copy number integrated in the DNA sample measured is demarcated with genome number, is obtained The viral copy number of every genome conformity.

Titre (integration units per ml, IU ml^-1) calculation formula it is as follows:

IU ml^-1=(C × N × D × 1000)/V

Wherein: C=is averaged the viral copy number of every genome conformity

The number (about 1 × 10 of cell when N=infects⁵)

The extension rate of D=viral vectors

The volume number for the dilution virus that V=is added

(13) titre results of recombined lentivirus vector lvOCTS-PDL1PSMAs, lvOCTS-PDL1PSMAt are (such as Fig. 6 institute Show)；

Two, OCTS-CAR-T cell construction

Referring to Fig. 7, the construction method of OCTS-CAR-T cell of the present invention is as follows:

1, PBMC is separated.

(1) health donors fresh peripheral blood 50ml is extracted；

(2) blood taking bag spray is wiped twice of alcohol, and dried.

(3) haemocyte in bag is sucked out with 50ml syringe and is moved in new 50ml pipe.

(4) 400g, 20 DEG C of centrifugation 10min.

(5) upper plasma being moved on in new 50ml centrifuge tube, 56 DEG C, 30min inactivates blood plasma, restores to room temperature, 2000g is centrifuged 30min, takes supernatant stand-by into 50ml centrifuge tube.

(6) it is mended with D-PBS (-) to 50ml, tightens lid, be mixed by inversion.

(7) 2 new 50ml centrifuge tubes are taken, 15ml Ficoll lymphocyte separation medium is added in every pipe.

(8) haemocyte dilution 25ml is carefully added on every pipe Ficoll.800g, 20 DEG C of centrifugation 20min.

(9) liquid is divided into four layers in centrifuge tube, be respectively as follows: from top to bottom the plasma layer (recycling stand-by) of yellow, tunica albuginea layer, The cell mixing layer of colorless and transparent Ficoll layer, reddish black.

(10) tunica albuginea layer is carefully drawn into new 50ml centrifuge tube, is added D-PBS (-) to 50ml, is mixed by inversion rear 500g, 20 DEG C of centrifugation 10min.

(11) 5% human serum albumin of 25ml is added and cell is resuspended, 400g, 20 DEG C of centrifugation 10min.

(12) supernatant is abandoned, 5% human serum albumin of 25ml is added, cell precipitation is resuspended, and cross 70um sieve, count.

(13) 1 part is taken to contain 1.25x10⁸Cells is for activating；Remaining cell suspension 400g, 20 DEG C of centrifugation 10min add CryoPremium simultaneously freezes.

2, CD4/CD8 positive T cell sorts.

(1) PBMC of acquisition is counted, with 80ul/10⁷Sorting buffer is added in the ratio of cells, and cell precipitation is resuspended.

(2) again with 20ul/10⁷CD4/CD8 magnetic bead is added in the ratio of cells, and piping and druming is put into 4 DEG C after mixing and is incubated for 15min。

(3) magnetic bead-cell mixture is taken out, with 2ml/10⁷Sorting buffer is added in the ratio of cells, after being mixed by inversion, 250g, 4 DEG C of centrifugation 10min.

(4) with 500ul/10⁸Sorting buffer is added in the ratio of cells, and cell precipitation is resuspended.

(5) on tweezers clamping LS splitter to magnetic frame.

(6) prepare 2 15ml centrifuge tubes simultaneously, mark respectively: CD4-/CD8- cell liquid (A pipe), CD4+/CD8+ cell Liquid (B pipe).

(7) 3ml dissociating buffer rinse LS is used, and connects buffer with A pipe.

(8) cell-magnetic bead mixed liquor is added, 3ml buffer is added after dripping off and rinses pillar (when each no liquid remains again New liquid is added), in total three times, collection obtains CD4/CD8- cell.

(9) LS splitter is separated with magnetic frame, connects cell suspension with B pipe, 5ml buffer is added, by and with pillar internal plug It slightly firmly rinses, is collected as CD4+/CD8+ cell, sampling counts.

(10) 1x10 is pressed⁶/ml-4x10⁶The cell density of/ml AIM-V culture medium resuspension cell precipitation, and addition 2 × 10⁵~1 × 10⁶The U/L IFN-γ factor.

3, t cell activation.

(1) the previous day is mentioned by 1 × 10³Ug/L~1 × 10⁴Ug/L CD3 monoclonal antibody and 1 × 10³Ug/L~1 × 10⁴24 orifice plates are added in ug/L CD28 monoclonal antibody, and sealed membrane sealing, 4 DEG C are coated with overnight.

(2) coated T75 bottles is taken out, coating buffer is outwelled, washed once with D-PBS (-), and the cell that sorting obtains is hanged Liquid is inoculated into T75 bottles, is shaken up, and 37 DEG C, 5%CO are put into₂It is cultivated in incubator.

4, CAR gene transfer and OCTS-CAR-T cell Fiber differentiation.

(1) the previous day coating 1 × 10 is proposed³Ug/L~1 × 10⁴In in 24 orifice plates, sealed membrane seals ug/L RetroNectin Mouthful, 4 DEG C are coated with overnight.

(2) into 24 orifice plates, according to every hole 5 × 10⁵Cell concentration is separately added into lvOCTS- by the amount of MOI=5~20 PDL1PSMAs, lvOCTS-PDL1PSMAt slow virus transgene carrier, while adding and containing 2 × 10⁵~5 × 10⁵U/L rIL-2,5 ×10³Ng/L~1 × 10⁴Ng/L rIL-7,5 × 10³Ng/L~1 × 10⁴Ng/L rIL-15,5 × 10³Ng/L~1 × 10⁴ng/ L rIL-21 and 37 DEG C of AIM-V culture medium, 5%CO containing 10% autoserum₂Continue to cultivate.

5, OCTS-CAR-T cell expansion ex vivo.

(1) every 2 days equivalent is added containing 2 × 10⁵~5 × 10⁵U/L rIL-2,5 × 10³Ng/L~1 × 10⁴ng/L rIL- 7,5 × 10³Ng/L~1 × 10⁴Ng/L rIL-15,5 × 10³Ng/L~1 × 10⁴Ng/L rIL-21 and contain 10% autoserum AIM-V culture medium, maintain pH value between 6.5~7.5, cell density maintains 5 × 10⁵~2 × 10⁶Between/ml, 37 DEG C, 5%CO₂Continue culture 10-14 days.

(2) the 7th days or so, the OCTS-CAR-T cell of culture was frozen for subsequent detection.

Embodiment 2

OCTS-CAR-T cell Pathogen test and detection of expression.

One, endotoxin detects；

(1), endotoxin working standard is 15EU/ branch；

(2), sensitivity of the limulus reagent λ=0.25EU/ml, 0.5ml/ pipe

(3), endotoxin standard dilutes: taking endotoxin standard one, is diluted to 4 λ and 2 λ in proportion with BET water respectively Dissolution, sealed membrane sealing, concussion dissolution 15min；One step of every dilution should all mix 30s on eddy mixer when dilution；

(4), it is loaded: taking reagents several, every addition BET water 0.5ml dissolution, packing to several endotoxin-frees tries Guan Zhong, every pipe 0.1ml.Wherein 2 are negative control pipe, and BET water 0.1ml is added；

2 are positive control pipe, and the endotoxin working standard solution 0.1ml of 2 λ concentration is added；

2 be Sample Positive control tube, be added 0.1ml containing 2 λ endotoxin standards sample solution (dilution 20 times to The endotoxin standard solution 1ml=2ml of sample 1ml+4 λ contains 40 times of samples of dilution of 2 λ endotoxin standards).

Be added 0.1ml sample in sample cell, dilution ratio be shown in Table 4,37 ± 1 DEG C of water-baths (or incubator) heat preservation 60 ± 1min；

4 endotoxin dilution ratio of table and corresponding endotoxin content

(5), the endotoxin testing result (as shown in table 5) of OCTS-CAR-T cell, the endotoxin content of all cells are equal Less than 2.5EU/ml, meet the standard for being less than 10EU/ml in the Pharmacopoeia of the People's Republic of China；

Table 5

Extension rate	Stoste	5	10	20	40	80	160
								Corresponding EU/ml	0.25	1.25	2.5	5	10	20	40
OCTS-PDLlPSMAs-CAR-T	(+)	(+)	(-)	(-)	(-)	(-)	(-)
								OCIS-PDLlPSMAt-CAR-T	(+)	(+)	(-)	(-)	(-)	(-)	(-)

Two, detection of mycoplasma；

(1) first three day is being tested, cell sample is cultivated with antibiotic-free culture medium；

(2) (cell number is greater than 1*10 to collection 1ml cell suspending liquid⁵), it is placed in 1.5ml centrifuge tube；

(3) 13000g is centrifuged 1min, collects precipitating, discards culture medium；

(4) 500ul PBS pipette tips pressure-vaccum or vortex oscillation is added, precipitating is resuspended.13000g is centrifuged 5min；

(5) step 4 is repeated once；

(6) 50 μ l Cell Lysis Buffer are added after mixing well, to be incubated in 55 DEG C of water-baths with pipette tips pressure-vaccum 20min；

(7) sample is placed in 95 DEG C and heats 5min；

(8) after 13000g is centrifuged 5min, take 5 μ l supernatants as template, 25 μ l PCR reaction systems are as follows: 6.5 μ l of ddH20, 1 μ l of Myco Mix, 2x Taq Plus Mix Master (Dye Plus) 12.5 μ l, 5 μ l of template；PCR cycle condition are as follows: 95 DEG C 30sec, (95 DEG C of 30sec, 56 DEG C of 30sec, 72 DEG C of 30sec) * 30cycle, 72 DEG C of 5min.

(9) detection of mycoplasma as the result is shown (as shown in Figure 8), is free of mycoplasma in OCTS-CAR-T cell.

Three, the detection of OCTS gene transduction efficiency and immunophenotyping detection；

(1) T cell after viral transduction is collected, cell is resuspended with D-PBS (-) solution containing 1~4% human serum albumin And it is adjusted to 1 × 10⁶/ml。

(2) D-PBS (-) solution 1ml containing 1~4% human serum albumin is added into centrifuge tube and mixes, 350g centrifugation 5min abandons supernatant.

(3) it is primary to repeat step 2.

(4) cell is resuspended with D-PBS (-) solution containing 1~4% human serum albumin of 0.2ml, and is added into centrifuge tube 1mg/ul protein L, 5ul CD4-FITC, the 5ul CD8-APC of 1ul is mixed, 4 DEG C of incubation 45min.

(5) D-PBS (-) solution of the 1ml containing 1~4% human serum albumin is added into centrifuge tube and mixes, 350g centrifugation 5min abandons supernatant.

(6) step 5 is repeated twice.

(7) cell is resuspended in D-PBS (-) solution with 0.2ml containing 1~4% human serum albumin, and is added into centrifuge tube 0.2ul PE-SA is mixed, and 37 DEG C are protected from light incubation 15min.

(8) D-PBS (-) solution of 1ml containing 1~4% human serum albumin is added into centrifuge tube to weigh and mix, 350g centrifugation 5min abandons supernatant.

(9) cell precipitation is resuspended with 1ml D-PBS (-) solution, 350g is centrifuged 5min, abandons supernatant.

(10) step 9 is repeated twice.

(11) cell precipitation is resuspended with 0.4ml D-PBS (-) solution, flow cytometer is detected.

(12) OCTS gene transduction efficiency and the testing result of immunophenotyping detection are as shown in figure 9, the OCTS-CAR- prepared The efficiency of infection of T cell is respectively positioned on the ratio of 40% or more, CD4 positive cell and CD8 positive cell between 1:3~3:1, It can carry out follow-up function detection.

The Function detection of 3 OCTS-CAR-T cell of embodiment.

One, target cell fragmentation effect is assessed.

(1) target cell [PSMA is cultivated respectively⁺K562、PDL1⁺K562、PDL1⁺PSMA⁺K562, K562 cell] and effect it is thin Born of the same parents' [OCTS-CAR-T cell]；

(2) target cell 4x10 is collected⁵Cells and OCTS-CAR-T cell 2.8x10⁶Cells, 800g, 6min are centrifuged, in abandoning Clearly；

(3) target cell and effector cell are resuspended respectively with 1ml D-PBS (-) solution, supernatant is abandoned in 800g, 6min centrifugation；

(4) it is primary to repeat step 3；

(5) effector cell is resuspended with 700ul culture medium (+1~10%FBS of AIM-V culture medium), with 2ml culture medium (AIM- + 1~10%FBS of V culture medium) target cell is resuspended；

(6) setting effect target is than the experimental port for 1:1,5:1,10:1, effector cell respectively with single target cell and pair target cell The grouping situation being incubated for altogether is as shown in table 6, and control group (K562 cell) is arranged, every group of 3 multiple holes；

Table 6

Effector cell	Target cell 1	Target cell 2	Target cell 3
				OCTS-PDLlPSMAs-CAR-T	PDLl+K562	PSMA+K562	PDLl+PSMA+K562
OCTS-PDLlPSMAt-CAR-T	PDLl+K562	PSMA+K562	PDLl+PSMA+K562

(7) centrifugation of 250g, 5min plate；

It (8) 37 DEG C, is cultivated 4 hours in 5%CO2 incubator；

(9) centrifugation of 250g, 5min plate；

(10) take the 50ul supernatant in each hole into new 96 orifice plate, and every hole is added 50ul substrate solution and (is protected from light behaviour Make)；

(11) it is protected from light and is incubated for 25min；

(12) 50ul terminate liquid is added in every hole；

(13) microplate reader detects 490nm absorbance；

(14) 3 multiple holes are averaged；The light absorption value of all experimental ports, Target cell wells and effector cell hole is subtracted into training Support the mean value of base background light absorption value；The light absorption value of target cell maximum value is subtracted to the mean value of volume correction control light absorption value.

(15) it brings the corrected value obtained in step 14 into following formula, it is thinner than generated to calculate each effect target Cellular toxicity percentage.The results are shown in Figure 10, and OCTS-CAR-T, which has respective single target cell and double target cells, preferably to be killed Hurt effect, the CAR-T cell of Turn OCTS structure is slightly above the CAR-T of Series OCTS structure to the killing-efficiency of target cell Cell；

Killing-efficiency=(experimental port-effector cell hole-Target cell wells)/(target cell largest hole-Target cell wells) X100%

(16) above-mentioned the experimental results showed that, pass through in traditional CAR structure antigen recognizing district transformation formed OCTS tie Structure can significantly improve OCTS-CAR-T cell recognition and kill the range of target cell, therefore OCTS-CAR-T cell will be not The malignant tumours such as the PSMA positive/PDL1 positive/PSMA, PDL1 bis- positives prostate cancer, melanoma, the carcinoma of endometrium come Cell therapy in play huge effect.

Sequence table

<110>Shanghai You Kadi biological medicine Science and Technology Ltd.

<120>a kind of based on the prostate cancer CAR-T therapy vector and its construction method of OCTS technology and application

<130> HJ17-13349

<160> 39

<170> PatentIn version 3.5

<210> 1

<211> 861

<212> DNA

<213>artificial sequence

<400> 1

atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt ttgccttcct 60

gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca gttgggtgca 120

cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag ttttcgcccc 180

gaagaacgtt ttccaatgat gagcactttt aaagttctgc tatgtggcgc ggtattatcc 240

cgtattgacg ccgggcaaga gcaactcggt cgccgcatac actattctca gaatgacttg 300

gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt aagagaatta 360

tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct gacaacgatc 420

ggaggaccga aggagctaac cgcttttttg cacaacatgg gggatcatgt aactcgcctt 480

gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga caccacgatg 540

cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg gcgaactact tactctagct 600

tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc acttctgcgc 660

tcggcccttc cggctggctg gtttattgct gataaatctg gagccggtga gcgtgggtct 720

cgcggtatca ttgcagcact ggggccagat ggtaagccct cccgtatcgt agttatctac 780

acgacgggga gtcaggcaac tatggatgaa cgaaatagac agatcgctga gataggtgcc 840

tcactgatta agcattggta a 861

<210> 2

<211> 674

<212> DNA

<213>artificial sequence

<400> 2

cccgtagaaa agatcaaagg atcttcttga gatccttttt ttctgcgcgt aatctgctgc 60

ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt tgccggatca agagctacca 120

actctttttc cgaaggtaac tggcttcagc agagcgcaga taccaaatac tgtccttcta 180

gtgtagccgt agttaggcca ccacttcaag aactctgtag caccgcctac atacctcgct 240

ctgctaatcc tgttaccagt ggctgctgcc agtggcgata agtcgtgtct taccgggttg 300

gactcaagac gatagttacc ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc 360

acacagccca gcttggagcg aacgacctac accgaactga gatacctaca gcgtgagcta 420

tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca ggtatccggt aagcggcagg 480

gtcggaacag gagagcgcac gagggagctt ccagggggaa acgcctggta tctttatagt 540

cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg 600

cggagcctat ggaaaaacgc cagcaacgcg gcctttttac ggttcctggc cttttgctgg 660

ccttttgctc acat 674

<210> 3

<211> 147

<212> DNA

<213>artificial sequence

<400> 3

atcccgcccc taactccgcc cagttccgcc cattctccgc cccatggctg actaattttt 60

tttatttatg cagaggccga ggccgcctcg gcctctgagc tattccagaa gtagtgagga 120

ggcttttttg gaggcctaga cttttgc 147

<210> 4

<211> 228

<212> DNA

<213>artificial sequence

<400> 4

gtagtcttat gcaatactct tgtagtcttg caacatggta acgatgagtt agcaacatgc 60

cttacaagga gagaaaaagc accgtgcatg ccgattggtg gaagtaaggt ggtacgatcg 120

tgccttatta ggaaggcaac agacgggtct gacatggatt ggacgaacca ctgaattgcc 180

gcattgcaga gatattgtat ttaagtgcct agctcgatac aataaacg 228

<210> 5

<211> 180

<212> DNA

<213>artificial sequence

<400> 5

ggtctctctg gttagaccag atctgagcct gggagctctc tggctaacta gggaacccac 60

tgcttaagcc tcaataaagc ttgccttgag tgcttcaagt agtgtgtgcc cgtctgttgt 120

gtgactctgg taactagaga tccctcagac ccttttagtc agtgtggaaa atctctagca 180

<210> 6

<211> 234

<212> DNA

<213>artificial sequence

<400> 6

tgctagagat tttccacact gactaaaagg gtctgaggga tctctagtta ccagagtcac 60

acaacagacg ggcacacact acttgaagca ctcaaggcaa gctttattga ggcttaagca 120

gtgggttccc tagttagcca gagagctccc aggctcagat ctggtctaac cagagagacc 180

cagtacaagc aaaaagcaga tcttattttc gttgggagtg aattagccct tcca 234

<210> 7

<211> 353

<212> DNA

<213>artificial sequence

<400> 7

atgggtgcga gagcgtcagt attaagcggg ggagaattag atcgcgatgg gaaaaaattc 60

ggttaaggcc agggggaaag aaaaaatata aattaaaaca tatagtatgg gcaagcaggg 120

agctagaacg attcgcagtt aatcctggcc tgttagaaac atcagaaggc tgtagacaaa 180

tactgggaca gctacaacca tcccttcaga caggatcaga agaacttaga tcattatata 240

atacagtagc aaccctctat tgtgtgcatc aaaggataga gataaaagac accaaggaag 300

ctttagacaa gatagaggaa gagcaaaaca aaagtaagac caccgcacag caa 353

<210> 8

<211> 233

<212> DNA

<213>artificial sequence

<400> 8

aggagctttg ttccttgggt tcttgggagc agcaggaagc actatgggcg cagcctcaat 60

gacgctgacg gtacaggcca gacaattatt gtctggtata gtgcagcagc agaacaattt 120

gctgagggct attgaggcgc aacagcatct gttgcaactc acagtctggg gcatcaagca 180

gctccaggca agaatcctgg ctgtggaaag atacctaaag gatcaacagc tcc 233

<210> 9

<211> 489

<212> DNA

<213>artificial sequence

<400> 9

tggggatttg gggttgctct ggaaaactca tttgcaccac tgctgtgcct tggaatgcta 60

gttggagtaa taaatctctg gaacagattg gaatcacacg acctggatgg agtgggacag 120

agaaattaac aattacacaa gcttaataca ctccttaatt gaagaatcgc aaaaccagca 180

agaaaagaat gaacaagaat tattggaatt agataaatgg gcaagtttgt ggaattggtt 240

taacataaca aattggctgt ggtatataaa attattcata atgatagtag gaggcttggt 300

aggtttaaga atagtttttg ctgtactttc tatagtgaat agagttaggc agggatattc 360

accattatcg tttcagaccc acctcccaac cccgagggga cccgacaggc ccgaaggaat 420

agaagaagaa ggtggagaga gagacagaga cagatccatt cgattagtga acggatctcg 480

acggttaac 489

<210> 10

<211> 119

<212> DNA

<213>artificial sequence

<400> 10

ttttaaaaga aaagggggga ttggggggta cagtgcaggg gaaagaatag tagacataat 60

agcaacagac atacaaacta aagaattaca aaaacaaatt acaaaaattc aaaatttta 119

<210> 11

<211> 696

<212> DNA

<213>artificial sequence

<400> 11

atggcccagt ccaagcacgg cctgaccaag gagatgacca tgaagtaccg catggagggc 60

tgcgtggacg gccacaagtt cgtgatcacc ggcgagggca tcggctaccc cttcaagggc 120

aagcaggcca tcaacctgtg cgtggtggag ggcggcccct tgcccttcgc cgaggacatc 180

ttgtccgccg ccttcatgta cggcaaccgc gtgttcaccg agtaccccca ggacatcgtc 240

gactacttca agaactcctg ccccgccggc tacacctggg accgctcctt cctgttcgag 300

gacggcgccg tgtgcatctg caacgccgac atcaccgtga gcgtggagga gaactgcatg 360

taccacgagt ccaagttcta cggcgtgaac ttccccgccg acggccccgt gatgaagaag 420

atgaccgaca actgggagcc ctcctgcgag aagatcatcc ccgtgcccaa gcagggcatc 480

ttgaagggcg acgtgagcat gtacctgctg ctgaaggacg gtggccgctt gcgctgccag 540

ttcgacaccg tgtacaaggc caagtccgtg ccccgcaaga tgcccgactg gcacttcatc 600

cagcacaagc tgacccgcga ggaccgcagc gacgccaaga accagaagtg gcacctgacc 660

gagcacgcca tcgcctccgg ctccgccttg ccctga 696

<210> 12

<211> 575

<212> DNA

<213>artificial sequence

<400> 12

gcccctctcc ctcccccccc cctaacgtta ctggccgaag ccgcttggaa taaggccggt 60

gtgcgtttgt ctatatgtta ttttccacca tattgccgtc ttttggcaat gtgagggccc 120

ggaaacctgg ccctgtcttc ttgacgagca ttcctagggg tctttcccct ctcgccaaag 180

gaatgcaagg tctgttgaat gtcgtgaagg aagcagttcc tctggaagct tcttgaagac 240

aaacaacgtc tgtagcgacc ctttgcaggc agcggaaccc cccacctggc gacaggtgcc 300

tctgcggcca aaagccacgt gtataagata cacctgcaaa ggcggcacaa ccccagtgcc 360

acgttgtgag ttggatagtt gtggaaagag tcaaatggct cacctcaagc gtattcaaca 420

aggggctgaa ggatgcccag aaggtacccc attgtatggg atctgatctg gggcctcggt 480

gcacatgctt tacatgtgtt tagtcgaggt taaaaaacgt ctaggccccc cgaaccacgg 540

ggacgtggtt ttcctttgaa aaacacgatg ataat 575

<210> 13

<211> 592

<212> DNA

<213>artificial sequence

<400> 13

aatcaacctc tggattacaa aatttgtgaa agattgactg gtattcttaa ctatgttgct 60

ccttttacgc tatgtggata cgctgcttta atgcctttgt atcatgctat tgcttcccgt 120

atggctttca ttttctcctc cttgtataaa tcctggttgc tgtctcttta tgaggagttg 180

tggcccgttg tcaggcaacg tggcgtggtg tgcactgtgt ttgctgacgc aacccccact 240

ggttggggca ttgccaccac ctgtcagctc ctttccggga ctttcgcttt ccccctccct 300

attgccacgg cggaactcat cgccgcctgc cttgcccgct gctggacagg ggctcggctg 360

ttgggcactg acaattccgt ggtgttgtcg gggaaatcat cgtcctttcc ttggctgctc 420

gcctgtgttg ccacctggat tctgcgcggg acgtccttct gctacgtccc ttcggccctc 480

aatccagcgg accttccttc ccgcggcctg ctgccggctc tgcggcctct tccgcgtctt 540

cgccttcgcc ctcagacgag tcggatctcc ctttgggccg cctccccgcc tg 592

<210> 14

<211> 1178

<212> DNA

<213>artificial sequence

<400> 14

gctccggtgc ccgtcagtgg gcagagcgca catcgcccac agtccccgag aagttggggg 60

gaggggtcgg caattgaacc ggtgcctaga gaaggtggcg cggggtaaac tgggaaagtg 120

atgtcgtgta ctggctccgc ctttttcccg agggtggggg agaaccgtat ataagtgcag 180

tagtcgccgt gaacgttctt tttcgcaacg ggtttgccgc cagaacacag gtaagtgccg 240

tgtgtggttc ccgcgggcct ggcctcttta cgggttatgg cccttgcgtg ccttgaatta 300

cttccacctg gctgcagtac gtgattcttg atcccgagct tcgggttgga agtgggtggg 360

agagttcgag gccttgcgct taaggagccc cttcgcctcg tgcttgagtt gaggcctggc 420

ctgggcgctg gggccgccgc gtgcgaatct ggtggcacct tcgcgcctgt ctcgctgctt 480

tcgataagtc tctagccatt taaaattttt gatgacctgc tgcgacgctt tttttctggc 540

aagatagtct tgtaaatgcg ggccaagatc tgcacactgg tatttcggtt tttggggccg 600

cgggcggcga cggggcccgt gcgtcccagc gcacatgttc ggcgaggcgg ggcctgcgag 660

cgcggccacc gagaatcgga cgggggtagt ctcaagctgg ccggcctgct ctggtgcctg 720

gcctcgcgcc gccgtgtatc gccccgccct gggcggcaag gctggcccgg tcggcaccag 780

ttgcgtgagc ggaaagatgg ccgcttcccg gccctgctgc agggagctca aaatggagga 840

cgcggcgctc gggagagcgg gcgggtgagt cacccacaca aaggaaaagg gcctttccgt 900

cctcagccgt cgcttcatgt gactccactg agtaccgggc gccgtccagg cacctcgatt 960

agttctcgag cttttggagt acgtcgtctt taggttgggg ggaggggttt tatgcgatgg 1020

agtttcccca cactgagtgg gtggagactg aagttaggcc agcttggcac ttgatgtaat 1080

tctccttgga atttgccctt tttgagtttg gatcttggtt cattctcaag cctcagacag 1140

tggttcaaag tttttttctt ccatttcagg tgtcgtga 1178

<210> 15

<211> 63

<212> DNA

<213>artificial sequence

<400> 15

atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60

ccg 63

<210> 16

<211> 321

<212> DNA

<213>artificial sequence

<400> 16

gatattcaga tgacccagag cccgagcagc ctgagcacca gcgtgggcga tcgcgtgacc 60

ctgacctgca aagcgagcca ggatgtgggc accgcggtgg attggtatca gcagaaaccg 120

ggcccgagcc cgaaactgct gatttattgg gcgagcaccc gccataccgg cattccgagc 180

cgctttagcg gcagcggcag cggcaccgat tttaccctga ccattagcag cctgcagccg 240

gaagattttg cggattatta ttgccagcag tataacagct atccgctgac ctttggcccg 300

ggcaccaaag tggatattaa a 321

<210> 17

<211> 345

<212> DNA

<213>artificial sequence

<400> 17

gaagtgcagc tggtgcagag cggcccggaa gtgaaaaaac cgggcgcgac cgtgaaaatt 60

agctgcaaaa ccagcggcta tacctttacc gaatatacca ttcattgggt gaaacaggcg 120

ccgggcaaag gcctggaatg gattggcaac attaacccga acaacggcgg caccacctat 180

aaccagaaat ttgaagataa agcgaccctg accgtggata aaagcaccga taccgcgtat 240

atggaactga gcagcctgcg cagcgaagat accgcggtgt attattgcgc ggcgggctgg 300

aactttgatt attggggcca gggcaccctg ctgaccgtga gcagc 345

<210> 18

<211> 333

<212> DNA

<213>artificial sequence

<400> 18

gatattgtgc tgacccagag cccggcgagc ctggcggtga gcccgggcca gcgcgcgacc 60

attacctgcc gcgcgagcca gagcgtgagc accagcagca gcagctttat gcattggtat 120

cagcagaaac cgggccagcc gccgaaactg ctgattaaat atgcgagcaa cctggaaagc 180

ggcgtgccgg cgcgctttag cggcagcggc agcggcaccg attttaccct gaccattaac 240

ccggtggaag cgaacgatac cgcgaactat tattgccagc atagctggga aattccgtat 300

acctttggcc agggcaccaa actggaaatt aaa 333

<210> 19

<211> 348

<212> DNA

<213>artificial sequence

<400> 19

gaagtgcagc tggtggaaag cggcggcggc ctggtgaaac cgggcggcag cctgcgcctg 60

agctgcgcgg cgagcggctt tatttttcgc agctatggca tgagctgggt gcgccaggcg 120

ccgggcaaag gcctggaatg ggtggcgagc attagcagcg gcggcagcac ctattatccg 180

gatagcgtga aaggccgctt taccattagc cgcgataacg cgaaaaacag cctgtatctg 240

cagatgaaca gcctgcgcgc ggaagatacc gcggtgtatg attgcgcgcg cggctatgat 300

agcggctttg cgtattgggg ccagggcacc ctggtgaccg tgagcagc 348

<210> 20

<211> 45

<212> DNA

<213>artificial sequence

<400> 20

ggtggcggtg gctcgggcgg tggtgggtcg ggtggcggcg gatct 45

<210> 21

<211> 57

<212> DNA

<213>artificial sequence

<400> 21

gcctccacca agggcccatc tgtcttcccc ctggccccca gctcctctgg ctccgga 57

<210> 22

<211> 141

<212> DNA

<213>artificial sequence

<400> 22

accacgacgc cagcgccgcg accaccaaca ccggcgccca ccatcgcgtc gcagcccctg 60

tccctgcgcc cagaggcgtg ccggccagcg gcggggggcg cagtgcacac gagggggctg 120

gacttcgcct gtgatatcta c 141

<210> 23

<211> 66

<212> DNA

<213>artificial sequence

<400> 23

atctgggcgc ccttggccgg gacttgtggg gtccttctcc tgtcactggt tatcaccctt 60

tactgc 66

<210> 24

<211> 123

<212> DNA

<213>artificial sequence

<400> 24

aggagtaaga ggagcaggct cctgcacagt gactacatga acatgactcc ccgccgcccc 60

gggcccaccc gcaagcatta ccagccctat gccccaccac gcgacttcgc agcctatcgc 120

tcc 123

<210> 25

<211> 111

<212> DNA

<213>artificial sequence

<400> 25

cgccgcgatc agcgcctgcc gccggatgcg cataaaccgc cgggcggcgg cagctttcgc 60

accccgattc aggaagaaca ggcggatgcg catagcaccc tggcgaaaat t 111

<210> 26

<211> 336

<212> DNA

<213>artificial sequence

<400> 26

cgcgtgaaat ttagccgcag cgcggatgcg ccggcgtatc agcagggcca gaaccagctg 60

tataacgaac tgaacctggg ccgccgcgaa gaatatgatg tgctggataa acgccgcggc 120

cgcgatccgg aaatgggcgg caaaccgcgc cgcaaaaacc cgcaggaagg cctgtataac 180

gaactgcaga aagataaaat ggcggaagcg tatagcgaaa ttggcatgaa aggcgaacgc 240

cgccgcggca aaggccatga tggcctgtat cagggcctga gcaccgcgac caaagatacc 300

tatgatgcgc tgcatatgca ggcgctgccg ccgcgc 336

<210> 27

<211> 1557

<212> DNA

<213>artificial sequence

<400> 27

atgaactcct tctccacaag cgccttcggt ccagttgcct tctccctggg gctgctcctg 60

gtgttgcctg ctgccttccc tgccccagat attgtgctga cccagagccc ggcgagcctg 120

gcggtgagcc cgggccagcg cgcgaccatt acctgccgcg cgagccagag cgtgagcacc 180

agcagcagca gctttatgca ttggtatcag cagaaaccgg gccagccgcc gaaactgctg 240

attaaatatg cgagcaacct ggaaagcggc gtgccggcgc gctttagcgg cagcggcagc 300

ggcaccgatt ttaccctgac cattaacccg gtggaagcga acgataccgc gaactattat 360

tgccagcata gctgggaaat tccgtatacc tttggccagg gcaccaaact ggaaattaaa 420

ggtggcggtg gctcgggcgg tggtgggtcg ggtggcggcg gatctgaagt gcagctggtg 480

gaaagcggcg gcggcctggt gaaaccgggc ggcagcctgc gcctgagctg cgcggcgagc 540

ggctttattt ttcgcagcta tggcatgagc tgggtgcgcc aggcgccggg caaaggcctg 600

gaatgggtgg cgagcattag cagcggcggc agcacctatt atccggatag cgtgaaaggc 660

cgctttacca ttagccgcga taacgcgaaa aacagcctgt atctgcagat gaacagcctg 720

cgcgcggaag ataccgcggt gtatgattgc gcgcgcggct atgatagcgg ctttgcgtat 780

tggggccagg gcaccctggt gaccgtgagc agcggtggcg gtggctcggg cggtggtggg 840

tcgggtggcg gcggatctga accgaaaagc tgcgacaaaa ctcacacatg cccaccgtgc 900

ccagcacctg aactcctggg gggaccgtca gtcttcctct tccccccaaa acccaaggac 960

accctcatga tctcccggac ccctgaggtc acatgcgtgg tggtggacgt gagccacgaa 1020

gaccctgagg tcaagttcaa ctggtacgtg gacggcgtgg aggtgcataa tgccaagaca 1080

aagccgcggg aggagcagta caacagcacg taccgtgtgg tcagcgtcct caccgtcctg 1140

caccaggact ggctgaatgg caaggagtac aagtgcaagg tctccaacaa agccctccca 1200

gcccccatcg agaaaaccat ctccaaagcc aaagggcagc cccgagaacc acaggtgtac 1260

accctgcccc catcccggga ggagatgacc aagaaccagg tcagcctgac ctgcctggtc 1320

aaaggcttct atcccagcga catcgccgtg gagtgggaga gcaatgggca gccggagaac 1380

aactacaaga ccacgcctcc cgtgctggac tccgacggct ccttcttcct ctacagcaag 1440

ctcaccgtgg acaagagcag gtggcagcag gggaacgtct tctcatgctc cgtgatgcac 1500

gaggctctgc acaaccacta cacgcagaag agcctctccc tgtctccggg taaatga 1557

<210> 28

<211> 36

<212> DNA

<213>artificial sequence

<220>

<221> misc_feature

<223>primer

<400> 28

attcaaaatt ttatcgatgc tccggtgccc gtcagt 36

<210> 29

<211> 22

<212> DNA

<213>artificial sequence

<220>

<221> misc_feature

<223>primer

<400> 29

tcacgacacc tgaaatggaa ga 22

<210> 30

<211> 46

<212> DNA

<213>artificial sequence

<220>

<221> misc_feature

<223>primer

<400> 30

catttcaggt gtcgtgagga tccgccacca tggcgctgcc ggtgac 46

<210> 31

<211> 33

<212> DNA

<213>artificial sequence

<220>

<221> misc_feature

<223>primer

<400> 31

ggggagggag aggggcttag cgcggcggca gcg 33

<210> 32

<211> 17

<212> DNA

<213>artificial sequence

<220>

<221> misc_feature

<223>primer

<400> 32

gcccctctcc ctccccc 17

<210> 33

<211> 25

<212> DNA

<213>artificial sequence

<220>

<221> misc_feature

<223>primer

<400> 33

attatcatcg tgtttttcaa aggaa 25

<210> 34

<211> 44

<212> DNA

<213>artificial sequence

<220>

<221> misc_feature

<223>primer

<400> 34

aaaacacgat gataatgcca ccatgaactc cttctccaca agcg 44

<210> 35

<211> 46

<212> DNA

<213>artificial sequence

<220>

<221> misc_feature

<223>primer

<400> 35

aatccagagg ttgattgtcg acgaattctc atttgcccgg gctcag 46

<210> 36

<211> 21

<212> DNA

<213>artificial sequence

<220>

<221> misc_feature

<223>primer

<400> 36

cctttccggg actttcgctt t 21

<210> 37

<211> 20

<212> DNA

<213>artificial sequence

<220>

<221> misc_feature

<223>primer

<400> 37

gcagaatcca ggtggcaaca 20

<210> 38

<211> 21

<212> DNA

<213>artificial sequence

<220>

<221> misc_feature

<223>primer

<400> 38

catgtacgtt gctatccagg c 21

<210> 39

<211> 21

<212> DNA

<213>artificial sequence

<220>

<221> misc_feature

<223>primer

<400> 39

ctccttaatg tcacgcacga t 21

Claims (10)

1. a kind of prostate cancer CAR-T therapy vector based on OCTS technology, which is characterized in that including slow virus skeleton plasmid, People EF1 α promoter, OCTS Chimerical receptor structural domain and PDL1 single-chain antibody；

The slow virus skeleton plasmid includes: the sequence of AmpR containing ampicillin resistance gene for purpose bacterial strain massive amplification Column, as shown in SEQ ID NO.1；For the prokaryotic replions pUC Ori sequence of plasmid replication, as shown in SEQ ID NO.2；With In the Viral Replicon SV40 Ori sequence of the duplication in enhancing eukaryocyte, as shown in SEQ ID NO.3；For slow virus packet The slow virus of dress packs cis element；ZsGreen1 green fluorescent protein, as shown in SEQ ID NO.11；IRES ribosomes combines Sequence, as shown in SEQ ID NO.12；The enhanced marmot hepatitis B of eWPRE for enhancing the expression efficiency of transgenosis turns Controlling element after record, as shown in SEQ ID NO.13；

The sequence of the people EF1 α promoter is as shown in SEQ ID NO.14；

The OCTS Chimerical receptor structural domain include: the CD8 leader Chimerical receptor signal peptide as shown in SEQ ID NO.15, PSMA single-chain antibody light chain VL, the PSMA single-chain antibody heavy chain as shown in SEQ ID NO.17 as shown in SEQ ID NO.16 VH, PDL1 single-chain antibody light chain VL, the PDL1 single-chain antibody weight as shown in SEQ ID NO.19 as shown in SEQ ID NO.18 Chain VH, antibody inner hinge Inner-Linker, the single-chain antibody as shown in SEQ ID NO.21 as shown in SEQ ID NO.20 Between hinge Inter-Linker, the CD8 Hinge Chimerical receptor hinge as shown in SEQ ID NO.22, such as SEQ ID NO.23 institute The CD8 Transmembrane Chimerical receptor transmembrane region shown, the TCR Chimerical receptor t cell activation as shown in SEQ ID NO.26 Domain and Chimerical receptor costimulating factor region；Chimerical receptor costimulating factor region is used as shown in SEQ ID NO.24 CD28 Chimerical receptor costimulating factor and the CD134 Chimerical receptor costimulating factor as shown in SEQ ID NO.25 combination.

2. carrier as described in claim 1, which is characterized in that the slow virus packaging cis element uses second generation slow virus Carrier or third generation slow virus carrier；The second generation slow virus carrier includes: the slow virus 5 as shown in SEQ ID NO.5 Terminal LTR, 3 terminal Self-Inactivating LTR of slow virus, such as SEQ as shown in SEQ ID NO.6 Gag cis element shown in ID NO.7, the RRE cis element as shown in SEQ ID NO.8, as shown in SEQ ID NO.9 Env cis element, the cPPT cis element as shown in SEQ ID NO.10；The third generation slow virus carrier includes: such as SEQ 5 terminal LTR of slow virus, the 3 terminal Self- of slow virus as shown in SEQ ID NO.6 shown in ID NO.5 Inactivating LTR, the Gag cis element as shown in SEQ ID NO.7, the cis- member of RRE as shown in SEQ ID NO.8 Part, the env cis element as shown in SEQ ID NO.9, the cPPT cis element as shown in SEQ ID NO.10, and such as SEQ RSV promoter shown in ID NO.4.

3. carrier as described in claim 1, which is characterized in that the PSMA single-chain antibody as shown in SEQ ID NO.16 Light chain VL, the PSMA single-chain antibody heavy chain VH as shown in SEQ ID NO.17, resist as PDL1 shown in SEQ ID NO.18 is single-stranded It is cut with scissors in body light chain VL, PDL1 single-chain antibody heavy chain VH, the antibody as shown in SEQ ID NO.20 as shown in SEQ ID NO.19 Hinge Inter-Linker uses series connection mode between chain Inner-Linker, the single-chain antibody as shown in SEQ ID NO.21 Or corner connection type；The series connection mode specifically: PDL1 single-chain antibody light chain VL and PSMA single-chain antibody light chain VL uses hinge Inter-Linker connection between single-chain antibody, and PDL1 single-chain antibody light chain VL and PDL1 single-chain antibody heavy chain VH is adopted With the Inner-Linker connection of antibody inner hinge, PSMA single-chain antibody light chain VL and PSMA single-chain antibody heavy chain VH are using in antibody Hinge Inner-Linker connection；The corner connection type specifically: PSMA single-chain antibody light chain VL and PSMA single-chain antibody Heavy chain VH uses antibody inner hinge Inner-Linker connection, and PDL1 single-chain antibody light chain VL and PSMA single-chain antibody heavy chain VH is adopted With hinge Inter-Linker connection between single-chain antibody, PDL1 single-chain antibody heavy chain VH and PSMA single-chain antibody light chain VL are using single Hinge Inter-Linker connection between chain antibody.

4. carrier as described in claim 1, which is characterized in that the sequence of the PDL1 single-chain antibody such as SEQ ID NO.27 institute Show.

5. carrier as described in claim 1, which is characterized in that adjusted after the enhanced marmot hepatitis B transcription of eWPRE Control element has the enhancing of 6 nucleotide to be mutated, specifically: g.396G > A, g.397C > T, g.398T > C, g.399G > A, g.400A >T、g.411A>T。

6. carrier as described in claim 1, which is characterized in that start entire OCTS Chimerical receptor by the people EF1 α promoter Domain constructs gene expression, the CD8 leader Chimerical receptor signal peptide are located at OCTS Chimerical receptor domain coding sequence N-terminal, for guiding OCTS Chimerical receptor domain protein to be positioned at cell membrane；Described PSMA single-chain antibody light chain VL, PSMA This two groups of single-chain antibodies of single-chain antibody heavy chain VH, PDL1 single-chain antibody light chain VL, PDL1 single-chain antibody heavy chain VH are combined into dual anti- Former cog region, for identification corresponding target antigen；The CD8 Hinge Chimerical receptor hinge is for scFv to be anchored to outside cell membrane Side；The CD8 Transmembrane Chimerical receptor transmembrane region is used to entire Chimerical receptor being fixed on cell membrane；It is described CD28 Chimerical receptor costimulating factor is for stimulating T lymphocyte Activation In Vitro and interior tumor cell lethal effect；It is described For promoting, T lymphocyte is proliferated CD134 Chimerical receptor costimulating factor and cytokine secretion, enhancing tumour immunity are conducive to remember Recall the long-term surviving of T cell；The TCR Chimerical receptor t cell activation domain is used to activate the expression of downstream signaling pathway；It is described PDL1 single-chain antibody, can effectively close PDL1, and blocking immunity negative regulator signal path can be clinically used for inhibiting the immune of tumour It escapes, improves the curative effect of CAR-T cellular immunotherapy；When antigen recognition region is in conjunction with target antigen, signal by it is chimeric by Body is transferred into the cell, to generate T cell proliferation, cytokine secretion increases, Anti-apoptotic proteins secretion increases, cell Death delay, a series of cracking biological effects of target cell.

7. carrier as described in claim 1, which is characterized in that PDL1 single-chain antibody light chain VL, PDL1 single-chain antibody Heavy chain VH, PDL1 single-chain antibody pass through humanization modified.

8. a kind of building of such as described in any item prostate cancer CAR-T therapy vectors based on OCTS technology of claim 1-7 Method, which comprises the following steps:

(1) sequence of AmpR containing ampicillin resistance gene as shown in SEQ ID NO.1, as shown in SEQ ID NO.2 Prokaryotic replions pUC Ori sequence, is used for slow virus packet at the Viral Replicon SV40 Ori sequence as shown in SEQ ID NO.3 The slow virus of dress packs cis element, the ZsGreen1 green fluorescent protein as shown in SEQ ID NO.11, such as SEQ ID IRES ribosome binding sequence shown in NO.12, as the enhanced marmot hepatitis B of eWPRE shown in SEQ ID NO.13 turn Controlling element is stored on slow virus skeleton plasmid after record；

(2) the people EF1 α promoter as shown in SEQ ID NO.14, the OCTS Chimerical receptor structural domain and such as SEQ ID PDL1 single-chain antibody shown in NO.27 is combined into OCTS Chimerical receptor design scheme, clones by digestion, connection, recombining reaction Into slow virus skeleton plasmid, the recombinant slow virus plasmid of third generation OCTS design is obtained；

(3) by obtained recombinant slow virus plasmid respectively with slow virus packaging plasmid pPac-GP, pPac-R and memebrane protein plasmid PEnv-G transfects HEK293T/17 cell jointly, after carrying out gene transcript expression in HEK293T/17 cell, packs and successfully weighs Group slow virus carrier can be discharged into cells and supernatant, collect the supernatant for the recombined lentivirus vector for including；

(4) obtained recombinant slow virus supernatant is purified using the column purification mode for filtering, adsorbing, eluting, is respectively obtained Recombined lentivirus vector.

9. method according to claim 8, which is characterized in that in step (4), the suction filtration step will control supernatant volume and exist 200ml ~ 2000ml controls vacuum degree in -0.5MPA ~ -0.9MPA, prevents due to plug-hole bring carrier loss；The absorption Step will control the pH value of solution 6 ~ 8, prevent the variation of PH from carrier being caused to inactivate；The elution step will control eluent Ionic strength prevents the variation of ionic strength from causing elution not exclusively or carrier inactivation in 0.5M ~ 1.0M.

10. such as application of the described in any item carriers of claim 1-7 in the drug of preparation treatment prostate cancer.