CN107164410A - A kind of prostate cancer CAR T therapy vectors and its construction method and application based on OCTS technologies - Google Patents

Abstract

The invention discloses a kind of prostate cancer CAR T therapy vectors based on OCTS technologies, including slow virus skeleton plasmid, people EF1 α promoters (SEQ ID NO.14), OCTS Chimerical receptors domain and PDL1 single-chain antibodies；OCTS Chimerical receptor domains include：CD8 leader Chimerical receptors signal peptide (SEQ ID NO.15), PSMA single-chain antibody light chains VL (SEQ ID NO.16), PSMA single-chain antibody heavy chains VH (SEQ ID NO.17), PDL1 single-chain antibody light chains VL (SEQ ID NO.18), PDL1 single-chain antibody heavy chains VH (SEQ ID NO.19), antibody inner hinge Inner Linker (SEQ ID NO.20), hinge Inter Linker (SEQ ID NO.21) between single-chain antibody, CD8 Hinge Chimerical receptors hinge (SEQ ID NO.22), CD8 Transmembrane Chimerical receptors transmembrane region (SEQ ID NO.23), TCR Chimerical receptor t cell activations domain (SEQ ID NO.26) and Chimerical receptor costimulating factor region.In addition, the application the invention also discloses the construction method of the carrier and its in the medicine for preparing treatment prostate cancer.

Description

A kind of prostate cancer CAR-T therapy vectors and its construction method based on OCTS technologies And application

Technical field

The invention belongs to field of medical biotechnology, and in particular to a kind of carrier, more particularly to before a kind of technology based on OCTS Row gland cancer CAR-T therapy vectors.Moreover, it relates to construction method and the application of the carrier.

Background technology

The theoretical foundation of immunotherapy of tumors is that immune system has identification tumor associated antigen, regulation and control body attack tumour The ability of cell (the cell dissolving of high degree of specificity).Generation nineteen fifty, Burnet and Thomas propose " immunosurveillance " theory, Thinking the tumour cell of the mutation often occurred in body can be recognized and remove by immune system, be that immunotherapy of tumors is established Determined theoretical foundation [Burnet FM.Immunological aspects of malignant disease.Lancet, 1967；1:1171-4].Then, various tumour immunotherapies include cytokine therapy, monoclonal antibody therapy, adoptive immunity The sequential uses such as therapy, vaccine therapy are in clinic.

A kind of more advanced tumour immunotherapy in 2013 --- CAR-T therapies are used successfully to clinic, and are demonstrated by preceding institute not Some clinical efficacies.CAR-T, full name is Chimeric Antigen Receptor T-Cell Immunotherapy, is fitted together to Antigen receptor T cell immunotherapy.The therapy is the means by transgenosis, by promoter, antigen recognizing district, costimulation because The chimeric molecule that son, effect area etc. are collectively constituted, is imported in T cell genome, so that T cell is to the identification of target cell, letter Number transduction, killing etc. function combine together, realize specific killing [the Eleanor J.Cheadle, et to target cell al.CAR T cells:driving the road from the laboratory to the clinic. Immunological Reviews 2014.Vol.257:91–106].CAR-T therapies are clinically most leading Novartis CLT019, refractory Patients With Acute Lymphoblastic Leukemia, the tumour Progression free survival rate of six months are recurred using CLT019 treatments 67% is reached, wherein most long response time was reached more than 2 years.General headquarters are located at the Shanghai You Kadi biological medicines section of Chinese Shanghai Skill Co., Ltd cooperated with hospital, by the end of 2 months 2017, altogether the refractory Patients With Acute Lymphoblastic Leukemia 36 for the treatment of recurrence Example, wherein complete 24, alleviation ratio reaches 66.6%.This is the subversiveness breakthrough of anticancer research.CAR-T cell therapies may It is one of most possible means for curing cancer, and by《Science》Magazine is chosen as first of 2013 annual ten big technological breakthroughs.

CAR-T is evident in efficacy in terms of the neoplastic hematologic disorder of the several types such as treatment B- lymphocytic leukemias at present, still There is also some limitations, the previous Chimeric antigen receptor of mesh can only recognize a kind of antigenic targets, and tumour cell is a complexity Colony, after the tumour cell containing corresponding antigens is eliminated, the tumour cell without corresponding antigens can be bred rapidly, at one section Between after cause tumor recurrence.CAR-T identifications are so made just there are two schemes optional while recognizing two kinds of antigens：One be by Two groups of Chimeric antigen receptors, which are built, enters a slow virus transgene carrier, disposably enters two groups of Chimeric antigen receptor transductions Primary T lymphocytes；Two are transduceed in two times with two slow virus transgene carriers, and two groups of Chimeric antigen receptors are transduceed respectively Into primary T lymphocytes.

The shortcoming of scheme one is the valuable capacity for taking slow virus transgene carrier, is unfavorable for loading other Functional Units Part；Transgene carrier packaging efficiency is low；Gene transduction efficiency is very low, it is difficult to transduce into primary T lymphocytes.

Scheme two disadvantage is that by transduceing twice, the overall efficiency transduceed twice is relatively low, transduce cycle time Long, the easy aging of primary cell causes multiplication capacity to fail, and killing ability declines, and influences tumor clearance curative effect.

PSMA in preceding gland cancer there is special altimeter to reach.In all 184 parts of prostates detected with 7El l-C5 In sample, [Bostwick DG, Pacelli A, Blute M, the et al.Prostate specific such as Bostwick membrane antigen expression in prostatic intraepithelial neoplasia and adenocarcinoma.Cancer.1998；82(11)：2256-2261] therefrom it is found that positive immune reacts, Benign Epithelial Tissue and prostate cancer high malignancy cell, positive rate is respectively 69.5% and 80.2%, wherein the staining power in cancerous tissue Most strong, they also also obtain similar results in the cohort study of other 200 parts of prostate samples.

PD-L1 overexpressions in most cancerous tissues, including NSCLC, melanoma, breast cancer, glioma, lymph [the Intlekofer AM, Thompson such as knurl, leukaemia and various urological cancers, tumor in digestive tract, system genitale tumour CB.At the bench:preclinical rationale for CTLA-4 and PD-1 blockade as cancer immunotherapy[J].J Leukoc Biol,2013,94(1):25-39.] .Parsa in the tumour cell of mouse and people, It was found that the IFN-γ of T cell abnormal secretion, IFN-γ can with the expression of the height of the PD-L1 on induced tumor cell [Ding H, Wu X, Wu J,et al.Delivering PD-1 inhibitory signal concomitant with blocking ICOS co-stimulation suppresses lupus-like syndrome in autoimmune BXSB mice[J].Clin Immunol,2006,118(2/3):258-267.].PD-L1 height expression, can be led to by suppressing RAS and PI3K/AKT signals Road, and then cell cycle regulation checkpoint albumen and cell multiplication related protein expression, ultimately result in the suppression of T cell propagation [11].The experiment in vitro such as Dong and mouse model also found that the activation of PD-1/PD-L1 signal paths can be with inducing specific CTL Tune is died, and declines CTL cell toxicant lethal effect sensitiveness, promotes tumour cell to occur immunologic escape [Dong H, Strome SE,Salomao DR,et al. Tumor-associated B7-H1 promotes T-cell apoptosis:a potential mechanism of immune evasion[J].Nat Med,2002,8(8):793-800.]。

At present, not yet there is the relevant report for overcoming disadvantages mentioned above to be treated for the CAR-T of two kinds of antigens of PSMA, PD-L1.

The content of the invention

One of the technical problem to be solved in the present invention is to provide a kind of prostate cancer CAR-T treatments based on OCTS technologies and carried Body.First, it only needs once to transduce, and transduction efficiency is high, the curative effect for not influenceing CAR-T to treat；Secondly, it is not take up slow virus The valuable capacity of transgene carrier, beneficial to the other function element of loading.3rd, it can effectively close PDL1, blocking immunity negative regulator Signal path, can be clinically used for suppressing the immune escape of tumour, improves the curative effect of CAR-T cellular immunotherapies.

The second technical problem to be solved by the present invention is to provide the construction method of the carrier.

The third technical problem to be solved by the present invention is to provide the application of the carrier.

In order to solve the above technical problems, the present invention is adopted the following technical scheme that：

In one aspect of the invention there is provided a kind of prostate cancer CAR-T therapy vectors based on OCTS technologies, including slow disease Malicious skeleton plasmid, people EF1 α promoters, OCTS Chimerical receptors domain and PDL1 single-chain antibodies；

The slow virus skeleton plasmid includes：The AmpR containing ampicillin resistance gene largely expanded for purpose bacterial strain Sequence, as shown in SEQ ID NO.1；For the prokaryotic replions pUC Ori sequences of plasmid replication, such as SEQ ID NO.2 institutes Show；Viral Replicon SV40 Ori sequences for strengthening the duplication in eukaryotic, as shown in SEQ ID NO.3；For slow The slow virus packaging cis element of virus packaging；ZsGreen1 green fluorescent proteins, as shown in SEQ ID NO.11；IRES ribose Body binding sequence, as shown in SEQ ID NO.12；The enhanced marmot hepatitis B of eWPRE of expression efficiency for strengthening transgenosis Controlling element after virus transcription, as shown in SEQ ID NO.13；

The sequence of the people EF1 α promoters is as shown in SEQ ID NO.14；

The OCTS Chimerical receptors domain includes：CD8 leader Chimerical receptor signals as shown in SEQ ID NO.15 Peptide, the PSMA single-chain antibody light chains VL as shown in SEQ ID NO.16, the PSMA single-chain antibody weights as shown in SEQ ID NO.17 Chain VH, PDL1 single-chain antibody light chains VL, the PDL1 single-chain antibodies as shown in SEQ ID NO.19 as shown in SEQ ID NO.18 It is heavy chain VH, the antibody inner hinge Inner-Linker as shown in SEQ ID NO.20, single-stranded anti-as shown in SEQ ID NO.21 Hinge Inter-Linker, CD8 Hinge Chimerical receptors hinge, such as SEQ ID NO.23 as shown in SEQ ID NO.22 between body Shown CD8 Transmembrane Chimerical receptors transmembrane region, the TCR Chimerical receptors T cell as shown in SEQ ID NO.26 swash Domain and Chimerical receptor costimulating factor region living；The Chimerical receptor costimulating factor region be selected from 4-1BB, ICOS, CD27, OX40、CD28、MYD88、IL1R1、CD70、TNFRSF19L、TNFRSF27、TNFRSF1OD、TNFRSF13B、 TNFRSF18、 The tumor necrosis factor superfamilies such as CD134 (tumor necrosis factor receptor superfamily, TNFRSF) In the combination of any one or more.

The slow virus packaging cis element can use second generation slow virus carrier, it would however also be possible to employ third generation slow virus Carrier.The slow virus packaging cis element is included using second generation slow virus carrier：Slow virus as shown in SEQ ID NO.5 5terminal LTR, slow virus 3terminal Self-Inactivating LTR, such as SEQ as shown in SEQ ID NO.6 Gag cis elements shown in ID NO.7, the RRE cis elements as shown in SEQ ID NO.8, as shown in SEQ ID NO.9 Env cis elements, the cPPT cis elements as shown in SEQ ID NO.10.The slow virus packaging cis element uses the third generation Slow virus carrier includes：Slow virus 5terminal LTR as shown in SEQ ID NO.5, the slow disease as shown in SEQ ID NO.6 Malicious 3terminal Self-Inactivating LTR, such as the Gag cis elements as shown in SEQ ID NO.7, SEQ ID RRE cis elements shown in NO.8, the env cis elements as shown in SEQ ID NO.9, the cPPT as shown in SEQ ID NO.10 Cis element, and the RSV promoters as shown in SEQ ID NO.4.Present invention preferably employs third generation slow virus carrier.

It is preferred that, the PSMA single-chain antibody light chains VL as shown in SEQ ID NO.16, as shown in SEQ ID NO.17 PSMA single-chain antibody heavy chains VH, the PDL1 single-chain antibody light chains VL as shown in SEQ ID NO.18, such as SEQ ID NO.19 institutes The PDL1 single-chain antibody heavy chains VH shown, antibody inner hinge Inner-Linker, such as SEQ ID as shown in SEQ ID NO.20 Hinge Inter-Linker is used and is connected in series mode or corner connected mode between single-chain antibody shown in NO.21；The string Joining connected mode is specially：PDL1 single-chain antibody light chain VL and PSMA single-chain antibody light chains VL uses hinge between single-chain antibody Inter-Linker connections, PDL1 single-chain antibody light chain VL and PDL1 single-chain antibody heavy chains VH uses antibody inner hinge Inner- Linker connections, PSMA single-chain antibody light chain VL and PSMA single-chain antibody heavy chains VH uses antibody inner hinge Inner-Linker Connection, i.e. pOCTS-PDL1PSMAs (see Fig. 4 A and Fig. 4 C)；The corner connected mode is specially：PSMA single-chain antibody light chains VL is connected with PSMA single-chain antibody heavy chains VH using antibody inner hinge Inner-Linker, PDL1 single-chain antibody light chains VL and PSMA Single-chain antibody heavy chain VH uses hinge Inter-Linker connections between single-chain antibody, and PDL1 single-chain antibody heavy chain VH and PSMA is mono- Chain antibody light chain VL uses hinge Inter-Linker connections between single-chain antibody, i.e. pOCTS-PDL1PSMAt is (see Fig. 4 B and figure 4C)。

It is preferred that, the sequence of the PDL1 single-chain antibodies is as shown in SEQ ID NO.27.

It is preferred that, the enhancing that the enhanced marmot hepatitis B posttranscriptional regulatory elements of eWPRE have 6 nucleotides is dashed forward Become, be specially： g.396G>A、g.397C>T、g.398T>C、g.399G>A、g.400A>T、g.411A>T.

It is preferred that, whole OCTS expression of structural gene is started by the people EF1 α promoters, the CD8 leader are fitted together to Receptor signal peptide is located at the N-terminal of OCTS coded sequences, for guiding OCTS albumen to be positioned at cell membrane；The PSMA single-chain antibodies This two groups of single-chain antibodies of light chain VL, PSMA single-chain antibody heavy chain VH, PDL1 single-chain antibody light chain VL, PDL1 single-chain antibody heavy chain VH Double antigen recognizing districts are combined into, for recognizing corresponding target antigen；The CD8Hinge Chimerical receptors hinge is used for scFv grapplings On the outside of cell membrane；The CD8 Transmembrane Chimerical receptors transmembrane region is used to whole Chimerical receptor being fixed on cell On film；The CD28 Chimerical receptors costimulating factor is used to stimulate the activation of T lymphocytes in vitro and interior tumor cell to kill work With；The CD134 Chimerical receptors costimulating factor is used to promote T lymphopoiesis and cytokine secretion, strengthens tumour immunity, has Beneficial to the long-term surviving of memory T cell；The TCR Chimerical receptors t cell activation domain is used for the expression for activating downstream signaling pathway； The PDL1 single-chain antibodies, can effectively close PDL1, and blocking immunity negative regulator signal path can be clinically used for suppressing tumour Immune escape, improves the curative effect of CAR-T cellular immunotherapies；When antigen recognition region is combined with target antigen, signal passes through embedding Close acceptor be transferred to it is intracellular so that produce T cell propagation, cytokine secretion increase, Anti-apoptotic proteins secretion increase, A series of biological effects such as cell death delay, cracking target cell.

It is preferred that, the Chimerical receptor costimulating factor region is using the CD28 Chimerical receptors as shown in SEQ ID NO.24 Costimulating factor and the CD134 Chimerical receptors costimulating factor combination as shown in SEQ ID NO.25.

It is preferred that, described PDL1 single-chain antibody light chain VL, PDL1 single-chain antibody heavy chain VH, PDL1 single-chain antibodies pass through It is humanization modified.

In the second aspect of the present invention, there is provided a kind of above-mentioned prostate cancer CAR-T therapy vectors based on OCTS technologies Construction method, comprises the following steps：

(1) by the sequences of AmpR containing ampicillin resistance gene as shown in SEQ ID NO.1, such as SEQ ID NO.2 institutes The prokaryotic replions pUC Ori sequences shown, the Viral Replicon SV40Ori sequences as shown in SEQ ID NO.3, for slow disease Slow virus packaging cis element, such as the ZsGreen1 green fluorescent proteins as shown in SEQ ID NO.11, the SEQ ID of poison packaging The enhanced marmot hepatitis B of IRES ribosome binding sequences shown in NO.12, the eWPRE as shown in SEQ ID NO.13 turns Controlling element is stored on slow virus skeleton plasmid after record；

(2) by the people EF1 α promoters shown in SEQ ID NO.14, as described in OCTS Chimerical receptors domain and such as SEQ PDL1 single-chain antibodies shown in ID NO.27 are combined into OCTS Chimerical receptor designs, by digestion, connection, recombining reaction gram In the grand skeleton plasmid to slow virus, the recombinant slow virus plasmid of third generation OCTS designs is obtained；

(3) by obtained recombinant slow virus plasmid respectively with slow virus packaging plasmid pPac-GP, pPac-R and memebrane protein Plasmid pEnv-G transfects HEK293T/17 cells jointly, carries out after gene transcript expression, is packaged into HEK293T/17 cells Work(recombined lentivirus vector can be discharged into cells and supernatant, collect the supernatant of the recombined lentivirus vector included；

(4) obtained recombinant slow virus supernatant is purified using the post way of purification of suction filtration, absorption, elution, respectively Obtain recombined lentivirus vector.

It is preferred that, in step (4), the suction filtration step will control supernatant volume in 200ml~2000ml, control vacuum In -0.5MPA~-0.9MPA, prevent due to the carrier loss that plug-hole is brought；The adsorption step will control the pH value of solution 6 ~8, preventing PH change causes carrier to inactivate；The elution step will control the ionic strength of eluent in 0.5M~1.0M, Prevent the change of ionic strength from causing elution not exclusively or carrier inactivation.

In application of the third aspect of the present invention there is provided described carrier in the medicine for preparing treatment prostate cancer.

Compared with prior art, the present invention has the advantages that：

OCTS-CAR-T technologies of the present invention, are on the basis of current tradition CAR-T cell therapies, by right The Optimizing Reconstruction of Chimeric antigen receptor (CAR) structure so that Chimeric antigen receptor can recognize two kinds of antigens, is expanded significantly The identification range of CAR-T cells, the removing for cancer colonies is more thorough, and curative effect is more longlasting；Avoid batch culture CAR-T thin Born of the same parents, greatly save cost；Avoid patient from repeatedly feeding back different targeting CAR-T cells, saved the economic expenditure of patient, reduce The probability of recurrence, improves life in patients indirectly.Only need once to transduce, transduction efficiency is high, the treatment for not influenceing CAR-T to treat Effect；The valuable capacity of slow virus transgene carrier is not take up, beneficial to the other function element of loading, transgene carrier packaging efficiency Height, gene transduction efficiency is high.

OCTS full name is One CAR with Two ScFvs, passes through the OCTS that connects (Series OCTS) or corner OCTS (Turn OCTS) connected mode, by two sections of scFv with being integrated into a chimeric molecule (as shown in Figure 1), assigns T and drenches The mode of bar cell HLA non-dependent recognizes the ability of two kinds of tumour antigens, can be recognized relative to traditional CAR-T cells wider General target, further expands the removing scope of tumour cell.OCTS basic engineering includes two tumor associated antigens (tumor-associated antigen, TAA) land (is typically derived from the scFv of monoclonal antibody antigen calmodulin binding domain CaM Section), an extracellular hinge area, a transmembrane region, Liang Ge intracellular signal transductions area and a response element area.ScFv regions for It is crucial determinant for OCTS specificity, validity and the genetic modification T cell security of itself.With OCTS-CAR-T's will indicate that CAR-T cell therapies will enter for 2.0 epoch into clinical investigation phase.

Carrier framework of the present invention can apply in third generation slow virus carrier structure, can also be applied to the In two generation slow virus carrier structures.The difference of the second generation and third generation slow virus carrier in structure is as shown in Figure 2 B.The present invention It is preferred that third generation slow virus carrier (as shown in Figure 2 A), 3 ' SIN LTR eliminate U3 regions, eliminate slow virus carrier and self answer The possibility of system, substantially increases security；CPPT and WPRE elements are added, transduction efficiency and the table of transgenosis is improved Up to efficiency；The lasting efficient transcription of core RNA when ensure that slow virus carrier packaging using RSV promoters；Using people's itself EF1 α promoters, enable CAR genes in human body long lasting for expression.

PDL1 single-chain antibodies light chain VL, PDL1 single-chain antibody heavy chain VH, PDL1 single-chain antibody of the present invention passes through It is humanization modified, the generation that the anti-mouse of internal people resists (Human anti-mouse antibodies, HAMA) can be effectively reduced, Extend scFv half-life period and action effect, increase the existence time of OCTS-CAR-T cells.

One kind of the costimulating factor used in the present invention or several combination, by increasing capacitance it is possible to increase the propagation speed of cell after transduction The characteristics such as rate, time-to-live, killing-efficiency, immunological memory.

The OCTS-CAR-T cells that the present invention is used are after the Workshop Production of GMP ranks, available for human clinical trial.

The recombined lentivirus vector of the present invention can be realized expresses the double of the combinations such as PSMA, PDL1 on human T lymphocyte Chimeric antigen receptor is targetted, guides and activated T lymphocytes is to the lethal effects of the positive cells such as PSMA, PDL1, clinically Treatment available for malignant tumours such as prostate cancer, melanoma, carcinomas of endometrium.

The present invention by recombined lentivirus vector skeleton, OCTS domains, PD1 parts (PD-L1) single chain Antibody (single-chain antibody) is built and forms recombined lentivirus vector, and the recombined lentivirus vector which is obtained can be realized The list of expression cell formula death ligand 1 (Programmed cell death 1ligand 1, PDL1) in human T lymphocyte Chain antibody, can effectively close PDL1, and blocking immunity negative regulator signal path can be clinically used for suppressing the immune escape of tumour, Improve the curative effect of CAR-T cellular immunotherapies.

It can be seen that, OCTS-CAR-T cells of the present invention will provide reliable ensure to tumour cell treatment.

Brief description of the drawings

Fig. 1 is the schematic diagram of OCTS Chimerical receptors of the present invention, contains series connection OCTS (Series OCTS) and turns Angle OCTS (Turn OCTS) schematic diagram；

Fig. 2 slow virus carrier structural representations of the present invention；Wherein Fig. 2A is that the third generation that the present invention is used is sick slowly Poisonous carrier structural representation, Fig. 2 B are the second generation and third generation slow virus carrier structure comparison schematic diagram；

Fig. 3 is to build the structure flow chart of recombined lentivirus vector of the present invention in the embodiment of the present invention 1.Wherein, (A) figure is slow virus skeleton plasmid pLenti-3G basic structural representation；(B) figure is the schematic diagram of 2 OCTS plasmids； (C) figure is the structural representation of pPac-GP plasmids；(D) figure is the structural representation of pPac-R plasmids；(E) figure is pEnv-G bags Fill the structural representation of plasmid；

Fig. 4 is the element orders schematic diagram of OCTS structures in the embodiment of the present invention 1, wherein, A figures are series connection OCTS The structural representation of (Series OCTS), B figures are corner OCTS (Turn OCTS) structural representations, and C figures are OCTS structures Plasmid number (OCTS Symbol) list schematic diagram；

Fig. 5 is the enzyme of recombinant slow virus plasmid pOCTS-PDL1PSMAs, pOCTS-PDL1PSMAt in the embodiment of the present invention 1 Cut prediction and digestion agarose gel electrophoresis figure；Wherein Fig. 5 A are pOCTS-PDL1PSMAs digestion prediction schematic diagrames, and Fig. 5 B are POCTS-PDL1PSMAs digestion agarose gel electrophoresis figure；Fig. 5 C are pOCTS-PDL1PSMAt digestion prediction schematic diagrames, Fig. 5 D are pOCTS-PDL1PSMAt digestion agarose gel electrophoresis figures；Lane1 in Fig. 5 A is 1kb DNA ladder Marker：Band is followed successively by from top to bottom：10kb、8kb、 6kb、5kb、4kb、3.5kb、3kb、2.5kb、2kb、1.5kb、 1kb、750bp、500bp、250bp；Lane2 in Fig. 5 A is pOCTS-PDL1PSMAs Sac II digestions prediction：Band from Top to bottm is followed successively by：7158bp、2437bp、1863bp、557bp；Lane1 in Fig. 5 B is 1kb DNA ladder Marker Electrophoresis result；Lane2 in Fig. 5 B is pOCTS-PDL1PSMAs Sac II restriction enzyme digestion and electrophoresis results；Lane1 in Fig. 5 C is 1kb DNA ladder Marker：Band is followed successively by from top to bottom：10kb、8kb、6kb、5kb、4kb、 3.5kb、3kb、 2.5kb、2kb、1.5kb、1kb、750bp、500bp、250bp；Lane2 in Fig. 5 C is pOCTS-PDL1PSMAt EcoR I Digestion is predicted：Band is followed successively by from top to bottom：8988bp、1934bp、1355bp；Lane1 in Fig. 5 D is 1kb DNA Ladder Marker electrophoresis result；Lane2 in Fig. 5 D is pOCTS-PDL1PSMAt EcoR I restriction enzyme digestion and electrophoresis results；

Fig. 6 is the titre testing result schematic diagram of recombined lentivirus vector in the embodiment of the present invention 1；

Fig. 7 is the step flow chart of the OCTS-CAR-T cell constructions described in the embodiment of the present invention 1, includes separation training The stages such as foster, activation, gene transfer, OCTS-CAR-T cellular identifications；

Fig. 8 is the detection of mycoplasma result schematic diagram of OCTS-CAR-T cells in the embodiment of the present invention 2, wherein, lane1 is DL2000marker, from top to bottom bar counterband tape be followed successively by from top to bottom：2kb、1kb、750bp、500bp、250bp、100bp； Lane2 is positive control；Lane3 is negative control；Lane4 is PBS；Lane5 is lysate；Lane6 is OCTS- PDL1PSMAs-CAR-T cells；Lane7 is OCTS-PDL1PSMAt-CAR-T cells；

Fig. 9 is the transduction efficiency and immunophenotyping result of flow cytometer detection OCTS-CAR-T cells in the embodiment of the present invention 2 Schematic diagram；Wherein, Fig. 9 A represent the transduction efficiency result of OCTS-PDL1PSMAs-CAR-T cells；Fig. 9 B represent OCTS- The immunophenotyping result of PDL1PSMAs-CAR-T cells；Fig. 9 C represent the transduction efficiency of OCTS-PDL1PSMAt-CAR-T cells As a result；Fig. 9 D represent the immunophenotyping result of OCTS-PDL1PSMAt-CAR-T cells；

Figure 10 is in the embodiment of the present invention 3 under the conditions of different effect target ratios, OCTS-PDL1PSMAs-CAR-T cells and Mortaility results comparison schematic diagram of the OCTS-PDL1PSMAt-CAR-T cells to different target cells.

Embodiment

This invention is expanded on further with reference to specific embodiment.It should be understood that particular implementation described here Represent by way of example, be not intended as limitation of the present invention.Without departing from the scope of the invention, it is of the invention Principal character can be used for various embodiments.Material

1st, slow virus skeleton plasmid pLenti-3G basic, slow virus packaging plasmid pPac-GP, pPac-R and film egg White matter grain pEnv-G, HEK293T/17 cells, homologous recombination enzyme, Oligo Annealing Buffer, mycoplasma test reagent Box, endotoxin detection kit, PSMA⁺K562、 PDL1⁺K562、PDL1⁺PSMA⁺K562, K562 cell are taken wing in (Shanghai) purchased from generation Biological medicine Science and Technology Ltd.；Slow virus skeleton plasmid pLenti-3G basic specific preparation method has been proposed in hair Bright entitled " a kind of based on the CAR-T transgene carriers and its construction method of replication defective recombinant slow virus and application ", specially In the patent application specification of sharp Application No. 201610008360.5；

2nd, people's fresh peripheral blood is provided by health donors；

3rd, OCTS-PDL1PSMAs, OCTS-PDL1PSMAtDNA combined sequence are designed (referring to figure by Shanghai You Kadi companies 4C), Shanghai Jierui Biology Engineering Co., Ltd's synthesis is given, and is preserved with oligonucleotides dry powder or plasmid form；

4th, toolenzyme Cla I, EcoR I, Sac II, T4DNA ligases are purchased from NEB companies；

5th, 0.22 μm of -0.8 μm of PES filter is purchased from millipore companies；

6th, D-PBS (-), 0.4% trypan blue, screen cloth, all types of Tissue Culture Dish, culture bag, culture plate are purchased from Corning companies；

7、Opti-MEM、Pen-Srep、Hepes、FBS、AIM-V、RPMI 1640、DMEM、lipofectamine 3000 Purchased from invitrogen companies；

8th, Biotinylated protein L are purchased from GeneScript companies；

9th, LDH detection kits are purchased from promega companies；

10th, Ficoll lymphocyte separation mediums are purchased from GE companies；

11st, 20% human serum albumin injection is purchased from Ztel's Belling company；

12nd, CryoPremium frozen stock solutions, sorting buffer solution come from Shanghai You Kadi companies；

13rd, rIL-2, rIL-7, rIL-15, rIL-21 is purchased from peprotech companies；

14th, CD3 monoclonal antibodies, CD28 monoclonal antibodies, CD3/CD28 magnetic bead CD4/CD8 magnetic beads are purchased from Germany Miltenyi companies；

15th, refrigerated centrifuge (ThermoScientific companies of the U.S.；

16th, FACS flow cytometers are purchased from Thermo companies；

17th, fluorescence inverted microscope is purchased from Olympus companies；

18th, CD4-FITC, CD8-APC are purchased from BioLegend companies；

19th, 0.9% physiological saline is purchased from Jin Mai companies；

20th, ProteinL Magnetic Beads are purchased from BioVision companies；

21st, PrimeSTAR, RetroNectin are purchased from Takara companies；

22nd, phycoerythrin (PE)-conjugated streptavidin are purchased from BD Bioscience companies；

23rd, plasmid extraction kit, Ago-Gel QIAquick Gel Extraction Kit are purchased from MN companies；

24th, competent cell TOP10 is purchased from tiangen companies；

25、NaCl、KCl、Na₂HPO₄.12H₂O、KH₂PO₄、Trypsin、EDTA、CaCl₂, NaOH, PEG6000 be purchased from Give birth to work in Shanghai；

26th, DNeasy kits are purchased from Shanghai JaRa company；

27th, SA-HRP is purchased from Shanghai Yi Sheng companies；

28th, primer：Primer according to needed for design of primers principle designs amplification of DNA fragments and target site, the primer is by upper Marine growth company synthesizes, and is specially：

EF1α-F：5’-ATTCAAAATTTTATCGATGCTCCGGTGCCCGTCAGT-3’(SEQ ID NO.28)

EF1α-R：5’-TCACGACACCTGAAATGGAAGA-3’(SEQ ID NO.29)

OCTS-F：CATTTCAGGTGTCGTGAGGATCCGCCACCATGGCGCTGCCGGTGAC(SEQ ID NO.30)

OCTS-R：GGGGAGGGAGAGGGGCTTAGCGCGGCGGCAGCG(SEQ ID NO.31)

IRES-F：GCCCCTCTCCCTCCCCC(SEQ ID NO.32)

IRES-R：ATTATCATCGTGTTTTTCAAAGGAA(SEQ ID NO.33)

PDL1scab-F：AAAACACGATGATAATGCCACCATGAACTCCTTCTCCACAAGCG(SEQ ID NO.34)

PDL1scab-R：AATCCAGAGGTTGATTGTCGACGAATTCTCATTTGCCCGGGCTCAG(SEQ ID NO.35)

WPRE-QPCR-F：5’-CCTTTCCGGGACTTTCGCTTT-3’(SEQ ID NO.36)

WPRE-QPCR-R：5’-GCAGAATCCAGGTGGCAACA-3’(SEQ ID NO.37)

Actin-QPCR-F：5’-CATGTACGTTGCTATCCAGGC-3’(SEQ ID NO.38)

Actin-QPCR-R：5’-CTCCTTAATGTCACGCACGAT-3’(SEQ ID NO.39)

29th, in the present invention, SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ the ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.22, SEQ DNA fragmentation is by upper shown in ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27 The sequent synthesis that extra large JaRa bioengineering Co., Ltd provides according to the present inventor.

The OCTS-CAR-T cell constructions of embodiment 1

First, recombined lentivirus vector lvOCTS-PDL1PSMAs, lvOCTS-PDL1PSMAt structure, purifying, detection side Method.

Referring to Fig. 3, the construction method of recombined lentivirus vector of the present invention is as follows：

1st, by people EF1 α promoters (SEQ ID NO.14), OCTS structures【OCTS-PDL1PSMAs、OCTS- PDL1PSMAt】(CD8 leader Chimerical receptors signal peptide (SEQ ID NO.15), PSMA single-chain antibody light chain VL (SEQ ID NO.16), PSMA single-chain antibodies heavy chain VH (SEQ ID NO.17), PDL1 single-chain antibody light chains VL (SEQ ID NO.18), PDL1 Between single-chain antibody heavy chain VH (SEQ ID NO.19), antibody inner hinge Inner-Linker (SEQ ID NO.20), single-chain antibody Hinge Inter-Linker (SEQ ID NO.21), CD8Hinge Chimerical receptors hinge (SEQ ID NO.22), CD8Transmembrane Chimerical receptors transmembrane region (SEQ ID NO.23), CD28 Chimerical receptors costimulating factor (SEQ ID NO.24), CD134 Chimerical receptors costimulating factor (SEQ ID NO.25), TCR Chimerical receptor t cell activations domain (SEQ ID NO.26)), PDL1 single-chain antibodies (SEQ ID NO.27) are combined into OCTS Chimerical receptor designs, by digestion, connection, Recombining reaction is cloned into slow virus skeleton plasmid pLenti-3G basic, respectively obtains recombinant slow virus plasmid pOCTS- PDL1PSMAs, pOCTS-PDL1PSMAt, element orders and numbering are as shown in Figure 4.

(1) slow virus skeleton plasmid pLenti-3G basic are carried out using Cla I and EcoR I restriction enzymes double Digestion, product passes through 1.5% agarose gel electrophoresis, confirms 5823bp fragment V1, and recovery of tapping rubber is placed in Eppendorf In pipe, corresponding fragment (being shown in Table 1) is reclaimed with the Ago-Gel QIAquick Gel Extraction Kits of MN companies, and determines the purity of product and dense Degree；

1st, colloidal sol	Sol solutionses are added in 200 μ l NTI/100mg gel ratios, 50 DEG C of water-baths are placed 5-10 minutes.
		2nd, with reference to DNA	11000g is centrifuged 30 seconds, discards filtrate.
3rd, film is washed	700 μ l NT3,11000g centrifugation 30 seconds is added, filtrate is discarded.
		4th, film is washed	Repeat the 3rd step once
5th, dry	11000g is centrifuged 1 minute, the collecting pipe renewed, and room temperature is placed 1 minute.
		6th, eluted dna	15-30 μ l NE are added, room temperature is placed 1 minute, and 11000g is centrifuged 1 minute, collects filtrate.

The Ago-Gel recycling step of table 1

(2) with primer EF1 α-F and EF1 α-R with the people EF1 α promoters (SEQ ID NO.14) that synthesize for template, use System in table 2, PCR cycle condition is：98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 2min) * 35cycle, 72 ℃10min.Product passes through 1.5% agarose gel electrophoresis, confirms 1208bp fragment a, and recovery of tapping rubber is placed in In Eppendorf pipes, corresponding fragment (being shown in Table 1) is reclaimed with the Ago-Gel QIAquick Gel Extraction Kit of MN companies, and determine product Purity and concentration；

The μ l PCR reaction systems of table 2 50

(3) with primer OCTS-F and OCTS-R using the OCTS-PDL1PSMAs that synthesizes as template, using the system in table 2, PCR cycle condition is：98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product By 1.5% agarose gel electrophoresis, 2352bp fragment b is confirmed, and recovery of tapping rubber is placed in Eppendorf pipes, uses MN The Ago-Gel QIAquick Gel Extraction Kit of company reclaims corresponding fragment (being shown in Table 1), and determines the purity and concentration of product；

(4) with primer OCTS-F and OCTS-R using the OCTS-PDL1PSMAt that synthesizes as template, using the system in table 2, PCR cycle condition is：98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product By 1.5% agarose gel electrophoresis, 2406bp fragment c is confirmed, and recovery of tapping rubber is placed in Eppendorf pipes, uses MN The Ago-Gel QIAquick Gel Extraction Kit of company reclaims corresponding fragment (being shown in Table 1), and determines the purity and concentration of product；

(5) with primer I RES-F and IRES-R with the IRES ribosome binding sequences (SEQ ID NO.12) that synthesize for mould Plate, using the system in table 2, PCR cycle condition is：98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product passes through 1.5% agarose gel electrophoresis, confirms 575bp fragment d, and recovery of tapping rubber is put In in Eppendorf pipes, corresponding fragment (being shown in Table 1) is reclaimed with the Ago-Gel QIAquick Gel Extraction Kit of MN companies, and determine production The purity and concentration of thing；

(6) with primer PDL1scab-F and PDL1scab-R with the PDL1 single-chain antibodies (SEQ ID NO.27) that synthesize for mould Plate, using the system in table 2, PCR cycle condition is：98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product passes through 1.5% agarose gel electrophoresis, confirms 1557bp fragment e, and recovery of tapping rubber is put In in Eppendorf pipes, corresponding fragment (being shown in Table 1) is reclaimed with the Ago-Gel QIAquick Gel Extraction Kit of MN companies, and determine production The purity and concentration of thing；

(7) by recombinant slow virus DNA fragment combination (being shown in Table 3) with 5 μ l cumulative volumes and mol ratio 1:1:1:1 ratio Add in Eppendorf pipes, add the μ l of homologous recombination enzyme reaction solution 15, be incubated 30 minutes, be transferred on ice at 42 DEG C after mixing Place 2-3 minutes, reaction solution added in 50 μ l TOP10, gently rotated to mix content, placed 30 minutes in ice, Pipe is put into pre-heating heat shock 90 seconds into 42 DEG C of thermostat water bath, quickly pipe is transferred in ice bath, cell is cooled down 2-3 Minute, often pipe, is then transferred on 37 DEG C of shaking tables by pipe plus 900 μ l LB nutrient solutions, and incubation makes bacteria resuscitation in 1 hour, takes 100 μ L transformed bacteria solution is coated on Amp LB agar plates, is inverted plate, 37 DEG C of cultures, 16 hours in constant incubator.

Recombinant slow virus plasmid	Fragment combination
		pOCTS-PDL1PSMAs	a、b、d、e
pOCTS-PDL1PSMAt	a、c、d、e

The recombinant slow virus DNA fragment combination of table 3

Picked clones carry out bacterium colony PCR identifications, and the correct clone of identification is recombinant slow virus plasmid pOCTS- PDL1PSMAs, pOCTS-PDL1PSMAt, carry out digestion identification (see Fig. 5), and send sequencing to check result to correct clone.

2nd, recombined lentivirus vector lvOCTS-PDL1PSMAs, lvOCTS-PDL1PSMAt packaging.

(1) complete medium：Preheated fresh culture is taken out, 10%FBS+5ml Pen-Srep is added, runs up and down Mix；

(2) 1XPBS solution：Weigh NaCl 8g, KCl 0.2, Na₂HPO₄.12H₂O 3.58g, KH₂PO4 0.24g are placed in In 1000ml beakers, the dissolving of 900ml Milli-Q grade ultra-pure waters is added, after the completion of dissolving, 1000ml graduated cylinder constant volumes are used To 1000ml, 121 DEG C of high-temperature heat sterilization 20min；

(3) 0.25%Trypsin solution:Trypsin 2.5g, EDTA 0.19729g is weighed to be placed in 1000ml beakers, 900ml 1XPBS dissolving is added, after the completion of dissolving, 1000ml is settled to using 1000ml graduated cylinders, 0.22 μM of filtration sterilization, for a long time Using can preserve to -20 DEG C of refrigerators；

(4) 0.5M CaCl2 solution：Weigh 36.75g CaCl₂Dissolved with 400ml Milli-Q grade ultra-pure waters；With Cumulative volume is settled to 500ml by Milli-Q grade ultra-pure waters, is mixed；0.22 μm of filtration sterilization, packing is saved in 50ml centrifugations Guan Zhong, often pipe 45ml or so, 4 DEG C of preservations.

(5) 2XHBS solution：Weigh 4.09g NaCl, 0.269g Na₂HPO4,5.96g Hepes, use 400ml Milli- Q grade ultra-pure waters dissolve；Calibrate after pH instrument, the pH of HBS solution is transferred to 7.05 with 2M NaOH solutions.Every bottle of HBS's of adjustment PH consumption 2M NaOH are 3ml or so；

(6) the HEK293T/17 cells frozen are taken out from liquid nitrogen container, are quickly transferred in 37 DEG C of water-baths, after 1~2min It is transferred in super-clean bench, the liquid in cryopreservation tube is fully transferred to 10cm by sterile working²In culture dish, supply containing 10%FBS DMEM to 8mL/10cm²Micro- sem observation cell after dish, 24h, the degree of cell confluency is passed on more than 80%；

(7) cell state is good, free of contamination HEK293T/17 cells for selection, is one group per 2-6 culture dish, by cell After pancreatin digestion, 4-12ml complete mediums are drawn with electric pipettor, 2ml is added into each postdigestive culture dish, it is to avoid Culture dish is dried；All cells are blown and beaten into single cell suspension using 1ml pipettors, are transferred in medium bottle；

(8) remaining cell in above-mentioned 2-6 culture dish is transferred in medium bottle, and rinsed again with culture medium once Culture dish；

(9) culture medium bottle cap is covered tightly, turns upside down 10 times or so and fully mixes cell suspension, cell is passed to 8-24 10cm²In culture dish, the cell density per ware should about 4 × 10⁶Individual/10ml complete mediums or so.If cell density and pre- The difference of phase is larger, then needs to count cell, then according to 4 × 10⁶The amount inoculation of individual/ware；

(10) every 6 culture dishes arrange piles up for one, notes the cooperation between ware above and below keeping.It is front and rear by culture dish or so Rock for several times, cell is fully spread out, be then placed in 5%CO₂Incubator.Remaining cell does same processing；

(11) institute's passage cell is checked, cell confluency degree should be 70-80%, and profile is full, it is adherent good, in cell training Support and be uniformly distributed in ware；

(12) liquid is changed for cell, culture medium is replaced with into fresh complete medium, per ware 9ml, and by the CO of incubator₂It is dense Degree setting value brings up to 8%；

(13) DNA/CaCl is matched somebody with somebody according to N+0.5₂Solution.Per ware HEK293T/17 cell transfecting plasmid amounts according to following ratio Use：Recombinant slow virus plasmid (20 μ g), pPac-GP (15 μ g), pPac-R (10 μ g), pEnv-G (7.5 μ g).Take one it is new 5ml centrifuge tubes, add 0.5M CaCl2：0.25ml, the μ g of recombinant slow virus plasmid 20：pPac-GP 15μg：pPac-R 10μg： The μ g of pEnv-G 7.5, supplement ultra-pure water to 0.5ml closes the lid, and fully mixes；

(14) it is another to take a 5ml centrifuge tube, add 0.5ml DNA/CaCl2 solution.Turbula shaker is opened, a hand is taken The firmly upper end of 5ml centrifuge tubes, makes ttom of pipe contact oscillating end, liquid is scattered on tube wall flowing, and another hand moves 1mL by one Liquid rifle, draws 0.5mL 2 × HBS solution, is slowly added dropwise and enters centrifuge tube, coutroi velocity is dripped off with half a minute and is advisable.2×HBS After addition, continue to vibrate 5 seconds, stop oscillation, can be directly added into the cell for needing to transfect；

(15) take a ware cell, the 1mL calcium in centrifuge tube is turned into drop adds, make as far as possible calcium turn reagent be distributed to it is whole In individual culture dish；

(16) calcium turns after liquid addition, is covered in ware and carries out mark, culture dish is released to another 5%CO₂In incubator. Ensure culture dish horizontal positioned, often pile up culture dish and do not exceed 6.In 5%CO₂(6-8h) is placed in incubator；

(17) by the CO of first incubator₂Concentration set point adjusts back to 5%；

After (18) 24 hours, cell state is checked.Cell confluency degree should be 80-85% or so, in good condition.Will culture Base is siphoned away, and changes the fresh DMEM complete mediums of 10ml；

After (19) 48 hours, transfection efficiency is observed.Most cells are still adherent.It can be seen that thin more than 95% Born of the same parents can carry green fluorescence.Same virus is packed into supernatant collection to together, and continues into culture dish addition 10mL Fresh culture；

After (20) 72 hours, same vial supernatant is collected into the virus together, collected twice again to be placed on Together, culture dish is abandoned；Recombined lentivirus vector lvOCTS-PDL1PSMAs, lvOCTS- are contained in the supernatant now collected PDL1PSMAt。

3rd, ion exchange chromatography recombined lentivirus vector；

(1) supernatant of collection is used into Thermo vavuum pumps, through 0.22 μm -0.8 μm of PES filter suction filtrations, except impurity elimination Matter；

(2) 1 is pressed:1~1:10 ratio is toward adding 1.5M NaCl 250mM Tris-HCl (pH 6-8) in supernatant；

(3) 2 ion exchange columns are placed in series, with 4ml 1M NaOH, 4ml 1M NaCl, 5ml 0.15M NaCl 25mM Tris-HCl (pH 6-8) solution crosses post successively；

(4) ion exchange column loading is given by peristaltic pump with 1-10ml/min speed by the solution obtained in step 2；

(5) whole supernatants are crossed after post, are cleaned using 10ml 0.15M NaCl 25mM Tris-HCl (pH 6-8) solution One time；

(6) eluted according to applied sample amount using 1-5ml 1.5M NaCl 25mM Tris-HCl (pH 6-8), collection is washed De- liquid；

(7) eluent is divided into the pipes of 25 to 50 μ l mono-, freezes -80 DEG C of refrigerators, preserved for a long time；

4th, recombined lentivirus vector titer determination；

(1) 24 orifice plates are taken to be inoculated with 293T cells.It is 5 × 10 per hole cell⁴Individual, added culture volume is 500ul, different The vitro growth rates of species difference, cell confluency when carrying out virus infection is 40%-60%；

(2) prepare 3 sterile EP pipes, 90ul fresh complete medium (DMEM in high glucose+10% is added in each pipe FBS) inoculating cell takes the cell in two holes to be counted with blood counting chamber after 24 hours, it is determined that infection when cell actual number, It is designated as N；

(3) take virus stock solution used 10ul to be determined to be added in first pipe, after gently mixing, take 10ul to be added to second In individual pipe, a to the last pipe is then operated successively；410ul complete medium (DMEM in high glucose+10% is added in every pipe ), FBS final volume is 500ul；

(4) 20 hours after infection starts, culture supernatant is removed, 500 μ l complete medium (DMEM in high glucose+10% are replaced by FBS), 5%CO₂Continue to cultivate 48 hours；

After (5) 72 hours, luciferase expression situation is observed, under normal circumstances, fluorecyte number increases and phase with extension rate It should reduce, and take pictures；

(6) the pancreas enzyme -EDTA solution digestion cells of 0.2ml 0.25% are used, are placed 1 minute at 37 DEG C.Purged with culture medium whole Individual cell face, is collected by centrifugation cell.Genomic DNA is extracted according to the explanation of DNeasy kits.200 are added in each sample cell μ l eluents wash lower DNA and quantitative；

(7) preparing target DNA detection house steward qPCRmix I, (QPCR primer sequences are SEQ ID NO.36---SEQ ID NO.37)：

N=number of reactions. are for example：Overall reaction number is 40, by 2 × TaqMan of 1ml Universal PCR Master Mix, 4 μ l forward primer, 4 μ l reverse primer, 4 μ l probe and 788 μ l H2O are mixed With.It is placed on ice after concussion；

(8) preparing internal reference DNA detection qPCRmix pipes II, (QPCR primer sequences are SEQ ID NO.38---SEQ ID NO.39)：

2×TaqMan Master Mix 25μl×n

10×RNaseP primer/probe mix 2.5μl×n

H₂O 17.5μl×n

N=number of reactions. are for example：Overall reaction number is 40, by 2 × TaqMan of 1ml Universal PCR Master Mix, 100 μ l 10 × RNaseP primer/probe mix and 700 μ l H₂O is mixed.Ice is placed on after concussion On；

(9) PCR system is completed in 96 hole PCR plates of precooling to set up.45 μ l are respectively taken to be added to each rows of A-D from house steward I Hole in, respectively take 45 μ l to be added in the hole of each rows of E-G from house steward II.

(10) 5 μ l plasmid standards and testing sample genomic DNA is taken to be added in A-D rows respectively, each sample repeats 1 It is secondary.It is another to stay the water that 1 hole adds 5 μ l as no template control (no-template control).

(11) 5 μ l genomes standard items and testing sample genomic DNA is taken to be added in E-G rows respectively, each sample weight It is multiple 1 time.It is another to stay the water that 1 hole adds 5 μ l as no template control (no-template control).

(12) it is the quantitative systems of ABI PRISM 7500 to use quantitative PCR apparatus.Cycling condition is set as：50 DEG C 2 minutes, 95 DEG C 10 minutes, followed by 95 DEG C 15 seconds, 60 DEG C of 40 of 1 minute circulations.

Data analysis：The slow virus carrier copy number integrated in the DNA sample measured is demarcated with genome number, is obtained Viral copy number per genome conformity.

Titre (integration units per ml, IU ml^-1) calculation formula it is as follows：

IU ml^-1=(C × N × D × 1000)/V

Wherein：Viral copy numbers of the C=averagely per genome conformity

The number (about 1 × 10 of cell when N=infects⁵)

The extension rate of D=viral vectors

The volume number for the dilution virus that V=is added

(13) recombined lentivirus vector lvOCTS-PDL1PSMAs, lvOCTS-PDL1PSMAt titre results are (such as Fig. 6 institutes Show)；

2nd, OCTS-CAR-T cell constructions

Referring to Fig. 7, the construction method of OCTS-CAR-T cells of the present invention is as follows：

1st, PBMC is separated.

(1) health donors fresh peripheral blood 50ml is extracted；

(2) blood taking bag spray is wiped into alcohol twice, and dried.

(3) haemocyte in bag is sucked out with 50ml syringes and moved in new 50ml pipes.

(4) 400g, 20 DEG C of centrifugation 10min.

(5) upper plasma is moved on in new 50ml centrifuge tubes, 56 DEG C, 30min inactivation blood plasma recovers to room temperature, 2000g, centrifuges 30min, takes supernatant stand-by into 50ml centrifuge tubes.

(6) mended with D-PBS (-) to 50ml, tighten lid, overturned and mix.

(7) 2 new 50ml centrifuge tubes are taken, often pipe adds 15ml Ficoll lymphocyte separation mediums.

(8) it is carefully added into haemocyte dilution 25ml on every pipe Ficoll.800g, 20 DEG C of centrifugation 20min.

(9) liquid is divided into four layers in centrifuge tube, is respectively from top to bottom：The plasma layer (reclaim stand-by) of yellow, tunica albuginea layer, The Ficoll layers of water white transparency, the cell mixing layer of reddish black.

(10) careful tunica albuginea layer of drawing adds D-PBS (-) to 50ml, overturns 500g after mixing into new 50ml centrifuge tubes, 20 DEG C of centrifugation 10min.

(11) human serum albumins of 25ml 5% are added and cell is resuspended, 400g, 20 DEG C of centrifugation 10min.

(12) supernatant is abandoned, the human serum albumins of 25ml 5% is added and cell precipitation is resuspended, and crosses 70um screen clothes, is counted.

(13) 1 part is taken to contain 1.25x10⁸Cells is used to activate；Remaining cell suspension 400g, 20 DEG C of centrifugation 10min, plus CryoPremium simultaneously freezes.

2nd, CD4/CD8 positive T cells are sorted.

(1) PBMC of acquisition is counted, with 80ul/10⁷Cells ratio adds sorting buffer solution, and cell precipitation is resuspended.

(2) again with 20ul/10⁷Cells ratio adds CD4/CD8 magnetic beads, and piping and druming is put into 4 DEG C after mixing and is incubated 15min。

(3) magnetic bead-cell mixture is taken out, with 2ml/10⁷Cells ratio adds sorting buffer solution, overturns after mixing, 250g, 4 DEG C of centrifugation 10min.

(4) with 500ul/10⁸Cells ratio adds sorting buffer solution, and cell precipitation is resuspended.

(5) LS splitters are gripped to magnetic frame with tweezers.

(6) while preparing 2 15ml centrifuge tubes, mark respectively：CD4-/CD8- cell liquid (A pipes), CD4+/CD8+ cells Liquid (B pipes).

(7) 3ml dissociating buffer rinse LS are used, and buffer solution is connect with A pipes.

(8) cell-magnetic bead mixed liquor is added, 3ml wash buffers pillar is added after dripping off (during each no liquid residual again Add new liquid), three times altogether, collection obtains CD4/CD8- cells.

(9) LS splitters are separated with magnetic frame, and cell suspension is connect with B pipes, add 5ml buffer solutions, will and be filled in in pillar Slightly firmly rinse, be collected as CD4+/CD8+ cells, sampling is counted.

(10) 1x10 is pressed⁶/ml-4x10⁶/ ml cell density AIM-V culture mediums resuspension cell precipitation, and addition 2 × 10⁵~1 × 10⁶The U/L IFN-γ factors.

3rd, t cell activation.

(1) the previous day is carried by 1 × 10³Ug/L~1 × 10⁴Ug/L CD3 monoclonal antibodies and 1 × 10³Ug/L~1 × 10⁴Ug/L CD28 monoclonal antibodies add 24 orifice plates, and sealed membrane sealing is stayed overnight for 4 DEG C and is coated with.

(2) coated T75 bottles is taken out, coating buffer is outwelled, washed once with D-PBS (-), and the cell that sorting is obtained hangs Liquid is inoculated into T75 bottles, is shaken up, and is put into 37 DEG C, 5%CO₂Cultivated in incubator.

4th, CAR gene transfers and OCTS-CAR-T cell induction cultures.

(1) the previous day coating 1 × 10 is put forward³Ug/L~1 × 10⁴Ug/L RetroNectin are in 24 orifice plates, and sealed membrane is sealed Mouthful, 4 DEG C are coated with overnight.

(2) toward in 24 orifice plates, according to every hole 5 × 10⁵Cell concentration, by the amount of MOI=5~20, is separately added into lvOCTS- PDL1PSMAs, lvOCTS-PDL1PSMAt slow virus transgene carrier, while addition contains 2 × 10⁵~5 × 10⁵U/L rIL-2, 5×10³Ng/L~1 × 10⁴Ng/L rIL-7,5 × 10³Ng/L~1 × 10⁴Ng/L rIL-15,5 × 10³Ng/L~1 × 10⁴Ng/L rIL-21 and 37 DEG C of AIM-V culture mediums, 5% CO containing 10% autoserum₂Continue to cultivate.

5th, OCTS-CAR-T cell expansion ex vivos.

(1) every 2 days equivalent is added containing 2 × 10⁵~5 × 10⁵U/L rIL-2,5 × 10³Ng/L~1 × 10⁴ng/L rIL- 7,5 × 10³Ng/L~1 × 10⁴Ng/L rIL-15,5 × 10³Ng/L~1 × 10⁴Ng/L rIL-21 and containing 10% autoserum AIM-V culture mediums, pH value is maintained between 6.5~7.5, cell density maintains 5 × 10⁵~2 × 10⁶Between/ml, 37 DEG C, 5%CO₂Continue to cultivate 10-14 days.

(2) the 7th days or so, freezing the OCTS-CAR-T cells of culture was used for subsequent detection.

Embodiment 2

OCTS-CAR-T cells Pathogen test and detection of expression.

First, endotoxin is detected；

(1), endotoxin working standard is 15EU/ branch；

(2), sensitivity of the limulus reagent λ=0.25EU/ml, 0.5ml/ are managed

(3), endotoxin standard dilutes：Endotoxin standard one is taken, 4 λ and 2 λ are diluted in proportion with BET water respectively Dissolving, sealed membrane sealing, concussion dissolving 15min；A step is often diluted during dilution all should mix 30s on eddy mixer；

(4), it is loaded：If taking the TAL Heavenly Stems and Earthly Branches, every adds BET water 0.5ml dissolvings, and as Heavenly Stems and Earthly Branches endotoxin-free is tried for packing Guan Zhong, often pipe 0.1ml.Wherein 2 are negative control pipe, add BET water 0.1ml；

2 are positive control pipe, add the endotoxin working standard solution 0.1ml of 2 λ concentration；

2 are Sample Positive control tube, and adding sample solutions of the 0.1ml containing 2 λ endotoxin standards, (20 times of dilution is treated Test sample product 1ml+4 λ endotoxin standard solution 1ml=2ml contains 40 times of samples of dilution of 2 λ endotoxin standards).

Add 0.1ml samples in sample cell, dilution ratio be shown in Table 4,37 ± 1 DEG C of water-baths (or incubator) insulation 60 ± 1min；

The endotoxin dilution ratio of table 4 and correspondence endotoxin content

(5), the endotoxin testing result (as shown in table 5) of OCTS-CAR-T cells, the endotoxin content of all cells is equal Less than 2.5EU/ml, meet《Pharmacopoeia of People's Republic of China》In be less than 10EU/ml standard；

Table 5

Extension rate	Stoste	5	10	20	40	80	160
								Correspondence EU/ml	0.25	1.25	2.5	5	10	20	40
OCTS-PDLlPSMAs-CAR-T	(+)	(+)	(-)	(-)	(-)	(-)	(-)
								OCIS-PDLlPSMAt-CAR-T	(+)	(+)	(-)	(-)	(-)	(-)	(-)

2nd, detection of mycoplasma；

(1) first three day is being tested, cell sample is cultivated with antibiotic-free culture medium；

(2) (cell number is more than 1*10 to collection 1ml cell suspending liquids⁵), it is placed in 1.5ml centrifuge tubes；

(3) 13000g centrifuges 1min, collects precipitation, discards culture medium；

(4) 500ul PBS pipette tips pressure-vaccum or vortex oscillation are added, precipitation is resuspended.13000g centrifuges 5min；

(5) step 4 is repeated once；

(6) 50 μ l Cell Lysis Buffer are added, pipette tips pressure-vaccum is used, after fully mixing, are incubated in 55 DEG C of water-baths 20min；

(7) sample is placed in 95 DEG C and heats 5min；

(8) 13000g is centrifuged after 5min, takes 5 μ l supernatants as template, 25 μ l PCR reaction systems are：ddH20 6.5μl、 The μ l of Myco Mix 1,2x Taq Plus Mix Master (Dye Plus) 12.5 μ l, the μ l of template 5；PCR cycle condition is：95 DEG C 30sec, (95 DEG C of 30sec, 56 DEG C of 30sec, 72 DEG C of 30sec) * 30cycle, 72 DEG C of 5min.

(9) detection of mycoplasma result is shown (as shown in Figure 8), and mycoplasma is free of in OCTS-CAR-T cells.

3rd, the detection of OCTS gene transduction efficiencies and immunophenotyping detection；

(1) T cell after viral transduction is collected, cell is resuspended with D-PBS (-) solution containing 1~4% human serum albumin And it is adjusted to 1 × 10⁶/ml。

(2) D-PBS (-) solution 1ml containing 1~4% human serum albumin is added into centrifuge tube and is mixed, 350g centrifugations 5min, abandons supernatant.

(3) repeat step 2 is once.

(4) cell is resuspended with 0.2ml D-PBS (-) solution containing 1~4% human serum albumin, and is added into centrifuge tube 1ul 1mg/ul protein L, 5ul CD4-FITC, 5ul CD8-APC, are mixed, 4 DEG C of incubation 45min.

(5) D-PBS (-) solution of the 1ml containing 1~4% human serum albumin is added into centrifuge tube and is mixed, 350g centrifugations 5min, abandons supernatant.

(6) repeat step 5 is twice.

(7) cell is resuspended with D-PBS (-) solution of 0.2ml containing 1~4% human serum albumin, and is added into centrifuge tube 0.2ul PE-SA, are mixed, and 37 DEG C of lucifuges are incubated 15min.

(8) add D-PBS (-) solution of 1ml containing 1~4% human serum albumin into centrifuge tube to weigh and mix, 350g centrifugations 5min, abandons supernatant.

(9) cell precipitation is resuspended with 1ml D-PBS (-) solution, 350g centrifugation 5min abandon supernatant.

(10) repeat step 9 is twice.

(11) cell precipitation is resuspended with 0.4ml D-PBS (-) solution, flow cytometer is detected.

(12) OCTS gene transduction efficiencies and the testing result of immunophenotyping detection are as shown in figure 9, the OCTS-CAR- prepared The efficiency of infection of T cell is respectively positioned on more than 40%, CD4 positive cells and the ratio of CD8 positive cells is located at 1:3~3:Between 1, Follow-up function detection can be carried out.

The Function detection of the OCTS-CAR-T cells of embodiment 3.

First, target cell fragmentation effect is assessed.

(1) target cell [PSMA is cultivated respectively⁺K562、PDL1⁺K562、PDL1⁺PSMA⁺K562, K562 cell] and effect it is thin Born of the same parents' [OCTS-CAR-T cells]；

(2) target cell 4x10 is collected⁵Cells and OCTS-CAR-T cells 2.8x10⁶Cells, 800g, 6min are centrifuged, and are abandoned Clearly；

(3) target cell and effector cell is resuspended respectively with 1ml D-PBS (-) solution, supernatant is abandoned in 800g, 6min centrifugations；

(4) repeat step 3 is once；

(5) effector cell is resuspended with 700ul culture mediums (+1~10%FBS of AIM-V culture mediums), with 2ml culture mediums (AIM- The FBS of V culture mediums+1~10%) target cell is resuspended；

(6) it is 1 to set effect target ratio:1、5:1、10:1 experimental port, effector cell respectively with single target cell and double target cell The packet situation being incubated altogether as shown in table 6, and sets control group (K562 cells), every group of 3 multiple holes；

Table 6

Effector cell	Target cell 1	Target cell 2	Target cell 3
				OCTS-PDLlPSMAs-CAR-T	PDLl+K562	PSMA+K562	PDLl+PSMA+K562
OCTS-PDLlPSMAt-CAR-T	PDLl+K562	PSMA+K562	PDLl+PSMA+K562

(7) 250g, 5min flat board are centrifuged；

(8) 37 DEG C, cultivated 4 hours in 5%CO2 incubators；

(9) 250g, 5min flat board are centrifuged；

(10) the 50ul supernatants in each hole are taken into new 96 orifice plate, and addition 50ul substrate solutions (the lucifuge behaviour per hole Make)；

(11) lucifuge is incubated 25min；

(12) 50ul terminate liquids are added per hole；

(13) ELIASA detection 490nm absorbances；

(14) 3 multiple holes are averaged；The light absorption value of all experimental ports, Target cell wells and effector cell hole is subtracted into training Support the average of base background light absorption value；The light absorption value of target cell maximum is subtracted into the average that volume correction compares light absorption value.

(15) bring the corrected value obtained in step 14 into formula below, calculate each effect target thinner than produced Cellular toxicity percentage.As a result as shown in Figure 10, OCTS-CAR-T has to respective single target cell and double target cells and preferably killed Hinder effect, the CAR-T cells of Turn OCTS structures are slightly above the CAR- of Series OCTS structures to the killing-efficiency of target cell T cell；

Killing-efficiency=(experimental port-effector cell hole-Target cell wells)/(target cell largest hole-Target cell wells) X100%

(16) it is above-mentioned test result indicates that, pass through in traditional CAR structures antigen recognizing district transformation formed OCTS tie Structure, can significantly improve OCTS-CAR-T cell recognitions and kill the scope of target cell, therefore OCTS-CAR-T cells will be not The PSMA positives/PDL1 the positives/PSMA, PDL1 double positive prostate cancer, melanoma, the carcinomas of endometrium come etc. are pernicious swollen Huge effect is played in the cell therapy of knurl.

Sequence table

<110>Shanghai You Kadi biological medicines Science and Technology Ltd.

<120>It is a kind of based on the prostate cancer CAR-T therapy vectors and its construction method of OCTS technologies and application

<130> HJ17-13349

<160> 39

<170> PatentIn version 3.5

<210> 1

<211> 861

<212> DNA

<213>Artificial sequence

<400> 1

atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt ttgccttcct 60

gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca gttgggtgca 120

cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag ttttcgcccc 180

gaagaacgtt ttccaatgat gagcactttt aaagttctgc tatgtggcgc ggtattatcc 240

cgtattgacg ccgggcaaga gcaactcggt cgccgcatac actattctca gaatgacttg 300

gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt aagagaatta 360

tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct gacaacgatc 420

ggaggaccga aggagctaac cgcttttttg cacaacatgg gggatcatgt aactcgcctt 480

gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga caccacgatg 540

cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg gcgaactact tactctagct 600

tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc acttctgcgc 660

tcggcccttc cggctggctg gtttattgct gataaatctg gagccggtga gcgtgggtct 720

cgcggtatca ttgcagcact ggggccagat ggtaagccct cccgtatcgt agttatctac 780

acgacgggga gtcaggcaac tatggatgaa cgaaatagac agatcgctga gataggtgcc 840

tcactgatta agcattggta a 861

<210> 2

<211> 674

<212> DNA

<213>Artificial sequence

<400> 2

cccgtagaaa agatcaaagg atcttcttga gatccttttt ttctgcgcgt aatctgctgc 60

ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt tgccggatca agagctacca 120

actctttttc cgaaggtaac tggcttcagc agagcgcaga taccaaatac tgtccttcta 180

gtgtagccgt agttaggcca ccacttcaag aactctgtag caccgcctac atacctcgct 240

ctgctaatcc tgttaccagt ggctgctgcc agtggcgata agtcgtgtct taccgggttg 300

gactcaagac gatagttacc ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc 360

acacagccca gcttggagcg aacgacctac accgaactga gatacctaca gcgtgagcta 420

tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca ggtatccggt aagcggcagg 480

gtcggaacag gagagcgcac gagggagctt ccagggggaa acgcctggta tctttatagt 540

cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg 600

cggagcctat ggaaaaacgc cagcaacgcg gcctttttac ggttcctggc cttttgctgg 660

ccttttgctc acat 674

<210> 3

<211> 147

<212> DNA

<213>Artificial sequence

<400> 3

atcccgcccc taactccgcc cagttccgcc cattctccgc cccatggctg actaattttt 60

tttatttatg cagaggccga ggccgcctcg gcctctgagc tattccagaa gtagtgagga 120

ggcttttttg gaggcctaga cttttgc 147

<210> 4

<211> 228

<212> DNA

<213>Artificial sequence

<400> 4

gtagtcttat gcaatactct tgtagtcttg caacatggta acgatgagtt agcaacatgc 60

cttacaagga gagaaaaagc accgtgcatg ccgattggtg gaagtaaggt ggtacgatcg 120

tgccttatta ggaaggcaac agacgggtct gacatggatt ggacgaacca ctgaattgcc 180

gcattgcaga gatattgtat ttaagtgcct agctcgatac aataaacg 228

<210> 5

<211> 180

<212> DNA

<213>Artificial sequence

<400> 5

ggtctctctg gttagaccag atctgagcct gggagctctc tggctaacta gggaacccac 60

tgcttaagcc tcaataaagc ttgccttgag tgcttcaagt agtgtgtgcc cgtctgttgt 120

gtgactctgg taactagaga tccctcagac ccttttagtc agtgtggaaa atctctagca 180

<210> 6

<211> 234

<212> DNA

<213>Artificial sequence

<400> 6

tgctagagat tttccacact gactaaaagg gtctgaggga tctctagtta ccagagtcac 60

acaacagacg ggcacacact acttgaagca ctcaaggcaa gctttattga ggcttaagca 120

gtgggttccc tagttagcca gagagctccc aggctcagat ctggtctaac cagagagacc 180

cagtacaagc aaaaagcaga tcttattttc gttgggagtg aattagccct tcca 234

<210> 7

<211> 353

<212> DNA

<213>Artificial sequence

<400> 7

atgggtgcga gagcgtcagt attaagcggg ggagaattag atcgcgatgg gaaaaaattc 60

ggttaaggcc agggggaaag aaaaaatata aattaaaaca tatagtatgg gcaagcaggg 120

agctagaacg attcgcagtt aatcctggcc tgttagaaac atcagaaggc tgtagacaaa 180

tactgggaca gctacaacca tcccttcaga caggatcaga agaacttaga tcattatata 240

atacagtagc aaccctctat tgtgtgcatc aaaggataga gataaaagac accaaggaag 300

ctttagacaa gatagaggaa gagcaaaaca aaagtaagac caccgcacag caa 353

<210> 8

<211> 233

<212> DNA

<213>Artificial sequence

<400> 8

aggagctttg ttccttgggt tcttgggagc agcaggaagc actatgggcg cagcctcaat 60

gacgctgacg gtacaggcca gacaattatt gtctggtata gtgcagcagc agaacaattt 120

gctgagggct attgaggcgc aacagcatct gttgcaactc acagtctggg gcatcaagca 180

gctccaggca agaatcctgg ctgtggaaag atacctaaag gatcaacagc tcc 233

<210> 9

<211> 489

<212> DNA

<213>Artificial sequence

<400> 9

tggggatttg gggttgctct ggaaaactca tttgcaccac tgctgtgcct tggaatgcta 60

gttggagtaa taaatctctg gaacagattg gaatcacacg acctggatgg agtgggacag 120

agaaattaac aattacacaa gcttaataca ctccttaatt gaagaatcgc aaaaccagca 180

agaaaagaat gaacaagaat tattggaatt agataaatgg gcaagtttgt ggaattggtt 240

taacataaca aattggctgt ggtatataaa attattcata atgatagtag gaggcttggt 300

aggtttaaga atagtttttg ctgtactttc tatagtgaat agagttaggc agggatattc 360

accattatcg tttcagaccc acctcccaac cccgagggga cccgacaggc ccgaaggaat 420

agaagaagaa ggtggagaga gagacagaga cagatccatt cgattagtga acggatctcg 480

acggttaac 489

<210> 10

<211> 119

<212> DNA

<213>Artificial sequence

<400> 10

ttttaaaaga aaagggggga ttggggggta cagtgcaggg gaaagaatag tagacataat 60

agcaacagac atacaaacta aagaattaca aaaacaaatt acaaaaattc aaaatttta 119

<210> 11

<211> 696

<212> DNA

<213>Artificial sequence

<400> 11

atggcccagt ccaagcacgg cctgaccaag gagatgacca tgaagtaccg catggagggc 60

tgcgtggacg gccacaagtt cgtgatcacc ggcgagggca tcggctaccc cttcaagggc 120

aagcaggcca tcaacctgtg cgtggtggag ggcggcccct tgcccttcgc cgaggacatc 180

ttgtccgccg ccttcatgta cggcaaccgc gtgttcaccg agtaccccca ggacatcgtc 240

gactacttca agaactcctg ccccgccggc tacacctggg accgctcctt cctgttcgag 300

gacggcgccg tgtgcatctg caacgccgac atcaccgtga gcgtggagga gaactgcatg 360

taccacgagt ccaagttcta cggcgtgaac ttccccgccg acggccccgt gatgaagaag 420

atgaccgaca actgggagcc ctcctgcgag aagatcatcc ccgtgcccaa gcagggcatc 480

ttgaagggcg acgtgagcat gtacctgctg ctgaaggacg gtggccgctt gcgctgccag 540

ttcgacaccg tgtacaaggc caagtccgtg ccccgcaaga tgcccgactg gcacttcatc 600

cagcacaagc tgacccgcga ggaccgcagc gacgccaaga accagaagtg gcacctgacc 660

gagcacgcca tcgcctccgg ctccgccttg ccctga 696

<210> 12

<211> 575

<212> DNA

<213>Artificial sequence

<400> 12

gcccctctcc ctcccccccc cctaacgtta ctggccgaag ccgcttggaa taaggccggt 60

gtgcgtttgt ctatatgtta ttttccacca tattgccgtc ttttggcaat gtgagggccc 120

ggaaacctgg ccctgtcttc ttgacgagca ttcctagggg tctttcccct ctcgccaaag 180

gaatgcaagg tctgttgaat gtcgtgaagg aagcagttcc tctggaagct tcttgaagac 240

aaacaacgtc tgtagcgacc ctttgcaggc agcggaaccc cccacctggc gacaggtgcc 300

tctgcggcca aaagccacgt gtataagata cacctgcaaa ggcggcacaa ccccagtgcc 360

acgttgtgag ttggatagtt gtggaaagag tcaaatggct cacctcaagc gtattcaaca 420

aggggctgaa ggatgcccag aaggtacccc attgtatggg atctgatctg gggcctcggt 480

gcacatgctt tacatgtgtt tagtcgaggt taaaaaacgt ctaggccccc cgaaccacgg 540

ggacgtggtt ttcctttgaa aaacacgatg ataat 575

<210> 13

<211> 592

<212> DNA

<213>Artificial sequence

<400> 13

aatcaacctc tggattacaa aatttgtgaa agattgactg gtattcttaa ctatgttgct 60

ccttttacgc tatgtggata cgctgcttta atgcctttgt atcatgctat tgcttcccgt 120

atggctttca ttttctcctc cttgtataaa tcctggttgc tgtctcttta tgaggagttg 180

tggcccgttg tcaggcaacg tggcgtggtg tgcactgtgt ttgctgacgc aacccccact 240

ggttggggca ttgccaccac ctgtcagctc ctttccggga ctttcgcttt ccccctccct 300

attgccacgg cggaactcat cgccgcctgc cttgcccgct gctggacagg ggctcggctg 360

ttgggcactg acaattccgt ggtgttgtcg gggaaatcat cgtcctttcc ttggctgctc 420

gcctgtgttg ccacctggat tctgcgcggg acgtccttct gctacgtccc ttcggccctc 480

aatccagcgg accttccttc ccgcggcctg ctgccggctc tgcggcctct tccgcgtctt 540

cgccttcgcc ctcagacgag tcggatctcc ctttgggccg cctccccgcc tg 592

<210> 14

<211> 1178

<212> DNA

<213>Artificial sequence

<400> 14

gctccggtgc ccgtcagtgg gcagagcgca catcgcccac agtccccgag aagttggggg 60

gaggggtcgg caattgaacc ggtgcctaga gaaggtggcg cggggtaaac tgggaaagtg 120

atgtcgtgta ctggctccgc ctttttcccg agggtggggg agaaccgtat ataagtgcag 180

tagtcgccgt gaacgttctt tttcgcaacg ggtttgccgc cagaacacag gtaagtgccg 240

tgtgtggttc ccgcgggcct ggcctcttta cgggttatgg cccttgcgtg ccttgaatta 300

cttccacctg gctgcagtac gtgattcttg atcccgagct tcgggttgga agtgggtggg 360

agagttcgag gccttgcgct taaggagccc cttcgcctcg tgcttgagtt gaggcctggc 420

ctgggcgctg gggccgccgc gtgcgaatct ggtggcacct tcgcgcctgt ctcgctgctt 480

tcgataagtc tctagccatt taaaattttt gatgacctgc tgcgacgctt tttttctggc 540

aagatagtct tgtaaatgcg ggccaagatc tgcacactgg tatttcggtt tttggggccg 600

cgggcggcga cggggcccgt gcgtcccagc gcacatgttc ggcgaggcgg ggcctgcgag 660

cgcggccacc gagaatcgga cgggggtagt ctcaagctgg ccggcctgct ctggtgcctg 720

gcctcgcgcc gccgtgtatc gccccgccct gggcggcaag gctggcccgg tcggcaccag 780

ttgcgtgagc ggaaagatgg ccgcttcccg gccctgctgc agggagctca aaatggagga 840

cgcggcgctc gggagagcgg gcgggtgagt cacccacaca aaggaaaagg gcctttccgt 900

cctcagccgt cgcttcatgt gactccactg agtaccgggc gccgtccagg cacctcgatt 960

agttctcgag cttttggagt acgtcgtctt taggttgggg ggaggggttt tatgcgatgg 1020

agtttcccca cactgagtgg gtggagactg aagttaggcc agcttggcac ttgatgtaat 1080

tctccttgga atttgccctt tttgagtttg gatcttggtt cattctcaag cctcagacag 1140

tggttcaaag tttttttctt ccatttcagg tgtcgtga 1178

<210> 15

<211> 63

<212> DNA

<213>Artificial sequence

<400> 15

atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60

ccg 63

<210> 16

<211> 321

<212> DNA

<213>Artificial sequence

<400> 16

gatattcaga tgacccagag cccgagcagc ctgagcacca gcgtgggcga tcgcgtgacc 60

ctgacctgca aagcgagcca ggatgtgggc accgcggtgg attggtatca gcagaaaccg 120

ggcccgagcc cgaaactgct gatttattgg gcgagcaccc gccataccgg cattccgagc 180

cgctttagcg gcagcggcag cggcaccgat tttaccctga ccattagcag cctgcagccg 240

gaagattttg cggattatta ttgccagcag tataacagct atccgctgac ctttggcccg 300

ggcaccaaag tggatattaa a 321

<210> 17

<211> 345

<212> DNA

<213>Artificial sequence

<400> 17

gaagtgcagc tggtgcagag cggcccggaa gtgaaaaaac cgggcgcgac cgtgaaaatt 60

agctgcaaaa ccagcggcta tacctttacc gaatatacca ttcattgggt gaaacaggcg 120

ccgggcaaag gcctggaatg gattggcaac attaacccga acaacggcgg caccacctat 180

aaccagaaat ttgaagataa agcgaccctg accgtggata aaagcaccga taccgcgtat 240

atggaactga gcagcctgcg cagcgaagat accgcggtgt attattgcgc ggcgggctgg 300

aactttgatt attggggcca gggcaccctg ctgaccgtga gcagc 345

<210> 18

<211> 333

<212> DNA

<213>Artificial sequence

<400> 18

gatattgtgc tgacccagag cccggcgagc ctggcggtga gcccgggcca gcgcgcgacc 60

attacctgcc gcgcgagcca gagcgtgagc accagcagca gcagctttat gcattggtat 120

cagcagaaac cgggccagcc gccgaaactg ctgattaaat atgcgagcaa cctggaaagc 180

ggcgtgccgg cgcgctttag cggcagcggc agcggcaccg attttaccct gaccattaac 240

ccggtggaag cgaacgatac cgcgaactat tattgccagc atagctggga aattccgtat 300

acctttggcc agggcaccaa actggaaatt aaa 333

<210> 19

<211> 348

<212> DNA

<213>Artificial sequence

<400> 19

gaagtgcagc tggtggaaag cggcggcggc ctggtgaaac cgggcggcag cctgcgcctg 60

agctgcgcgg cgagcggctt tatttttcgc agctatggca tgagctgggt gcgccaggcg 120

ccgggcaaag gcctggaatg ggtggcgagc attagcagcg gcggcagcac ctattatccg 180

gatagcgtga aaggccgctt taccattagc cgcgataacg cgaaaaacag cctgtatctg 240

cagatgaaca gcctgcgcgc ggaagatacc gcggtgtatg attgcgcgcg cggctatgat 300

agcggctttg cgtattgggg ccagggcacc ctggtgaccg tgagcagc 348

<210> 20

<211> 45

<212> DNA

<213>Artificial sequence

<400> 20

ggtggcggtg gctcgggcgg tggtgggtcg ggtggcggcg gatct 45

<210> 21

<211> 57

<212> DNA

<213>Artificial sequence

<400> 21

gcctccacca agggcccatc tgtcttcccc ctggccccca gctcctctgg ctccgga 57

<210> 22

<211> 141

<212> DNA

<213>Artificial sequence

<400> 22

accacgacgc cagcgccgcg accaccaaca ccggcgccca ccatcgcgtc gcagcccctg 60

tccctgcgcc cagaggcgtg ccggccagcg gcggggggcg cagtgcacac gagggggctg 120

gacttcgcct gtgatatcta c 141

<210> 23

<211> 66

<212> DNA

<213>Artificial sequence

<400> 23

atctgggcgc ccttggccgg gacttgtggg gtccttctcc tgtcactggt tatcaccctt 60

tactgc 66

<210> 24

<211> 123

<212> DNA

<213>Artificial sequence

<400> 24

aggagtaaga ggagcaggct cctgcacagt gactacatga acatgactcc ccgccgcccc 60

gggcccaccc gcaagcatta ccagccctat gccccaccac gcgacttcgc agcctatcgc 120

tcc 123

<210> 25

<211> 111

<212> DNA

<213>Artificial sequence

<400> 25

cgccgcgatc agcgcctgcc gccggatgcg cataaaccgc cgggcggcgg cagctttcgc 60

accccgattc aggaagaaca ggcggatgcg catagcaccc tggcgaaaat t 111

<210> 26

<211> 336

<212> DNA

<213>Artificial sequence

<400> 26

cgcgtgaaat ttagccgcag cgcggatgcg ccggcgtatc agcagggcca gaaccagctg 60

tataacgaac tgaacctggg ccgccgcgaa gaatatgatg tgctggataa acgccgcggc 120

cgcgatccgg aaatgggcgg caaaccgcgc cgcaaaaacc cgcaggaagg cctgtataac 180

gaactgcaga aagataaaat ggcggaagcg tatagcgaaa ttggcatgaa aggcgaacgc 240

cgccgcggca aaggccatga tggcctgtat cagggcctga gcaccgcgac caaagatacc 300

tatgatgcgc tgcatatgca ggcgctgccg ccgcgc 336

<210> 27

<211> 1557

<212> DNA

<213>Artificial sequence

<400> 27

atgaactcct tctccacaag cgccttcggt ccagttgcct tctccctggg gctgctcctg 60

gtgttgcctg ctgccttccc tgccccagat attgtgctga cccagagccc ggcgagcctg 120

gcggtgagcc cgggccagcg cgcgaccatt acctgccgcg cgagccagag cgtgagcacc 180

agcagcagca gctttatgca ttggtatcag cagaaaccgg gccagccgcc gaaactgctg 240

attaaatatg cgagcaacct ggaaagcggc gtgccggcgc gctttagcgg cagcggcagc 300

ggcaccgatt ttaccctgac cattaacccg gtggaagcga acgataccgc gaactattat 360

tgccagcata gctgggaaat tccgtatacc tttggccagg gcaccaaact ggaaattaaa 420

ggtggcggtg gctcgggcgg tggtgggtcg ggtggcggcg gatctgaagt gcagctggtg 480

gaaagcggcg gcggcctggt gaaaccgggc ggcagcctgc gcctgagctg cgcggcgagc 540

ggctttattt ttcgcagcta tggcatgagc tgggtgcgcc aggcgccggg caaaggcctg 600

gaatgggtgg cgagcattag cagcggcggc agcacctatt atccggatag cgtgaaaggc 660

cgctttacca ttagccgcga taacgcgaaa aacagcctgt atctgcagat gaacagcctg 720

cgcgcggaag ataccgcggt gtatgattgc gcgcgcggct atgatagcgg ctttgcgtat 780

tggggccagg gcaccctggt gaccgtgagc agcggtggcg gtggctcggg cggtggtggg 840

tcgggtggcg gcggatctga accgaaaagc tgcgacaaaa ctcacacatg cccaccgtgc 900

ccagcacctg aactcctggg gggaccgtca gtcttcctct tccccccaaa acccaaggac 960

accctcatga tctcccggac ccctgaggtc acatgcgtgg tggtggacgt gagccacgaa 1020

gaccctgagg tcaagttcaa ctggtacgtg gacggcgtgg aggtgcataa tgccaagaca 1080

aagccgcggg aggagcagta caacagcacg taccgtgtgg tcagcgtcct caccgtcctg 1140

caccaggact ggctgaatgg caaggagtac aagtgcaagg tctccaacaa agccctccca 1200

gcccccatcg agaaaaccat ctccaaagcc aaagggcagc cccgagaacc acaggtgtac 1260

accctgcccc catcccggga ggagatgacc aagaaccagg tcagcctgac ctgcctggtc 1320

aaaggcttct atcccagcga catcgccgtg gagtgggaga gcaatgggca gccggagaac 1380

aactacaaga ccacgcctcc cgtgctggac tccgacggct ccttcttcct ctacagcaag 1440

ctcaccgtgg acaagagcag gtggcagcag gggaacgtct tctcatgctc cgtgatgcac 1500

gaggctctgc acaaccacta cacgcagaag agcctctccc tgtctccggg taaatga 1557

<210> 28

<211> 36

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<223>Primer

<400> 28

attcaaaatt ttatcgatgc tccggtgccc gtcagt 36

<210> 29

<211> 22

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<223>Primer

<400> 29

tcacgacacc tgaaatggaa ga 22

<210> 30

<211> 46

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<223>Primer

<400> 30

catttcaggt gtcgtgagga tccgccacca tggcgctgcc ggtgac 46

<210> 31

<211> 33

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<223>Primer

<400> 31

ggggagggag aggggcttag cgcggcggca gcg 33

<210> 32

<211> 17

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<223>Primer

<400> 32

gcccctctcc ctccccc 17

<210> 33

<211> 25

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<223>Primer

<400> 33

attatcatcg tgtttttcaa aggaa 25

<210> 34

<211> 44

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<223>Primer

<400> 34

aaaacacgat gataatgcca ccatgaactc cttctccaca agcg 44

<210> 35

<211> 46

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<223>Primer

<400> 35

aatccagagg ttgattgtcg acgaattctc atttgcccgg gctcag 46

<210> 36

<211> 21

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<223>Primer

<400> 36

cctttccggg actttcgctt t 21

<210> 37

<211> 20

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<223>Primer

<400> 37

gcagaatcca ggtggcaaca 20

<210> 38

<211> 21

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<223>Primer

<400> 38

catgtacgtt gctatccagg c 21

<210> 39

<211> 21

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<223>Primer

<400> 39

ctccttaatg tcacgcacga t 21

Claims (11)

1. a kind of prostate cancer CAR-T therapy vectors based on OCTS technologies, it is characterised in that including slow virus skeleton plasmid, People EF1 α promoters, OCTS Chimerical receptors domain and PDL1 single-chain antibodies；

The slow virus skeleton plasmid includes：The sequences of AmpR containing ampicillin resistance gene largely expanded for purpose bacterial strain Row, as shown in SEQ ID NO.1；For the prokaryotic replions pUC Ori sequences of plasmid replication, as shown in SEQ ID NO.2；With In the Viral Replicon SV40 Ori sequences of the duplication in enhancing eukaryotic, as shown in SEQ ID NO.3；For slow virus bag The slow virus packaging cis element of dress；ZsGreen1 green fluorescent proteins, as shown in SEQ ID NO.11；IRES ribosomes is combined Sequence, as shown in SEQ ID NO.12；The enhanced marmot hepatitis Bs of eWPRE of expression efficiency for strengthening transgenosis turn Controlling element after record, as shown in SEQ ID NO.13；

The sequence of the people EF1 α promoters is as shown in SEQ ID NO.14；

The OCTS Chimerical receptors domain includes：CD8leader Chimerical receptors signal peptide as shown in SEQ ID NO.15, such as PSMA single-chain antibody light chains VL shown in SEQ ID NO.16, the PSMA single-chain antibody heavy chains VH as shown in SEQ ID NO.17, PDL1 single-chain antibody light chains VL as shown in SEQ ID NO.18, the PDL1 single-chain antibody heavy chains as shown in SEQ ID NO.19 Between VH, the antibody inner hinge Inner-Linker as shown in SEQ ID NO.20, the single-chain antibody as shown in SEQ ID NO.21 Hinge Inter-Linker, the CD8Hinge Chimerical receptors hinge as shown in SEQ ID NO.22, as shown in SEQ ID NO.23 CD8Transmembrane Chimerical receptors transmembrane region, the TCR Chimerical receptor t cell activation domains as shown in SEQ ID NO.26 with And Chimerical receptor costimulating factor region；The Chimerical receptor costimulating factor region be selected from 4-1BB, ICOS, CD27, OX40, CD28, MYD88, IL1R1, CD70, TNFRSF19L, TNFRSF27, TNFRSF1OD, TNFRSF13B, TNFRSF18, CD134 etc. The combination of any one or more in tumor necrosis factor superfamily.

2. carrier as claimed in claim 1, it is characterised in that the slow virus packaging cis element uses second generation slow virus Carrier or third generation slow virus carrier；The second generation slow virus carrier includes：Slow virus as shown in SEQ ID NO.5 5terminal LTR, slow virus 3terminal Self-Inactivating LTR, such as SEQ as shown in SEQ ID NO.6 Gag cis elements shown in ID NO.7, the RRE cis elements as shown in SEQ ID NO.8, as shown in SEQ ID NO.9 Env cis elements, the cPPT cis elements as shown in SEQ ID NO.10；The third generation slow virus carrier includes：Such as SEQ Slow virus 5terminal LTR shown in ID NO.5, the slow virus 3terminal Self- as shown in SEQ ID NO.6 Inactivating LTR, the Gag cis elements as shown in SEQ ID NO.7, the cis members of RRE as shown in SEQ ID NO.8 Part, the env cis elements as shown in SEQ ID NO.9, the cPPT cis elements as shown in SEQ ID NO.10, and such as SEQ RSV promoters shown in ID NO.4.

3. carrier as claimed in claim 1, it is characterised in that the PSMA single-chain antibodies as shown in SEQ ID NO.16 are light Chain VL, PSMA single-chain antibody heavy chains VH, the PDL1 single-chain antibodies as shown in SEQ ID NO.18 as shown in SEQ ID NO.17 Light chain VL, PDL1 single-chain antibody heavy chains VH, the antibody inner hinge as shown in SEQ ID NO.20 as shown in SEQ ID NO.19 Between Inner-Linker, the single-chain antibody as shown in SEQ ID NO.21 hinge Inter-Linker using be connected in series mode or Person's corner connected mode；The mode that is connected in series is specially：PDL1 single-chain antibody light chain VL and PSMA single-chain antibody light chains VL Using hinge Inter-Linker connections between single-chain antibody, PDL1 single-chain antibody light chain VL and PDL1 single-chain antibody heavy chains VH is used Antibody inner hinge Inner-Linker connections, PSMA single-chain antibody light chain VL and PSMA single-chain antibody heavy chains VH is cut with scissors using in antibody Chain Inner-Linker connections；The corner connected mode is specially：PSMA single-chain antibody light chain VL and PSMA single-chain antibody weights Chain VH uses the Inner-Linker connections of antibody inner hinge, and PDL1 single-chain antibody light chain VL and PSMA single-chain antibody heavy chains VH is used Hinge Inter-Linker connections between single-chain antibody, PDL1 single-chain antibody heavy chain VH and PSMA single-chain antibody light chains VL is using single-stranded Hinge Inter-Linker connections between antibody.

4. carrier as claimed in claim 1, it is characterised in that the sequence of the PDL1 single-chain antibodies such as SEQ ID NO.27 institutes Show.

5. carrier as claimed in claim 1, it is characterised in that adjusted after the enhanced marmot hepatitis B transcriptions of eWPRE Control element has the enhancing mutation of 6 nucleotides, is specially：g.396G>A、g.397C>T、g.398T>C、g.399G>A、g.400A >T、g.411A>T。

6. carrier as claimed in claim 1, it is characterised in that whole OCTS structural genes are started by the people EF1 α promoters Expression, the CD8leader Chimerical receptors signal peptide is located at the N-terminal of OCTS coded sequences, for guiding OCTS albumen to be positioned at Cell membrane；Described PSMA single-chain antibodies light chain VL, PSMA single-chain antibody heavy chain VH, PDL1 single-chain antibody light chain VL, PDL1 are single-stranded This two groups of single-chain antibodies of heavy chain of antibody VH are combined into double antigen recognizing districts, for recognizing corresponding target antigen；The CD8Hinge is embedding Closing acceptor hinge is used to scFv being anchored on the outside of cell membrane；The CD8Transmembrane Chimerical receptors transmembrane region is used for will Whole Chimerical receptor is fixed on cell membrane；The CD28 Chimerical receptors costimulating factor is used to stimulate T lymphocytes in vitro to swash Living and interior tumor cell lethal effect；The CD134 Chimerical receptors costimulating factor be used for promote T lymphopoiesis and because Son secretion, strengthens tumour immunity, is conducive to the long-term surviving of memory T cell；The TCR Chimerical receptors t cell activation domain is used for Activate the expression of downstream signaling pathway；The PDL1 single-chain antibodies, can effectively close PDL1, and blocking immunity negative regulator signal leads to Road, can be clinically used for suppressing the immune escape of tumour, improves the curative effect of CAR-T cellular immunotherapies；Work as antigen recognition region When being combined with target antigen, signal be transferred to by Chimerical receptor it is intracellular so that produce T cell propagation, cytokine secretion increase Plus, Anti-apoptotic proteins secretion increase, cell death delay, cracking a series of biological effects of target cell.

7. carrier as claimed in claim 1, it is characterised in that the Chimerical receptor costimulating factor region uses such as SEQ ID CD28 Chimerical receptors costimulating factor shown in NO.24 and the CD134 Chimerical receptor costimulations as shown in SEQ ID NO.25 Combinations of factors.

8. carrier as claimed in claim 1, it is characterised in that described PDL1 single-chain antibody light chain VL, PDL1 single-chain antibodies Heavy chain VH, PDL1 single-chain antibody are by humanization modified.

9. a kind of structure of prostate cancer CAR-T therapy vectors based on OCTS technologies as described in claim any one of 1-8 Method, it is characterised in that comprise the following steps：

(1) by the sequences of AmpR containing ampicillin resistance gene as shown in SEQ ID NO.1, as shown in SEQ ID NO.2 Prokaryotic replions pUC Ori sequences, the Viral Replicon SV40 Ori sequences as shown in SEQ ID NO.3, for slow virus bag Slow virus packaging cis element, such as the ZsGreen1 green fluorescent proteins as shown in SEQ ID NO.11, the SEQ ID of dress The enhanced marmot hepatitis B of IRES ribosome binding sequences shown in NO.12, the eWPRE as shown in SEQ ID NO.13 turns Controlling element is stored on slow virus skeleton plasmid after record；

(2) by the people EF1 α promoters shown in SEQ ID NO.14, as described in OCTS Chimerical receptors domain and such as SEQ ID PDL1 single-chain antibodies shown in NO.27 are combined into OCTS Chimerical receptor designs, are cloned by digestion, connection, recombining reaction Into slow virus skeleton plasmid, the recombinant slow virus plasmid of third generation OCTS designs is obtained；

(3) by obtained recombinant slow virus plasmid respectively with slow virus packaging plasmid pPac-GP, pPac-R and memebrane protein plasmid PEnv-G transfects HEK293T/17 cells jointly, is carried out in HEK293T/17 cells after gene transcript expression, packs and successfully weigh Group slow virus carrier can be discharged into cells and supernatant, collect the supernatant of the recombined lentivirus vector included；

(4) obtained recombinant slow virus supernatant is purified using the post way of purification of suction filtration, absorption, elution, respectively obtained Recombined lentivirus vector.

10. method as claimed in claim 9, it is characterised in that in step (4), the suction filtration step will control supernatant volume In 200ml~2000ml, control vacuum is prevented due to the carrier loss that plug-hole is brought in -0.5MPA~-0.9MPA；It is described Adsorption step will control the pH value of solution 6~8, and preventing PH change causes carrier to inactivate；The elution step will control to wash The ionic strength of de- liquid prevents the change of ionic strength from causing elution not exclusively or carrier inactivation in 0.5M~1.0M.

11. application of the carrier in the medicine for preparing treatment prostate cancer as described in claim any one of 1-8.