CN112251412B - BCMA (brain cell activating antigen) targeted chimeric antigen receptor T cell and application thereof - Google Patents
BCMA (brain cell activating antigen) targeted chimeric antigen receptor T cell and application thereof Download PDFInfo
- Publication number
- CN112251412B CN112251412B CN202011085552.9A CN202011085552A CN112251412B CN 112251412 B CN112251412 B CN 112251412B CN 202011085552 A CN202011085552 A CN 202011085552A CN 112251412 B CN112251412 B CN 112251412B
- Authority
- CN
- China
- Prior art keywords
- cell
- antigen receptor
- chimeric antigen
- bcma
- leu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0636—T lymphocytes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/0005—Vertebrate antigens
- A61K39/0011—Cancer antigens
- A61K39/001102—Receptors, cell surface antigens or cell surface determinants
- A61K39/001111—Immunoglobulin superfamily
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/7051—T-cell receptor (TcR)-CD3 complex
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2878—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/515—Animal cells
- A61K2039/5158—Antigen-pulsed cells, e.g. T-cells
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
- C12N2740/15041—Use of virus, viral particle or viral elements as a vector
- C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Abstract
The invention provides a BCMA-targeted chimeric antigen receptor T cell and application thereof, wherein the chimeric antigen receptor comprises a signal peptide, an antigen binding domain, a transmembrane domain and a signal transduction domain; the antigen binding domain comprises an anti-BCMA single chain antibody; the signaling domains include 4-1BB, CD3 zeta, and TLR2. The chimeric antigen receptor T cell constructed by adopting the 4-1BB, the CD3 zeta and the TLR2 which are connected in series as a signal transduction structural domain of the chimeric antigen receptor and matching with a specific antigen binding structural domain anti-BCMA single-chain antibody has the advantages of remarkably enhanced capability of specifically recognizing and killing BCMA positive tumor cells, high safety and good clinical application prospect in the field of B cell malignant tumor treatment.
Description
Technical Field
The invention belongs to the technical field of biological medicines, and relates to a BCMA (B cell-binding antigen receptor) targeted chimeric antigen receptor T cell and application thereof.
Background
A Chimeric Antigen Receptor (CAR) is a recombinant receptor targeting a cell surface antigen, and mainly comprises an extracellular antigen binding region, a transmembrane region and an intracellular signal region. Wherein the extracellular antigen-binding region is responsible for recognizing an antigen, the transmembrane region connects the extracellular antigen-binding region and an intracellular signal region, which affects the expression ability of the introduced CAR gene, and the intracellular signal region is responsible for conducting a signal.
Chimeric antigen receptor T cells (CAR-T) recognize and bind to tumor antigens using CAR molecules, thereby exerting a specific killing effect of T cells on tumor cells, have been developed into mature tumor immunotherapy methods, and have achieved remarkable performance in treating hematological malignancies.
B Cell Maturation Antigen (BCMA), expressed on mature B cells and plasma cells, is a biomarker for the diagnosis and prognosis of Multiple Myeloma (MM). The expression levels of BCMA at different stages of multiple myeloma were found to be similar, indicating that BCMA may be a potent therapeutic target throughout the multiple myeloma process. In the prior art, BCMA antigen is used as an extracellular antigen binding region to construct CAR molecules for treating B cell related diseases such as multiple myeloma, but the prior art has the problems of easy initiation of cytokine storm and the like.
Therefore, there is a need to further optimize the molecular structure of BCMA-targeted CARs for use in the field of multiple myeloma treatment.
Disclosure of Invention
Aiming at the defects and actual needs of the prior art, the invention provides a BCMA-targeted chimeric antigen receptor T cell and application thereof.
In order to achieve the purpose, the invention adopts the following technical scheme:
in a first aspect, the present invention provides a chimeric antigen receptor T cell targeting BCMA, the chimeric antigen receptor comprising a signal peptide, an antigen binding domain, a transmembrane domain, and a signaling domain;
the antigen binding domain comprises an anti-BCMA single chain antibody;
the signaling domains include 4-1BB, CD3 zeta, and TLR2.
According to the invention, toll-like receptor 2 (TLR 2) is connected to the C-terminal of 4-1BB and CD3 zeta to serve as a signal transduction domain, and the signal transduction domain is matched with an anti-BCMA single-chain antibody to construct a chimeric antigen receptor which efficiently targets BCMA antigen, and T cells expressing the chimeric antigen receptor have specific killing effect on BCMA positive tumors, so that the killing effect is obvious, and the killing efficiency is high.
Preferably, the signal peptide comprises a GM-CSF signal peptide.
Preferably, the transmembrane domain comprises CD28 and/or CD8 α, preferably CD8 α.
Preferably, the chimeric antigen receptor consists of a GM-CSF signal peptide, an anti-BCMA single chain antibody, CD8 α, 4-1BB, CD3 ζ, and TLR2 in tandem.
Preferably, the chimeric antigen receptor comprises the amino acid sequence shown in SEQ ID NO. 1;
SEQ ID NO:1：
MLLLVTSLLLCELPHPAFLLDIVLTQSPASLAVSLGERATINCRASESVSVIGAHLIHWYQQKPGQPPKLLIYLASNLETGVPARFSGSGSGTDFTLTISSLQAEDAAIYYCLQSRIFPRTFGQGTKLEIKGSTSGSGKPGSGEGSTKGQVQLVQSGSELKKPGASVKVSCKASGYTFTDYSINWVRQAPGQGLEWMGWINTETREPAYAYDFRGRFVFSLDTSVSTAYLQISSLKAEDTAVYYCARDYSYAMDYWGQGTLVTVSSTTTPAPRPPTPAPTIASQPLSLRPEACRPAAGGAVHTRGLDFACDIYIWAPLAGTCGVLLLSLVITLYCKRGRKKLLYIFKQPFMRPVQTTQEEDGCSCRFPEEEEGGCELRVKFSRSADAPAYQQGQNQLYNELNLGRREEYDVLDKRRGRDPEMGGKPRRKNPQEGLYNELQKDKMAEAYSEIGMKGERRRGKGHDGLYQGLSTATKDTYDALHMQALPPRQAKRKPRKAPSRNICYDAFVSYSERDAYWVENLMVQELENFNPPFKLCLHKRDFIPGKWIIDNIIDSIEKSHKTVFVLSENFVKSEWCKYELDFSHFRLFDENNDAAILILLEPIEKKAIPQRFCKLRKIMNTKTYLEWPMDEAQREGFWVNLRAAIKS。
in a second aspect, the present invention provides a nucleic acid molecule comprising a gene encoding a GM-CSF signal peptide, a gene encoding an anti-BCMA single-chain antibody, a gene encoding CD8 α, a gene encoding 4-1BB, a gene encoding CD3 ζ and a gene encoding TLR2.
Preferably, the nucleic acid molecule comprises the nucleic acid sequence shown as SEQ ID NO. 2;
SEQ ID NO:2：
atgcttctcctggtgacaagccttctgctctgtgagttaccacacccagcattcctcctggacatcgtcctgacccagtcacctgccagcctggccgtcagcctgggcgagagagccaccattaattgccgcgctagcgaatcagtgtcagtcatcggcgctcacctgatccactggtatcagcaaaagcctgggcagccaccaaagctgctcatctatctcgcctccaacctggagacaggcgtgcctgctcgctttagtggttctggtagcggcaccgatttcaccctgactatttcaagcctgcaggcagaggacgcagccatatactattgcctgcagtcccggattttccctcgcacattcggccagggcacaaaactggaaatcaaaggatctacctccggctccgggaagcccggaagcggcgaaggctcaaccaaaggccaggttcagctcgtgcagtctggttctgaactgaagaaacccggtgcatctgtgaaagtctcctgcaaggcttccgggtatactttcacagactacagtattaattgggttcgccaagctcctggacagggactggagtggatgggatggataaacacagaaactagggagcctgcatacgcctatgatttcagaggtcgcttcgtgttcagtctggatacaagtgtttcaacagcctatctgcaaattagctccctgaaagccgaggacaccgcagtttactactgtgcacgggattattcttacgctatggactattgggggcagggcacactcgtgacagtgtctagcaccacgacgccagcgccgcgaccaccaacaccggcgcccaccatcgcgtcgcagcccctgtccctgcgcccagaggcgtgccggccagcggcggggggcgcagtgcacacgagggggctggacttcgcctgtgatatctacatctgggcgcccttggccgggacttgtggggtccttctcctgtcactggttatcaccctttactgcaaacggggcagaaagaaactcctgtatatattcaaacaaccatttatgagaccagtacaaactactcaagaggaagatggctgtagctgccgatttccagaagaagaagaaggaggatgtgaactgagagtgaagttcagcaggagcgcagacgcccccgcgtaccagcagggccagaaccagctctataacgagctcaatctaggacgaagagaggagtacgatgttttggacaagagacgtggccgggaccctgagatggggggaaagccgagaaggaagaaccctcaggaaggcctgtacaatgaactgcagaaagataagatggcggaggcctacagtgagattgggatgaaaggcgagcgccggaggggcaaggggcacgatggcctttaccagggtctcagtacagccaccaaggacacctacgacgcccttcacatgcaggccctgccccctcgccaggccaaaaggaagcccaggaaagctcccagcaggaacatctgctatgatgcatttgtttcttacagtgagcgggatgcctactgggtggagaaccttatggtccaggagctggagaacttcaatccccccttcaagttgtgtcttcataagcgggacttcattcctggcaagtggatcattgacaatatcattgactccattgaaaagagccacaaaactgtctttgtgctttctgaaaactttgtgaagagtgagtggtgcaagtatgaactggacttctcccatttccgtctttttgatgagaacaatgatgctgccattctcattcttctggagcccattgagaaaaaagccattccccagcgcttctgcaagctgcggaagataatgaacaccaagacctacctggagtggcccatggacgaggctcagcgggaaggattttgggtaaatctgagagctgcgataaagtcc。
in a third aspect, the present invention provides an expression vector which is a viral vector comprising the nucleic acid molecule of the second aspect.
Preferably, the viral vector comprises any one of a lentiviral vector, a retroviral vector or an adeno-associated viral vector, preferably a lentiviral vector.
In a fourth aspect, the invention provides a recombinant lentivirus prepared by co-transfecting a mammalian cell with the expression vector of the third aspect and a packaging helper plasmid.
In a fifth aspect, the present invention provides a method for producing a chimeric antigen receptor T cell according to the first aspect, the method comprising the step of introducing the recombinant lentivirus according to the fourth aspect into a T cell.
In a sixth aspect, the present invention provides a pharmaceutical composition comprising the chimeric antigen receptor T cell of the first aspect.
Preferably, the pharmaceutical composition further comprises any one or a combination of at least two of a pharmaceutically acceptable carrier, excipient or diluent.
In a seventh aspect, the present invention provides a chimeric antigen receptor T cell of the first aspect, a nucleic acid molecule of the second aspect, an expression vector of the third aspect, a recombinant lentivirus of the fourth aspect, or a pharmaceutical composition of the sixth aspect, for use in the preparation of a medicament for the treatment of a B-cell malignancy.
Compared with the prior art, the invention has the following beneficial effects:
(1) The chimeric antigen receptor T cell constructed by adopting the 4-1BB, the CD3 zeta and the TLR2 which are connected in series as a signal transduction structural domain of the chimeric antigen receptor and matching with a specific antigen binding structural domain anti-BCMA single-chain antibody has the remarkably enhanced capacity of specifically recognizing a tumor antigen, and the anti-tumor capacity of the T cell is more remarkably improved;
(2) The chimeric antigen receptor T cell has low immunogenicity, high safety and low occurrence probability of side reaction, and has good clinical application prospect in the field of B cell malignant tumor treatment.
Drawings
FIG. 1 is a schematic diagram of a chimeric antigen receptor structure;
FIG. 2 shows the killing efficiency of different CAR-T cells against tumor cell K562-BCMA-GL at different E: T ratios;
FIG. 3 shows the secretion of IFN-. Gamma.by different CAR-T cells after co-culture with test cells.
Detailed Description
To further illustrate the technical means adopted by the present invention and the effects thereof, the present invention is further described below with reference to the embodiments and the accompanying drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and that no limitation of the invention is intended.
The examples do not specify particular techniques or conditions, and are to be construed in accordance with the description of the art in the literature or with the specification of the product. The reagents or apparatus used are conventional products commercially available from normal sources, not indicated by the manufacturer.
Example 1 preparation of CAR vectors
The structural schematic diagram of the chimeric antigen receptor targeting BCMA constructed in the embodiment is shown in figure 1, the amino acid sequence is shown in SEQ ID NO. 1, and the coding gene is shown in SEQ ID NO. 2;
respectively adding restriction enzyme Pme1 enzyme cutting site and protective base thereof, restriction enzyme Spe1 enzyme cutting site and protective base thereof at the C end and the N end of the coding gene;
the coding gene is subjected to double enzyme digestion by utilizing restriction enzymes Pme1 and Spe1, an enzyme digestion product containing a sticky end is obtained by agar gel electrophoresis recovery, and is connected into a linearized pWPXld-eGFP plasmid (containing the sticky end) which is also subjected to double enzyme digestion by Pme1 and Spe1, and the connection reaction is carried out in the presence of T4 DNA polymerase (Invitrogen company), so that a lentivirus vector containing the coding gene of the alpha BCMA scFv-4-1BB-CD3 zeta-TLR 2 is obtained.
In this example, a lentiviral vector containing the gene encoding α BCMA scFv-4-1BB-CD3 ζ was constructed at the same time.
Example 2 recombinant lentivirus packaging
In this example, 293T cells were used to prepare recombinant lentiviruses, and when 293T cells were plated on 100mm petri dishes to the bottom of 80-90%, lentivirus packaging was performed:
2h before virus packaging, the culture medium is changed into DMEM containing 1% fetal calf serum, and the addition amount is 6mL/100mm culture dish;
preparing a plasmid mixed solution as shown in table 1, wherein pWPXld-expression plasmid is a lentiviral vector for expressing CAR molecules, and pWPXld-eGFP plasmid is an empty vector without CAR molecule encoding genes;
TABLE 1
Adding 36 μ g PEI into another 500 μ L opti-MEM medium, mixing, and standing at room temperature for 5min;
mixing the plasmid mixed solution shown in the table 1 with PEI, blowing, beating and uniformly mixing, and standing at room temperature for 25-30 min;
dropwise adding the mixed solution to 293T cells cultured in a 100mm culture dish;
after culturing for 6h, changing the culture medium into DMEM containing 1% fetal calf serum, and adding the DMEM into a culture dish with the volume of 7mL/100 mm;
collecting virus supernatant 24h, 48h and 72h after packaging, and simultaneously supplementing a culture medium to 293T cells, wherein the addition amount is 7mL/100mm culture dish;
1000g was centrifuged for 10min, filtered through a 0.45 μm filter to obtain recombinant lentiviruses expressing CAR, and stored at 4 ℃ for further use.
Example 3T cell activation and lentivirus transfection
Separating Peripheral Blood Mononuclear Cells (PBMC) from whole blood by using a Ficoll density gradient centrifugation kit (GE company), removing red blood cells, and then separating T cells by using MACS Pan-T magnetic beads;
the sorted T cells were diluted with medium (AIM-V medium +5% FBS + penicillin 100U/mL + streptomycin 0.1 mg/mL) to a cell concentration of 2.5X 10 6 Per mL for standby;
t cells are activated by adopting a CD2/CD3/CD 28T cell activation and amplification kit (America whirlwind company), namely, coated magnetic beads are mixed with the T cells according to the proportion of 1 6 Per mL/cm 2 After mixing, the mixture was left at 37 ℃ and 5% CO 2 Culturing and stimulating for 48h in an incubator;
after 48h of T cell activation, beads were removed, centrifuged at 300g for 5min, supernatant removed, T cells resuspended in fresh medium and CAR-expressing recombinant lentivirus or blank added separatelyControl lentivirus (MOI = 10), and adding 8. Mu.g/mL polybrene and 300IU/mL IL-2, at 37 ℃, 5% CO 2 Culturing in an incubator;
after 24h, centrifuging for 5min at 300g, removing supernatant, and resuspending T cells with fresh culture medium containing 300IU/mL IL-2 to obtain CAR-T cells;
maintenance of CAR-T cell density at 1X 10 6 About one/mL, half the liquid change is carried out every 2-3 days, and after two weeks, the number of CAR-T cells is expanded by 100 times.
CAR-T cells constructed in this example included α BCMA scFv-4-1BB-CD3 zeta-TLR 2-T and α BCMA scFv-4-1BB-CD3 zeta-T, while the WT control group (transfection blank lentivirus) was set.
Example 4 in vitro testing of the killing function of CAR-T cells on tumor cells K562-BCMA-GL
WT, alpha BCMA scFv-4-1BB-CD3 zeta-TLR 2-T and alpha BCMA scFv-4-1BB-CD3 zeta-T prepared in example 3 were compared with 1X 10 4 The individual tumor cells K562-BCMA-GL were mixed in the ratio E: T of 4, 1, 2, 1, 4, 1 2 Co-culturing for 18h in an incubator;
after 18h, adding 100 μ L/well Luciferase substrate (1 ×), resuspending and mixing the cells, immediately measuring RLU (relative light unit) by a multifunctional microplate reader for 1 second, using a Luciferase (Luciferase) quantitative killing efficiency evaluation method, comparing the killing effect of WT, alpha BCMA scFv-4-1BB-CD3 ζ -TLR2-T and alpha BCMA scFv-4-1BB-CD3 ζ -T on K562-BCMA-GL in vitro, wherein the killing ratio calculation formula is as follows:
100% × (control well reading-experimental well reading)/control well reading (blank reading without cells negligible)
The result is shown in figure 2, the in vitro killing efficiency of the alpha BCMA scFv-4-1BB-CD3 zeta-TLR 2-T and the alpha BCMA scFv-4-1BB-CD3 zeta-T on K562-BCMA-GL is obviously higher than that of WT, the killing efficiency of the alpha BCMA scFv-4-1BB-CD3 zeta-TLR 2-T is stronger, and the alpha BCMA scFv-4-1BB-CD3 zeta-TLR 2-T can also show stronger tumor killing activity under the condition that the E: T is very small, namely the tumor target cells are far larger than effector T cells, which indicates that the TLR2 plays a role in expanding the extracellular region transmission signal and causing the cascade amplification effect of the lower-level cell killing effect.
Example 5
Respectively mixing K562 and K562-BCMA-GL according to 5 × 10 5 Inoculating 24-well plates at the density of cells/well, adding WT, alpha BCMA scFv-4-1BB-CD3 zeta-TLR 2-T and alpha BCMA scFv-4-1BB-CD3 zeta-T, and co-culturing in an incubator for 12h; and detecting the co-culture supernatant by adopting an IFN-gamma ELISA detection kit.
As shown in FIG. 3, the IFN-gamma cytokine level in the supernatant co-cultured with BCMA-CAR-T and K562-BCMA was significantly increased compared to that in the supernatant co-cultured with K562, wherein the IFN-gamma cytokine level in the supernatant co-cultured with alpha BCMA scFv-4-1BB-CD3 zeta-TLR 2-T and K562-BCMA was higher than that in alpha BCMA scFv-4-1BB-CD3 zeta-T, indicating that the killing ability of alpha BCMA scFv-4-1BB-CD3 zeta-TLR 2-T was stronger.
In conclusion, the invention adopts the 4-1BB, the CD3 zeta and the TLR2 which are connected in series as the signal transduction structural domain of the chimeric antigen receptor, and the signal transduction structural domain is matched with the specific antigen binding structural domain to resist the BCMA single-chain antibody, so that the constructed chimeric antigen receptor T cell has the capability of remarkably enhancing the specificity recognition of the tumor antigen and the killing of the tumor cell, and has wide application prospect in the field of treatment of B cell malignant tumor.
The applicant states that the present invention is illustrated in detail by the above examples, but the present invention is not limited to the above detailed methods, i.e. it is not meant that the present invention must rely on the above detailed methods for its implementation. It should be understood by those skilled in the art that any modifications of the present invention, equivalent substitutions of the raw materials of the product of the present invention, and the addition of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.
SEQUENCE LISTING
<110> Guangdong Shoutai in vivo biomedical science and technology Co., ltd
<120> BCMA-targeted chimeric antigen receptor T cell and application thereof
<130> 202009
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 648
<212> PRT
<213> Artificial sequence
<400> 1
Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro
1 5 10 15
Ala Phe Leu Leu Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala
20 25 30
Val Ser Leu Gly Glu Arg Ala Thr Ile Asn Cys Arg Ala Ser Glu Ser
35 40 45
Val Ser Val Ile Gly Ala His Leu Ile His Trp Tyr Gln Gln Lys Pro
50 55 60
Gly Gln Pro Pro Lys Leu Leu Ile Tyr Leu Ala Ser Asn Leu Glu Thr
65 70 75 80
Gly Val Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr
85 90 95
Leu Thr Ile Ser Ser Leu Gln Ala Glu Asp Ala Ala Ile Tyr Tyr Cys
100 105 110
Leu Gln Ser Arg Ile Phe Pro Arg Thr Phe Gly Gln Gly Thr Lys Leu
115 120 125
Glu Ile Lys Gly Ser Thr Ser Gly Ser Gly Lys Pro Gly Ser Gly Glu
130 135 140
Gly Ser Thr Lys Gly Gln Val Gln Leu Val Gln Ser Gly Ser Glu Leu
145 150 155 160
Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr
165 170 175
Thr Phe Thr Asp Tyr Ser Ile Asn Trp Val Arg Gln Ala Pro Gly Gln
180 185 190
Gly Leu Glu Trp Met Gly Trp Ile Asn Thr Glu Thr Arg Glu Pro Ala
195 200 205
Tyr Ala Tyr Asp Phe Arg Gly Arg Phe Val Phe Ser Leu Asp Thr Ser
210 215 220
Val Ser Thr Ala Tyr Leu Gln Ile Ser Ser Leu Lys Ala Glu Asp Thr
225 230 235 240
Ala Val Tyr Tyr Cys Ala Arg Asp Tyr Ser Tyr Ala Met Asp Tyr Trp
245 250 255
Gly Gln Gly Thr Leu Val Thr Val Ser Ser Thr Thr Thr Pro Ala Pro
260 265 270
Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu
275 280 285
Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg
290 295 300
Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly
305 310 315 320
Thr Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Lys
325 330 335
Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg
340 345 350
Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro
355 360 365
Glu Glu Glu Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser
370 375 380
Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu
385 390 395 400
Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg
405 410 415
Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln
420 425 430
Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr
435 440 445
Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp
450 455 460
Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala
465 470 475 480
Leu His Met Gln Ala Leu Pro Pro Arg Gln Ala Lys Arg Lys Pro Arg
485 490 495
Lys Ala Pro Ser Arg Asn Ile Cys Tyr Asp Ala Phe Val Ser Tyr Ser
500 505 510
Glu Arg Asp Ala Tyr Trp Val Glu Asn Leu Met Val Gln Glu Leu Glu
515 520 525
Asn Phe Asn Pro Pro Phe Lys Leu Cys Leu His Lys Arg Asp Phe Ile
530 535 540
Pro Gly Lys Trp Ile Ile Asp Asn Ile Ile Asp Ser Ile Glu Lys Ser
545 550 555 560
His Lys Thr Val Phe Val Leu Ser Glu Asn Phe Val Lys Ser Glu Trp
565 570 575
Cys Lys Tyr Glu Leu Asp Phe Ser His Phe Arg Leu Phe Asp Glu Asn
580 585 590
Asn Asp Ala Ala Ile Leu Ile Leu Leu Glu Pro Ile Glu Lys Lys Ala
595 600 605
Ile Pro Gln Arg Phe Cys Lys Leu Arg Lys Ile Met Asn Thr Lys Thr
610 615 620
Tyr Leu Glu Trp Pro Met Asp Glu Ala Gln Arg Glu Gly Phe Trp Val
625 630 635 640
Asn Leu Arg Ala Ala Ile Lys Ser
645
<210> 2
<211> 1944
<212> DNA
<213> Artificial sequence
<400> 2
atgcttctcc tggtgacaag ccttctgctc tgtgagttac cacacccagc attcctcctg 60
gacatcgtcc tgacccagtc acctgccagc ctggccgtca gcctgggcga gagagccacc 120
attaattgcc gcgctagcga atcagtgtca gtcatcggcg ctcacctgat ccactggtat 180
cagcaaaagc ctgggcagcc accaaagctg ctcatctatc tcgcctccaa cctggagaca 240
ggcgtgcctg ctcgctttag tggttctggt agcggcaccg atttcaccct gactatttca 300
agcctgcagg cagaggacgc agccatatac tattgcctgc agtcccggat tttccctcgc 360
acattcggcc agggcacaaa actggaaatc aaaggatcta cctccggctc cgggaagccc 420
ggaagcggcg aaggctcaac caaaggccag gttcagctcg tgcagtctgg ttctgaactg 480
aagaaacccg gtgcatctgt gaaagtctcc tgcaaggctt ccgggtatac tttcacagac 540
tacagtatta attgggttcg ccaagctcct ggacagggac tggagtggat gggatggata 600
aacacagaaa ctagggagcc tgcatacgcc tatgatttca gaggtcgctt cgtgttcagt 660
ctggatacaa gtgtttcaac agcctatctg caaattagct ccctgaaagc cgaggacacc 720
gcagtttact actgtgcacg ggattattct tacgctatgg actattgggg gcagggcaca 780
ctcgtgacag tgtctagcac cacgacgcca gcgccgcgac caccaacacc ggcgcccacc 840
atcgcgtcgc agcccctgtc cctgcgccca gaggcgtgcc ggccagcggc ggggggcgca 900
gtgcacacga gggggctgga cttcgcctgt gatatctaca tctgggcgcc cttggccggg 960
acttgtgggg tccttctcct gtcactggtt atcacccttt actgcaaacg gggcagaaag 1020
aaactcctgt atatattcaa acaaccattt atgagaccag tacaaactac tcaagaggaa 1080
gatggctgta gctgccgatt tccagaagaa gaagaaggag gatgtgaact gagagtgaag 1140
ttcagcagga gcgcagacgc ccccgcgtac cagcagggcc agaaccagct ctataacgag 1200
ctcaatctag gacgaagaga ggagtacgat gttttggaca agagacgtgg ccgggaccct 1260
gagatggggg gaaagccgag aaggaagaac cctcaggaag gcctgtacaa tgaactgcag 1320
aaagataaga tggcggaggc ctacagtgag attgggatga aaggcgagcg ccggaggggc 1380
aaggggcacg atggccttta ccagggtctc agtacagcca ccaaggacac ctacgacgcc 1440
cttcacatgc aggccctgcc ccctcgccag gccaaaagga agcccaggaa agctcccagc 1500
aggaacatct gctatgatgc atttgtttct tacagtgagc gggatgccta ctgggtggag 1560
aaccttatgg tccaggagct ggagaacttc aatcccccct tcaagttgtg tcttcataag 1620
cgggacttca ttcctggcaa gtggatcatt gacaatatca ttgactccat tgaaaagagc 1680
cacaaaactg tctttgtgct ttctgaaaac tttgtgaaga gtgagtggtg caagtatgaa 1740
ctggacttct cccatttccg tctttttgat gagaacaatg atgctgccat tctcattctt 1800
ctggagccca ttgagaaaaa agccattccc cagcgcttct gcaagctgcg gaagataatg 1860
aacaccaaga cctacctgga gtggcccatg gacgaggctc agcgggaagg attttgggta 1920
aatctgagag ctgcgataaa gtcc 1944
Claims (10)
1. A chimeric antigen receptor T cell targeting BCMA, wherein said chimeric antigen receptor comprises a signal peptide, an antigen binding domain, a transmembrane domain, and a signaling domain;
the antigen binding domain comprises an anti-BCMA single chain antibody;
the signaling domain comprises 4-1BB, CD3 ζ, and TLR2;
the signal peptide comprises a GM-CSF signal peptide;
the transmembrane domain is CD8 α;
the chimeric antigen receptor is formed by connecting GM-CSF signal peptide, anti-BCMA single-chain antibody, CD8 alpha, 4-1BB, CD3 zeta and TLR2 in series;
the chimeric antigen receptor is an amino acid sequence shown in SEQ ID NO. 1.
2. A nucleic acid molecule comprising a GM-CSF signal peptide-encoding gene, an anti-BCMA single chain antibody-encoding gene, a CD8 α -encoding gene, a 4-1 BB-encoding gene, a CD3 ζ -encoding gene, and a TLR 2-encoding gene;
the nucleic acid molecule is a nucleic acid sequence shown as SEQ ID NO. 2.
3. An expression vector which is a viral vector comprising the nucleic acid molecule of claim 2.
4. The expression vector of claim 3, wherein the viral vector comprises any one of a lentiviral vector, a retroviral vector, or an adeno-associated viral vector.
5. The expression vector of claim 4, wherein the viral vector is a lentiviral vector.
6. A recombinant lentivirus prepared by co-transfecting a mammalian cell with the expression vector of any one of claims 3 to 5 and a packaging helper plasmid.
7. A method for producing the chimeric antigen receptor T cell according to claim 1, which comprises the step of introducing the recombinant lentivirus according to claim 6 into a T cell.
8. A pharmaceutical composition comprising the chimeric antigen receptor T cell of claim 1.
9. The pharmaceutical composition of claim 8, further comprising any one or a combination of at least two of a pharmaceutically acceptable carrier, excipient, or diluent.
10. Use of the chimeric antigen receptor T cell of claim 1, the nucleic acid molecule of claim 2, the expression vector of any one of claims 3-5, the recombinant lentivirus of claim 6, or the pharmaceutical composition of claim 8 or 9 for the preparation of a medicament for the treatment of a B-cell malignancy.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011085552.9A CN112251412B (en) | 2020-10-12 | 2020-10-12 | BCMA (brain cell activating antigen) targeted chimeric antigen receptor T cell and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011085552.9A CN112251412B (en) | 2020-10-12 | 2020-10-12 | BCMA (brain cell activating antigen) targeted chimeric antigen receptor T cell and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112251412A CN112251412A (en) | 2021-01-22 |
| CN112251412B true CN112251412B (en) | 2023-03-28 |
Family
ID=74242815
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011085552.9A Active CN112251412B (en) | 2020-10-12 | 2020-10-12 | BCMA (brain cell activating antigen) targeted chimeric antigen receptor T cell and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112251412B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112979808B (en) * | 2021-02-08 | 2022-07-29 | 华道(上海)生物医药有限公司 | Antibody for resisting B cell mature antigen and application thereof |
| CN113461818B (en) * | 2021-06-30 | 2022-01-21 | 徐州医科大学 | CD 276-targeted fully human antibody scFv, chimeric antigen receptor, engineered immune cell and preparation method thereof |
| CN116120465B (en) * | 2022-11-01 | 2023-10-13 | 邦恩泰(山东)生物医药科技集团股份有限公司 | Chimeric antigen receptor targeting BCMA and/or FCRH5 and application thereof |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108018299A (en) * | 2016-11-01 | 2018-05-11 | 上海恒润达生生物科技有限公司 | Target Chimeric antigen receptor of BCMA and application thereof |
| CN108441504A (en) * | 2018-05-07 | 2018-08-24 | 武汉波睿达生物科技有限公司 | A kind of mosaic type antigen receptor of anti-BCMA and preparation method thereof |
| CN109021116A (en) * | 2018-08-16 | 2018-12-18 | 重庆精准生物技术有限公司 | The Chimeric antigen receptor and its application of anti-BCMA antigen |
| CN109153731A (en) * | 2015-08-11 | 2019-01-04 | 南京传奇生物科技有限公司 | Target the Chimeric antigen receptor and its application method of BCMA |
| CN109651511A (en) * | 2018-12-26 | 2019-04-19 | 广州百暨基因科技有限公司 | A kind of Chimeric antigen receptor and its application targeting BCMA |
| CN110372796A (en) * | 2018-04-12 | 2019-10-25 | 西比曼生物科技（香港）有限公司 | The Chimeric antigen receptor and its preparation method of targeting BCMA and application |
-
2020
- 2020-10-12 CN CN202011085552.9A patent/CN112251412B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109153731A (en) * | 2015-08-11 | 2019-01-04 | 南京传奇生物科技有限公司 | Target the Chimeric antigen receptor and its application method of BCMA |
| CN108018299A (en) * | 2016-11-01 | 2018-05-11 | 上海恒润达生生物科技有限公司 | Target Chimeric antigen receptor of BCMA and application thereof |
| CN110372796A (en) * | 2018-04-12 | 2019-10-25 | 西比曼生物科技（香港）有限公司 | The Chimeric antigen receptor and its preparation method of targeting BCMA and application |
| CN108441504A (en) * | 2018-05-07 | 2018-08-24 | 武汉波睿达生物科技有限公司 | A kind of mosaic type antigen receptor of anti-BCMA and preparation method thereof |
| CN109021116A (en) * | 2018-08-16 | 2018-12-18 | 重庆精准生物技术有限公司 | The Chimeric antigen receptor and its application of anti-BCMA antigen |
| CN109651511A (en) * | 2018-12-26 | 2019-04-19 | 广州百暨基因科技有限公司 | A kind of Chimeric antigen receptor and its application targeting BCMA |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112251412A (en) | 2021-01-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112251412B (en) | BCMA (brain cell activating antigen) targeted chimeric antigen receptor T cell and application thereof | |
| CN112048481B (en) | Chimeric antigen receptor NK (natural killer) cell targeting CD19 and application thereof | |
| WO2018223600A1 (en) | Octs-car dual targeting chimeric antigen receptor, encoding gene, recombinant expression vector and construction and use thereof | |
| WO2018223601A1 (en) | Anti-psca and anti-pdl1 dual targeting chimeric antigen receptor based on octs-car, encoding gene and expression vector | |
| CN112029729B (en) | CD19 and CD22 double-target chimeric antigen receptor NK (natural killer) cell and application thereof | |
| CN109111525B (en) | HLA-G chimeric antigen receptor, coding sequence, expression vector and application | |
| CN112195157B (en) | CD19 and CD22 double-target chimeric antigen receptor T cell and application thereof | |
| CN111848822B (en) | CD19 and CD30 double-target chimeric antigen receptor and application thereof | |
| CN111748044A (en) | CD19 and PD-L1 double-target chimeric antigen receptor and application thereof | |
| CN111848820B (en) | CD19 and BCMA double-target chimeric antigen receptor and application thereof | |
| CN111848818A (en) | Enhanced immune cell and application thereof | |
| CN111875711A (en) | Enhanced immune cell and application thereof | |
| CN112226462A (en) | Expression vector for co-expressing secretory IL-7 and selective CCL19 and application thereof | |
| CN114230658A (en) | Novel coronavirus-specific T cell receptor and uses thereof | |
| CN108822216A (en) | Carry the Chimeric antigen receptor and its application of truncation or not truncated nature cell toxin receptor signal structure | |
| CN113045675B (en) | Antibody for resisting CD22 protein molecule and application thereof | |
| CN111808200B (en) | CD19 and CD22 double-target chimeric antigen receptor and application thereof | |
| CN107286246B (en) | Chimeric antigen receptor modified dendritic cell for treating brain glioma and preparation method thereof | |
| CN115925948B (en) | anti-CD 22 nano antibody and application thereof | |
| CN112226412B (en) | T cell expressing immunosuppressive checkpoint receptor molecule and application thereof | |
| CN112608387B (en) | CD19 and CD20 double-target chimeric antigen receptor and application thereof | |
| CN111484561A (en) | Chimeric antigen receptor targeting CD19 molecule | |
| CN113004423B (en) | CAR-T cell for specifically targeting and activating hepatic stellate cell and preparation method and application thereof | |
| WO2020133050A1 (en) | Ebv epitope high affinity t cell receptor | |
| CN113249331B (en) | DC cell and CTL cell loaded with Tax antigen as well as preparation methods and applications of DC cell and CTL cell |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20211227 Address after: No. 833, Shunde street, Shunde District, Guangdong Province Applicant after: Tang Chaoyang Address before: 510663 units 517-519, 518-520, 5th floor, Zone D, Guangzhou Science and technology innovation base, No.80, Science City, Langyue Road, Guangzhou high tech Industrial Development Zone, Guangdong Province Applicant before: GUANGDONG ZHAOTAI INVIVO BIOMEDICINE Co.,Ltd. |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |