CN107286246B

CN107286246B - Chimeric antigen receptor modified dendritic cell for treating brain glioma and preparation method thereof

Info

Publication number: CN107286246B
Application number: CN201611232788.4A
Authority: CN
Inventors: 樊克兴; 高同同
Original assignee: When Biological Technology (beijing) Co Ltd
Current assignee: When Biological Technology (beijing) Co Ltd
Priority date: 2016-12-28
Filing date: 2016-12-28
Publication date: 2019-12-17
Anticipated expiration: 2036-12-28
Also published as: CN107286246A

Abstract

The invention relates to a chimeric antigen receptor, a dendritic cell modified by the chimeric antigen receptor, a preparation method of the dendritic cell, application of the dendritic cell in treating a glioma immune cell, and application of the dendritic cell in preparing a medicament for treating a glioma.

Description

Chimeric antigen receptor modified dendritic cell for treating brain glioma and preparation method thereof

Technical Field

The invention belongs to the field of biomedicine, and particularly relates to a Chimeric Antigen Receptor (CAR) and a dendritic cell (CAR-DC) modified by the Chimeric Antigen Receptor, a preparation method of the CAR-DC, and application of the dendritic cell in preparation of a medicament for treating brain glioma.

Background

Dendritic cells are a class of leukocytes that differ in morphology and function from granulocytes, macrophages and lymphocytes, with their cell membranes protruding outward to form membranous dendrites similar to nerve cell axons, named Dendritic Cells (DCs). It is a professional antigen presenting cell with the strongest organism function, can efficiently take, process and present antigen, DC is combined with tumor antigen captured and processed by the DC through MHC molecules on the surface to form peptide-MHC molecule compound, and is presented to T cells, thereby starting MHC-I restricted CTL reaction and MHC-II restricted CD4+ Thl reaction. At the same time, DCs also provide a secondary signal necessary for T cell activation through their highly expressed co-stimulatory molecules (CD80/B7-1, CD86/B7-2, CD40, etc.), initiating an immune response (Stumbles PA. Regulation of T cell differentiation by differentiation transcriptional cells. immunity and cell biology (1999)77, 428-.

The current DC cell therapy adopts the steps that mononuclear cells of a tumor patient are proliferated, cultured and induced in vitro to generate DCs, then the DCs are loaded with corresponding tumor antigens, the DCs are prepared into DCs loaded with the tumor antigens after strict screening, then the DCs are infused back into the patient body to activate a natural anti-tumor system in the human body, and the DCs transmit the information of the tumor cells to an immune system in the process, and guide the anti-cancer immune system of the human body to recognize and eliminate the tumor cells (Turnis ME, Rooney CM. enhancement of dendritic cells as vaccines for cancer. immunotherpay 2010; 2(6): 847-62). Many years of clinical research have shown that DC cell therapy is widely applicable to various clinical tumor therapies, especially to malignant melanoma, prostate cancer, kidney cancer, bladder cancer, ovarian cancer, colon cancer, rectal cancer, breast cancer, cervical cancer, various lung cancers, laryngeal cancer, nasopharyngeal cancer, pancreatic cancer, liver cancer, stomach cancer, etc. (Constantino J, Gomes C, FalcaoA, Cruz MT, New BM. Antitumental polymeric cell-based cancers: tissues from20years of clinical trials and future cancers. Transl Res 2016; 168: 74-95). However, the efficacy of loading tumor antigens by in vitro activation of DCs alone is limited, and further improvements are still needed in methods for DC cell immunotherapy of tumors.

EGFRvIII is the most frequently occurring mutant EGFR in human tumors and is particularly prevalent in brain tumors known as glioblastoma multiforme. EGFRvIII has been reported to be present in 56% glioblastoma, 16% non-small cell lung cancer and 78% Breast cancer (Carol J. Wikstrand, Laura P. Hale, et al, monoclonal antibodies against the age of EGFRvIII Are Tumor specificity and reaction with Breast and Lung Carcinomas and Malignant Gliomas. cancer Res.1995Jul 15; 55(14):3140-8), while the sequence was not found in any normal tissue. Therefore, EGFRvIII is a potentially ideal tumor target.

With the development of tumor immunology theory and clinical technology, Chimeric antigen receptor T-cell immunotherapy (CAR-T) (June CH, Blazar BR, Riley JL. engineering lymphoma subsets: tools, tris and tribulions. NatRev Immunol.2009; 9:704-16) became one of the most promising tumor immunotherapies. Chimeric Antigen Receptors (CARs) consist of a tumor-associated antigen binding region, an extracellular hinge region, a transmembrane region, and an intracellular signaling region. CAR-T cell therapy expresses a fusion protein of Single chain antibody (scFv) for recognizing tumor-associated antigen and T cell activation sequence to the surface of T cell by exogenous gene transfection technology, so that the scFv capable of specifically recognizing tumor-associated antigen is coupled with activation proliferation signal domain in T cell via transmembrane region. CAR-expressing T cells bind tumor antigens in an antigen-dependent, but not MHC-restricted manner, initiating and activating a specific killing tumor response. However, CAR-T can produce some off-target toxicity, affecting its cellular immune efficacy; and more importantly, because of tumor heterogeneity, multiple tumor antigens are often present in the same tumor, CAR-T against a single tumor antigen has limited efficacy and is prone to recurrence.

Considering that DC cells are the most important antigen presenting cells of human body, the DC can more effectively recognize presented tumor antigens by transducing CAR structures into the DC, and simultaneously a DC activation amplification signal is added to further promote the activation of the DC; and more importantly, the tumor-targeted CAR-DC can effectively present multiple antigens of the same tumor to effector T cells, thereby overcoming the single-target recognition killing effect of CAR-T. In the invention, a novel DC cell tumor treatment strategy is designed, a CD40 signal domain is fused with a tumor-associated chimeric antigen receptor (anti-EGFRvIII scfv) by utilizing a lentivirus system, DC cells are transduced, and EGFRvIII CAR-DC is constructed. The tumor-associated chimeric antigen receptor is combined with glioma cells to activate DC cells, and simultaneously presents tumor antigens to stimulate T cells to be activated, thereby playing the role of resisting tumors.

Disclosure of Invention

in order to overcome the defects that the killing effect of the in vitro activated DC cells on tumors is weak and the specific killing activity needs to be improved in the prior art, the invention provides the following aspects.

The invention firstly provides a Chimeric Antigen Receptor (CAR), which is formed by splicing a CD8 alpha signal peptide, an anti-EGFRvIIIscFv, a human CD8 alpha hinge region, a transmembrane region and an intracellular signal region of human CD40 in sequence and is called EGFRvIIICAR.

Furthermore, the amino acid sequence of the single-chain antibody is shown in SEQ ID NO. 1.

The invention also provides a gene for coding the chimeric antigen receptor, and the nucleotide sequence of the gene is shown in SEQ ID NO. 2.

The invention also provides an expression vector which comprises the coding gene of the chimeric antigen receptor with the amino acid sequence shown as SEQ ID NO.1 and can express.

Further, the expression vector is a lentiviral vector pCDH-EGFRvIIICAR.

the invention also provides an engineered dendritic cell containing the expression vector.

Further, the expression vector is a lentiviral vector pCDH-EGFRvIIICAR.

The invention also provides application of the engineered DC cell in preparing a medicament for treating tumors.

Further, the tumor is selected from: brain glioma, non-small cell lung cancer and breast cancer.

the invention also provides a method for expressing the dendritic cell of the chimeric antigen receptor, which comprises the step of introducing the expression vector of the chimeric antigen receptor into the dendritic cell.

Further, the chimeric antigen receptor in the method is the EGFRvIIICAR, and preferably has an amino acid sequence shown in SEQ ID NO. 1.

Further, the expression vector in the method comprises a coding gene capable of expressing the chimeric antigen receptor with the amino acid sequence shown as SEQ ID NO.1, and preferably is a lentiviral vector pCDH-EGFRvIIICAR.

Drawings

FIG. 1 is a schematic structural diagram of the chimeric antigen receptor EGFRvIIICAR used in the present invention, which consists of CD8 α signal peptide (CD8 α SP), EGFRvIII antibody light chain variable region (EGFR vIIIscfv-VL), linker region, EGFRvIII antibody heavy chain variable region (EGFRvIIIscfv-VH), CD8 α Hinge region (CD8 α Hinge), CD40 transmembrane region (CD40TM), and CD40 intracellular signal region. And designing a contrast structure which does not have a CD40 intracellular signal region, namely EGFRvIIICAR'.

FIG. 2 is a diagram of plasmid information of pCDH-EGFRvIIICAR lentiviral expression vector.

FIG. 3 shows in vitro EGFRvIIICAR-DC cells and EGFRvIII cells of the invention⁺Tumor cell U87 (EGFRvIII)⁺U87) activation after co-cultivation. A: culturing the DC cells in vitro; b: culturing DC cells outside the empty lentivirus vector transductant; c: culturing DC cells outside the lentivirus pCDH-EGFRvIIICAR transductant; d: and culturing the DC cells outside the conductor of the lentivirus pCDH-EGFRvIIICAR'. As shown in the figure, the EGFRvIIICAR-DC cells are in EGFRvIII⁺Higher degrees of activation maturation were achieved in vitro under stimulation by U87 cells.

FIG. 4 shows T cell activation. EGFRvIIICAR-DC cells incubated with T cells in EGFRvIII⁺The stimulation of U87 cells promotes the activation of T cells. A: culturing DC cells (without T cells) outside the lentiviral pCDH-EGFRvIIICAR transductant; b: culturing DC cells (+ T cells) outside the conductor of the lentivirus pCDH empty vector; c: culturing DC cell cells (+ T cells) outside the conductor of the lentivirus pCDH-EGFRvIIICAR; d: and culturing the DC cell (+ T cell) outside the conductor of the lentivirus pCDH-EGFRvIIICAR'.

FIG. 5 is a graph of the change in tumor volume in mice in a mouse brain glioma model. A: culturing DC cells (T cell free) in vitro with lentiviral egfrviii car transductants; b: culturing DC cells (+ T cells) in vitro by lentivirus empty vector transductants; c: culturing DC cells (+ T cells) outside of lentiviral egfrviii car' transductants; d: DC cells (+ T cells) were cultured in vitro with lentiviral egfrviii car transductants. From the figure, the tumors of the mice injected with the EGFRvIIICAR-DC cell + T cell group are obviously inhibited, and the tumor volume is obviously reduced until disappearance as time goes on.

Fig. 6 is a graph of mouse survival in a mouse glioma model. A: culturing DC cells (T cell free) in vitro with lentiviral egfrviii car transductants; b: culturing DC cells (+ T cells) in vitro by lentivirus empty vector transductants; c: culturing DC cells (+ T cells) outside of lentiviral egfrviii car' transductants; d: DC cells (+ T cells) were cultured in vitro with lentiviral egfrviii car transductants.

Detailed Description

The following describes in detail specific embodiments of the present invention. It should be understood that the detailed description and specific examples, while indicating the present invention, are given by way of illustration and explanation only, not limitation.

The experimental procedures in the following examples are, unless otherwise specified, conventional in the art. In the following examples

The experimental materials used, unless otherwise specified, were purchased from conventional biochemical stores, in which:

DMEM medium and X-VIVO 15 medium were purchased from TaKaRa.

T4DNA ligase was purchased from TaKaRa.

Restriction endonucleases EcoR I, Xba I were purchased from Thermo Fisher Scientific.

Agarose gel DNA recovery kit, common DNA product purification kit and plasmid miniprep kit were purchased from Tiangen Biotechnology Ltd.

pCDH-CMV-MCS-EF1-copGFP-T2A-puro (pCDH for short) and its packaging plasmids pLP1, pLP2, pLP/VSVG were purchased from Addgene.

Trans1-T1Phage resist chemically competent cells were purchased from Kyoto Kogyo gold Biotech, Inc.

Lipofectamine (TM) 2000Transfection Reagent was purchased from Invitrogen.

293T packaging cells, BHK21 milk hamster kidney fibroblasts and U87 glioma cells were purchased from ATCC in the United states.

Fetal bovine serum was purchased from Gibco.

All primers and gene synthesis were synthesized by Shanghai Biotech, Inc.

Both PEG6000 and NaCl were purchased from Shanghai Solaibao Biotech Co.

Human GM-CSF, IL-4, rhIL-2, CD3/CD28 antibodies, etc. were purchased from ebioscience.

anti-MHC-I, MHC-II, CD80, CD86, CD3, CD25 and other flow antibodies were purchased from BD company.

Human DC CELL sorting kits and T CELL sorting kits were purchased from STEM CELL corporation.

NSG micePurchased from Beijing Wintoda Biotechnology Ltd.

Example 1

Determination of EGFRvIIICAR gene sequence

1.1 sequences of the human CD8 alpha signal peptide gene (SEQ ID NO.3), the human CD8 alpha hinge region gene (SEQ ID NO.7), the human CD40 transmembrane region (SEQ ID NO.8) and the human CD40 signal region gene (SEQ ID NO.9) were obtained from the GenBank database at the national library site of medicine (http:// www.ncbi.nlm.nih.gov/entrez). Human CD8 alpha signal peptide gene (SEQ ID NO.3), EGFRvIIIscFv light chain gene (SEQ ID NO.4), linker region (Gly4-Ser)₃(SEQ ID NO.5), EGFRvIIIscFv heavy chain gene (SEQ ID NO.6), human CD8 alpha hinge region gene (SEQ ID NO.7), human CD40 transmembrane region (SEQ ID NO.8) and human CD40 signal domain gene (SEQ ID NO.9) are connected to form the final complete information of the EGFRvIIICAR gene sequence (SEQ ID NO. 2).

II, construction of EGFRvIIICAR expression plasmid

2.1 Total Gene Synthesis:

The complete EGFRvIIICAR sequence (SEQ ID NO.2) was synthesized by Shanghai Biotechnology Ltd, to which Xba I cleavage site was added at the 5 'end and EcoR I cleavage site was added at the 3' end.

2.2 amplification by PCR of the EGFRvIIICAR ' region not containing the intracellular signaling region of human CD40, with Xba I cleavage site added at the 5 ' end and EcoR I cleavage site added at the 3 ' end. F: GCTCTAGAATGGCCCTGCCTGTG (SEQ ID NO. 10); r: GGAATTCTCAGGTATCAGAAACCCCTGTAG (SEQ ID NO. 11). The 1005bp fragment was recovered by amplification.

2.3 cloning EGFRvIIICAR and EGFRvIIICAR' into pCDH lentivirus expression vector respectively to construct

pCDH-EGFRvIIICAR and pCDH-EGFRvIIICAR' plasmids. The method comprises the following specific steps: the pCDH vector, the EGFRvIIICAR fragment and the EGFRvIIICAR' fragment Xba I/EcoR I are subjected to enzyme digestion, and 8192bp, 1186bp and 1000bp fragments are respectively recovered. And respectively using T4DNA ligase to connect the digested pCDH vector and EGFRvIIICAR, and the digested pCDH vector and EGFRvIIICAR', using the ligation products to transform Trans1-T1 competence for overnight culture, picking out a single clone, culturing, extracting plasmids and sequencing to obtain pCDH-EGFRvIIICAR and pCDH-EGFRvIII plasmids. The structures of EGFRvIIICAR and EGFRvIIICAR' are shown in figure 1. The information of the pCDH-EGFRvIIICAR lentiviral expression vector is shown in FIG. 2. The gene sequence and the amino acid sequence of the EGFRvIIICAR' are shown in a sequence table SEQ ID NO.12 and a sequence table SEQ ID NO. 13.

third, slow virus packaging, concentration and titer determination

3.1 packaging of lentiviruses:

3.1.1 cell treatment: 293T cells at passage 3-10 in logarithmic growth phase were collected 24 hours prior to transfection, and the 293T cells were seeded in six-well cell culture plates at an inoculum size of 5X10^ 5/well in DMEM medium containing 2ml 10% FBS and placed at 37 ℃ with 5% CO₂The cell culture box is used for culturing for 18 hours, and the transfection can be carried out when the cell density reaches 60-80%.

3.1.2 Co-transfection of lentiviral vector plasmids (pCDH or pCDH-EGFRvIIICAR') and their packaging plasmids (pLP1, pLP2, pLP/VSVG) into 293T cells;

3.1.3 24 hours after transfection, expression of GFP fluorescence after transfection of 293T cells was observed under a fluorescence microscope. Respectively collecting 293T culture supernatant 48 hours and 72 hours after transfection, centrifuging at 3000rpm for 15 minutes, respectively collecting cells and supernatant, repeatedly freezing and thawing for three times to lyse the cells, and centrifuging to collect supernatant;

3.1.4 the viral supernatants were filtered through 0.45 μm filters to obtain pCDH-rIdasome virus, pCDH-EGFRvIIICAR' virus, pCDH-EGFRvIIICAR virus solutions, respectively.

3.2 concentration of lentivirus and determination of viral titre

3.2.1 collecting cells and culture supernatant respectively, concentrating virus with PEG6000, adding 1/4 volume of PEG6000/NaCl solution (25% PEG6000+ 4.4% NaCl) into the virus solution, mixing, and standing at 4 deg.C for 1 hr;

3.2.24 ℃, centrifuging for 30 minutes at 5000 rpm;

3.2.3 discard the supernatant, add 2ml of virus lysis solution (10mM Tris-HCl (pH8.0), 2mM MgCl₂5% sucrose) dissolved the lentiviral pellet and stored at-80 ℃.

3.2.4 determination of viral titre. Pre-inoculating BHK21 cells to a 24-pore plate with 10^ 5/pore, and culturing in a 5% CO2 cell culture box at 37 ℃ for 18 hours;

3.2.5 dissolving the virus in preparation for 10^-2To 10^-710-fold dilution of the virus sample;

3.2.6 removing the cell culture fluid, adding the cell culture fluid containing different virus amounts, adding polybrene (polybrene) of 6ug/ml into the cell culture fluid, and culturing in a 5% CO2 cell culture box at 37 ℃ for 2 hours;

3.2.7 cell culture Medium was removed, 1% FBS-containing DMEM was added, and the mixture was incubated at 37 ℃ with 5% CO₂Culturing in a cell culture box for 48 hours;

3.2.8 removing cell culture solution, adding DMEM culture solution containing 2ug/ml puromycin and 1% FBS, and culturing in 5% CO2 cell culture box at 37 deg.C for 72 hr;

3.2.9 the cell culture fluid was removed, crystal violet staining solution was added, the number of stained clones counted, and the virus titer was calculated.

2.10 the virus was diluted to 10^7TU/ml and stored at-80 ℃.

In vitro culture, infection and amplification of dendritic cells

4.1 CD14+ CELLs were sorted from Peripheral Blood Mononuclear CELLs (PBMC) using a dendritic CELL sorting kit (purchased from STEM CELL).

4.2 resuspending the cells in X-VIVO 15 medium, adding 200U/ml of a solution of recombinant human granulocyte macrophage colony stimulating factor (GM-CSF), 500U/ml of an IL-4 solution and 5% of autologous plasma, and inducing differentiation of CD14+ cells into dendritic cells.

4.3 to dendritic cells cultured for 6 days, pCDH or pCDH-EGFRvIIICAR' or pCDH-EGFRvIIICAR virus concentrate was added to the dendritic cells, respectively, to a viral multiplicity of infection MOI of 10 and a final concentration of polybrene of 6. mu.g/ml, mixed, and placed at 37 ℃ with 5% CO₂Culturing in a cell culture box, and not changing the culture solution within 24 hours; a second infection was performed 24 hours after infection;

4.4 expression of green fluorescence of dendritic cells was observed with a fluorescence microscope at 96 hours post infection.

4.5 after collecting cells, centrifugation at 1000rpm for 10 minutes, PBS wash 1 time, 200ul PBS heavy suspension cells placed in the flow tube, flow cytometry detection of GFP positive rate. The positive cells are the obtained EGFRvIIICAR-dendritic cells.

Fifthly, in vitro co-culture determination of CAR-DC cell activation and T cell activation

5.1 assay for dendritic cell activation

5.1.1 cell treatment: respectively aiming at EGFRvIIICAR-DC cells and EGFRvIII⁺Counting U87 cells (abbreviated as U87 vIII);

5.1.2 contacting EGFRvIIICAR-DC cells with EGFRvIII⁺U87 cells were cultured as 3: 1 proportion, and placing at 37 ℃ with 5% CO₂Culturing in a cell culture box for 48 hours;

5.1.3 after collecting cells, 1000rpm centrifugation for 10min, PBS washing 1 time, using PBS heavy suspension cells, using anti human MHC-I/MHC-II/CD86/CD80 antibody staining, detection of DC cell surface activation marker MHC-I/MHC-II/CD86/CD80 expression level. The results are shown in fig. 3, and the activation degree of egfrviii car-DC cells is remarkably increased.

5.2 assay for T cell activation

5.2.1 isolation and culture of T CELLs, T CELLs were sorted from Peripheral Blood Mononuclear CELLs (PBMC) using a T CELL sorting kit (purchased from STEM CELL Co.);

5.2.2 adjusting the cell concentration to 1 x10 ^6/ml with 10% FBS-containing RPMI 1640 medium, inoculating the cells into cell culture flasks pre-coated with anti-human CD3 and CD28 antibodies, adding 200IU/ml recombinant human interleukin 2(rhIL-2), and standing at 37 ℃ with 5% CO₂Culturing in a cell culture box;

5.2.3 EGFRvIIICAR-DC cells, EGFRvIII⁺U87 cells and T cells were measured as 3: 1: 3, placing the mixture at 37 ℃ with 5% CO₂culturing in a cell culture box for 48 hours;

5.2.4 after collecting cells, centrifugation at 1000rpm for 10 minutes, PBS washing 1 time, using PBS heavy suspension cells, using anti-human CD3/CD25 antibody staining, detection of T cell surface activation marker CD25 expression level. The results are shown in fig. 4, and only egfrviii car-DC cells activated T cells efficiently.

Sixth, anti-tumor Effect of CAR-DC cells in vivo

20 6-8 week-old NSG mice were implanted subcutaneously with 5x10^5EGFRvIII⁺U87 cells, and observing and measuring the growth of tumor until the tumor grows to 200mm³the mice were randomly divided into 4 groups, one groupRespectively injecting 10^6EGFRvIIICAR-DC cells, pCDH empty vector-DC cells + T cells, pCDH-EGFRvIIICAR' -DC cells + T cells, pCDH-EGFRvIIICAR-DC cells + T cells (the number of the T cells is 10^ 6/cell) through tail vein.

CAR-DC cell therapy glioma mouse model effect determination: tumor growth was observed and measured after treatment with CAR-DC cells, and mouse survival was recorded. Results of tumor volume measurement referring to fig. 5, in the experimental group of pCDH-egfrviii car-DC cells + T cells, tumor volume increases slowly and gradually decreases after a period of time until disappearance. The survival rate of the mice with the EGFRvIIICAR-DC cell and T cell group tumor-bearing mice is 100% after treatment, the mice with the DC cell treatment and the empty vector DC cell group mice are completely dead, the mice with the EGFRvIIICAR' -DC cell and T cell group tumor-bearing mice partially survive for 28 days after treatment, and the tumor growth speed is relatively reduced. The critical role of the co-stimulatory molecule CD40 in DC cell activation of T cells, initiating an immune response, was demonstrated.

Sequence listing

<110> Shili Biotechnology (Beijing) Ltd

<120> chimeric antigen receptor-modified dendritic cell for treating brain glioma and method for preparing the same

<130> do not

<160> 13

<170> PatentIn version 3.3

<210> 1

<211> 391

<212> PRT

<213> Artificial sequence

<220>

<223> amino acid sequence of EGFRvIIICAR

<400> 1

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Glu Ile Gln Leu Val Gln Ser Gly Ala Glu Val

20 25 30

Lys Lys Pro Gly Glu Ser Leu Arg Ile Ser Cys Lys Gly Ser Gly Phe

35 40 45

Asn Ile Glu Asp Tyr Tyr Ile His Trp Val Arg Gln Met Pro Gly Lys

50 55 60

Gly Leu Glu Trp Met Gly Arg Ile Asp Pro Glu Asn Asp Glu Thr Lys

65 70 75 80

Tyr Gly Pro Ile Phe Gln Gly His Val Thr Ile Ser Ala Asp Thr Ser

85 90 95

Ile Asn Thr Val Tyr Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr

100 105 110

Ala Met Tyr Tyr Cys Ala Phe Arg Gly Gly Val Tyr Trp Gly Gln Gly

115 120 125

Thr Thr Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly

130 135 140

Ser Gly Gly Gly Gly Ser Asp Val Val Met Thr Gln Ser Pro Asp Ser

145 150 155 160

Leu Ala Val Ser Leu Gly Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser

165 170 175

Gln Ser Leu Leu Asp Ser Asp Gly Lys Thr Tyr Leu Asn Trp Leu Gln

180 185 190

Gln Lys Pro Gly Gln Pro Pro Lys Arg Leu Ile Ser Leu Val Ser Lys

195 200 205

Leu Asp Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr

210 215 220

Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val

225 230 235 240

Tyr Tyr Cys Trp Gln Gly Thr His Phe Pro Gly Thr Phe Gly Gly Gly

245 250 255

Thr Lys Val Glu Ile Lys Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr

260 265 270

Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala

275 280 285

Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe

290 295 300

Ala Cys Asp Val Leu His Arg Ser Cys Ser Pro Gly Phe Gly Val Lys

305 310 315 320

Gln Ile Ala Thr Gly Val Ser Asp Thr Ile Cys Glu Pro Cys Pro Val

325 330 335

Gly Phe Ser Asn Val Ser Ser Ala Phe Glu Lys Cys His Pro Trp Thr

340 345 350

Arg Ser Pro Gly Ser Ala Glu Ser Pro Gly Gly Asp Pro His His His

355 360 365

Leu Arg Asp Pro Val Cys His Pro Leu Gly Ala Gly Leu Ser Gln Lys

370 375 380

Gly Gly Gln Glu Ala Asn Gln

385 390

<210> 2

<211> 1173

<212> DNA

<213> Artificial sequence

<220>

<223> nucleic acid sequence of EGFRvIIICAR

<400> 2

atggccctgc ctgtgacagc cctgctgctg cctctggctc tgctgctgca tgccgctaga 60

cccgagattc agctcgtgca atcgggagcg gaagtcaaga agccaggaga gtccttgcgg 120

atctcatgca agggtagcgg ctttaacatc gaggattact acatccactg ggtgaggcag 180

atgccgggga agggactcga atggatggga cggatcgacc cagaaaacga cgaaactaag 240

tacggtccga tcttccaagg ccatgtgact attagcgccg atacttcaat caataccgtg 300

tatctgcaat ggtcctcatt gaaagcctca gataccgcga tgtactactg tgctttcaga 360

ggaggggtct actggggaca gggaactacc gtgactgtct cgtccggcgg aggcgggtca 420

ggaggtggcg gcagcggagg aggagggtcc gacgtcgtga tgacccagag ccctgacagc 480

ctggcagtga gcctgggcga aagagctacc attaactgca aatcgtcgca gagcctgctg 540

gactcggacg gaaaaacgta cctcaattgg ctgcagcaaa agcctggcca gccaccgaag 600

cgccttatct cactggtgtc gaagctggat tcgggagtgc ccgatcgctt ctccggctcg 660

ggatcgggta ctgacttcac cctcactatc tcctcgcttc aagcagagga cgtggccgtc 720

tactactgct ggcagggaac ccactttccg ggaaccttcg gcggagggac gaaagtggag 780

atcaagacca cgacgccagc gccgcgacca ccaacaccgg cgcccaccat cgcgtcgcag 840

cccctgtccc tgcgcccaga ggcgtgccgg ccagcggcgg ggggcgcagt gcacacgagg 900

gggctggact tcgcctgtga tgtcctgcac cgctcatgct cgcccggctt tggggtcaag 960

cagattgcta caggggtttc tgataccatc tgcgagccct gcccagtcgg cttctccaat 1020

gtgtcatctg ctttcgaaaa atgtcaccct tggacaaggt ccccaggatc ggctgagagc 1080

cctggtggtg atccccatca tcatcttcgg gatcctgttt gccatcctct tggtgctggt 1140

ctttctcaaa aaggtggcca agaagccaac caa 1173

<210> 3

<211> 63

<212> DNA

<213> Artificial sequence

<220>

<223> human CD8 alpha signal peptide gene sequence

<400> 3

atggccctgc ctgtgacagc cctgctgctg cctctggctc tgctgctgca tgccgctaga 60

ccc 63

<210> 4

<211> 342

<212> DNA

<213> Artificial sequence

<220>

<223> nucleic acid sequence of EGFRvIIIscFv light chain

<400> 4

gagattcagc tcgtgcaatc gggagcggaa gtcaagaagc caggagagtc cttgcggatc 60

tcatgcaagg gtagcggctt taacatcgag gattactaca tccactgggt gaggcagatg 120

ccggggaagg gactcgaatg gatgggacgg atcgacccag aaaacgacga aactaagtac 180

ggtccgatct tccaaggcca tgtgactatt agcgccgata cttcaatcaa taccgtgtat 240

ctgcaatggt cctcattgaa agcctcagat accgcgatgt actactgtgc tttcagagga 300

ggggtctact ggggacaggg aactaccgtg actgtctcgt cc 342

<210> 5

<211> 45

<212> DNA

<213> Artificial sequence

<220>

<223> nucleic acid sequence of linker region

<400> 5

ggcggaggcg ggtcaggagg tggcggcagc ggaggaggag ggtcc 45

<210> 6

<211> 336

<212> DNA

<213> Artificial sequence

<220>

<223> nucleic acid sequence of EGFRvIIIscFv heavy chain

<400> 6

gacgtcgtga tgacccagag ccctgacagc ctggcagtga gcctgggcga aagagctacc 60

attaactgca aatcgtcgca gagcctgctg gactcggacg gaaaaacgta cctcaattgg 120

ctgcagcaaa agcctggcca gccaccgaag cgccttatct cactggtgtc gaagctggat 180

tcgggagtgc ccgatcgctt ctccggctcg ggatcgggta ctgacttcac cctcactatc 240

tcctcgcttc aagcagagga cgtggccgtc tactactgct ggcagggaac ccactttccg 300

ggaaccttcg gcggagggac gaaagtggag atcaag 336

<210> 7

<211> 135

<212> DNA

<213> Artificial sequence

<220>

<223> nucleic acid sequence of human CD8 alpha hinge region

<400> 7

accacgacgc cagcgccgcg accaccaaca ccggcgccca ccatcgcgtc gcagcccctg 60

tccctgcgcc cagaggcgtg ccggccagcg gcggggggcg cagtgcacac gagggggctg 120

gacttcgcct gtgat 135

<210> 8

<211> 66

<212> DNA

<213> Artificial sequence

<220>

<223> human CD40 transmembrane region

<400> 8

gtcctgcacc gctcatgctc gcccggcttt ggggtcaagc agattgctac aggggtttct 60

gatacc 66

<210> 9

<211> 186

<212> DNA

<213> Artificial sequence

<220>

<223> nucleic acid sequence of intracellular signal region of human CD40

<400> 9

atctgcgagc cctgcccagt cggcttctcc aatgtgtcat ctgctttcga aaaatgtcac 60

ccttggacaa ggtccccagg atcggctgag agccctggtg gtgatcccca tcatcatctt 120

cgggatcctg tttgccatcc tcttggtgct ggtctttctc aaaaaggtgg ccaagaagcc 180

aaccaa 186

<210> 10

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> PCR Forward because

<400> 10

gctctagaat ggccctgcct gtg 23

<210> 11

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> PCR reverse primer

<400> 11

ggaattctca ggtatcagaa acccctgtag 30

<210> 12

<211> 987

<212> DNA

<213> Artificial sequence

<220>

<223> nucleic acid sequence of EGFRvIIICAR

<400> 12

atggccctgc ctgtgacagc cctgctgctg cctctggctc tgctgctgca tgccgctaga 60

cccgagattc agctcgtgca atcgggagcg gaagtcaaga agccaggaga gtccttgcgg 120

atctcatgca agggtagcgg ctttaacatc gaggattact acatccactg ggtgaggcag 180

atgccgggga agggactcga atggatggga cggatcgacc cagaaaacga cgaaactaag 240

tacggtccga tcttccaagg ccatgtgact attagcgccg atacttcaat caataccgtg 300

tatctgcaat ggtcctcatt gaaagcctca gataccgcga tgtactactg tgctttcaga 360

ggaggggtct actggggaca gggaactacc gtgactgtct cgtccggcgg aggcgggtca 420

ggaggtggcg gcagcggagg aggagggtcc gacgtcgtga tgacccagag ccctgacagc 480

ctggcagtga gcctgggcga aagagctacc attaactgca aatcgtcgca gagcctgctg 540

gactcggacg gaaaaacgta cctcaattgg ctgcagcaaa agcctggcca gccaccgaag 600

cgccttatct cactggtgtc gaagctggat tcgggagtgc ccgatcgctt ctccggctcg 660

ggatcgggta ctgacttcac cctcactatc tcctcgcttc aagcagagga cgtggccgtc 720

tactactgct ggcagggaac ccactttccg ggaaccttcg gcggagggac gaaagtggag 780

atcaagacca cgacgccagc gccgcgacca ccaacaccgg cgcccaccat cgcgtcgcag 840

cccctgtccc tgcgcccaga ggcgtgccgg ccagcggcgg ggggcgcagt gcacacgagg 900

gggctggact tcgcctgtga tgtcctgcac cgctcatgct cgcccggctt tggggtcaag 960

cagattgcta caggggtttc tgatacc 987

<210> 13

<211> 329

<212> PRT

<213> Artificial sequence

<220>

<223> amino acid sequence of EGFRvIIICAR

<400> 13

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Glu Ile Gln Leu Val Gln Ser Gly Ala Glu Val

20 25 30

Lys Lys Pro Gly Glu Ser Leu Arg Ile Ser Cys Lys Gly Ser Gly Phe

35 40 45

Asn Ile Glu Asp Tyr Tyr Ile His Trp Val Arg Gln Met Pro Gly Lys

50 55 60

Gly Leu Glu Trp Met Gly Arg Ile Asp Pro Glu Asn Asp Glu Thr Lys

65 70 75 80

Tyr Gly Pro Ile Phe Gln Gly His Val Thr Ile Ser Ala Asp Thr Ser

85 90 95

Ile Asn Thr Val Tyr Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr

100 105 110

Ala Met Tyr Tyr Cys Ala Phe Arg Gly Gly Val Tyr Trp Gly Gln Gly

115 120 125

Thr Thr Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly

130 135 140

Ser Gly Gly Gly Gly Ser Asp Val Val Met Thr Gln Ser Pro Asp Ser

145 150 155 160

Leu Ala Val Ser Leu Gly Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser

165 170 175

Gln Ser Leu Leu Asp Ser Asp Gly Lys Thr Tyr Leu Asn Trp Leu Gln

180 185 190

Gln Lys Pro Gly Gln Pro Pro Lys Arg Leu Ile Ser Leu Val Ser Lys

195 200 205

Leu Asp Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr

210 215 220

Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val

225 230 235 240

Tyr Tyr Cys Trp Gln Gly Thr His Phe Pro Gly Thr Phe Gly Gly Gly

245 250 255

Thr Lys Val Glu Ile Lys Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr

260 265 270

Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala

275 280 285

Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe

290 295 300

Ala Cys Asp Val Leu His Arg Ser Cys Ser Pro Gly Phe Gly Val Lys

305 310 315 320

Gln Ile Ala Thr Gly Val Ser Asp Thr

325

Claims

1. The chimeric antigen receptor is formed by splicing a CD8 alpha signal peptide, an anti-EGFRvIII single-chain antibody (EGFRvIIIscFv), a human CD8 alpha hinge region, a transmembrane region and an intracellular signal region of human CD40 in sequence and is called EGFRvIIICAR, and the amino acid sequence of the chimeric antigen receptor is shown as SEQ ID No. 1.

2. The gene encoding the chimeric antigen receptor of claim 1, the nucleotide sequence of which is shown in SEQ ID No. 2.

3. The expression vector contains and can express the coding gene of the chimeric antigen receptor with the amino acid sequence shown as SEQ ID NO. 1.

4. The expression vector of claim 3, wherein the expression vector is a lentiviral expression vector pCDH-EGFRvIIICAR.

5. an engineered dendritic cell comprising the expression vector of claim 3.

6. Use of the engineered DC cell of claim 5 in the manufacture of a medicament for treating a tumor, wherein the tumor is selected from the group consisting of: brain glioma, non-small cell lung cancer and breast cancer.

7. Method for preparing a dendritic cell according to claim 5, characterized in that an expression vector for the chimeric antigen receptor is allowed to enter the dendritic cell.

8. The method of claim 7, wherein the chimeric antigen receptor is the chimeric antigen receptor of claim 1.

9. the method of claim 7, wherein the expression vector is the expression vector of claim 3 or 4.