CN112522256B

CN112522256B - CRISPR/Cas9 system and application thereof in construction of dystrophin gene-deficient porcine recombinant cells

Info

Publication number: CN112522256B
Application number: CN202010835848.1A
Authority: CN
Inventors: 牛冬; 汪滔; 马翔; 曾为俊; 王磊; 程锐; 赵泽英
Original assignee: Nanjing Qizhen Genetic Engineering Co Ltd
Current assignee: Nanjing Qizhen Genetic Engineering Co Ltd
Priority date: 2020-08-19
Filing date: 2020-08-19
Publication date: 2023-08-22
Anticipated expiration: 2040-08-19
Also published as: CN112522256A

Abstract

The application discloses a CRISPR/Cas9 system and application thereof in construction of a pig source recombinant cell with dystrophin gene defects. The application provides a combination of sgRNAs, from which _DMD‑Ug3 (target sequence binding region is shown as nucleotide 1-20 in SEQ ID NO: 8) and sgRNA _DMD‑Dg3 (the binding region of the target sequence is shown as 1-20 nucleotides in SEQ ID NO: 11). The application provides a kit for obtaining sgRNA by transcription _DMD‑Ug3 Plasmid pKG-U6gRNA (DMD-Ug 3), transcribed to give sgRNA _DMD‑Dg3 Is composed of plasmid pKG-U6gRNA (DMD-Dg 3) and plasmid pKG-GE3. The sgRNA combination or the kit can be used for the preparation of recombinant cells or for the preparation of an animal model of duchenne muscular dystrophy. The recombinant cells are cells defective in dystrophin genes and can be used for preparing animal disease models by somatic cell cloning. The application lays a solid foundation for the preparation of the Dunaliella muscular dystrophy pig model and has great application value for the research and development of Dunaliella muscular dystrophy medicines.

Description

CRISPR/Cas9 system and application thereof in construction of dystrophin gene-deficient porcine recombinant cells

Technical Field

The application relates to a CRISPR/Cas9 system and application thereof in construction of a pig-derived recombinant cell defective in dystrophin genes.

Background

Du's muscular dystrophy (Duchenne muscular dystrophy, DMD) is an X-chromosome recessive genetic disease. Since the disease is an X-linked recessive genetic disease, the primary patient of the disease is male, the incidence of male is about 1/3500-1/5000, and 1/3 of the patients are caused by autologous gene mutation. Women are mostly carriers and are not usually ill. Dunaliella muscular dystrophy is pathologically caused by the change of structure and function of dystrophin (also called dystrophin, english is dystophin), which causes progressive degeneration, necrosis and calf muscle pseudohypertrophy of skeletal muscle at the proximal extremity, thereby causing muscle necrosis and cell death; although the surrounding satellite cells activate to regenerate the muscle cells, the satellite cells eventually age to stop the regeneration of the muscle cells, so that the muscle tissue is finally infiltrated by the fiber fat to lose the function of the muscle tissue. Currently, there are over 30 tens of thousands of male patients worldwide.

The gene encoding dystrophin (called dystrophin gene, dystrobin gene or DMD gene) is currently the only causative gene known for duchenne muscular dystrophy.

Construction of an animal model of duchenne muscular dystrophy, particularly a large animal model, would provide a powerful experimental tool for the study and treatment of this disease. Pig is a main meat animal for human, is easy to breed and raise in large scale, has low requirement in ethical moral and animal protection, has size and organ function similar to human, and is ideal human disease model animal. At present, the report of a DMD large animal model is not yet seen.

Disclosure of Invention

The application aims to provide a CRISPR/Cas9 system and application thereof in construction of a pig-derived recombinant cell defective in dystrophin gene.

The application provides a combination of sgRNAs, from which _DMD-Ug3 And sgRNA _DMD-Dg3 Composition is prepared.

The application provides a plasmid combination, which consists of plasmid pKG-U6gRNA (DMD-Ug 3) and plasmid pKG-U6gRNA (DMD-Dg 3). In the plasmid combination, the molar ratio of the plasmid pKG-U6gRNA (DMD-Ug 3) to the plasmid pKG-U6gRNA (DMD-Dg 3) can be 1:1.

The application also provides a kit comprising the sgRNA combination.

The application also provides a kit comprising the plasmid combination. The kit also comprises plasmid pKG-GE3. The ratio of the total mole number of the plasmids of the plasmid combination to the mole number of the plasmids pKG-GE3 can be specifically 3:1.

the application also protects the application of the sgRNA combination in preparing a kit.

The application also protects the application of the plasmid combination in preparing a kit.

The application also protects the plasmid combination and the application of the plasmid pKG-GE3 in the preparation of the kit. The ratio of the total mole number of the plasmids of the plasmid combination to the mole number of the plasmids pKG-GE3 can be specifically 3:1.

the use of any of the above kits is as follows (a) or (b): (a) preparing a recombinant cell; (b) preparing an animal model of duchenne muscular dystrophy. The transformed recipient cell of the recombinant cell is a porcine cell. The porcine cells may be porcine fibroblasts. The porcine cells may specifically be porcine primary fibroblasts. The pig may be a river fragrant pig. When the Dunaliella muscular dystrophy animal model is prepared, the recombinant cells are prepared first, and then the recombinant cells are used as donor cells to obtain cloned pigs by adopting a somatic cell cloning technology, namely the Dunaliella muscular dystrophy animal model. The Du's muscular dystrophy cell model can also be prepared by the Du's muscular dystrophy animal model, namely, the corresponding cells of the Du's muscular dystrophy animal model are isolated and used as the Du's muscular dystrophy cell model.

The application also protects the application of any one of the sgRNA combinations or any one of the plasmid combinations or any one of the kits in preparing recombinant cells. When the preparation method is applied, the ratio of the total mole number of the sgRNA plasmid to the mole number of the Cas plasmid (specifically, the plasmid pKG-GE 3) can be specifically 3:1. the sgRNA plasmids were plasmid pKG-U6gRNA (DMD-Ug 3) and plasmid pKG-U6gRNA (DMD-Dg 3). When in use, the molar ratio of plasmid pKG-U6gRNA (DMD-Ug 3) to plasmid pKG-U6gRNA (DMD-Dg 3) can be 1:1. The transformed recipient cell of the recombinant cell is a porcine cell. The porcine cells may be porcine fibroblasts. The porcine cells may specifically be porcine primary fibroblasts. The pig may be a river fragrant pig.

The application also protects the application of any one of the sgRNA combinations or any one of the plasmid combinations or any one of the kits in preparing Du's muscular dystrophy animal models. When the method is applied, the recombinant cells are prepared first, and then the recombinant cells are used as donor cells to obtain cloned pigs by adopting a somatic cell cloning technology, namely the Dunaliella muscular dystrophy animal model. When preparing the recombinant cell, the ratio of the total mole number of the sgRNA plasmid to the mole number of the Cas plasmid (specifically, the plasmid pKG-GE 3) may specifically be 3:1. the sgRNA plasmids were plasmid pKG-U6gRNA (DMD-Ug 3) and plasmid pKG-U6gRNA (DMD-Dg 3). When in use, the molar ratio of plasmid pKG-U6gRNA (DMD-Ug 3) to plasmid pKG-U6gRNA (DMD-Dg 3) can be 1:1. The transformed recipient cell of the recombinant cell is a porcine cell. The porcine cells may be porcine fibroblasts. The porcine cells may specifically be porcine primary fibroblasts. The pig may be a river fragrant pig. The Du's muscular dystrophy cell model can also be prepared by the Du's muscular dystrophy animal model, namely, the corresponding cells of the Du's muscular dystrophy animal model are isolated and used as the Du's muscular dystrophy cell model.

Any of the above recombinant cells are dystrophin gene-deficient cells.

Any of the above recombinant cells is a recombinant cell in which the dystrophin gene is mutated. The mutation may be a heterozygous mutation (corresponding genotype is heterozygous mutant) or a homozygous mutation (corresponding genotype is biallelic identical mutant or biallelic different mutant).

The application also provides a method for preparing recombinant cells, comprising the steps of: the plasmid pKG-U6gRNA (DMD-Ug 3), the plasmid pKG-U6gRNA (DMD-Dg 3) and the plasmid pKG-GE3 are co-transfected into pig cells to obtain recombinant cells with the dystrophin gene mutated. The ratio of the total mole number of plasmid pKG-U6gRNA (DMD-Ug 3) and plasmid pKG-U6gRNA (DMD-Dg 3) to the mole number of plasmid pKG-GE3 was 3:1. the molar ratio of plasmid pKG-U6gRNA (DMD-Ug 3) to plasmid pKG-U6gRNA (DMD-Dg 3) may be 1:1. The porcine cells may be porcine fibroblasts. The porcine cells may specifically be porcine primary fibroblasts. The pig may be a river fragrant pig. The mutation may be a heterozygous mutation (corresponding genotype is heterozygous mutant) or a homozygous mutation (corresponding genotype is biallelic identical mutant or biallelic different mutant).

The application also protects the recombinant cells prepared by any one of the methods. In particular, the recombinant cell may be a recombinant cell as described in any one of table 3. Specifically, the recombinant cell may be any one of the following cell lines: monoclonal cell lines numbered 3, 6, 9, 15, 19, 26, 29, 30, 33, 5, 11, 17, 32, 37, 4, 8, 10, 12, 18, 22, 27, 28, 35, 36, 38, or 39 in table 3.

The application also protects the application of the recombinant cells in preparing the Du's muscular dystrophy animal model. When the Dunaliella muscular dystrophy animal model is prepared, the recombinant cells are used as donor cells to obtain cloned pigs by adopting a somatic cell cloning technology, and the Dunaliella muscular dystrophy animal model is obtained. The Du's muscular dystrophy cell model can also be prepared by the Du's muscular dystrophy animal model, namely, the corresponding cells of the Du's muscular dystrophy animal model are isolated and used as the Du's muscular dystrophy cell model.

sgRNA _DMD-Ug3 Target point: 5'-AAAATAAGCAATATAAAACA-3'.

sgRNA _DMD-Dg3 Target point: 5'-CATATACTCTTTATACAAGT-3'.

The sgRNA _DMD-Ug3 The target sequence binding region of (a) is as set forth in SEQ ID NO:8 from nucleotide 1 to nucleotide 20. The sgRNA _DMD-Ug3 Specifically shown as SEQ ID NO: shown at 8.

The sgRNA _DMD-Dg3 The target sequence binding region of (a) is as set forth in SEQ ID NO:11 from nucleotide 1 to nucleotide 20. The sgRNA _DMD-Dg3 Specifically shown as SEQ ID NO: 11.

The plasmid pKG-U6gRNA (DMD-Ug 3) was transcribed to give sgRNA _DMD-Ug3 。

The plasmid pKG-U6gRNA (DMD-Dg 3) was transcribed to give sgRNA _DMD-Dg3 。

Specifically, the plasmid pKG-U6gRNA (DMD-Ug 3) is obtained by introducing the sgRNA with the aid of the restriction enzyme BbsI _DMD-Ug3 Is inserted into a pKG-U6gRNA vector.

Specifically, the plasmid pKG-U6gRNA (DMD-Dg 3) is obtained by introducing the sgRNA with the aid of the restriction enzyme BbsI _DMD-Dg3 Is inserted into a pKG-U6gRNA vector.

The plasmid pKG-GE3 has a specific fusion gene; the specific fusion gene codes for a specific fusion protein;

the specific fusion protein sequentially comprises the following elements from the N end to the C end: two Nuclear Localization Signals (NLS), cas9 protein, two nuclear localization signals, self-cleaving polypeptide P2A, fluorescent reporter protein, self-cleaving polypeptide T2A, resistance selection marker protein;

in the plasmid pKG-GE3, the EF1a promoter is used for promoting the expression of the specific fusion gene;

in plasmid pKG-GE3, the specific fusion gene has downstream a WPRE sequence element, a 3' LTR sequence element and a bGH poly (A) signal sequence element.

The plasmid pKG-GE3 has the following elements in this order: CMV enhancer, EF1a promoter, the specific fusion gene, WPRE sequence element, 3' LTR sequence element, bGH poly (A) signal sequence element.

In the specific fusion protein, two nuclear localization signals at the upstream of the Cas9 protein are SV40 nuclear localization signals, and two nuclear localization signals at the downstream of the Cas9 protein are nucleoplasin nuclear localization signals.

In the specific fusion protein, the fluorescent reporter protein can be EGFP protein.

In the specific fusion protein, the resistance screening marker protein can be a Puromycin protein.

The amino acid sequence of the self-cleaving polypeptide P2A is "ATNFSLLKQAGDVEENPGP" (the cleavage site where self-cleavage occurs is between the first amino acid residue and the second amino acid residue from the C-terminus).

The amino acid sequence of the self-cleaving polypeptide T2A is "EGRGSLLTCGDVEENPGP" (the cleavage site where self-cleavage occurs is between the first amino acid residue and the second amino acid residue from the C-terminus).

Specific fusion genes are specifically shown as SEQ ID NO:2 from nucleotide numbers 911-6706.

CMV enhancer as set forth in SEQ ID NO:2 from nucleotide 395 to 680.

The EF1a promoter is shown in SEQ ID NO:2 from nucleotide 682 to nucleotide 890.

WPRE sequence element is shown as SEQ ID NO:2 from nucleotide 6722 to nucleotide 7310.

The 3' LTR sequence element is shown in SEQ ID NO:2 from nucleotide 7382 to nucleotide 7615.

The bGH poly (A) signal sequence element is shown as SEQ ID NO:2 from nucleotide 7647 to nucleotide 7871.

Plasmid pKG-GE3 is specifically shown in SEQ ID NO: 2.

Plasmid pKG-U6gRNA has the sequence of SEQ ID NO:3 from nucleotide 2280 to nucleotide 2637.

The plasmid pKG-U6gRNA is specifically shown as SEQ ID NO: 3.

The dystrophin gene is the porcine DMD gene.

Porcine DMD gene information: coding dystraphin; located on the X chromosome;

GeneID 1756, sus scrofa. The protein coded by the pig DMD gene is shown as SEQ ID NO: 4. In the genome DNA, the pig DMD gene has 89 exons, wherein the 46 th exon and 500bp sequences respectively at the upstream and downstream thereof are shown in SEQ ID NO: shown at 5.

The application can be used for obtaining the Dunaliella muscular dystrophy pig model by a gene editing means, is used for carrying out researches such as drug screening, drug effect detection, disease pathology, gene therapy and cell therapy, can provide effective experimental data for further clinical application, and lays a solid foundation for curing human Dunaliella muscular dystrophy in future.

Compared with the prior art, the application has at least the following beneficial effects:

(1) Compared with single gRNA, the application can effectively reduce the generation of non-frameshift mutation and can directly detect the gene editing efficiency by PCR. If a single gRNA is used to mutate a target gene, in non-homologous end joining (NHEJ) random repair of DNA, there is a 1/3 probability that a non-frameshift mutation of the base will occur, and it is highly probable that the non-frameshift mutation will not disrupt the function of the target gene, failing to achieve the intended goal of inactivating the target gene. When the double gRNA is used for cutting and mutating the target gene, one fragment of the target gene can be removed, and the fragment deletion frame shift mutation of the target gene can be effectively generated by designing to remove base fragments which are not multiple of 3. Meanwhile, the gene editing product of the deletion fragment can be directly detected by a PCR method, and the efficiency of gene editing can be directly estimated by the ratio of the gene editing product to the wild type product (namely, the unedited product). In addition, double gRNAs can cause theoretical fragment deletion, and separate individual cutting situations of single gRNAs exist, so that the efficiency of gene mutation is greatly improved.

(2) The gRNA vector and cas9 vector are not as conventional 1:1 molar ratio, but in 3:1 molar ratio. The optimal amount of the two gRNA plasmids to Cas9 plasmid is 1.5:1.5:1, the actual amount of plasmid was 0.46. Mu.g+0.46. Mu.g+1.08. Mu.g. For the final acting gRNA: for cas9 protein complexes, the time for transcription of the gRNA vector to form gRNA is earlier than the time for formation of cas9 protein, and the degradation rate of transcribed gRNA is very fast, so if at the DNA vector level, the molar ratio is 1:1, the molar number of cas9 protein is eventually greater than that of undegraded gRNA due to early transcription and degradation of gRNA. Through experimental comparison, the molar ratio editing efficiency of the gRNA:cas9 vector is higher than that of the gRNA:cas9 vector of which the ratio is 1:1 or 1:1. Therefore, the present application preferably employs a vector molar ratio of gRNA to cas9 of 3:1.

(3) The subject (pig) of the application has better applicability than other animals (rats, mice, primates). No model of Dunaliella muscular dystrophy disease is currently being successfully developed in any large animal. Rodents such as rats and mice have great differences from humans in terms of body type, organ size, physiology, pathology and the like, and cannot truly simulate normal physiological and pathological states of humans. Studies have shown that more than 95% of drugs that are validated in mice are ineffective in human clinical trials. In the case of large animals, primates are animals with the closest relationship to humans, but are small in size, late in sexual maturity (mating begins at 6-7 years old), and single animals, the population expansion rate is extremely slow, and the raising cost is also high. In addition, primate cloning is inefficient, difficult and costly. The pig is an animal which has the closest relationship with human except primate, and has the similar body shape, weight, organ size and the like as human, and has the similar anatomy, physiology, nutrition metabolism, disease pathogenesis and the like as human. Meanwhile, the pig has early sexual maturity (4-6 months), high fertility and multiple fetuses in one litter, and can form a larger group within 2-3 years. In addition, the cloning technology of pigs is very mature, and the cloning and feeding cost is much lower than that of primates; and pigs are taken as meat animals of human beings for a long time, and the resistance of the pigs taken as disease model animals in animal protection, ethics and the like is relatively small.

(4) The cas9 high-efficiency expression vector modified by the application is adopted for gene editing, and the editing efficiency is obviously improved compared with the original vector.

The application lays a solid foundation for the preparation of the Dunaliella muscular dystrophy pig model and has great application value for the research and development of Dunaliella muscular dystrophy medicines.

Drawings

FIG. 1 is a schematic diagram of the structure of plasmid pX330.

FIG. 2 is a schematic diagram of the structure of plasmid pKG-GE3.

FIG. 3 is a schematic diagram of the structure of plasmid pKG-U6 gRNA.

FIG. 4 is a schematic representation of the insertion of a DNA molecule of about 20bp (target sequence binding region for transcription to form gRNA) into plasmid pKG-U6 gRNA.

FIG. 5 is an electrophoretogram of example 2 after PCR amplification using genomic DNA as a template and primer sets composed of MSTN-F896 and MSTN-R1351.

FIG. 6 is an electrophoretogram of three groups of MSTN in step three of example 2.

FIG. 7 is an electrophoretogram of three sets of FNDC5 in step three of example 2.

FIG. 8 is an electrophoretogram of example 3 after PCR amplification using 8 pig genomic DNA as a template and a primer set of DMD-E46-F1/DMD-E46-R796.

FIG. 9 shows various double-stranded DNA molecules having cohesive ends in step three of example 3.

FIG. 10 is an electrophoretogram of example 3 after PCR amplification using the primer set consisting of DMD-E46-F1 and DMD-E46-R796 using genomic DNA as a template.

FIG. 11 is an electrophoresis chart of target gene PCR products of monoclonal cells obtained in example 4 (using a primer set composed of DMD-E46-F1 and DMD-E46-R796).

FIG. 12 is a diagram showing the sequencing peaks of the target gene of DMD-4.

Detailed Description

The following detailed description of the application is provided in connection with the accompanying drawings that are presented to illustrate the application and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the application in any way.

The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified. Unless otherwise indicated, the quantitative tests in the examples below were all performed in triplicate, and the results averaged. Complete culture solution (% by volume): 15% fetal bovine serum (Gibco) +83% DMEM medium (Gibco) +1% Penicillin-Streptomycin (Gibco) +1% HEPES (Solarbio). Cell culture conditions: 37 ℃,5% CO ₂ 、5％O ₂ Is a constant temperature incubator.

The 8 pigs in the examples are all from the river of birth, wherein 4 females (named 1, 2, 3, 4 respectively) and 4 males (named A, B, C, D respectively) are female.

A method of preparing porcine primary fibroblasts: (1) taking 0.5g of pig ear tissue, removing hair, soaking in 75% alcohol for 30-40s, washing with PBS buffer solution containing 5% (volume ratio) Penicillin-Streptomycin (Gibco) for 5 times, and washing with PBS buffer solution for one time; (2) shearing the tissue with scissors, digesting with 5mL 1% collagenase solution (Sigma) at 37deg.C for 1h, centrifuging 500g for 5min, and discarding the supernatant; (3) the pellet was resuspended in 1mL of complete medium, then plated into a 9cm diameter cell culture dish containing 10mL of complete medium and capped with 0.2% gelatin (VWR), and cultured until the cells grew to about 60% of the bottom of the dish; (4) after step (3) is completed, cells are digested with trypsin and collected, and frozen using cell frozen stock (90% complete medium+10% dmso, volume ratio).

The porcine primary fibroblasts used in examples 2 to 4 were obtained from the above-described swine designated 2 (female, blood group AO).

Example 1 preparation of plasmids

Preparing a plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9, as shown in SEQ ID NO: 1. Plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9, abbreviated as plasmid pX330.

Preparing a plasmid pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO, and performing the following steps: 2. Plasmid pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO, abbreviated as plasmid pKG-GE3.

Plasmid pKG-U6gRNA was prepared as shown in SEQ ID NO: 3.

Plasmid pX330, plasmid pKG-GE3, plasmid pKG-U6gRNA are all circular plasmids.

The schematic structure of plasmid pX330 is shown in fig. 1.SEQ ID NO:1, nucleotides 440-725 constitute the CMV enhancer, nucleotides 727-1208 constitute the chicken β -actin promoter, nucleotides 1304-1324 encode the SV40 Nuclear Localization Signal (NLS), nucleotides 1325-5449 encode the Cas9 protein, and nucleotides 5450-5497 encode the nucleoplasin Nuclear Localization Signal (NLS).

The schematic structure of plasmid pKG-GE3 is shown in FIG. 2.SEQ ID NO:2, nucleotides 395 to 680 comprising the CMV enhancer, nucleotides 682 to 890 comprising the EF1a promoter, nucleotides 986 to 1006 comprising the Nuclear Localization Signal (NLS), nucleotides 1016 to 1036 comprising the Nuclear Localization Signal (NLS), nucleotides 1037 to 5161 comprising the Cas9 protein, nucleotides 5162 to 5209 comprising the Nuclear Localization Signal (NLS), nucleotides 5219 to 5266 comprising the Nuclear Localization Signal (NLS), nucleotides 5276 to 5332 comprising the self-cleaving polypeptide P2A (the amino acid sequence of the self-cleaving polypeptide P2A is "ATNFSLLKQAGDVEENPGP", the cleavage site for the self-cleaving is between the first amino acid residue and the second amino acid residue from the C-terminus), nucleotide numbers 5333-6046 encode EGFP protein, nucleotide numbers 6056-6109 encode self-cleaving polypeptide T2A (the amino acid sequence of self-cleaving polypeptide T2A is EGRGSLLTCGDVEENPGP, the cleavage site where self-cleavage occurs is between the first amino acid residue and the second amino acid residue from the C-terminus), nucleotide numbers 6110-6703 encode Puromycin protein (called Puro protein for short), nucleotide numbers 6722-7310 constitute WPRE sequence element, nucleotide numbers 7382-7615 constitute 3' LTR sequence element, and nucleotide numbers 7647-7871 constitute bGH poly (A) signal sequence element. SEQ ID NO:2, 911-6706 form a fusion gene, expressing a fusion protein. Due to the presence of self-cleaving polypeptide P2A and self-cleaving polypeptide T2A, the fusion protein spontaneously forms three proteins: proteins with Cas9 protein, proteins with EGFP protein, and proteins with Puro protein.

Compared with plasmid pX330, plasmid pKG-GE3 was mainly modified as follows: (1) removing residual gRNA backbone sequences (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTTT), reducing interference; (2) the original chicken beta-actin promoter is modified into an EF1a promoter with higher expression activity, so that the protein expression capacity of the Cas9 gene is increased; (3) adding nuclear localization signal coding genes (NLS) at the upstream and downstream of the Cas9 gene, and increasing the nuclear localization capability of the Cas9 protein; (4) the original plasmid has no eukaryotic cell screening mark, is not beneficial to screening and enrichment of positive transformed cells, and is sequentially inserted with P2A-EGFP-T2A-PURO coding genes at the downstream of Cas9 genes, so that the carrier fluorescence and eukaryotic cell resistance screening capability are endowed; (5) the insertion of the WPRE element and the 3' ltr sequence element enhances the protein translation capacity of the Cas9 gene.

The schematic structure of plasmid pKG-U6gRNA is shown in FIG. 3.SEQ ID NO:3, nucleotides 2280 to 2539 constitute the hU6 promoter and nucleotides 2558 to 2637 are used for transcription to form the gRNA backbone. When in use, a DNA molecule (target sequence binding region for transcription to form gRNA) of about 20bp is inserted into plasmid pKG-U6gRNA to form a recombinant plasmid, the schematic diagram is shown in FIG. 4, and the recombinant plasmid is transcribed in cells to obtain gRNA.

Example 2, plasmid proportion optimization, comparison of the Effect of plasmid pX330 and plasmid pKG-GE3

Two gRNA targets located at the MSTN gene were selected:

target of MSTN-gRNA 1: 5'-GCTGATTGTTGCTGGTCCCG-3';

target of MSTN-gRNA 2: 5'-TTTCCAGGCGAAGTTTACTG-3'.

Two gRNA targets located at the FNDC5 gene were selected:

target for FNDC5-gRNA 1: 5'-TGTACTCAGTGTCCTCCTCC-3';

target for FNDC5-gRNA 2: 5'-GCTCTTCAAGACGCCTCGCG-3'.

Primers used to amplify fragments containing the target were:

MSTN-F896：5’-TCTCTCAGACAGTGCAGGCATTA-3’；

MSTN-R1351：5’-CGTTTCCGTCGTAGCGTGATAAT-3’。

FNDC5-F209：5’-CAGTTCTCACTTGATGGCCTTGG-3’；

FNDC5-R718：5’-AGGGGTCTGGGGAGGAATGG-3’。

1. preparation of recombinant plasmids

Plasmid pKG-U6gRNA was taken and digested with restriction enzyme BbsI, and the vector backbone (about 3kb linear fragment) was recovered.

MSTN-1S and MSTN-1A were synthesized separately, and then mixed and annealed to obtain double-stranded DNA molecules having cohesive ends. The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (MSTN-1).

MSTN-2S and MSTN-2A were synthesized separately, and then mixed and annealed to obtain double-stranded DNA molecules having cohesive ends. The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (MSTN-2).

FNDC5-1S and FNDC5-1A were synthesized separately, and then mixed and annealed to obtain double-stranded DNA molecules having cohesive ends. The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (FNDC 5-1).

FNDC5-2S and FNDC5-2A were synthesized separately, and then mixed and annealed to obtain double-stranded DNA molecules having cohesive ends. The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (FNDC 5-2).

MSTN-1S：5’-caccGCTGATTGTTGCTGGTCCCG-3’；

MSTN-1A：5’-aaacCGGGACCAGCAACAATCAGC-3’。

MSTN-2S：5’-caccgTTTCCAGGCGAAGTTTACTG-3’；

MSTN-2A：5’-aaacCAGTAAACTTCGCCTGGAAAc-3’。

FNDC5-1S：5’-caccgTGTACTCAGTGTCCTCCTCC-3’；

FNDC5-1A：5’-aaacGGAGGAGGACACTGAGTACAc-3’。

FNDC5-2S：5’-caccGCTCTTCAAGACGCCTCGCG-3’；

FNDC5-2A：5’-aaacCGCGAGGCGTCTTGAAGAGC-3’。

2. Plasmid proportioning optimization

A first group: the plasmid pKG-U6gRNA (MSTN-1), plasmid pKG-U6gRNA (MSTN-2) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.22. Mu.g plasmid pKG-U6gRNA (MSTN-1): 0.22. Mu.g plasmid pKG-U6gRNA (MSTN-2): 1.56. Mu.g of plasmid pKG-GE3. Namely, the molar ratio of the plasmid pKG-U6gRNA (MSTN-1), the plasmid pKG-U6gRNA (MSTN-2) and the plasmid pKG-GE3 is as follows: 0.5:0.5:1.

second group: the plasmid pKG-U6gRNA (MSTN-1), plasmid pKG-U6gRNA (MSTN-2) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.36. Mu.g of plasmid pKG-U6gRNA (MSTN-1): 0.36. Mu.g of plasmid pKG-U6gRNA (MSTN-2): 1.27. Mu.g of plasmid pKG-GE3. Namely, the molar ratio of the plasmid pKG-U6gRNA (MSTN-1), the plasmid pKG-U6gRNA (MSTN-2) and the plasmid pKG-GE3 is as follows: 1:1:1.

third group: the plasmid pKG-U6gRNA (MSTN-1), plasmid pKG-U6gRNA (MSTN-2) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.46. Mu.g of plasmid pKG-U6gRNA (MSTN-1): 0.46. Mu.g of plasmid pKG-U6gRNA (MSTN-2): 1.08 μg of plasmid pKG-GE3. Namely, the molar ratio of plasmid pKG-U6gRNA (MSTN-1), plasmid pKG-U6gRNA (MSTN-2) and plasmid pKG-GE3 is 1.5 in sequence: 1.5:1.

fourth group: the plasmid pKG-U6gRNA (MSTN-1), plasmid pKG-U6gRNA (MSTN-2) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.53 μg plasmid pKG-U6gRNA (MSTN-1): 0.53 μg plasmid pKG-U6gRNA (MSTN-2): 0.93 μg of plasmid pKG-GE3. Namely, the molar ratio of the plasmid pKG-U6gRNA (MSTN-1), the plasmid pKG-U6gRNA (MSTN-2) and the plasmid pKG-GE3 is as follows: 2:2:1.

fifth group: plasmid pKG-U6gRNA (MSTN-1) and plasmid pKG-U6gRNA (MSTN-2) were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 1 μg plasmid pKG-U6gRNA (MSTN-1): mu.g of plasmid pKG-U6gRNA (MSTN-2).

Co-transfection was performed by electric shock transfection using a mammalian nuclear transfection kit (Neon kit, thermofiser) and a Neon TM transfection system electrotransfection apparatus (parameters set to 1450V, 10ms, 3 pulses).

2. After the step 1 is completed, the culture is carried out for 16 to 18 hours by adopting the complete culture solution, and then the culture is carried out by replacing the new complete culture solution. The total incubation time was 48 hours.

3. After step 2 is completed, cells are digested and collected by trypsin, genomic DNA is extracted, PCR amplification is performed by using a primer pair consisting of MSTN-F896 and MSTN-R1351, and then electrophoresis is performed.

The result of electrophoresis is shown in FIG. 5. The 456bp band is a wild-type band (WT), and the 329bp band (the 127bp theoretical deletion of the 456bp band) is a deletion mutant band (MT).

Gene deletion mutation efficiency = (MT gray scale/MT band bp number)/(WT gray scale/WT band bp number + MT gray scale/MT band bp number) ×100%. The first group of genes had 28.6% deletion mutation efficiency, the second group of genes had 77.8% deletion mutation efficiency, the third group of genes had 86.8% deletion mutation efficiency, and the fourth group of genes had 81.5% deletion mutation efficiency. The gene editing efficiency of the third group is highest, and the optimal amount of the two gRNA plasmids and the Cas9 plasmid is determined to be 1.5:1.5:1, the actual amount of plasmid was 0.46. Mu.g: 0.46 μg:1.08 μg.

3. Comparison of the effects of plasmid pX330 and plasmid pKG-GE3

1. Co-transfection

MSTN-B group: plasmid pKG-U6gRNA (MSTN-1) and plasmid pKG-U6gRNA (MSTN-2) were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.46. Mu.g of plasmid pKG-U6gRNA (MSTN-1): 0.46. Mu.g of plasmid pKG-U6gRNA (MSTN-2).

MSTN-330 group: plasmid pKG-U6gRNA (MSTN-1), plasmid pKG-U6gRNA (MSTN-2) and plasmid pX330 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.46. Mu.g of plasmid pKG-U6gRNA (MSTN-1): 0.46. Mu.g of plasmid pKG-U6gRNA (MSTN-2): 1.08 μg of plasmid pX330.

MSTN-KG group: the plasmid pKG-U6gRNA (MSTN-1), plasmid pKG-U6gRNA (MSTN-2) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.46. Mu.g of plasmid pKG-U6gRNA (MSTN-1): plasmid 0.46. Mu.g pKG-U6gRNA (MSTN-2): 1.08 μg of plasmid pKG-GE3.

FNDC5-B group: the plasmid pKG-U6gRNA (FNDC 5-1) and the plasmid pKG-U6gRNA (FNDC 5-2) were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.46. Mu.g of plasmid pKG-U6gRNA (FNDC 5-1): 0.46. Mu.g of plasmid pKG-U6gRNA (FNDC 5-2).

FNDC5-330 group: the plasmid pKG-U6gRNA (FNDC 5-1), plasmid pKG-U6gRNA (FNDC 5-2) and plasmid pX330 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.46. Mu.g of plasmid pKG-U6gRNA (FNDC 5-1): 0.46. Mu.g of plasmid pKG-U6gRNA (FNDC 5-2): 1.08 μg of plasmid pX330.

FNDC5-KG group: the plasmid pKG-U6gRNA (FNDC 5-1), plasmid pKG-U6gRNA (FNDC 5-2) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.46. Mu.g of plasmid pKG-U6gRNA (FNDC 5-1): 0.46. Mu.g of plasmid pKG-U6gRNA (FNDC 5-2): 1.08 μg of plasmid pKG-GE3.

3. After step 2 was completed, cells were digested with trypsin and collected, genomic DNA was extracted, PCR amplification was performed using a primer pair (three sets of MSTN) composed of MSTN-F896 and MSTN-R1351, or PCR amplification was performed using a primer pair (three sets of FNDC 5) composed of FNDC5-F209 and FNDC5-R718, followed by electrophoresis.

The results of three groups of MSTNs are shown in FIG. 6.

The results of three groups of FNDC5 are shown in FIG. 7.

The deletion mutation efficiency of the MSTN-330 group gene is 27.6%, and the deletion mutation efficiency of the MSTN-KG group gene is 86.5%. The deletion mutation efficiency of the gene of the FNDC5-330 group is 18.6%, and the deletion mutation efficiency of the gene of the FNDC5-KG group is 81.7%. The results show that the use of plasmid pKG-GE3 results in a significant increase in gene editing efficiency compared to the use of plasmid pX330.

Example 3 screening of target combinations for DMD Gene knockout

1. DMD gene knockout preset target spot and adjacent genome sequence conservation analysis

Porcine DMD gene information: coding dystraphin; located on the X chromosome; geneID 1756, sus scrofa. The protein coded by the pig DMD gene is shown as SEQ ID NO: 4. In the genome DNA, the pig DMD gene has 89 exons, wherein the 46 th exon and 500bp sequences respectively at the upstream and downstream thereof are shown in SEQ ID NO: shown at 5.

The genomic DNA of 8 pigs was used as a template, and PCR amplification was performed using a primer pair (the target sequence of the primer pair includes exon 46 of the pig DMD gene), followed by electrophoresis. And (3) recovering PCR amplification products, sequencing, and comparing the sequencing results with DMD gene sequences in a public database for analysis. Based on the results of the alignment, primers for detecting the mutation (the primers themselves avoid possible mutation sites) were designed. The primers designed for mutation detection were: DMD-E46-F1/DMD-E46-R796. The electrophoresis chart of 8 pigs after PCR amplification of genomic DNA using the primer pair consisting of DMD-E46-F1/DMD-E46-R796 is shown in FIG. 8.

DMD-E46-F1：5’-GAATGCCAGGGATACCATTCAAC-3’；

DMD-E46-R796：5’-GCAATAATTTGGAGCTGTGG-3’。

2. Screening target

Several targets were initially screened by screening NGG (avoiding possible mutation sites), from which 6 targets were further screened by pre-experiments.

The 6 targets were as follows:

sgRNA _DMD-Ug1 target point: 5'-TATTTCATTCTTCTATCTCC-3';

sgRNA _DMD-Ug2 target point: 5'-TAAAACATGGTAACGATATA-3';

sgRNA _DMD-Ug3 target point: 5'-AAAATAAGCAATATAAAACA-3';

sgRNA _DMD-Dg1 target point: 5'-TCTTTATACAAGTAGGCCCT-3';

sgRNA _DMD-Dg2 target point: 5'-CTCTTTATACAAGTAGGCCC-3';

sgRNA _DMD-Dg3 target point: 5'-CATATACTCTTTATACAAGT-3'.

The combination of each target and the resulting theoretical absence are shown in Table 1.

Table 1 target combinations and resulting theoretical deletions

5' terminal target sequence

Direction

Numbering device

3' terminal target sequence

Direction

Numbering device

Deletion length bp

TATTTCATTCTTCTATCTCC

+

Ug1

TCTTTATACAAGTAGGCCCT

-

Dg1

181

TATTTCATTCTTCTATCTCC

+

Ug1

CTCTTTATACAAGTAGGCCC

-

Dg2

182

TATTTCATTCTTCTATCTCC

+

Ug1

CATATACTCTTTATACAAGT

-

Dg3

188

TAAAACATGGTAACGATATA

-

Ug2

TCTTTATACAAGTAGGCCCT

-

Dg1

297

TAAAACATGGTAACGATATA

-

Ug2

CTCTTTATACAAGTAGGCCC

-

Dg2

298

TAAAACATGGTAACGATATA

-

Ug2

CATATACTCTTTATACAAGT

-

Dg3

304

AAAATAAGCAATATAAAACA

-

Ug3

TCTTTATACAAGTAGGCCCT

-

Dg1

284

AAAATAAGCAATATAAAACA

-

Ug3

CTCTTTATACAAGTAGGCCC

-

Dg2

285

AAAATAAGCAATATAAAACA

-

Ug3

CATATACTCTTTATACAAGT

-

Dg3

291

3. Preparation of recombinant plasmids

DMD-Ug1S and DMD-Ug1A were synthesized separately, and then mixed and annealed to give double-stranded DNA molecules having cohesive ends (FIG. 9A). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (DMD-Ug 1). Plasmid pKG-U6gRNA (DMD-Ug 1) expresses the sequence of SEQ ID NO: 6. SgRNA as shown in FIG. 6 _DMD-Ug1 。

SEQ ID NO：6：

UAUUUCAUUCUUCUAUCUCCguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

DMD-Ug2S and DMD-Ug2A were synthesized separately, and then mixed and annealed to give double-stranded DNA molecules having cohesive ends (FIG. 9B). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (DMD-Ug 2). Plasmid pKG-U6gRNA (DMD-Ug 2) expresses the sequence of SEQ ID NO: 7. SgRNA _DMD-Ug2 。

SEQ ID NO：7：

UAAAACAUGGUAACGAUAUAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

DMD-Ug3S and DMD-Ug3A were synthesized separately, and then mixed and annealed to give double-stranded DNA molecules having cohesive ends (FIG. 9C). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (DMD-Ug 3). Plasmid pKG-U6gRNA (DMD-Ug 3) expresses the sequence of SEQ ID NO:8, sgRNA shown in FIG. 8 _DMD-Ug3 。

SEQ ID NO：8：

AAAAUAAGCAAUAUAAAACAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

Synthesis of DMD-Dg1S and respectivelyDMD-Dg1A, followed by mixing and annealing, gives a double-stranded DNA molecule with cohesive ends (FIG. 9D). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (DMD-Dg 1). Plasmid pKG-U6gRNA (DMD-Dg 1) expresses the sequence of SEQ ID NO: 9. SgRNA as shown in FIG. 9 _DMD-Dg1 。

SEQ ID NO：9：

UCUUUAUACAAGUAGGCCCUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

DMD-Dg2S and DMD-Dg2A were synthesized separately, and then mixed and annealed to obtain double-stranded DNA molecules having cohesive ends (FIG. 9E). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (DMD-Dg 2). Plasmid pKG-U6gRNA (DMD-Dg 2) expresses the sequence of SEQ ID NO:10, sgRNA shown in FIG. 10 _DMD-Dg2 。

SEQ ID NO：10：

CUCUUUAUACAAGUAGGCCCguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

DMD-Dg3S and DMD-Dg3A were synthesized separately, and then mixed and annealed to obtain double-stranded DNA molecules having cohesive ends (FIG. 9F). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (DMD-Dg 3). Plasmid pKG-U6gRNA (DMD-Dg 3) expresses the sequence of SEQ ID NO:11, sgRNA shown in FIG. 11 _DMD-Dg3 。

SEQ ID NO：11：

CAUAUACUCUUUAUACAAGUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

DMD-Ug1S：5’-caccgTATTTCATTCTTCTATCTCC-3’；

DMD-Ug1A：5’-aaacGGAGATAGAAGAATGAAATAc-3’。

DMD-Ug2S：5’-caccgTAAAACATGGTAACGATATA-3’；

DMD-Ug2A：5’-aaacTATATCGTTACCATGTTTTAc-3’。

DMD-Ug3S：5’-caccgAAAATAAGCAATATAAAACA-3’；

DMD-Ug3A：5’-aaacTGTTTTATATTGCTTATTTTc-3’。

DMD-Dg1S：5’-caccgTCTTTATACAAGTAGGCCCT-3’；

DMD-Dg1A：5’-aaacAGGGCCTACTTGTATAAAGAc-3’。

DMD-Dg2S：5’-caccgCTCTTTATACAAGTAGGCCC-3’；

DMD-Dg2A：5’-aaacGGGCCTACTTGTATAAAGAGc-3’。

DMD-Dg3S：5’-caccgCATATACTCTTTATACAAGT-3’；

DMD-Dg3A：5’-aaacACTTGTATAAAGAGTATATGc-3’。

DMD-Ug1S, DMD-Ug1A, DMD-Ug2S, DMD-Ug2A, DMD-Ug3S, DMD-Ug3A, DMD-Dg1S, DMD-Dg1A, DMD-Dg2S, DMD-Dg2A, DMD-Dg3S, DMD-Dg3A are single stranded DNA molecules.

4. Editing efficiency comparison of different target combinations

1. Co-transfection

Group 1: the plasmid pKG-U6gRNA (DMD-Ug 1), plasmid pKG-U6gRNA (DMD-Dg 1) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.46. Mu.g plasmid pKG-U6gRNA (DMD-Ug 1): 0.46. Mu.g plasmid pKG-U6gRNA (DMD-Dg 1): 1.08 μg of plasmid pKG-GE3.

Group 2: plasmid pKG-U6gRNA (DMD-Ug 1), plasmid pKG-U6gRNA (DMD-Dg 2) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.46. Mu.g plasmid pKG-U6gRNA (DMD-Ug 1): 0.46. Mu.g plasmid pKG-U6gRNA (DMD-Dg 2): 1.08 μg of plasmid pKG-GE3.

Group 3: plasmid pKG-U6gRNA (DMD-Ug 1), plasmid pKG-U6gRNA (DMD-Dg 3) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.46. Mu.g plasmid pKG-U6gRNA (DMD-Ug 1): 0.46. Mu.g plasmid pKG-U6gRNA (DMD-Dg 3): 1.08 μg of plasmid pKG-GE3.

Group 4: plasmid pKG-U6gRNA (DMD-Ug 2), plasmid pKG-U6gRNA (DMD-Dg 1) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.46. Mu.g plasmid pKG-U6gRNA (DMD-Ug 2): 0.46. Mu.g plasmid pKG-U6gRNA (DMD-Dg 1): 1.08 μg of plasmid pKG-GE3.

Group 5: plasmid pKG-U6gRNA (DMD-Ug 2), plasmid pKG-U6gRNA (DMD-Dg 2) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.46. Mu.g plasmid pKG-U6gRNA (DMD-Ug 2): 0.46. Mu.g plasmid pKG-U6gRNA (DMD-Dg 2): 1.08 μg of plasmid pKG-GE3.

Group 6: plasmid pKG-U6gRNA (DMD-Ug 2), plasmid pKG-U6gRNA (DMD-Dg 3) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.46. Mu.g plasmid pKG-U6gRNA (DMD-Ug 2): 0.46. Mu.g plasmid pKG-U6gRNA (DMD-Dg 3): 1.08 μg of plasmid pKG-GE3.

Group 7: plasmid pKG-U6gRNA (DMD-Ug 3), plasmid pKG-U6gRNA (DMD-Dg 1) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.46. Mu.g plasmid pKG-U6gRNA (DMD-Ug 3): 0.46. Mu.g plasmid pKG-U6gRNA (DMD-Dg 1): 1.08 μg of plasmid pKG-GE3.

Group 8: plasmid pKG-U6gRNA (DMD-Ug 3), plasmid pKG-U6gRNA (DMD-Dg 2) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.46. Mu.g plasmid pKG-U6gRNA (DMD-Ug 3): 0.46. Mu.g plasmid pKG-U6gRNA (DMD-Dg 2): 1.08 μg of plasmid pKG-GE3.

Group 9: plasmid pKG-U6gRNA (DMD-Ug 3), plasmid pKG-U6gRNA (DMD-Dg 3) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.46. Mu.g plasmid pKG-U6gRNA (DMD-Ug 3): 0.46. Mu.g plasmid pKG-U6gRNA (DMD-Dg 3): 1.08 μg of plasmid pKG-GE3.

Group 10: pig primary fibroblasts were not subjected to any transfection procedure.

3. After step 2 is completed, cells are digested and collected by trypsin, genomic DNA is extracted, PCR amplification is performed by using a primer pair consisting of DMD-E46-F1 and DMD-E46-R796, and then electrophoresis is performed. The results are shown in FIG. 10. The larger band is the wild-type band (WT), the smaller band is the mutant band (MT), and the brighter the mutant band is relative to the wild-type band, the higher the mutation efficiency.

The gene deletion mutation efficiency= (MT gray/MT band bp number)/(WT gray/WT band bp number+mt gray/MT band bp number) ×100% was shown in table 2.

TABLE 2

The deletion mutation efficiency of group 10 genes was 0%.

The results show that group 9 has the best effect, sgRNA _DMD-Ug3 And sgRNA _DMD-Dg3 Is the optimal combination.

EXAMPLE 4 preparation of DMD Gene-editing monoclonal cells

1. Co-transfection

Plasmid pKG-U6gRNA (DMD-Ug 3), plasmid pKG-U6gRNA (DMD-Dg 3) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.46. Mu.g plasmid pKG-U6gRNA (DMD-Ug 3): 0.46. Mu.g plasmid pKG-U6gRNA (DMD-Dg 3): 1.08 μg of plasmid pKG-GE3.

3. After completion of step 2, the cells were digested with trypsin and collected, then washed with complete medium, then resuspended with complete medium, and then each individual monoclonal was individually picked and transferred to 96-well plates (1 cell per well, 200. Mu.l of complete medium per well) and cultured for 2 weeks (new complete medium was changed every 2-3 days).

4. After completion of step 3, cells were digested with trypsin and collected (about 2/3 of the resulting cells per well were inoculated into 6-well plates filled with complete culture medium, and the remaining 1/3 were collected in 1.5mL centrifuge tubes).

5. Taking the 6-hole plate in the step 4, culturing until the cells grow to 50% plumpness, digesting and collecting the cells by trypsin, and freezing the cells by using cell freezing solution (90% complete culture medium+10% DMSO, volume ratio).

6. Taking the centrifuge tube in the step 4, taking cells, extracting genome DNA, performing PCR amplification by adopting a primer pair consisting of DMD-E46-F1 and DMD-E46-R796, and then performing electrophoresis. Porcine primary fibroblasts were used as wild-type controls.

The electrophoretogram of the resulting cells is shown in FIG. 11, with lane numbers consistent with the numbers of the monoclonal cells.

7. After step 6 is completed, the PCR amplification product is recovered and sequenced.

The sequencing result of the primary fibroblast of the pig is only one, and the genotype of the primary fibroblast is homozygous wild type. If there are two kinds of sequencing results of a certain monoclonal cell, one kind is consistent with the sequencing result of the primary fibroblast of the pig, the other kind is mutated (mutation comprises deletion, insertion or substitution of one or more nucleotides) compared with the sequencing result of the primary fibroblast of the pig, the genotype of the monoclonal cell is heterozygous; if the sequencing result of a certain monoclonal cell is two, compared with the sequencing result of a primary fibroblast of a pig, the mutation (the mutation comprises deletion, insertion or replacement of one or more nucleotides) is generated, and the genotype of the monoclonal cell is a double-allele different mutant type; if the sequencing result of a monoclonal cell is one and a mutation (mutation includes deletion, insertion or substitution of one or more nucleotides) is generated compared with the sequencing result of a swine primary fibroblast, the genotype of the monoclonal cell is the same mutant type of the double allele; if the sequencing result of a certain monoclonal cell is one and is consistent with the sequencing result of a primary fibroblast of a pig, the genotype of the monoclonal cell is homozygous wild type.

The results are shown in Table 3. The genotypes of the monoclonal cells numbered 3, 6, 9, 15, 19, 26, 29, 30, 33 are identical mutants of the double alleles. The genotypes of the monoclonal cells numbered 5, 11, 17, 32, 37 are the different mutants of the bi-allele. The genotypes of the monoclonal cells numbered 4, 8, 10, 12, 18, 22, 27, 28, 35, 36, 38, 39 are heterozygous. The ratio of DMD gene editing monoclonal cells was 26/40. Exemplary, the target gene sequencing peak pattern of DMD-4 is shown in FIG. 12, the upper pattern is the target gene sequencing peak pattern of DMD-4, and the lower pattern is the target gene sequencing peak pattern of the wild-type control.

TABLE 3 Table 3

/>

The present application is described in detail above. It will be apparent to those skilled in the art that the present application can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the application and without undue experimentation. While the application has been described with respect to specific embodiments, it will be appreciated that the application may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the application following, in general, the principles of the application and including such departures from the present disclosure as come within known or customary practice within the art to which the application pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.

SEQUENCE LISTING

<110> Nanjing Kidney Gene engineering Co., ltd

<120> CRISPR/Cas9 system and application thereof in construction of dystrophin gene-deficient porcine recombinant cells

<130> GNCYX201920

<160> 11

<170> PatentIn version 3.5

<210> 1

<211> 8484

<212> DNA

<213> Artificial sequence

<400> 1

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaaataag 300

gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttg ttttagagct 360

agaaatagca agttaaaata aggctagtcc gtttttagcg cgtgcgccaa ttctgcagac 420

aaatggctct agaggtaccc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 480

ccaacgaccc ccgcccattg acgtcaatag taacgccaat agggactttc cattgacgtc 540

aatgggtgga gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc 600

caagtacgcc ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tgtgcccagt 660

acatgacctt atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta 720

ccatggtcga ggtgagcccc acgttctgct tcactctccc catctccccc ccctccccac 780

ccccaatttt gtatttattt attttttaat tattttgtgc agcgatgggg gcgggggggg 840

ggggggggcg gggcgagggg cggggcgggg cgaggcggag aggtgcggcg gcagccaatc 900

agagcggcgc gctccgaaag tttcctttta tggcgaggcg gcggcggcgg cggccctata 960

aaaagcgaag cgcgcggcgg gcgggagtcg ctgcgcgctg ccttcgcccc gtgccccgct 1020

ccgccgccgc ctcgcgccgc ccgccccggc tctgactgac cgcgttactc ccacaggtga 1080

gcgggcggga cggcccttct cctccgggct gtaattagct gagcaagagg taagggttta 1140

agggatggtt ggttggtggg gtattaatgt ttaattacct ggagcacctg cctgaaatca 1200

ctttttttca ggttggaccg gtgccaccat ggactataag gaccacgacg gagactacaa 1260

ggatcatgat attgattaca aagacgatga cgataagatg gccccaaaga agaagcggaa 1320

ggtcggtatc cacggagtcc cagcagccga caagaagtac agcatcggcc tggacatcgg 1380

caccaactct gtgggctggg ccgtgatcac cgacgagtac aaggtgccca gcaagaaatt 1440

caaggtgctg ggcaacaccg accggcacag catcaagaag aacctgatcg gagccctgct 1500

gttcgacagc ggcgaaacag ccgaggccac ccggctgaag agaaccgcca gaagaagata 1560

caccagacgg aagaaccgga tctgctatct gcaagagatc ttcagcaacg agatggccaa 1620

ggtggacgac agcttcttcc acagactgga agagtccttc ctggtggaag aggataagaa 1680

gcacgagcgg caccccatct tcggcaacat cgtggacgag gtggcctacc acgagaagta 1740

ccccaccatc taccacctga gaaagaaact ggtggacagc accgacaagg ccgacctgcg 1800

gctgatctat ctggccctgg cccacatgat caagttccgg ggccacttcc tgatcgaggg 1860

cgacctgaac cccgacaaca gcgacgtgga caagctgttc atccagctgg tgcagaccta 1920

caaccagctg ttcgaggaaa accccatcaa cgccagcggc gtggacgcca aggccatcct 1980

gtctgccaga ctgagcaaga gcagacggct ggaaaatctg atcgcccagc tgcccggcga 2040

gaagaagaat ggcctgttcg gaaacctgat tgccctgagc ctgggcctga cccccaactt 2100

caagagcaac ttcgacctgg ccgaggatgc caaactgcag ctgagcaagg acacctacga 2160

cgacgacctg gacaacctgc tggcccagat cggcgaccag tacgccgacc tgtttctggc 2220

cgccaagaac ctgtccgacg ccatcctgct gagcgacatc ctgagagtga acaccgagat 2280

caccaaggcc cccctgagcg cctctatgat caagagatac gacgagcacc accaggacct 2340

gaccctgctg aaagctctcg tgcggcagca gctgcctgag aagtacaaag agattttctt 2400

cgaccagagc aagaacggct acgccggcta cattgacggc ggagccagcc aggaagagtt 2460

ctacaagttc atcaagccca tcctggaaaa gatggacggc accgaggaac tgctcgtgaa 2520

gctgaacaga gaggacctgc tgcggaagca gcggaccttc gacaacggca gcatccccca 2580

ccagatccac ctgggagagc tgcacgccat tctgcggcgg caggaagatt tttacccatt 2640

cctgaaggac aaccgggaaa agatcgagaa gatcctgacc ttccgcatcc cctactacgt 2700

gggccctctg gccaggggaa acagcagatt cgcctggatg accagaaaga gcgaggaaac 2760

catcaccccc tggaacttcg aggaagtggt ggacaagggc gcttccgccc agagcttcat 2820

cgagcggatg accaacttcg ataagaacct gcccaacgag aaggtgctgc ccaagcacag 2880

cctgctgtac gagtacttca ccgtgtataa cgagctgacc aaagtgaaat acgtgaccga 2940

gggaatgaga aagcccgcct tcctgagcgg cgagcagaaa aaggccatcg tggacctgct 3000

gttcaagacc aaccggaaag tgaccgtgaa gcagctgaaa gaggactact tcaagaaaat 3060

cgagtgcttc gactccgtgg aaatctccgg cgtggaagat cggttcaacg cctccctggg 3120

cacataccac gatctgctga aaattatcaa ggacaaggac ttcctggaca atgaggaaaa 3180

cgaggacatt ctggaagata tcgtgctgac cctgacactg tttgaggaca gagagatgat 3240

cgaggaacgg ctgaaaacct atgcccacct gttcgacgac aaagtgatga agcagctgaa 3300

gcggcggaga tacaccggct ggggcaggct gagccggaag ctgatcaacg gcatccggga 3360

caagcagtcc ggcaagacaa tcctggattt cctgaagtcc gacggcttcg ccaacagaaa 3420

cttcatgcag ctgatccacg acgacagcct gacctttaaa gaggacatcc agaaagccca 3480

ggtgtccggc cagggcgata gcctgcacga gcacattgcc aatctggccg gcagccccgc 3540

cattaagaag ggcatcctgc agacagtgaa ggtggtggac gagctcgtga aagtgatggg 3600

ccggcacaag cccgagaaca tcgtgatcga aatggccaga gagaaccaga ccacccagaa 3660

gggacagaag aacagccgcg agagaatgaa gcggatcgaa gagggcatca aagagctggg 3720

cagccagatc ctgaaagaac accccgtgga aaacacccag ctgcagaacg agaagctgta 3780

cctgtactac ctgcagaatg ggcgggatat gtacgtggac caggaactgg acatcaaccg 3840

gctgtccgac tacgatgtgg accatatcgt gcctcagagc tttctgaagg acgactccat 3900

cgacaacaag gtgctgacca gaagcgacaa gaaccggggc aagagcgaca acgtgccctc 3960

cgaagaggtc gtgaagaaga tgaagaacta ctggcggcag ctgctgaacg ccaagctgat 4020

tacccagaga aagttcgaca atctgaccaa ggccgagaga ggcggcctga gcgaactgga 4080

taaggccggc ttcatcaaga gacagctggt ggaaacccgg cagatcacaa agcacgtggc 4140

acagatcctg gactcccgga tgaacactaa gtacgacgag aatgacaagc tgatccggga 4200

agtgaaagtg atcaccctga agtccaagct ggtgtccgat ttccggaagg atttccagtt 4260

ttacaaagtg cgcgagatca acaactacca ccacgcccac gacgcctacc tgaacgccgt 4320

cgtgggaacc gccctgatca aaaagtaccc taagctggaa agcgagttcg tgtacggcga 4380

ctacaaggtg tacgacgtgc ggaagatgat cgccaagagc gagcaggaaa tcggcaaggc 4440

taccgccaag tacttcttct acagcaacat catgaacttt ttcaagaccg agattaccct 4500

ggccaacggc gagatccgga agcggcctct gatcgagaca aacggcgaaa ccggggagat 4560

cgtgtgggat aagggccggg attttgccac cgtgcggaaa gtgctgagca tgccccaagt 4620

gaatatcgtg aaaaagaccg aggtgcagac aggcggcttc agcaaagagt ctatcctgcc 4680

caagaggaac agcgataagc tgatcgccag aaagaaggac tgggacccta agaagtacgg 4740

cggcttcgac agccccaccg tggcctattc tgtgctggtg gtggccaaag tggaaaaggg 4800

caagtccaag aaactgaaga gtgtgaaaga gctgctgggg atcaccatca tggaaagaag 4860

cagcttcgag aagaatccca tcgactttct ggaagccaag ggctacaaag aagtgaaaaa 4920

ggacctgatc atcaagctgc ctaagtactc cctgttcgag ctggaaaacg gccggaagag 4980

aatgctggcc tctgccggcg aactgcagaa gggaaacgaa ctggccctgc cctccaaata 5040

tgtgaacttc ctgtacctgg ccagccacta tgagaagctg aagggctccc ccgaggataa 5100

tgagcagaaa cagctgtttg tggaacagca caagcactac ctggacgaga tcatcgagca 5160

gatcagcgag ttctccaaga gagtgatcct ggccgacgct aatctggaca aagtgctgtc 5220

cgcctacaac aagcaccggg ataagcccat cagagagcag gccgagaata tcatccacct 5280

gtttaccctg accaatctgg gagcccctgc cgccttcaag tactttgaca ccaccatcga 5340

ccggaagagg tacaccagca ccaaagaggt gctggacgcc accctgatcc accagagcat 5400

caccggcctg tacgagacac ggatcgacct gtctcagctg ggaggcgaca aaaggccggc 5460

ggccacgaaa aaggccggcc aggcaaaaaa gaaaaagtaa gaattcctag agctcgctga 5520

tcagcctcga ctgtgccttc tagttgccag ccatctgttg tttgcccctc ccccgtgcct 5580

tccttgaccc tggaaggtgc cactcccact gtcctttcct aataaaatga ggaaattgca 5640

tcgcattgtc tgagtaggtg tcattctatt ctggggggtg gggtggggca ggacagcaag 5700

ggggaggatt gggaagagaa tagcaggcat gctggggagc ggccgcagga acccctagtg 5760

atggagttgg ccactccctc tctgcgcgct cgctcgctca ctgaggccgg gcgaccaaag 5820

gtcgcccgac gcccgggctt tgcccgggcg gcctcagtga gcgagcgagc gcgcagctgc 5880

ctgcaggggc gcctgatgcg gtattttctc cttacgcatc tgtgcggtat ttcacaccgc 5940

atacgtcaaa gcaaccatag tacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg 6000

tggttacgcg cagcgtgacc gctacacttg ccagcgcctt agcgcccgct cctttcgctt 6060

tcttcccttc ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc 6120

tccctttagg gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgatttgg 6180

gtgatggttc acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg 6240

agtccacgtt ctttaatagt ggactcttgt tccaaactgg aacaacactc aactctatct 6300

cgggctattc ttttgattta taagggattt tgccgatttc ggtctattgg ttaaaaaatg 6360

agctgattta acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaattttat 6420

ggtgcactct cagtacaatc tgctctgatg ccgcatagtt aagccagccc cgacacccgc 6480

caacacccgc tgacgcgccc tgacgggctt gtctgctccc ggcatccgct tacagacaag 6540

ctgtgaccgt ctccgggagc tgcatgtgtc agaggttttc accgtcatca ccgaaacgcg 6600

cgagacgaaa gggcctcgtg atacgcctat ttttataggt taatgtcatg ataataatgg 6660

tttcttagac gtcaggtggc acttttcggg gaaatgtgcg cggaacccct atttgtttat 6720

ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga taaatgcttc 6780

aataatattg aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc cttattccct 6840

tttttgcggc attttgcctt cctgtttttg ctcacccaga aacgctggtg aaagtaaaag 6900

atgctgaaga tcagttgggt gcacgagtgg gttacatcga actggatctc aacagcggta 6960

agatccttga gagttttcgc cccgaagaac gttttccaat gatgagcact tttaaagttc 7020

tgctatgtgg cgcggtatta tcccgtattg acgccgggca agagcaactc ggtcgccgca 7080

tacactattc tcagaatgac ttggttgagt actcaccagt cacagaaaag catcttacgg 7140

atggcatgac agtaagagaa ttatgcagtg ctgccataac catgagtgat aacactgcgg 7200

ccaacttact tctgacaacg atcggaggac cgaaggagct aaccgctttt ttgcacaaca 7260

tgggggatca tgtaactcgc cttgatcgtt gggaaccgga gctgaatgaa gccataccaa 7320

acgacgagcg tgacaccacg atgcctgtag caatggcaac aacgttgcgc aaactattaa 7380

ctggcgaact acttactcta gcttcccggc aacaattaat agactggatg gaggcggata 7440

aagttgcagg accacttctg cgctcggccc ttccggctgg ctggtttatt gctgataaat 7500

ctggagccgg tgagcgtgga agccgcggta tcattgcagc actggggcca gatggtaagc 7560

cctcccgtat cgtagttatc tacacgacgg ggagtcaggc aactatggat gaacgaaata 7620

gacagatcgc tgagataggt gcctcactga ttaagcattg gtaactgtca gaccaagttt 7680

actcatatat actttagatt gatttaaaac ttcattttta atttaaaagg atctaggtga 7740

agatcctttt tgataatctc atgaccaaaa tcccttaacg tgagttttcg ttccactgag 7800

cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa 7860

tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg ccggatcaag 7920

agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata ccaaatactg 7980

ttcttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca ccgcctacat 8040

acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag tcgtgtctta 8100

ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc tgaacggggg 8160

gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga tacctacagc 8220

gtgagctatg agaaagcgcc acgcttcccg aagggagaaa ggcggacagg tatccggtaa 8280

gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac gcctggtatc 8340

tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg tgatgctcgt 8400

caggggggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct 8460

tttgctggcc ttttgctcac atgt 8484

<210> 2

<211> 10476

<212> DNA

<213> Artificial sequence

<400> 2

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaaataag 300

gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttc tagcgcgtgc 360

gccaattctg cagacaaatg gctctagagg tacccgttac ataacttacg gtaaatggcc 420

cgcctggctg accgcccaac gacccccgcc cattgacgtc aatagtaacg ccaataggga 480

ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc 540

aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 600

ggcattgtgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 660

tagtcatcgc tattaccatg ggggcagagc gcacatcgcc cacagtcccc gagaagttgg 720

ggggaggggt cggcaattga tccggtgcct agagaaggtg gcgcggggta aactgggaaa 780

gtgatgtcgt gtactggctc cgcctttttc ccgagggtgg gggagaaccg tatataagtg 840

cagtagtcgc cgtgaacgtt ctttttcgca acgggtttgc cgccagaaca caggttggac 900

cggtgccacc atggactata aggaccacga cggagactac aaggatcatg atattgatta 960

caaagacgat gacgataaga tggcccccaa aaagaaacga aaggtgggtg ggtccccaaa 1020

gaagaagcgg aaggtcggta tccacggagt cccagcagcc gacaagaagt acagcatcgg 1080

cctggacatc ggcaccaact ctgtgggctg ggccgtgatc accgacgagt acaaggtgcc 1140

cagcaagaaa ttcaaggtgc tgggcaacac cgaccggcac agcatcaaga agaacctgat 1200

cggagccctg ctgttcgaca gcggcgaaac agccgaggcc acccggctga agagaaccgc 1260

cagaagaaga tacaccagac ggaagaaccg gatctgctat ctgcaagaga tcttcagcaa 1320

cgagatggcc aaggtggacg acagcttctt ccacagactg gaagagtcct tcctggtgga 1380

agaggataag aagcacgagc ggcaccccat cttcggcaac atcgtggacg aggtggccta 1440

ccacgagaag taccccacca tctaccacct gagaaagaaa ctggtggaca gcaccgacaa 1500

ggccgacctg cggctgatct atctggccct ggcccacatg atcaagttcc ggggccactt 1560

cctgatcgag ggcgacctga accccgacaa cagcgacgtg gacaagctgt tcatccagct 1620

ggtgcagacc tacaaccagc tgttcgagga aaaccccatc aacgccagcg gcgtggacgc 1680

caaggccatc ctgtctgcca gactgagcaa gagcagacgg ctggaaaatc tgatcgccca 1740

gctgcccggc gagaagaaga atggcctgtt cggaaacctg attgccctga gcctgggcct 1800

gacccccaac ttcaagagca acttcgacct ggccgaggat gccaaactgc agctgagcaa 1860

ggacacctac gacgacgacc tggacaacct gctggcccag atcggcgacc agtacgccga 1920

cctgtttctg gccgccaaga acctgtccga cgccatcctg ctgagcgaca tcctgagagt 1980

gaacaccgag atcaccaagg cccccctgag cgcctctatg atcaagagat acgacgagca 2040

ccaccaggac ctgaccctgc tgaaagctct cgtgcggcag cagctgcctg agaagtacaa 2100

agagattttc ttcgaccaga gcaagaacgg ctacgccggc tacattgacg gcggagccag 2160

ccaggaagag ttctacaagt tcatcaagcc catcctggaa aagatggacg gcaccgagga 2220

actgctcgtg aagctgaaca gagaggacct gctgcggaag cagcggacct tcgacaacgg 2280

cagcatcccc caccagatcc acctgggaga gctgcacgcc attctgcggc ggcaggaaga 2340

tttttaccca ttcctgaagg acaaccggga aaagatcgag aagatcctga ccttccgcat 2400

cccctactac gtgggccctc tggccagggg aaacagcaga ttcgcctgga tgaccagaaa 2460

gagcgaggaa accatcaccc cctggaactt cgaggaagtg gtggacaagg gcgcttccgc 2520

ccagagcttc atcgagcgga tgaccaactt cgataagaac ctgcccaacg agaaggtgct 2580

gcccaagcac agcctgctgt acgagtactt caccgtgtat aacgagctga ccaaagtgaa 2640

atacgtgacc gagggaatga gaaagcccgc cttcctgagc ggcgagcaga aaaaggccat 2700

cgtggacctg ctgttcaaga ccaaccggaa agtgaccgtg aagcagctga aagaggacta 2760

cttcaagaaa atcgagtgct tcgactccgt ggaaatctcc ggcgtggaag atcggttcaa 2820

cgcctccctg ggcacatacc acgatctgct gaaaattatc aaggacaagg acttcctgga 2880

caatgaggaa aacgaggaca ttctggaaga tatcgtgctg accctgacac tgtttgagga 2940

cagagagatg atcgaggaac ggctgaaaac ctatgcccac ctgttcgacg acaaagtgat 3000

gaagcagctg aagcggcgga gatacaccgg ctggggcagg ctgagccgga agctgatcaa 3060

cggcatccgg gacaagcagt ccggcaagac aatcctggat ttcctgaagt ccgacggctt 3120

cgccaacaga aacttcatgc agctgatcca cgacgacagc ctgaccttta aagaggacat 3180

ccagaaagcc caggtgtccg gccagggcga tagcctgcac gagcacattg ccaatctggc 3240

cggcagcccc gccattaaga agggcatcct gcagacagtg aaggtggtgg acgagctcgt 3300

gaaagtgatg ggccggcaca agcccgagaa catcgtgatc gaaatggcca gagagaacca 3360

gaccacccag aagggacaga agaacagccg cgagagaatg aagcggatcg aagagggcat 3420

caaagagctg ggcagccaga tcctgaaaga acaccccgtg gaaaacaccc agctgcagaa 3480

cgagaagctg tacctgtact acctgcagaa tgggcgggat atgtacgtgg accaggaact 3540

ggacatcaac cggctgtccg actacgatgt ggaccatatc gtgcctcaga gctttctgaa 3600

ggacgactcc atcgacaaca aggtgctgac cagaagcgac aagaaccggg gcaagagcga 3660

caacgtgccc tccgaagagg tcgtgaagaa gatgaagaac tactggcggc agctgctgaa 3720

cgccaagctg attacccaga gaaagttcga caatctgacc aaggccgaga gaggcggcct 3780

gagcgaactg gataaggccg gcttcatcaa gagacagctg gtggaaaccc ggcagatcac 3840

aaagcacgtg gcacagatcc tggactcccg gatgaacact aagtacgacg agaatgacaa 3900

gctgatccgg gaagtgaaag tgatcaccct gaagtccaag ctggtgtccg atttccggaa 3960

ggatttccag ttttacaaag tgcgcgagat caacaactac caccacgccc acgacgccta 4020

cctgaacgcc gtcgtgggaa ccgccctgat caaaaagtac cctaagctgg aaagcgagtt 4080

cgtgtacggc gactacaagg tgtacgacgt gcggaagatg atcgccaaga gcgagcagga 4140

aatcggcaag gctaccgcca agtacttctt ctacagcaac atcatgaact ttttcaagac 4200

cgagattacc ctggccaacg gcgagatccg gaagcggcct ctgatcgaga caaacggcga 4260

aaccggggag atcgtgtggg ataagggccg ggattttgcc accgtgcgga aagtgctgag 4320

catgccccaa gtgaatatcg tgaaaaagac cgaggtgcag acaggcggct tcagcaaaga 4380

gtctatcctg cccaagagga acagcgataa gctgatcgcc agaaagaagg actgggaccc 4440

taagaagtac ggcggcttcg acagccccac cgtggcctat tctgtgctgg tggtggccaa 4500

agtggaaaag ggcaagtcca agaaactgaa gagtgtgaaa gagctgctgg ggatcaccat 4560

catggaaaga agcagcttcg agaagaatcc catcgacttt ctggaagcca agggctacaa 4620

agaagtgaaa aaggacctga tcatcaagct gcctaagtac tccctgttcg agctggaaaa 4680

cggccggaag agaatgctgg cctctgccgg cgaactgcag aagggaaacg aactggccct 4740

gccctccaaa tatgtgaact tcctgtacct ggccagccac tatgagaagc tgaagggctc 4800

ccccgaggat aatgagcaga aacagctgtt tgtggaacag cacaagcact acctggacga 4860

gatcatcgag cagatcagcg agttctccaa gagagtgatc ctggccgacg ctaatctgga 4920

caaagtgctg tccgcctaca acaagcaccg ggataagccc atcagagagc aggccgagaa 4980

tatcatccac ctgtttaccc tgaccaatct gggagcccct gccgccttca agtactttga 5040

caccaccatc gaccggaaga ggtacaccag caccaaagag gtgctggacg ccaccctgat 5100

ccaccagagc atcaccggcc tgtacgagac acggatcgac ctgtctcagc tgggaggcga 5160

caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa aagaaaaagg gcggctccaa 5220

gcggcctgcc gcgacgaaga aagcgggaca ggccaagaaa aagaaaggat ccggcgcaac 5280

aaacttctct ctgctgaaac aagccggaga tgtcgaagag aatcctggac cggtgagcaa 5340

gggcgaggag ctgttcaccg gggtggtgcc catcctggtc gagctggacg gcgacgtaaa 5400

cggccacaag ttcagcgtgt ccggcgaggg cgagggcgat gccacctacg gcaagctgac 5460

cctgaagttc atctgcacca ccggcaagct gcccgtgccc tggcccaccc tcgtgaccac 5520

cctgacctac ggcgtgcagt gcttcagccg ctaccccgac cacatgaagc agcacgactt 5580

cttcaagtcc gccatgcccg aaggctacgt ccaggagcgc accatcttct tcaaggacga 5640

cggcaactac aagacccgcg ccgaggtgaa gttcgagggc gacaccctgg tgaaccgcat 5700

cgagctgaag ggcatcgact tcaaggagga cggcaacatc ctggggcaca agctggagta 5760

caactacaac agccacaacg tctatatcat ggccgacaag cagaagaacg gcatcaaggt 5820

gaacttcaag atccgccaca acatcgagga cggcagcgtg cagctcgccg accactacca 5880

gcagaacacc cccatcggcg acggccccgt gctgctgccc gacaaccact acctgagcac 5940

ccagtccgcc ctgagcaaag accccaacga gaagcgcgat cacatggtcc tgctggagtt 6000

cgtgaccgcc gccgggatca ctctcggcat ggacgagctg tacaagggct ccggcgaggg 6060

caggggaagt cttctaacat gcggggacgt ggaggaaaat cccggcccaa ccgagtacaa 6120

gcccacggtg cgcctcgcca cccgcgacga cgtccccagg gccgtacgca ccctcgccgc 6180

cgcgttcgcc gactaccccg ccacgcgcca caccgtcgat ccggaccgcc acatcgagcg 6240

ggtcaccgag ctgcaagaac tcttcctcac gcgcgtcggg ctcgacatcg gcaaggtgtg 6300

ggtcgcggac gacggcgccg cggtggcggt ctggaccacg ccggagagcg tcgaagcggg 6360

ggcggtgttc gccgagatcg gcccgcgcat ggccgagttg agcggttccc ggctggccgc 6420

gcagcaacag atggaaggcc tcctggcgcc gcaccggccc aaggagcccg cgtggttcct 6480

ggccaccgtc ggagtctcgc ccgaccacca gggcaagggt ctgggcagcg ccgtcgtgct 6540

ccccggagtg gaggcggccg agcgcgccgg ggtgcccgcc ttcctggaga cctccgcgcc 6600

ccgcaacctc cccttctacg agcggctcgg cttcaccgtc accgccgacg tcgaggtgcc 6660

cgaaggaccg cgcacctggt gcatgacccg caagcccggt gcctgaacgc gttaagtcga 6720

caatcaacct ctggattaca aaatttgtga aagattgact ggtattctta actatgttgc 6780

tccttttacg ctatgtggat acgctgcttt aatgcctttg tatcatgcta ttgcttcccg 6840

tatggctttc attttctcct ccttgtataa atcctggttg ctgtctcttt atgaggagtt 6900

gtggcccgtt gtcaggcaac gtggcgtggt gtgcactgtg tttgctgacg caacccccac 6960

tggttggggc attgccacca cctgtcagct cctttccggg actttcgctt tccccctccc 7020

tattgccacg gcggaactca tcgccgcctg ccttgcccgc tgctggacag gggctcggct 7080

gttgggcact gacaattccg tggtgttgtc ggggaaatca tcgtcctttc cttggctgct 7140

cgcctgtgtt gccacctgga ttctgcgcgg gacgtccttc tgctacgtcc cttcggccct 7200

caatccagcg gaccttcctt cccgcggcct gctgccggct ctgcggcctc ttccgcgtct 7260

tcgccttcgc cctcagacga gtcggatctc cctttgggcc gcctccccgc gtcgacttta 7320

agaccaatga cttacaaggc agctgtagat cttagccact ttttaaaaga aaagggggga 7380

ctggaagggc taattcactc ccaacgaaga caagatctgc tttttgcttg tactgggtct 7440

ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt 7500

aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac 7560

tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagggcc 7620

cgtttaaacc cgctgatcag cctcgactgt gccttctagt tgccagccat ctgttgtttg 7680

cccctccccc gtgccttcct tgaccctgga aggtgccact cccactgtcc tttcctaata 7740

aaatgaggaa attgcatcgc attgtctgag taggtgtcat tctattctgg ggggtggggt 7800

ggggcaggac agcaaggggg aggattggga agacaatagc aggcatgctg gggatgcggt 7860

gggctctatg gcctgcaggg gcgcctgatg cggtattttc tccttacgca tctgtgcggt 7920

atttcacacc gcatacgtca aagcaaccat agtacgcgcc ctgtagcggc gcattaagcg 7980

cggcgggtgt ggtggttacg cgcagcgtga ccgctacact tgccagcgcc ttagcgcccg 8040

ctcctttcgc tttcttccct tcctttctcg ccacgttcgc cggctttccc cgtcaagctc 8100

taaatcgggg gctcccttta gggttccgat ttagtgcttt acggcacctc gaccccaaaa 8160

aacttgattt gggtgatggt tcacgtagtg ggccatcgcc ctgatagacg gtttttcgcc 8220

ctttgacgtt ggagtccacg ttctttaata gtggactctt gttccaaact ggaacaacac 8280

tcaactctat ctcgggctat tcttttgatt tataagggat tttgccgatt tcggtctatt 8340

ggttaaaaaa tgagctgatt taacaaaaat ttaacgcgaa ttttaacaaa atattaacgt 8400

ttacaatttt atggtgcact ctcagtacaa tctgctctga tgccgcatag ttaagccagc 8460

cccgacaccc gccaacaccc gctgacgcgc cctgacgggc ttgtctgctc ccggcatccg 8520

cttacagaca agctgtgacc gtctccggga gctgcatgtg tcagaggttt tcaccgtcat 8580

caccgaaacg cgcgagacga aagggcctcg tgatacgcct atttttatag gttaatgtca 8640

tgataataat ggtttcttag acgtcaggtg gcacttttcg gggaaatgtg cgcggaaccc 8700

ctatttgttt atttttctaa atacattcaa atatgtatcc gctcatgaga caataaccct 8760

gataaatgct tcaataatat tgaaaaagga agagtatgag tattcaacat ttccgtgtcg 8820

cccttattcc cttttttgcg gcattttgcc ttcctgtttt tgctcaccca gaaacgctgg 8880

tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt gggttacatc gaactggatc 8940

tcaacagcgg taagatcctt gagagttttc gccccgaaga acgttttcca atgatgagca 9000

cttttaaagt tctgctatgt ggcgcggtat tatcccgtat tgacgccggg caagagcaac 9060

tcggtcgccg catacactat tctcagaatg acttggttga gtactcacca gtcacagaaa 9120

agcatcttac ggatggcatg acagtaagag aattatgcag tgctgccata accatgagtg 9180

ataacactgc ggccaactta cttctgacaa cgatcggagg accgaaggag ctaaccgctt 9240

ttttgcacaa catgggggat catgtaactc gccttgatcg ttgggaaccg gagctgaatg 9300

aagccatacc aaacgacgag cgtgacacca cgatgcctgt agcaatggca acaacgttgc 9360

gcaaactatt aactggcgaa ctacttactc tagcttcccg gcaacaatta atagactgga 9420

tggaggcgga taaagttgca ggaccacttc tgcgctcggc ccttccggct ggctggttta 9480

ttgctgataa atctggagcc ggtgagcgtg gaagccgcgg tatcattgca gcactggggc 9540

cagatggtaa gccctcccgt atcgtagtta tctacacgac ggggagtcag gcaactatgg 9600

atgaacgaaa tagacagatc gctgagatag gtgcctcact gattaagcat tggtaactgt 9660

cagaccaagt ttactcatat atactttaga ttgatttaaa acttcatttt taatttaaaa 9720

ggatctaggt gaagatcctt tttgataatc tcatgaccaa aatcccttaa cgtgagtttt 9780

cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga gatccttttt 9840

ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt 9900

tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc agagcgcaga 9960

taccaaatac tgttcttcta gtgtagccgt agttaggcca ccacttcaag aactctgtag 10020

caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc agtggcgata 10080

agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg cagcggtcgg 10140

gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac accgaactga 10200

gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca 10260

ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt ccagggggaa 10320

acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt 10380

tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg gcctttttac 10440

ggttcctggc cttttgctgg ccttttgctc acatgt 10476

<210> 3

<211> 3120

<212> DNA

<213> Artificial sequence

<400> 3

gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 60

cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt 120

tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 180

aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt 240

ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg 300

ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga 360

tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc 420

tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac 480

actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg 540

gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca 600

acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg 660

gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg 720

acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg 780

gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag 840

ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg 900

gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct 960

cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac 1020

agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact 1080

catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga 1140

tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 1200

cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct 1260

gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 1320

taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgttc 1380

ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 1440

tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 1500

ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 1560

cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 1620

agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 1680

gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 1740

atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 1800

gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1860

gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 1920

ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 1980

cagtgagcga ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 2040

cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca 2100

acgcaattaa tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc 2160

cggctcgtat gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg 2220

accatgatta cgccaagctt gcatgcaggc ctctgcagtc gacgggcccg ggatccgatg 2280

ataaacatgt gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc 2340

tgttagagag ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac 2400

gtgacgtaga aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat 2460

ggactatcat atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt 2520

gtggaaagga cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag 2580

ttaaaataag gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttc 2640

tagcgcgtgc gccaattctg cagacaaatg gctctagagg tacccataga tctagatgca 2700

ttcgcgaggt accgagctcg aattcactgg ccgtcgtttt acaacgtcgt gactgggaaa 2760

accctggcgt tacccaactt aatcgccttg cagcacatcc ccctttcgcc agctggcgta 2820

atagcgaaga ggcccgcacc gatcgccctt cccaacagtt gcgcagcctg aatggcgaat 2880

ggcgcctgat gcggtatttt ctccttacgc atctgtgcgg tatttcacac cgcatatggt 2940

gcactctcag tacaatctgc tctgatgccg catagttaag ccagccccga cacccgccaa 3000

cacccgctga cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg 3060

tgaccgtctc cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga 3120

<210> 4

<211> 3674

<212> PRT

<213> Sus scrofa

<400> 4

Met Ser Glu Val Ser Ser Asp Glu Arg Glu Asp Val Gln Lys Lys Thr

1 5 10 15

Phe Thr Lys Trp Ile Asn Ala Gln Phe Ser Lys Phe Gly Lys Gln His

20 25 30

Ile Glu Asn Leu Phe Asn Asp Leu Gln Asp Gly Arg Arg Leu Leu Asp

35 40 45

Leu Leu Glu Gly Leu Thr Gly Gln Lys Leu Pro Lys Glu Lys Gly Ser

50 55 60

Thr Arg Val His Ala Leu Asn Asn Val Asn Lys Ala Leu Gln Val Leu

65 70 75 80

Gln Lys Asn Asn Val Asp Leu Val Asn Ile Gly Ser Thr Asp Ile Val

85 90 95

Asp Gly Asn His Lys Leu Thr Leu Gly Leu Ile Trp Asn Ile Ile Leu

100 105 110

His Trp Gln Val Lys Asn Val Met Lys Asn Ile Met Ala Gly Leu Gln

115 120 125

Gln Thr Asn Ser Glu Lys Ile Leu Leu Ser Trp Val Arg Gln Ser Thr

130 135 140

Arg Asn Tyr Pro Gln Val Asn Val Ile Asn Phe Thr Thr Ser Trp Ser

145 150 155 160

Asp Gly Leu Ala Leu Asn Ala Leu Ile His Ser His Arg Pro Asp Leu

165 170 175

Phe Asp Trp Asn Ser Val Val Cys Gln Gln Ser Ala Thr Gln Arg Leu

180 185 190

Glu His Ala Phe Asn Ile Ala Lys Tyr Gln Leu Gly Ile Glu Lys Leu

195 200 205

Leu Asp Pro Glu Asp Val Ala Thr Thr Tyr Pro Asp Lys Lys Ser Ile

210 215 220

Leu Met Tyr Val Thr Ser Leu Phe Gln Val Leu Pro Gln Gln Val Ser

225 230 235 240

Ile Glu Ala Ile Gln Glu Val Glu Met Leu Pro Arg Pro Ser Lys Val

245 250 255

Thr Arg Glu Glu His Phe Gln Leu His His Gln Met His Tyr Ser Gln

260 265 270

Gln Ile Thr Val Cys Leu Ala Gln Gly Tyr Glu Arg Thr Pro Ser Pro

275 280 285

Lys Pro Arg Phe Lys Ser Tyr Ala Tyr Thr Gln Ala Ala Tyr Val Thr

290 295 300

Thr Ser Asp Pro Thr Arg Ser Pro Phe Pro Ser Gln Arg Leu Glu Ser

305 310 315 320

Pro Glu Asp Lys Ser Phe Gly Ser Ser Leu Leu Glu Thr Glu Val Asn

325 330 335

Leu Asp Ser Tyr Gln Thr Ala Leu Glu Glu Val Leu Ser Trp Leu Leu

340 345 350

Ser Ala Glu Asp Thr Leu Gln Ala Gln Gly Glu Ile Ser Asn Asp Val

355 360 365

Glu Glu Val Lys Glu Gln Phe His Thr His Glu Gly Tyr Met Met Asp

370 375 380

Leu Thr Ser His Gln Gly Arg Ile Gly Ser Val Leu Gln Leu Gly Ser

385 390 395 400

Gln Leu Ile Gly Lys Gly Lys Leu Ser Glu Asp Glu Glu Thr Glu Val

405 410 415

Gln Glu Gln Met Asn Leu Leu Asn Ser Arg Trp Glu Cys Leu Arg Val

420 425 430

Ala Ser Val Glu Lys Gln Ser Asn Leu His Lys Val Leu Met Asp Leu

435 440 445

Gln Asn Gln Gln Leu Lys Glu Leu Asn Asp Trp Leu Thr Lys Thr Glu

450 455 460

Glu Lys Thr Arg Lys Met Glu Lys Glu Pro Leu Gly Pro Asp Leu Glu

465 470 475 480

Asp Leu Lys His Gln Ile Gln Gln His Lys Val Leu Gln Glu Asp Leu

485 490 495

Glu Gln Glu Gln Val Arg Val Asn Ser Leu Thr His Met Val Val Val

500 505 510

Val Asp Glu Ser Ser Gly Asp His Ala Thr Ala Ala Leu Glu Glu Gln

515 520 525

Leu Lys Val Leu Gly Asp Arg Trp Ala Asn Ile Cys Arg Trp Thr Glu

530 535 540

Asp Arg Trp Val Leu Leu Gln Asp Ile Leu Leu Lys Trp Gln Arg Phe

545 550 555 560

Thr Glu Glu Gln Cys Leu Phe Ser Thr Trp Leu Ser Glu Lys Glu Asp

565 570 575

Ala Leu Asn Lys Ile His Thr Thr Gly Phe Lys Asp Gln Gly Glu Met

580 585 590

Leu Ser Ser Leu Gln Lys Leu Ala Val Leu Lys Thr Asp Leu Glu Lys

595 600 605

Lys Lys Gln Thr Met Asp Lys Leu Ser Ser Leu Asn Gln Asp Leu Leu

610 615 620

Ser Thr Leu Lys Asn Thr Leu Val Ala Gln Lys Met Glu Ala Trp Leu

625 630 635 640

Asp Asn Phe Ala Gln Arg Trp Asp Asn Leu Val Gln Lys Leu Glu Lys

645 650 655

Ser Ser Thr Gln Ile Ser Gln Ala Val Thr Thr Thr Gln Pro Ser Leu

660 665 670

Thr Gln Thr Thr Val Met Glu Thr Val Thr Met Val Thr Thr Arg Glu

675 680 685

Gln Ile Leu Val Lys His Ala Gln Glu Glu Leu Pro Pro Pro Pro Pro

690 695 700

Gln Lys Lys Arg Gln Ile Ile Val Asp Ser Glu Ile Arg Lys Arg Leu

705 710 715 720

Asp Val Asp Ile Thr Glu Leu His Ser Trp Ile Thr Arg Ser Glu Ala

725 730 735

Val Leu Gln Ser Pro Glu Phe Ala Ile Tyr Arg Lys Glu Gly Asn Phe

740 745 750

Ser Asp Leu Lys Glu Lys Val Asn Ala Ile Glu Arg Glu Lys Ala Glu

755 760 765

Lys Phe Arg Lys Leu Gln Asp Ala Ser Arg Ser Ala Gln Ala Leu Val

770 775 780

Glu Gln Met Val Asn Glu Gly Val Asn Ala Asp Ser Ile Lys Gln Ala

785 790 795 800

Ala Glu Gln Leu Asn Ser Arg Trp Ile Glu Phe Cys Gln Leu Leu Ser

805 810 815

Glu Arg Leu Asn Trp Leu Glu Tyr Gln Asn Arg Ile Ile Thr Phe Tyr

820 825 830

Asn Gln Leu Gln Gln Leu Glu Gln Ile Thr Thr Ala Ala Glu Asn Trp

835 840 845

Leu Lys Thr Gln Pro Ile Thr Thr Ser Glu Pro Thr Ala Val Lys Ser

850 855 860

Gln Leu Lys Ile Cys Lys Asp Glu Val Asn Arg Leu Ser Ala Leu Gln

865 870 875 880

Pro Gln Ile Glu Arg Leu Lys Ile Glu Ser Ile Ala Leu Lys Glu Lys

885 890 895

Gly Gln Gly Pro Met Phe Leu Asp Ala Asp Ser Val Ala Phe Thr Asn

900 905 910

His Phe Asn Gln Val Phe Ala Asp Met Gln Ala Lys Glu Lys Glu Leu

915 920 925

Gln Ile Ile Phe Asp Thr Leu Pro Pro Met Arg Tyr Gln Glu Thr Met

930 935 940

Ser Thr Ile Leu Thr Trp Ile Gln His Ser Glu Ala Lys Leu Ser Ile

945 950 955 960

Pro Gln Ala Thr Val Thr Glu Tyr Glu Ile Met Glu Gln Arg Leu Gly

965 970 975

Glu Leu Gln Ala Leu Gln Ser Ser Leu Gln Glu Gln Gln Asn Gly Leu

980 985 990

Asn Tyr Leu Ser Thr Thr Val Lys Glu Met Ser Lys Lys Ala Pro Ser

995 1000 1005

Asn Ile Ser Arg Lys Tyr Gln Ser Glu Phe Glu Glu Ile Glu Gly

1010 1015 1020

Arg Trp Lys Lys Leu Ser Ala Gln Leu Met Glu His Cys Gln Lys

1025 1030 1035

Leu Glu Glu Gln Ile Ala Lys Leu Arg Lys Leu Gln Asn His Ile

1040 1045 1050

Lys Thr Leu Lys Asn Trp Met Ala Glu Val Asp Ile Phe Leu Lys

1055 1060 1065

Glu Glu Trp Pro Ala Leu Gly Asp Ser Glu Ile Leu Arg Lys Gln

1070 1075 1080

Leu Lys Gln Cys Arg Leu Leu Val Ser Asp Ile Gln Thr Ile Gln

1085 1090 1095

Pro Ser Leu Asn Ser Val Asn Glu Gly Gly Gln Lys Ile Lys Lys

1100 1105 1110

Glu Ala Glu Pro Glu Phe Ala Ser Arg Leu Glu Thr Glu Leu Arg

1115 1120 1125

Glu Leu Asn Thr Gln Trp Asp Tyr Ile Cys Arg Gln Val Tyr Ala

1130 1135 1140

Arg Lys Glu Ala Leu Lys Gly Gly Leu Asp Lys Thr Ile Ser Leu

1145 1150 1155

Gln Lys Asp Leu Ser Glu Met His Glu Trp Met Thr Gln Ala Glu

1160 1165 1170

Glu Glu Tyr Leu Glu Arg Asp Phe Glu Tyr Lys Thr Pro Asp Glu

1175 1180 1185

Leu Gln Thr Ala Val Glu Glu Met Lys Arg Ala Lys Glu Glu Ala

1190 1195 1200

Gln Gln Lys Glu Ala Lys Val Lys Leu Leu Thr Glu Ser Val Asn

1205 1210 1215

Ser Val Ile Ala Gln Ala Pro Pro Ala Ala Gln Glu Ala Leu Lys

1220 1225 1230

Lys Glu Leu Asp Thr Leu Thr Thr Asn Tyr Gln Trp Leu Cys Thr

1235 1240 1245

Arg Leu Asn Gly Lys Cys Lys Thr Leu Glu Glu Val Trp Ala Cys

1250 1255 1260

Trp His Glu Leu Leu Ser Tyr Leu Glu Lys Ala Asn Lys Trp Leu

1265 1270 1275

Ser Glu Val Glu Phe Lys Leu Lys Thr Thr Glu Asn Ile Pro Gly

1280 1285 1290

Gly Ala Glu Glu Ile Ser Glu Val Leu Glu Ser Leu Glu Asn Leu

1295 1300 1305

Met Gln His Ser Glu Asp Asn Pro Asn Gln Ile Arg Ile Leu Ala

1310 1315 1320

Gln Thr Leu Thr Asp Gly Gly Val Met Asp Glu Leu Ile Asn Glu

1325 1330 1335

Glu Leu Glu Thr Phe Asn Ser Arg Trp Arg Glu Leu His Glu Glu

1340 1345 1350

Ala Val Arg Arg Gln Lys Leu Leu Glu Gln Ser Ile Gln Ser Ala

1355 1360 1365

Gln Glu Ile Glu Lys Ser Leu His Leu Ile Gln Asp Ser Leu Ser

1370 1375 1380

Ser Ile Asp His Gln Leu Ala Val Tyr Ile Ala Asp Lys Val Asp

1385 1390 1395

Ala Ala Gln Met Pro Gln Glu Ala Gln Lys Ile Gln Ser Asp Leu

1400 1405 1410

Thr Ser His Glu Ile Ser Leu Glu Glu Met Lys Lys His Tyr Gln

1415 1420 1425

Gly Lys Glu Ala Ala Pro Arg Val Leu Ser Gln Ile Glu Leu Ala

1430 1435 1440

Gln Lys Lys Leu Gln Asp Val Ser Met Lys Phe Arg Leu Phe Gln

1445 1450 1455

Lys Pro Ala Asn Phe Glu Gln Arg Leu Gln Glu Ser Lys Met Ile

1460 1465 1470

Leu Asp Glu Val Lys Met His Leu Pro Ala Leu Glu Ile Lys Ser

1475 1480 1485

Val Glu Gln Glu Val Val Gln Ser Gln Leu Asn His Cys Val Asn

1490 1495 1500

Leu Tyr Lys Ser Leu Ser Glu Val Lys Ser Glu Val Glu Met Val

1505 1510 1515

Ile Lys Thr Gly Arg Gln Ile Val Gln Lys Lys Gln Thr Glu Asn

1520 1525 1530

Pro Lys Glu Leu Asp Glu Arg Val Thr Ala Leu Lys Leu His Tyr

1535 1540 1545

Asn Glu Leu Gly Ala Lys Val Thr Glu Arg Lys Gln Gln Leu Glu

1550 1555 1560

Lys Cys Leu Lys Leu Ser Arg Lys Met Arg Lys Glu Met Asn Val

1565 1570 1575

Leu Thr Glu Trp Leu Ala Ala Thr Asp Thr Glu Leu Thr Lys Arg

1580 1585 1590

Ser Ala Val Glu Gly Met Pro Ser Asn Leu Asp Ser Glu Val Val

1595 1600 1605

Trp Gly Lys Ala Thr Gln Lys Glu Ile Glu Lys Gln Lys Phe His

1610 1615 1620

Leu Lys Ser Ile Ser Glu Ile Gly Glu Ala Leu Lys Met Val Leu

1625 1630 1635

Gly Lys Lys Glu Thr Leu Val Glu Asp Lys Leu Ser Leu Leu Asn

1640 1645 1650

Ser Asn Trp Ile Ala Val Thr Ser Arg Ala Glu Glu Trp Leu Asn

1655 1660 1665

Leu Leu Leu Glu Tyr Gln Lys His Met Glu Asn Phe Asp Gln Asn

1670 1675 1680

Val Asp His Ile Thr Lys Trp Ile Ile Gln Ala Asp Thr Leu Leu

1685 1690 1695

Asp Glu Ser Glu Lys Lys Lys Pro Gln Gln Lys Glu Asp Val Leu

1700 1705 1710

Lys Arg Leu Lys Ala Glu Met Asn Asp Met Arg Pro Lys Val Asp

1715 1720 1725

Ser Thr Arg Asp Gln Ala Ala Asn Leu Met Ala Asn Arg Gly Asp

1730 1735 1740

His Cys Arg Lys Val Ile Glu Pro Lys Ile Ser Glu Leu Asn His

1745 1750 1755

Arg Phe Ala Ala Ile Ser His Arg Ile Lys Thr Gly Lys Ala Ser

1760 1765 1770

Ile Pro Leu Lys Glu Leu Glu Gln Phe Asn Ser Asp Ile Gln Lys

1775 1780 1785

Leu Leu Glu Pro Leu Glu Ala Glu Ile Gln Gln Gly Val Asn Leu

1790 1795 1800

Lys Glu Glu Asp Phe Asn Lys Asp Met Ser Glu Asp Asn Glu Gly

1805 1810 1815

Thr Val Lys Glu Leu Leu Gln Arg Gly Asp Asn Leu Gln Gln Arg

1820 1825 1830

Ile Thr Asp Glu Arg Lys Arg Glu Glu Ile Lys Ile Lys Gln Gln

1835 1840 1845

Leu Leu Gln Thr Lys His Asn Ala Leu Lys Asp Leu Arg Ser Gln

1850 1855 1860

Arg Arg Lys Lys Ala Leu Glu Ile Ser His Gln Trp Tyr Gln Tyr

1865 1870 1875

Lys Arg Gln Ala Asp Asp Leu Leu Lys Cys Leu Asp Asp Ile Glu

1880 1885 1890

Lys Lys Leu Ala Ser Leu Pro Glu Pro Gln Asp Glu Lys Lys Ile

1895 1900 1905

Lys Glu Ile Asp Arg Glu Leu Gln Lys Lys Lys Glu Glu Leu Asp

1910 1915 1920

Ala Val Arg Arg Gln Ala Glu Gly Leu Ser Glu Asp Gly Ala Ala

1925 1930 1935

Met Ala Val Glu Pro Thr Gln Ile Gln Leu Ser Lys Arg Trp Arg

1940 1945 1950

Glu Ile Glu Ser Lys Phe Ala His Phe Arg Arg Leu Asn Phe Ala

1955 1960 1965

Gln Ile His Thr Val His Glu Glu Ser Val Met Val Met Thr Glu

1970 1975 1980

Asp Met Pro Leu Glu Ile Ser Tyr Val Pro Ser Ala Tyr Leu Thr

1985 1990 1995

Glu Ile Thr His Val Ser Gln Ala Leu Ser Glu Val Glu Gln Leu

2000 2005 2010

Leu Asn Ala Pro Asp Leu Cys Ala Lys Asp Phe Glu Asp Leu Phe

2015 2020 2025

Lys Gln Glu Glu Ser Leu Lys Asn Ile Lys Asp Ser Leu Gln Gln

2030 2035 2040

Ile Ser Gly Arg Val Asp Ile Ile His Asn Lys Lys Thr Ala Gly

2045 2050 2055

Leu Gln Ser Ala Thr Pro Val Glu Arg Thr Arg Leu Gln Glu Ala

2060 2065 2070

Leu Ser Gln Leu Asp Phe Gln Trp Glu Arg Val Asn Lys Met Tyr

2075 2080 2085

Lys Asp Arg Gln Gly Lys Phe Asp Arg Ser Val Glu Lys Trp Arg

2090 2095 2100

Arg Phe His Tyr Asp Met Lys Ile Phe Asn Gln Trp Leu Thr Glu

2105 2110 2115

Ala Glu His Phe Leu Lys Lys Thr Gln Ile Pro Glu Asn Trp Glu

2120 2125 2130

His Ala Lys Tyr Lys Trp Tyr Leu Lys Glu Leu Gln Asp Gly Ile

2135 2140 2145

Gly Gln Arg Gln Thr Ile Val Arg Val Leu Asn Ala Thr Gly Glu

2150 2155 2160

Glu Val Ile Gln Gln Ser Ser Lys Thr Asp Ala Ser Ile Leu Gln

2165 2170 2175

Glu Lys Leu Gly Ser Leu Asn Leu Arg Trp Gln Glu Val Cys Lys

2180 2185 2190

Gln Leu Ala Glu Arg Lys Lys Arg Leu Glu Glu Gln Lys Asn Ile

2195 2200 2205

Leu Ser Glu Phe Gln Arg Asp Leu Asn Glu Phe Val Leu Trp Leu

2210 2215 2220

Glu Glu Ala Asp Asn Ile Thr Ser Val Ala Leu Glu Pro Gly Asn

2225 2230 2235

Glu Gln Gln Leu Lys Glu Lys Leu Glu Glu Ile Lys Leu Leu Ala

2240 2245 2250

Glu Glu Leu Pro Leu Arg Gln Gly Thr Leu Lys Gln Leu Asn Glu

2255 2260 2265

Thr Gly Gly Thr Val Leu Val Ser Ala Pro Ile Ser Pro Glu Glu

2270 2275 2280

Gln Asp Lys Ile Glu Asn Lys Leu Lys Gln Thr Asn Leu Gln Trp

2285 2290 2295

Ile Lys Val Ser Arg Ile Leu Pro Glu Lys Gln Gly Glu Ile Glu

2300 2305 2310

Ala His Ile Lys Asp Leu Gly Gln Phe Glu Glu Gln Leu Asn His

2315 2320 2325

Leu Leu Val Trp Leu Ser Pro Ile Lys Asn Gln Leu Glu Ile Tyr

2330 2335 2340

Asn Gln Pro Asn Gln Thr Gly Pro Phe Asp Ile Lys Glu Thr Glu

2345 2350 2355

Val Ala Val Gln Ala Lys Gln Leu Asp Val Glu Gly Ile Leu Ser

2360 2365 2370

Lys Gly Gln His Leu Tyr Lys Glu Lys Pro Ala Thr Gln Pro Val

2375 2380 2385

Lys Arg Lys Leu Glu Asp Leu Ser Ser Glu Trp Lys Ala Val Thr

2390 2395 2400

His Leu Leu Gln Glu Leu Arg Ala Lys Trp Pro Gly Pro Thr Pro

2405 2410 2415

Gly Leu Thr Thr Ile Glu Ala Pro Thr Ser Gln Thr Val Thr Leu

2420 2425 2430

Val Thr Gln Pro Thr Val Thr Lys Glu Thr Ala Ile Ser Lys Pro

2435 2440 2445

Glu Met Pro Ser Ser Leu Leu Leu Glu Val Pro Ala Leu Ala Asp

2450 2455 2460

Phe Asn Arg Ala Trp Thr Glu Leu Thr Asp Trp Leu Ser Leu Leu

2465 2470 2475

Asp Arg Val Ile Lys Ser Gln Arg Val Met Val Gly Asp Leu Glu

2480 2485 2490

Asp Ile Asn Glu Met Ile Ile Lys Gln Lys Ala Thr Leu Gln Asp

2495 2500 2505

Leu Glu Gln Arg Arg Pro Gln Leu Glu Glu Leu Ile Thr Ala Ala

2510 2515 2520

Gln Asn Leu Lys Asn Lys Thr Ser Asn Gln Glu Ala Arg Thr Ile

2525 2530 2535

Ile Thr Asp Arg Ile Glu Arg Ile Gln Ser Gln Trp Asp Glu Val

2540 2545 2550

Gln Glu His Leu Gln Asn Arg Arg Gln Gln Leu Asn Glu Met Leu

2555 2560 2565

Lys Asp Ser Thr Gln Trp Leu Glu Ala Lys Glu Glu Ala Glu Gln

2570 2575 2580

Val Leu Gly Gln Ala Arg Ala Lys Leu Glu Ser Trp Lys Glu Gly

2585 2590 2595

Pro Tyr Thr Met Asp Ala Ile Gln Arg Lys Ile Thr Glu Thr Lys

2600 2605 2610

Gln Leu Ala Lys Asp Leu Arg Gln Trp Gln Ile Asn Val Asp Val

2615 2620 2625

Ala Asn Asp Leu Ala Leu Lys Leu Leu Arg Asp Tyr Ser Ala Asp

2630 2635 2640

Asp Thr Arg Lys Val His Met Ile Thr Glu Asn Ile Asn Ala Ser

2645 2650 2655

Trp Ala Asn Ile His Lys Arg Leu Ser Glu Arg Glu Thr Val Leu

2660 2665 2670

Glu Glu Thr His Arg Leu Leu Gln Gln Phe Pro Leu Asp Leu Glu

2675 2680 2685

Lys Phe Leu Ala Trp Leu Thr Glu Ala Glu Thr Thr Ala Asn Val

2690 2695 2700

Leu Gln Asp Ala Thr His Lys Glu Arg Leu Leu Glu Asp Ser Lys

2705 2710 2715

Gly Val Arg Glu Leu Met Lys Gln Trp Gln Asp Leu Gln Gly Glu

2720 2725 2730

Ile Glu Ala His Thr Asp Ile Tyr His Asn Leu Asp Glu Asn Gly

2735 2740 2745

Gln Lys Ile Leu Arg Ser Leu Glu Gly Ser Asp Asp Ala Ile Leu

2750 2755 2760

Leu Gln Arg Arg Leu Asp Asn Met Asn Phe Lys Trp Ser Glu Leu

2765 2770 2775

Arg Lys Lys Ser Leu Asn Ile Arg Ser His Leu Glu Ala Ser Ser

2780 2785 2790

Asp Gln Trp Lys Arg Leu His Leu Ser Leu Gln Glu Leu Leu Val

2795 2800 2805

Trp Leu Gln Leu Lys Asp Asp Glu Leu Ser Arg Gln Ala Pro Ile

2810 2815 2820

Gly Gly Asp Cys Pro Ala Val Gln Lys Gln Asn Asp Val His Arg

2825 2830 2835

Ala Phe Lys Arg Glu Leu Lys Thr Lys Glu Pro Val Ile Met Ser

2840 2845 2850

Thr Leu Glu Thr Val Arg Ile Phe Leu Thr Glu Gln Pro Leu Glu

2855 2860 2865

Gly Leu Glu Lys Leu Tyr Gln Glu Pro Arg Glu Leu Pro Pro Glu

2870 2875 2880

Glu Arg Ala Gln Asn Val Thr Arg Leu Leu Arg Lys Gln Ala Glu

2885 2890 2895

Glu Val Asn Thr Glu Trp Glu Lys Leu Asn Leu His Ser Ala Asp

2900 2905 2910

Trp Gln Arg Lys Ile Asp Glu Ala Leu Glu Arg Leu Gln Glu Leu

2915 2920 2925

Gln Glu Ala Thr Asp Glu Leu Asp Leu Lys Leu Arg Gln Ala Glu

2930 2935 2940

Val Ile Lys Gly Ser Trp Gln Pro Val Gly Asp Leu Leu Ile Asp

2945 2950 2955

Ser Leu Gln Asp His Leu Glu Lys Val Lys Ala Leu Arg Gly Glu

2960 2965 2970

Lys Ala Pro Leu Lys Glu Asn Val Ser His Val Asn Asp Leu Ala

2975 2980 2985

Arg Gln Leu Thr Thr Leu Gly Ile Gln Leu Ser Pro Tyr Asn Leu

2990 2995 3000

Ser Thr Leu Glu Asp Leu Asn Thr Arg Trp Lys Leu Leu Gln Val

3005 3010 3015

Ala Val Glu Asp Arg Ile Arg Gln Leu His Glu Ala His Arg Asp

3020 3025 3030

Phe Gly Pro Ala Ser Gln His Phe Leu Ser Thr Ser Val Gln Gly

3035 3040 3045

Pro Trp Glu Arg Ala Ile Ser Pro Asn Lys Val Pro Tyr Tyr Ile

3050 3055 3060

Asn His Glu Thr Gln Thr Thr Cys Trp Asp His Pro Lys Met Thr

3065 3070 3075

Glu Leu Tyr Gln Ser Leu Ala Asp Leu Asn Asn Val Arg Phe Ser

3080 3085 3090

Ala Tyr Arg Thr Ala Met Lys Leu Arg Arg Leu Gln Lys Ala Leu

3095 3100 3105

Cys Leu Asp Leu Leu Ser Leu Ser Ala Ala Cys Asp Ala Leu Asp

3110 3115 3120

Gln His Asn Leu Lys Gln Asn Asp Gln Pro Met Asp Ile Leu Gln

3125 3130 3135

Ile Ile Asn Cys Leu Thr Thr Val Tyr Asp Arg Leu Glu Gln Glu

3140 3145 3150

His Asn Asn Leu Val Asn Val Pro Leu Cys Val Asp Met Cys Leu

3155 3160 3165

Asn Trp Leu Leu Asn Val Tyr Asp Thr Gly Arg Thr Gly Arg Ile

3170 3175 3180

Arg Val Leu Ser Phe Lys Thr Gly Ile Val Ser Leu Cys Lys Ala

3185 3190 3195

His Leu Glu Asp Lys Tyr Arg Tyr Leu Phe Lys Gln Val Ala Ser

3200 3205 3210

Ser Thr Gly Phe Cys Asp Gln Arg Arg Leu Gly Leu Leu Leu His

3215 3220 3225

Asp Ser Ile Gln Ile Pro Arg Gln Leu Gly Glu Val Ala Ser Phe

3230 3235 3240

Gly Gly Ser Asn Ile Glu Pro Ser Val Arg Ser Cys Phe Gln Phe

3245 3250 3255

Ala Asn Asn Lys Pro Glu Ile Glu Ala Ala Leu Phe Leu Asp Trp

3260 3265 3270

Met Arg Leu Glu Pro Gln Ser Met Val Trp Leu Pro Val Leu His

3275 3280 3285

Arg Val Ala Ala Ala Glu Thr Ala Lys His Gln Ala Lys Cys Asn

3290 3295 3300

Ile Cys Lys Glu Cys Pro Ile Ile Gly Phe Arg Tyr Arg Ser Leu

3305 3310 3315

Lys His Phe Asn Tyr Asp Ile Cys Gln Ser Cys Phe Phe Ser Gly

3320 3325 3330

Arg Val Ala Lys Gly His Lys Met His Tyr Pro Met Val Glu Tyr

3335 3340 3345

Cys Thr Pro Thr Thr Ser Gly Glu Asp Val Arg Asp Phe Ala Lys

3350 3355 3360

Val Leu Lys Asn Lys Phe Arg Thr Lys Arg Tyr Phe Ala Lys His

3365 3370 3375

Pro Arg Met Gly Tyr Leu Pro Val Gln Thr Val Leu Glu Gly Asp

3380 3385 3390

Asn Met Glu Thr Pro Val Thr Leu Ile Asn Phe Trp Pro Val Asp

3395 3400 3405

Ser Ala Pro Ala Ser Ser Pro Gln Leu Ser His Asp Asp Thr His

3410 3415 3420

Ser Arg Ile Glu His Tyr Ala Ser Arg Leu Ala Glu Met Glu Asn

3425 3430 3435

Ser Asn Gly Ser Tyr Leu Asn Asp Ser Ile Ser Pro Asn Glu Ser

3440 3445 3450

Ile Asp Asp Glu His Leu Leu Ile Gln His Tyr Cys Gln Ser Leu

3455 3460 3465

Asn Gln Asp Ser Pro Leu Ser Gln Pro Arg Ser Pro Ala Gln Ile

3470 3475 3480

Leu Ile Ser Leu Glu Ser Glu Glu Arg Gly Glu Leu Glu Arg Ile

3485 3490 3495

Leu Ala Asp Leu Glu Glu Glu Asn Arg Asn Leu Gln Ala Glu Tyr

3500 3505 3510

Asp Arg Leu Lys Gln Gln His Glu His Lys Gly Leu Ser Pro Leu

3515 3520 3525

Pro Ser Pro Pro Glu Met Met Pro Thr Ser Pro Gln Ser Pro Arg

3530 3535 3540

Asp Ala Glu Leu Ile Ala Glu Ala Lys Leu Leu Arg Gln His Lys

3545 3550 3555

Gly Arg Leu Glu Ala Arg Met Gln Thr Leu Glu Asp His Asn Lys

3560 3565 3570

Gln Leu Glu Ser Gln Leu His Arg Leu Arg Gln Leu Leu Glu Gln

3575 3580 3585

Pro Gln Ala Glu Ala Lys Val Asn Gly Thr Thr Val Ser Ser Pro

3590 3595 3600

Ser Thr Ser Leu Gln Arg Ser Asp Ser Ser Gln Pro Met Leu Leu

3605 3610 3615

Arg Val Val Gly Ser Gln Thr Ser Glu Ser Met Gly Glu Glu Asp

3620 3625 3630

Leu Leu Ser Pro Pro Gln Asp Thr Ser Thr Gly Leu Glu Glu Val

3635 3640 3645

Met Glu Gln Leu Asn Asn Ser Phe Pro Ser Ser Arg Gly Arg Asn

3650 3655 3660

Thr Pro Gly Lys Pro Val Arg Glu Asp Thr Met

3665 3670

<210> 5

<211> 1158

<212> DNA

<213> Sus scrofa

<400> 5

taaaacacgc aacttcatat tatacactta ttctagtgaa gttgtgctca cctggggata 60

gtttttttct tcaaggtatt atttgacagt gcttcaaggc atttttgttt ggcacaactg 120

ggtggaggct actggcatac tagtggggga atgccaggga taccattcaa cctcctacaa 180

tgcccagagt agcccatcgc agctaagaat tacccaacct taaatgtcag tggtgctgag 240

gttgagaaat actgctctag tttaataaca taatattgtt ggaattttaa aattggaatt 300

ttttctggac taattttaat atcttctttt agagattttt gatattgaaa tgatctgtga 360

acaaattttc tttcaaaacc gtatatcgtt accatgtttt atattgctta ttttttgaaa 420

gcatgtgcct ttttttagtt ttctttttaa aaagttacag aaaaattttg tttataaaag 480

tattatttca ttcttctatc tccaggctag aagaacaaaa aaatatcttg tcagaatttc 540

aaagagattt aaatgaattt gttttatggc tggaagaagc agacaacatt actagtgttg 600

cacttgagcc tggaaatgag cagcaactaa aagaaaaact tgaagaaatc aaggtaattt 660

tattttctaa aatcacccag ggcctacttg tataaagagt atatgaacct attttttaat 720

gtattaatca ttggttttct gcccattagg ttatttatag ttcctcagta gttttcctca 780

caactttatt ttgtcttaat cccagtgttt cttaatgagt atatatacat ttttaaaagt 840

gtgtatggga tgtgtatgtg tgtaaaatgc atagtagtat ttcttaaatt aatttgaaat 900

taattttaga gttaatggag gattccacag ctccaaatta ttgcaaaaac tgatgagaat 960

tctttataga aatgaatctc atttcttagg gaagatctta attgctaaat caatctcact 1020

acttcagcct ctaattaaag gcattcaatt tgcctgaagc aatgttttgg tttggtttgt 1080

ttttttttgc agggtgggga gtggtggttc actttcaata gtgattgaat cgacttcagt 1140

ttattcaagt gtcttttc 1158

<210> 6

<211> 100

<212> RNA

<213> Artificial sequence

<400> 6

uauuucauuc uucuaucucc guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 7

<211> 100

<212> RNA

<213> Artificial sequence

<400> 7

uaaaacaugg uaacgauaua guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 8

<211> 100

<212> RNA

<213> Artificial sequence

<400> 8

aaaauaagca auauaaaaca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 9

<211> 100

<212> RNA

<213> Artificial sequence

<400> 9

ucuuuauaca aguaggcccu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 10

<211> 100

<212> RNA

<213> Artificial sequence

<400> 10

cucuuuauac aaguaggccc guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 11

<211> 100

<212> RNA

<213> Artificial sequence

<400> 11

cauauacucu uuauacaagu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

Claims

Combination of sgrnas, consisting of sgrnas _DMD-Ug3 And sgRNA _DMD-Dg3 Composition;

the sgRNA _DMD-Ug3 The target sequence binding region of (a) is as set forth in SEQ ID NO:8 from nucleotide 1 to nucleotide 20;

the sgRNA _DMD-Dg3 The target sequence binding region of (a) is as set forth in SEQ ID NO:11 from nucleotide 1 to nucleotide 20.
2. Plasmid combination consisting of plasmid pKG-U6gRNA (DMD-Ug 3) and plasmid pKG-U6gRNA (DMD-Dg 3);

the plasmid pKG-U6gRNA (DMD-Ug 3) was obtained by introducing the sgRNA with the aid of the restriction enzyme BbsI _DMD-Ug3 The target sequence binding region of (a) is inserted into a pKG-U6gRNA vector;

the plasmid pKG-U6gRNA (DMD-Dg 3) was obtained by introducing the sgRNA with the aid of the restriction enzyme BbsI _DMD-Dg3 The target sequence binding region of (a) is inserted into a pKG-U6gRNA vector;

the sgRNA _DMD-Ug3 The target sequence binding region of (a) is as set forth in SEQ ID NO:8 from nucleotide 1 to nucleotide 20;

the sgRNA _DMD-Dg3 The target sequence binding region of (a) is as set forth in SEQ ID NO:11 from nucleotide 1 to nucleotide 20;

the plasmid pKG-U6gRNA is shown as SEQ ID NO: 3.
3. A kit comprising the sgRNA combination of claim 1 or the plasmid combination of claim 2; the kit is used as follows (a) or (b): (a) preparing a recombinant cell; (b) preparing an animal model of duchenne muscular dystrophy.
4. A kit according to claim 3, wherein: the kit also comprises a plasmid pKG-GE3; the plasmid pKG-GE3 is shown as SEQ ID NO: 2.
5. Use of the sgRNA combination of claim 1 or the plasmid combination of claim 2 in the preparation of a kit; the kit is used as follows (a) or (b): (a) preparing a recombinant cell; (b) preparing an animal model of duchenne muscular dystrophy.
6. Use of the plasmid combination according to claim 2 and the plasmid pKG-GE3 according to claim 4 in the co-preparation of a kit; the kit is used as follows (a) or (b): (a) preparing a recombinant cell; (b) preparing an animal model of duchenne muscular dystrophy.
7. Use of the sgRNA combination of claim 1 or the plasmid combination of claim 2 or the kit of claim 3 or the kit of claim 4, said use being as follows (a) or (b): (a) preparing a recombinant cell; (b) preparing an animal model of duchenne muscular dystrophy.
8. A method of preparing a recombinant cell comprising the steps of: cotransfecting a pig cell with the plasmid pKG-U6gRNA (DMD-Ug 3) of claim 2, the plasmid pKG-U6gRNA (DMD-Dg 3) of claim 2 and the plasmid pKG-GE3 of claim 4 to obtain a recombinant cell with a mutation in the dystrophin gene.
9. The recombinant cell prepared by the method of claim 8.
10. Use of the recombinant cell of claim 9 in the preparation of an animal model of duchenne muscular dystrophy.