CN112795566B - OPG gene editing system for constructing osteoporosis clone pig nuclear donor cell line and application thereof - Google Patents

Abstract

The invention discloses an OPG gene editing system for constructing an osteoporosis clone pig nuclear donor cell line and application thereof. A CRISPR/Cas9 system for porcine OPG gene editing comprising a Cas9 expression vector and a gRNA expression vector; the Cas9 expression vector is a pKG-GE3 vector with the complete sequence of the plasmid shown as SEQ ID NO. 2; the expression sequence of the gRNA expression vector is shown as SEQ ID NO: 49. The gene editing is carried out by adopting the Cas9 high-efficiency expression vector jointly modified by the gRNA screened by the invention, and the editing efficiency is obviously improved compared with that of the original vector.

Description

OPG gene editing system for constructing osteoporosis clone pig nuclear donor cell line and application thereof

Technical Field

The invention belongs to the technical field of gene editing, and particularly relates to an OPG gene editing system for constructing an osteoporosis clone pig nuclear donor cell line.

Background

Osteoporosis (OP) is caused by an imbalance between bone resorption and bone formation, a systemic metabolic disease of bone characterized by low bone mass and microstructural destruction of bone tissue, increased bone fragility and susceptibility to fracture. Modern medicine classifies osteoporosis into three major categories, primary, secondary and idiopathic osteoporosis. Primary osteoporosis is a sudden decrease in sex hormones in the body and a physiological degenerative change due to age, and is classified into type i postmenopausal osteoporosis and type ii senile osteoporosis. Secondary osteoporosis is induced by diseases or drug factors, diseases such as endocrine metabolic diseases (diabetes and hyperthyroidism), kidney diseases, liver diseases and the like, and drug induction such as application of heparin, immunosuppressant, antiepileptic drugs and glucocorticoid in long-term large dosage. Idiopathic osteoporosis is generally accompanied by a history of genetic diseases, is common in women, and is often classified as osteoporosis in lactation and pregnancy of women.

The large-scale epidemiological investigation and research in China show that the total disease rate of osteoporosis in China is 12.4 percent, and the total number of people exceeds 1.6 hundred million. The bone is dynamic and constantly changing tissue, about 10 percent of the bone is renewed every year, namely dynamic balance between bone absorption and bone reconstruction is repeated circularly, and the osteoporosis is caused by the balance which is increased to the bone absorption and inclined to the bone reconstruction. OPG (Osteoprotegerin, also known as TNF receptor superfamily member11b, tnfrsf11b), which belongs to the TNF receptor superfamily member, plays an important role in the OPG/RANK/RANKL signaling pathway of bone metabolism. Binding of RANK to RANKL is important in osteoclast survival, differentiation and activation, and can promote enhancement of bone resorption, while OPG can competitively bind RANKL, block binding between RANKL and RANK, inhibit osteoclast activity, and thus block bone resorption. The interaction of the OPG, the RANKL and the RANK jointly forms a system for regulating the bone metabolism balance. The existing research results show that the loss of the function of the OPG gene can cause severe osteoporosis and is accompanied with the symptoms of reduction of cortex lycii radicis, trabecula ossis and the like, so that the establishment of the osteoporosis animal model based on the OPG gene mutation can provide a powerful experimental tool for researching and treating the osteoporosis of human beings. The pig is a large animal, is a main meat food supply animal for human for a long time, is easy to breed and feed in a large scale, has lower requirements on ethics, animal protection and the like, has the body size and the physiological function similar to those of human, and is an ideal human disease model animal.

Gene editing is a biotechnology that has been under significant development in recent years, including injection from embryonic stem cells based on homologous recombination into nuclease-based ZFNs, TALENs, CRISPR/Cas9, etc., with CRISPR/Cas9 technology being the currently most advanced gene editing technology. Currently, gene editing techniques are increasingly applied to the production of animal models. For example, in the method of embryo transplantation after injecting gene editing material into fertilized ovum microinjection adopted in the mouse model making, because the probability of directly obtaining homozygous mutant offspring is very low (less than 5 percent), the offspring hybridization breeding is needed, which is not suitable for making the model of large animals (such as pigs) with longer gestation period.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provide a CRISPR/Cas9 system for pig OPG gene editing.

Another objective of the invention is to provide a target gRNA for OPG gene editing and an expression vector thereof.

It is still another object of the present invention to provide recombinant porcine fibroblasts.

The purpose of the invention can be realized by the following technical scheme:

a CRISPR/Cas9 system for porcine OPG gene editing comprising a Cas9 expression vector and a gRNA expression vector; the Cas9 expression vector is a pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO vector with the complete sequence of the plasmid shown as SEQ ID NO. 2; the expression sequence of the gRNA expression vector is shown as SEQ ID NO: a gRNA shown at 49.

As a preferable selection of the invention, the gRNA expression vector takes pKG-U6gRNA with the complete sequence shown in SEQ ID NO.3 as a vector framework.

As a further preferred embodiment of the present invention, the gRNA expression vector is a gRNA expression vector comprising SEQ ID NO:41 and SEQ ID NO:42, and cloning a double-stranded DNA molecule having a sticky end obtained by annealing the single-stranded DNA shown in 42 into a pKG-U6gRNA backbone vector.

As a further preferred aspect of the present invention, the molar ratio of the gRNA expression vector to the Cas9 expression vector is 1 to 3, and further preferred is 3.

A target gRNA for OPG gene editing has a sequence shown in SEQ ID NO: shown at 37.

A gRNA expression vector for pig OPG gene uses pKG-U6gRNA with the complete sequence shown in SEQ ID NO.3 as a vector framework to express SEQ ID NO: 49.

As a preferred embodiment of the present invention, the expression vector is a vector formed by SEQ ID NO:41 and SEQ ID NO:42, and cloning a double-stranded DNA molecule having a sticky end obtained by annealing the single-stranded DNA shown in 42 into a pKG-U6gRNA backbone vector.

The CRISPR/Cas9 system and the application of the gRNA expression vector aiming at the pig OPG gene in constructing the osteoporosis clone pig nuclear donor cell.

A recombinant porcine fibroblast is obtained by carrying out verification on a primary porcine fibroblast cotransfected by the CRISPR/Cas9 system.

The recombinant cell is applied to construction of an OPG gene knockout cloned pig; preferably in the construction of OPG gene knockout osteoporosis clone pigs.

Compared with the prior art, the invention has at least the following beneficial effects:

(1) According to the invention, a Cas9 expression vector is modified, and compared with a pX330 vector before modification, the modified pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO vector has the advantages that a stronger promoter is replaced, a protein translation enhancing element is added, the Cas9 expression is improved, the number of nuclear localization signals is increased, the nuclear localization capability of the Cas9 protein is improved, and the gene editing efficiency is higher. The invention also adds a fluorescent marker and a resistance marker in the vector, so that the vector can be more conveniently applied to screening and enrichment of vector positive transformed cells. The gene editing is carried out by adopting the Cas9 high-efficiency expression vector jointly modified by the gRNA screened by the invention, and the editing efficiency is obviously improved compared with that of the original vector.

(2) The Cas9 high-efficiency expression vector modified by the invention is adopted to carry out gene editing, the genotype of the obtained cells (homozygous mutation comprises double allele same mutation and double allele different mutation, heterozygous mutation or wild type) can be analyzed through the sequencing result of the target gene PCR product, the probability of obtaining the homozygous mutation is 30-50%, and is superior to the probability (lower than 5%) of obtaining the homozygous mutation in a model preparation method (namely a fertilized egg injection gene editing material) by using an embryo injection technology.

(3) The research object pig has better application than other animals (big and small mice, primates). Rodents such as rats and mice are greatly different from humans in physiology, pathology and body type, and cannot truly simulate normal physiology and pathology of humans. The primate has the advantages of low propagation speed, small quantity, high cost, high requirements on animal protection, ethics and the like. The pig has no defects, and the pig cloning technology is mature, and the feeding and cloning cost is much lower than that of a primate. Pigs are therefore very suitable animals as models for human diseases.

(4) The homozygous mutant monoclonal cell strain obtained by the invention is used for somatic cell nuclear transplantation animal cloning to directly obtain a cloned pig containing target gene homozygous mutation, and the homozygous mutation can be stably inherited.

The invention adopts the method of primary cells with great technical difficulty and high challenge to edit and screen the positive editing monoclonal cells in vitro, and directly obtains the corresponding disease model pig by the somatic cell nuclear transfer animal cloning technology in the later stage, thereby greatly shortening the manufacturing period of the model pig and saving manpower, material resources and financial resources.

Drawings

FIG. 1 is a schematic diagram of the structure of plasmid pX330.

FIG. 2 is a schematic diagram of the structure of plasmid pU6gRNAcas 9.

FIG. 3 is a structural map of pU6gRNA-eEF1a Cas9 vector.

FIG. 4 is a pU6gRNA-eEF1a Cas9+ nNLS vector map.

FIG. 5 is a schematic diagram of the structure of plasmid pKG-GE3.

FIG. 6 is a schematic structural diagram of plasmid pKG-U6 gRNA.

FIG. 7 is a schematic diagram of the insertion of a DNA molecule of about 20bp (the target sequence binding region for transcription to form a gRNA) into the plasmid pKG-U6 gRNA.

FIG. 8 is a graph of the sequencing peaks of step 2.3.3 in example 2.

FIG. 9 is a graph of the sequencing peaks of step 2.4.3 in example 2.

FIG. 10 is an electrophoretogram obtained after PCR amplification of the primer pairs consisting of OPG-E2g-F3/OPG-E2g-R675 (group 1), OPG-E2g-F3/OPG-E2g-R869 (group 2), OPG-E2g-F4/OPG-E2g-R675 (group 3) and OPG-E2g-F4/OPG-E2g-R869 (group 4) using porcine genomic DNA as a template in step 3.2.3 of example 3, respectively.

FIG. 11 is an electrophoretogram after PCR amplification of a primer pair consisting of OPG-E2g-F4/OPG-E2g-R869 using 18 pig genomic DNAs as templates in step 3.2.4 of example 3.

FIG. 12 is an electrophoretogram obtained after PCR amplification of a primer pair consisting of OPG-E2g-F4/OPG-E2g-R869 using genomic DNA as a template in step 3.6.4 of example 3.

FIG. 13 is an electrophoretogram obtained after PCR amplification of a primer pair consisting of OPG-E2g-F4/OPG-E2g-R869 using genomic DNA as a template in step 4.4.4 of example 4.

FIG. 14 is an electrophoretogram obtained after PCR amplification of a primer pair consisting of OPG-E2g-F4/OPG-E2g-R869 using genomic DNA as a template in step 5.4.4 of example 5.

FIG. 15 is an exemplary sequencing peak plot for the determination of the target gene as wild-type at step 5.4.5 in example 5.

FIG. 16 is a graph of exemplary sequencing peaks for the determination of biallelic identity of the target gene at step 5.4.5 in example 5.

FIG. 17 is a graph of exemplary sequencing peaks for the determination of heterozygous mutations for the target gene at step 5.4.5 of example 5.

FIG. 18 is an exemplary sequencing peak plot for determining biallelic differential mutation of the target gene at step 5.4.5 in example 5.

Detailed Description

Example 1 preparation of plasmid

1.1 preparation of plasmid pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO (plasmid pKG-GE3 for short)

The original plasmid pX330-U6-Chimeric _ BB-CBh-hSpCas9 (plasmid pX330 for short) has a sequence shown in SEQ ID NO:1 is shown. The schematic structure of plasmid pX330 is shown in FIG. 1.SEQ ID NO:1, the 440 th to 725 th nucleotides form CMV enhancer, the 727 th to 1208 th nucleotides form chicken beta-actin promoter, the 1304 th to 1324 th nucleotides encode SV40 Nuclear Localization Signal (NLS), the 1325 th to 5449 th nucleotides encode Cas9 protein, and the 5450 th to 5497 th nucleotides encode nucleoplasmin Nuclear Localization Signal (NLS).

Plasmid pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO, which is called plasmid pKG-GE3 for short, and the nucleotide is shown in SEQ ID NO:2, respectively. Compared with plasmid pX330, plasmid pKG-GE3 was mainly modified as follows: (1) removing residual gRNA framework sequence (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTTT) to reduce interference; (2) the original chicken beta-actin promoter is transformed into an EF1a promoter with higher expression activity, so that the protein expression capacity of the Cas9 gene is increased; (3) a nuclear localization signal coding gene (NLS) is added at the upstream and the downstream of the Cas9 gene, and the nuclear localization capacity of the Cas9 protein is increased; (4) the original plasmid does not have any eukaryotic cell screening marker, is not beneficial to screening and enriching of positive transformed cells, and is sequentially inserted with a P2A-EGFP-T2A-PURO coding gene at the downstream of a Cas9 gene to endow the vector with fluorescence and eukaryotic cell resistance screening capacity; (5) WPRE element and 3' LTR sequence element are inserted to enhance protein translation capability of Cas9 gene.

The pKG-GE3 plasmid was constructed as follows:

(1) Removal of redundant null sequences in the gRNA backbone

Plasmid pX330 was digested with BbsI and XbaI, the vector fragment (about 8313 bp) was recovered, an insert 175bp (SEQ ID NO: 4) was synthesized by a multi-fragment recombination method, and the recovered vector fragment was recombined to obtain the pU6gRNAcas9 vector (FIG. 2).

(2) Engineering promoters and enhancers

For the constructed pU6gRNAcas9 vector, xbaI and AgeI endonuclease are used to remove promoter (chicken beta-actin promoter) and enhancer sequence (CMV enhancer), linear vector sequence is recovered by about 7650bp, 554bp sequence containing CMV enhancer and EF1a promoter (SEQ ID NO: 5) is synthesized by a multi-fragment recombination method, and the sequence is recombined with the vector pU6gRNAcas9 after the enzyme digestion to obtain pU6gRNA-eEF1a Cas9 vector (figure 3).

(3) Cas9 gene N-terminal increasing NLS sequence

The constructed vector pU6gRNA-eEF1a Cas9 is subjected to enzyme digestion by AgeI and BglII, a 7786bp vector sequence is recovered, a sequence with increased NLS is supplemented to an enzyme digestion site, namely a 447bp Cas9 coding sequence (SEQ ID NO: 6) comprising 2 nuclear localization signals and partial excision is synthesized by a multi-fragment recombination method, and a pU6gRNA-eEF1a Cas9+ nNLS vector is obtained by recombination (figure 4).

(4) NLS, P2A-EGFP-T2A-PURO and WPRE-3' LTR-bGH polyA signals are added to the C end of Cas9 gene

The vector constructed above is named pU6gRNA-eEF1a Cas9+ nNLS, digestion is carried out by using FseI and SbfI, the 7781bp vector sequence is recovered, 2727bp fragment (SEQ ID NO: 7) comprising NLS-P2A-EGFP-T2A-PURO-WPRE-3 LTR-bGH polyA signals is synthesized by a multi-fragment recombination method, recombination is carried out with the vector fragment to obtain pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO which is called pKG-3 for short, and the plasmid map is shown in figure 5 and the nucleotide sequence (SEQ ID NO: 2).

SEQ ID NO:2, nucleotides 395 to 680 form a CMV enhancer, nucleotides 682 to 890 form an EF1a promoter, nucleotides 986 to 1006 encode a Nuclear Localization Signal (NLS), nucleotides 1016 to 1036 encode a Nuclear Localization Signal (NLS), nucleotides 1037 to 5161 encode a Cas9 protein, nucleotides 5162 to 5209 encode a Nuclear Localization Signal (NLS), nucleotides 5219 to 5266 encode a Nuclear Localization Signal (NLS), nucleotides 5276 to 5332 encode a self-cleaving polypeptide P2A (the amino acid sequence of the self-cleaving polypeptide P2A is "ATNFSLLKQACGDVEENPGP", the cleavage site occurring from the cleavage site is between the first and second amino acid residues C-terminal), nucleotides 5333 to 6046 encode an EGFP protein, nucleotides 6056 to 609 encode a self-cleaving polypeptide T2A (the amino acid sequence of the self-cleaving polypeptide T2A is "EGLTCGVEENP", the cleavage site occurring from the first and second amino acid residues 617647), nucleotides 677647 to 6747 encode a RGBW 10 protein), and nucleotides 677647 to 6747 encode a RGBW 10 protein (RGBW) for short. The amino acid sequence of SEQ ID NO: in 2, 911-6706 form a fusion gene, expressing the fusion protein. Due to the presence of the self-cleaving polypeptide P2A and the self-cleaving polypeptide T2A, the fusion protein spontaneously forms the following three proteins: proteins with Cas9 protein, proteins with EGFP protein and proteins with Puro protein.

1.2 construction of pKG-U6gRNA vector

A pUC57 vector is derived, a pKG-U6gRNA insertion sequence (a DNA fragment containing a U6 promoter, a BbsI enzyme cutting site and a sgRNA framework sequence, the sequence is shown in SEQ ID NO: 8) is connected through an EcoRV enzyme cutting site, and the pKG-U6gRNA insertion sequence is reversely inserted into the pUC57 vector to obtain a pKG-U6gRNA vector complete sequence (SEQ ID NO: 3), SEQ ID NO:3, the 2280 th to 2539 th nucleotides form the hU6 promoter, and the 2558 th to 2637 th nucleotides are used for transcription to form a gRNA framework. When the recombinant plasmid is used, a DNA molecule (a target sequence binding region for forming gRNA through transcription) of about 20bp is inserted into the plasmid pKG-U6gRNA to form a recombinant plasmid, and the recombinant plasmid is transcribed in a cell to obtain the gRNA. The map of the constructed pKG-U6gRNA vector is shown in FIG. 6.

Example 2 optimization of plasmid proportion and comparison of the Effect of plasmid pX330 and plasmid pKG-GE3

2.1 target gRNA design and construction

2.1.1 target gRNA design of RAG1 Gene Using Benchling

RAG1-g4：AGTTATGGCAGAACTCAGTG(SEQ ID NO.9)

The synthesis of the insertion sequence complementary DNA oligo for the RAG1 gene target is as follows:

RAG1-gRNA4S：caccgAGTTATGGCAGAACTCAGTG(SEQ ID NO.10)

RAG1-gRNA4A：aaacCACTGAGTTCTGCCATAACTc(SEQ ID NO.11)

RAG1-gRNA4S and RAG1-gRNA4A are single-stranded DNA molecules.

2.1.2 primers designed for amplification and detection of fragments containing the RAG1 gRNA target

RAG1-nF126：CCCCATCCAAAGTTTTTAAAGGA(SEQ ID NO.12)

RAG1-nR525：TGTGGCAGATGTCACAGTTTAGG(SEQ ID NO.13)

2.1.3 method for cloning gRNA sequences onto pKG-U6gRNA backbone vectors

1) Digesting 1ug pKG-U6gRNA plasmid by using restriction enzyme BbsI;

2) Separating the digested pKG-U6gRNA plasmid by agarose gel (agarose gel concentration is 1%, namely 1g of agarose gel is added into 100mL of electrophoresis buffer solution), and purifying and recovering the digested product by a gel recovery kit (Vazyme);

3) 2 complementary DNA oligos synthesized from the target of 2.1.1 are annealed to form a DNA double strand complementary to the cleaved sticky end of pKG-U6gRNA vector BbsI, as shown in FIG. 7:

95 ℃ for 5min and then reducing the temperature to 25 ℃ at the speed of 5 ℃/min;

4) The ligation reaction was initiated as follows: reacting at room temperature for 10min

5) Transformation of

The procedure was performed according to the instructions for competent cells (Vazyme).

2.1.4 gRNA vector construction

1) The synthesized RAG1-gRNA4S and RAG1-gRNA4A were mixed and annealed to obtain a double-stranded DNA molecule having a cohesive end. The double-stranded DNA molecule having the cohesive ends was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (RAG 1-gRNA 4). Plasmid pKG-U6gRNA (RAG 1-gRNA 4) will express the RAG1-gRNA4 shown in SEQ ID No. 14.

2.1.5 gRNA vector identification

Picking a single clone from an LB flat plate, placing the single clone into an LB culture solution added with corresponding antibiotics, culturing the single clone in a constant temperature shaking table at 37 ℃ for 12-16h, sending the small upgraded grains to a general company for sequencing, and confirming that the construction of the RAG1-gRNA4 vector is successful through sequence comparison.

2.2 preparation of Primary pig fibroblasts

2.2.1 taking 0.5g of ear tissue of a newborn juniperus domestica, removing external tissue, and soaking in 75% alcohol for 30-40s;

2.2.2 washing 5 times with PBS containing 5% P/S (Gibco Penicillin-Streptomyces), once with PBS without P/S;

wherein 5% P/S PBS formulation is: 5% P/S (Gibco Penicillin-Streptomyces) +95% PBS,5%, 95% in% by volume.

2.2.3 shearing the tissue with scissors, adding 5mL of 0.1% collagenase (Sigma) solution, digesting for 1h at 37 ℃ in a shaker;

2.2.4 500g centrifugation for 5min, supernatant removed, pellet resuspended in 1mL complete medium, plated into 10cm cell culture dish containing 10mL complete medium and sealed with 0.2% gelatin (VWR).

Wherein, the formula of the complete cell culture medium is as follows: 15% fetal bovine serum (Gibco) +83% DMEM medium

(Gibco) +1% P/S (Gibco Penicillin-Streptomyces) +1% HEPES (Solambio), 15%, 83%, 1% in% by volume.

2.2.5% by volume of CO2, 5% by volume of O2, in an incubator at 37 ℃;

2.2.6 cells were cultured to about 60% full bottom of dish and then digested with 0.25% (Gibco) trypsin, complete medium was added to stop digestion, the cell suspension was transferred to a 15mL centrifuge tube, centrifuged at 400g for 4min, the supernatant was discarded, and the cells were resuspended in 1mL complete medium for further nuclear transfection experiments.

2.3 plasmid proportioning optimization

2.3.1 Co-transfection grouping

A first group: plasmid pKG-U6gRNA (RAG 1-gRNA 4) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.44 μ g plasmid pKG-U6gRNA (RAG 1-gRNA 4): 1.56. Mu.g of plasmid pKG-GE3. Namely, the molar ratio of the plasmid pKG-U6gRNA (RAG 1-gRNA 4) to the plasmid pKG-GE3 is 1:1.

second group: the plasmid pKG-U6gRNA (RAG 1-gRNA 4) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.72 μ g plasmid pKG-U6gRNA (RAG 1-gRNA 4): 1.28. Mu.g of plasmid pKG-GE3. Namely, the molar ratio of the plasmid pKG-U6gRNA (RAG 1-gRNA 4) to the plasmid pKG-GE3 is 2:1.

third group: plasmid pKG-U6gRNA (RAG 1-gRNA 4) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (RAG 1-gRNA 4): 1.08. Mu.g of plasmid pKG-GE3. Namely, the molar ratio of the plasmid pKG-U6gRNA (RAG 1-gRNA 4) to the plasmid pKG-GE3 is 3:1.

and a fourth group: plasmid pKG-U6gRNA (RAG 1-gRNA 4) was transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: mu.g of plasmid pKG-U6gRNA (RAG 1-gRNA 4).

2.3.2 Co-transfection procedure

Transfection experiments were performed using a mammalian fibroblast cell nuclear transfection kit (Neon) with a Neon TM transfection system electrotransfer.

1) Preparing electrotransformation reaction liquid according to the above groups, and deliberately not generating bubbles in the process of uniformly mixing;

2) Washing the cell suspension prepared in the first step once by using PBS phosphate buffer (Solarbio), centrifuging for 6min at 600g, discarding supernatant, and resuspending the cells by using 11 mu L of electric rotating basic solution Opti-MEM, wherein bubbles are prevented from being generated in the process of resuspension;

3) Sucking 10 mu L of cell suspension, adding the cell suspension into the electrotransformation reaction liquid obtained in the step 1), uniformly mixing, and intentionally preventing bubbles from being generated in the uniformly mixing process;

4) Placing the electric rotating cup with the reagent cassette in a cup groove of a Neon (TM) transformation system electric rotating instrument, and adding 3mL of E Buffer;

5) Sucking 10 μ L of the mixed solution obtained in step 3) with an electric rotary gun, inserting into a click cup, selecting an electric rotary program (1450V 10ms3pulse), transferring the electric rotary gun-mixed solution into 6-well plates in a super clean bench immediately after electric shock transfection, each well containing 3mL of a complete culture solution of 15% fetal bovine serum (Gibco) +83% DMEM medium (Gibco) +1% P/S (Gibco penillin-Streptmycin) +1% HEPES (Solarbio);

6) Mixing, and culturing in constant temperature incubator at 37 deg.C, 5% CO2, 5% O2;

7) After 6-12h of electrotransformation, the solution was changed, and 36-48h were digested with 0.25% (Gibco) trypsin and the cells were collected in a 1.5mL centrifuge tube.

2.3.3 Gene editing efficiency analysis

Extracting the cellular genomic DNA collected in 2.3.2, performing PCR amplification by using a primer pair consisting of RAG1-nF126 and RAG1-nR525, and sequencing the product. The sequencing result utilizes a webpage version synthgo ICE tool to analyze the sequencing peak map to obtain that the editing efficiency of the first group, the second group and the third group is 9%, 53% and 66% in sequence, and an exemplary peak map of the sequencing result is shown in figure 8. Analysis confirms that the gene editing efficiency of the third group is the highest, namely the optimal dosage of the gRNA plasmid and the Cas9 plasmid is determined as the molar ratio of 3:1, the actual amount of plasmid is 0.92. Mu.g: 1.08. Mu.g.

2.4 comparison of the Effect of plasmid pX330 and plasmid pKG-GE3

2.4.1 Co-transfection grouping

RAG1-330 group: plasmid pKG-U6gRNA (RAG 1-gRNA 4) and plasmid pX330 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (RAG 1-gRNA 4): 1.08. Mu.g of plasmid pX330.

Group RAG 1-KG: plasmid pKG-U6gRNA (RAG 1-gRNA 4) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (RAG 1-gRNA 4): 1.08. Mu.g of plasmid pKG-GE3.

RAG1-B group: plasmid pKG-U6gRNA (RAG 1-gRNA 4) was transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92. Mu.g of plasmid pKG-U6gRNA (RAG 1-gRNA 4).

2.4.2 Co-transfection procedure

As in this example 2.3.2.

2.4.3 Gene editing efficiency analysis

Extracting the cellular genomic DNA collected in 2.4.2, performing PCR amplification by using a primer pair consisting of RAG1-nF126 and RAG1-nR525, and sequencing the product. The sequencing result utilizes a webpage version synthgo ICE tool to analyze a sequencing peak map to obtain that the editing efficiency of a RAG1-330 group and a RAG1-KG group is respectively 28% and 68%, an exemplary peak map of the sequencing result is shown in figure 9, and the result shows that compared with the plasmid pX330, the gene editing efficiency is obviously improved by adopting the plasmid pKG-GE3.

Example 3OPG gene screening for efficient sgRNA target 1

3.1 extraction of genomic DNA

Genomic DNA of ear tissues of 18 pigs (male A, B, C, D, E, F, G, H, female 1, 2, 3, 4, 5, 6, 7, 8, 9, 10) was extracted in a column using Fastpure Cell/Tissue DNA Isolation Mini Kit (Vazyme Cat. DC102-01) of Vazyme, and quantified by NanoDrop and stored at-20 ℃ for future use.

3.2 Conservation analysis of preset target and adjacent genome sequence of OPG gene knockout

3.2.1 pig OPG Gene information

Encodes an osteoprotegerin protein, also known as TNF receptor superfamily member11B (TNFRSF 11B); is located on chromosome 4; geneID is 100049688, sus scrofa. The amino acid sequence of the pig OPG gene code is shown in SEQ ID NO. 15. It has been shown that OPG plays a central role in the regulation of osteoclast differentiation and activity, and in porcine genomic DNA, the OPG gene has 5 exons, of which exon 2 occupies an important position in all transcripts (the exon 2 sequence of the porcine OPG gene, including part of the intron 1 and part of the intron 2 sequence, is shown in SEQ ID NO. 16).

3.2.2OPG Gene knock-out Preset target exon and adjacent genome sequence PCR amplification primer design

According to the found porcine OPG genome sequence

(https://www.ncbi.nlm.nih.gov/nuccore/NC_010446.5report＝genbank& from＝19850212&to＝19879132) And designing a primer to amplify the site of the exon 2 of the OPG gene of the 18 pig genome samples.

Primer design was performed using Oligo7, and the design results are as follows:

OPG-E2g-F3：ACTTTTTGAGGTTAACGATGC(SEQ ID NO.17)

OPG-E2g-R675：TGAGATTTGTCACTAAATTGT(SEQ ID NO.18)

OPG-E2g-F4：ACTCAGAGGCAAGAACTGTGG(SEQ ID NO.19)

OPG-E2g-R869：ACACAGAGGTATAGATCAGCT(SEQ ID NO.20)

3.2.3OPG genomic PCR amplification primer screening

Using the genome extracted from ear tissue of swine (female 1) as a template, PCR was performed using two designed upstream primers and two designed downstream primer combinations, max enzyme (Vazyme: P505), and the product was subjected to 1% agarose gel electrophoresis to screen for good amplification primers, as shown in FIG. 10, with group 1: primer OPG-E2g-F3/OPG-E2g-R675; group 2 is: primer OPG-E2g-F3/OPG-E2g-R869; group 3 is: primer OPG-E2g-F4/OPG-E2g-R675; group 4 is: the target fragment is amplified by using the primers OPG-E2g-F4/OPG-E2g-R869, preferably by using the primer pair OPG-E2g-F4/OPG-E2 g-R869.

3.2.4 PCR amplification of 18 pig OPG gene fragments

The amplification of the OPG genomic fragment was performed with 18 genomic templates (male A, B, C, D, E, F, G, H female 1, 2, 3, 4, 5, 6, 7, 8, 9, 10), primers OPG-E2G-F4/OPG-E2G-R869, max enzyme, and the product (865 bp) was subjected to 1% agarose gel electrophoresis, as shown in FIG. 11.

3.2.5OPG Gene sequence conservation analysis

The PCR amplification products are sequenced by using amplification primers (sequencing by general biology company), and the sequencing results are compared with the OPG gene sequences in public databases for analysis. According to the comparison result, the sequence of the amplified fragment is relatively conservative, and the designed primer has no possible mutation site.

3.3 gRNA target design and construction

3.3.1 target gRNA design Using Benchling

Designing a target to avoid possible mutation sites, and designing the target gRNA by using Benchling:

https://benchling.com/

the OPG gene knockout target is designed as follows:

OPG-E2-g1：TGTAGCACTCCAAATCCAGG(SEQ ID NO.21)

OPG-E2-g2：CCTCCTCGCATTCACACACG(SEQ ID NO.22)

OPG-E2-g3：CTGCAGTTCCTTGCACACTG(SEQ ID NO.23)

OPG-E2-g4：GTAATAGTGGTCAGGACAGG(SEQ ID NO.24)

the synthetic OPG gene has the following complementary DNA oligo of the insertion sequence of 4 targets:

OPG-E2-gRNA1-S：caccgTGTAGCACTCCAAATCCAGG(SEQ ID NO.25)

OPG-E2-gRNA1-A：aaacCCTGGATTTGGAGTGCTACAc(SEQ ID NO.26)

OPG-E2-gRNA2-S：caccgCCTCCTCGCATTCACACACG(SEQ ID NO.27)

OPG-E2-gRNA2-A：aaacCGTGTGTGAATGCGAGGAGGc(SEQ ID NO.28)

OPG-E2-gRNA3-S：caccgCTGCAGTTCCTTGCACACTG(SEQ ID NO.29)

OPG-E2-gRNA3-A：aaacCAGTGTGCAAGGAACTGCAGc(SEQ ID NO.30)

OPG-E2-gRNA4-S：caccGTAATAGTGGTCAGGACAGG(SEQ ID NO.31)

OPG-E2-gRNA4-A：aaacCCTGTCCTGACCACTATTAC(SEQ ID NO.32)

OPG-E2-gRNA1-S, OPG-E2-gRNA1-A, OPG-E2-gRNA2-S, OPG-E2-gRNA2-A, OPG-E2-gRNA3-S, OPG-E2-gRNA3-A, OPG-E2-gRNA4-S, OPG-E2-gRNA4-A are single-stranded DNA molecules.

3.3.2 method for cloning gRNA sequence onto pKG-U6gRNA backbone vector

The same as 2.1.3 in example 2.

3.3.3 gRNA vector construction

1) The synthesized OPG-E2-gRNA1-S and OPG-E2-gRNA1-A were mixed and annealed to obtain a double-stranded DNA molecule having a sticky end. A double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (OPG-E2-gRNA 1). The plasmid pKG-U6gRNA (OPG-E2-gRNA 1) will express OPG-E2-gRNA1 as shown in SEQ ID NO. 33.

2) The synthesized OPG-E2-gRNA2-S and OPG-E2-gRNA2-A were mixed and annealed to obtain a double-stranded DNA molecule having a cohesive end. A double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (OPG-E2-gRNA 2). The plasmid pKG-U6gRNA (OPG-E2-gRNA 2) will express OPG-E2-gRNA2 as shown in SEQ ID No. 34.

3) The synthesized OPG-E2-gRNA3-S and OPG-E2-gRNA3-A were mixed and annealed to obtain a double-stranded DNA molecule having a cohesive end. A double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (OPG-E2-gRNA 3). The plasmid pKG-U6gRNA (OPG-E2-gRNA 3) will express OPG-E2-gRNA3 as shown in SEQ ID NO. 35.

4) The synthesized OPG-E2-gRNA4-S and OPG-E2-gRNA4-A were mixed and annealed to obtain a double-stranded DNA molecule having a cohesive end. A double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (OPG-E2-gRNA 4). The plasmid pKG-U6gRNA (OPG-E2-gRNA 4) will express OPG-E2-gRNA4 as shown in SEQ ID NO. 36.

3.3.3 gRNA vector identification

Picking a single clone from an LB flat plate, placing the single clone into an LB culture solution added with corresponding antibiotics, culturing the single clone in a constant temperature shaking table at 37 ℃ for 12-16h, sending the small upgraded particles to a general company for sequencing, and confirming that vectors of pKG-U6gRNA (OPG-E2-gRNA 1), pKG-U6gRNA (OPG-E2-gRNA 2), pKG-U6gRNA (OPG-E2-gRNA 3) and pKG-U6gRNA (OPG-E2-gRNA 4) are successfully constructed through sequence comparison.

3.4 preparation of Primary pig fibroblasts

The same as 2.2 in example 2.

3.5 the constructed gRNA plasmid, CRISPR/Cas9 plasmid (pKG-GE 3) was used to co-transfect porcine primary fibroblasts.

3.5.1 Co-transfection grouping cases

A first group: the plasmid pKG-U6gRNA (OPG-E2-gRNA 1) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (OPG-E2-gRNA 1): 1.08. Mu.g of plasmid pKG-GE3, wherein the molar ratio of pKG-U6gRNA (OPG-E2-gRNA 1) to pKG-GE3 is 3.

Second group: the plasmid pKG-U6gRNA (OPG-E2-gRNA 2) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (OPG-E2-gRNA 2): 1.08 μ g plasmid pKG-GE3, wherein pKG-U6gRNA (OPG-E2-gRNA 2) is present in a molar ratio to pKG-GE3 of 3.

Third group: the plasmid pKG-U6gRNA (OPG-E2-gRNA 3) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (OPG-E2-gRNA 3): 1.08 μ g plasmid pKG-GE3, wherein pKG-U6gRNA (OPG-E2-gRNA 3) to pKG-GE3 molar ratio is 3.

And a fourth group: the plasmid pKG-U6gRNA (OPG-E2-gRNA 4) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92. Mu.g of plasmid pKG-U6gRNA (OPG-E2-gRNA 4): 1.08 μ g of plasmid pKG-GE3, wherein the molar ratio of pKG-U6gRNA (OPG-E2-gRNA 4) to pKG-GE3 is 3.

And a fifth group: the pig primary fibroblast is subjected to electrotransfection operation without adding plasmid under the same electrotransformation parameters.

3.5.2 Co-transfection procedure

The same as 2.3.2 in example 2.

3.6 Analysis of editing efficiency of different gRNA targets of OPG gene

3.6.1 to 5 groups of cells collected in 1.5mL centrifuge tubes in step 3.5.2, respectively, 10. Mu.L of KAPA2G lysate was added to lyse the cells and extract the genomic DNA of the cells.

The KAPA2G lysate preparation system is as follows:

10X extract Buffer 1μL

Enzyme 0.2μL

ddH2O 8.8μL

the temperature of 75 ℃ is 15min to 95 ℃ and the temperature of 5min to 4 ℃, and the genome DNA is preserved at the temperature of-20 ℃ after the reaction is finished;

3.6.2 the E2 primer OPG-E2g-F4/OPG-E2g-R869 aiming at the OPG gene is adopted to detect mutation, and the length of the PCR target product is 865bp;

3.6.3 amplification of the OPG target gene using conventional PCR reactions;

3.6.4 subjecting the PCR reaction product to 1% agarose gel electrophoresis, as shown in FIG. 12, cutting and recovering the target product and its nearby product, and sending the cut product to a sequencing company for sequencing, and then analyzing the sequencing peak diagram by using a webpage version Synthego ICE tool to obtain the editing efficiencies of different targets of OPG-E2-gRNA1, OPG-E2-gRNA2, OPG-E2-gRNA3 and OPG-E2-gRNA4 of 11%, 7%, 12% and 7% in sequence. The result shows that the editing efficiency of 4 sgRNA targets is lower than 20%, and no better high-efficiency sgRNA target is screened at this time.

Example 4 OPG gene screening for efficient sgRNA target 2

4.1 gRNA target design and construction

4.1.1 target gRNA design Using Benchling

Designing a target to avoid possible mutation sites, and designing the target gRNA by using Benchling:

https://benchling.com/

the OPG gene knockout target is designed as follows:

OPG-E2-g5：AACAGCACTGCACGGCAAGG(SEQ ID NO.37)

OPG-E2-g6：CCTCCTCGCATTCACACACG(SEQ ID NO.38)

OPG-E2-g7：GCAGTACAGACACTCGTCAC(SEQ ID NO.39)

OPG-E2-g8：GTACTGCACCCCAGTGTGCA(SEQ ID NO.40)

the synthetic OPG gene has the following complementary DNA oligo of the insertion sequence of 4 targets:

OPG-E2-gRNA5-S：caccgAACAGCACTGCACGGCAAGG(SEQ ID NO.41)

OPG-E2-gRNA5-A：aaacCCTTGCCGTGCAGTGCTGTTc(SEQ ID NO.42)

OPG-E2-gRNA6-S：caccgCCTCCTCGCATTCACACACG(SEQ ID NO.43)

OPG-E2-gRNA6-A：aaacCGTGTGTGAATGCGAGGAGGc(SEQ ID NO.44)

OPG-E2-gRNA7-S：caccGCAGTACAGACACTCGTCAC(SEQ ID NO.45)

OPG-E2-gRNA7-A：aaacGTGACGAGTGTCTGTACTGC(SEQ ID NO.46)

OPG-E2-gRNA8-S：caccGTACTGCACCCCAGTGTGCA(SEQ ID NO.47)

OPG-E2-gRNA8-A：aaacTGCACACTGGGGTGCAGTAC(SEQ ID NO.48)

OPG-E2-gRNA5-S, OPG-E2-gRNA5-A, OPG-E2-gRNA6-S, OPG-E2-gRNA6-A, OPG-E2-gRNA7-S, OPG-E2-gRNA7-A, OPG-E2-gRNA8-S, OPG-E2-gRNA8-A are single-stranded DNA molecules.

4.1.2 method for cloning gRNA sequences onto pKG-U6gRNA backbone vectors

Same as 2.1.3 in example 2.

4.1.3gRNA vector construction

1) The synthesized OPG-E2-gRNA5-S and OPG-E2-gRNA5-A were mixed and annealed to obtain a double-stranded DNA molecule having a cohesive end. A double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (OPG-E2-gRNA 5). The plasmid pKG-U6gRNA (OPG-E2-gRNA 5) will express OPG-E2-gRNA5 as shown in SEQ ID NO. 49.

2) The synthesized OPG-E2-gRNA6-S and OPG-E2-gRNA6-A were mixed and annealed to obtain a double-stranded DNA molecule having a cohesive end. A double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (OPG-E2-gRNA 6). The plasmid pKG-U6gRNA (OPG-E2-gRNA 6) will express OPG-E2-gRNA6 as shown in SEQ ID No. 50.

3) The synthesized OPG-E2-gRNA7-S and OPG-E2-gRNA7-A were mixed and annealed to obtain a double-stranded DNA molecule having a sticky end. A double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (OPG-E2-gRNA 7). The plasmid pKG-U6gRNA (OPG-E2-gRNA 7) will express the OPG-E2-gRNA7 shown in SEQ ID NO. 51.

4) The synthesized OPG-E2-gRNA8-S and OPG-E2-gRNA8-A were mixed and annealed to obtain a double-stranded DNA molecule having a cohesive end. A double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (OPG-E2-gRNA 8). The plasmid pKG-U6gRNA (OPG-E2-gRNA 8) will express OPG-E2-gRNA8 as shown in SEQ ID No. 52.

4.1.3gRNA vector identification

Picking a single clone from an LB flat plate, placing the single clone into an LB culture solution added with corresponding antibiotics, culturing the single clone in a constant temperature shaker at 37 ℃ for 12-16h, sending the small upgraded grains to a general company for sequencing, and confirming that vectors of pKG-U6gRNA (OPG-E2-gRNA 5), pKG-U6gRNA (OPG-E2-gRNA 6), pKG-U6gRNA (OPG-E2-gRNA 7) and pKG-U6gRNA (OPG-E2-gRNA 8) are successfully constructed through sequence comparison.

4.2 preparation of Primary pig fibroblasts

The same as 2.2 in example 2.

4.3 the constructed gRNA plasmid, CRISPR/Cas9 plasmid (pKG-GE 3) was used to co-transfect porcine primary fibroblasts.

4.3.1 Co-transfection grouping

A first group: the plasmid pKG-U6gRNA (OPG-E2-gRNA 5) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92. Mu.g of plasmid pKG-U6gRNA (OPG-E2-gRNA 5): 1.08 μ g plasmid pKG-GE3, wherein pKG-U6gRNA (OPG-E2-gRNA 5) is present in a molar ratio to pKG-GE3 of 3.

Second group: the plasmid pKG-U6gRNA (OPG-E2-gRNA 6) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.92. Mu.g of plasmid pKG-U6gRNA (OPG-E2-gRNA 6): 1.08 μ g plasmid pKG-GE3, wherein pKG-U6gRNA (OPG-E2-gRNA 6) is present in a molar ratio to pKG-GE3 of 3.

Third group: the plasmid pKG-U6gRNA (OPG-E2-gRNA 7) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.92. Mu.g of plasmid pKG-U6gRNA (OPG-E2-gRNA 7): 1.08 μ g of plasmid pKG-GE3, wherein the molar ratio of pKG-U6gRNA (OPG-E2-gRNA 7) to pKG-GE3 is 3.

And a fourth group: the plasmid pKG-U6gRNA (OPG-E2-gRNA 8) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92. Mu.g of plasmid pKG-U6gRNA (OPG-E2-gRNA 8): 1.08 μ g of plasmid pKG-GE3, wherein the molar ratio of pKG-U6gRNA (OPG-E2-gRNA 8) to pKG-GE3 is 3.

And a fifth group: the pig primary fibroblast is subjected to electrotransfection operation without adding plasmid under the same electrotransformation parameters.

4.3.2 Co-transfection procedure

The same as 2.3.2 in example 2.

4.4 Analysis of editing efficiency of different gRNA targets of OPG gene

4.4.1 to 5 groups of cells collected in 1.5mL centrifuge tubes in step 4.3.2, respectively, 10. Mu.L of KAPA2G lysate was added to lyse the cells and extract the genomic DNA of the cells.

The KAPA2G lysate preparation system is as follows:

10X extract Buffer 1μL

Enzyme 0.2μL

ddH2O 8.8μL

the temperature of 75 ℃ is 15min to 95 ℃ and the temperature of 5min to 4 ℃, and the genome DNA is preserved at the temperature of-20 ℃ after the reaction is finished;

4.4.2 detecting mutation by using the primer OPG-E2g-F4/OPG-E2g-R869 aiming at the OPG gene E2, wherein the length of a PCR target product is 865bp;

4.4.3 amplification of the OPG target gene using conventional PCR reactions;

4.4.4 performing 1% agarose gel electrophoresis on the PCR reaction product, as shown in FIG. 13, cutting and recovering the target product and the products nearby, sending the cut products to a sequencing company for sequencing, and analyzing sequencing peak diagrams by using a webpage version Synthego ICE tool to obtain the editing efficiencies of different targets of OPG-E2-gRNA5, OPG-E2-gRNA6, OPG-E2-gRNA7 and OPG-E2-gRNA8 of 24%, 0%, 20% and 18% in sequence. The result shows that the OPG-E2-gRNA5 has the highest editing efficiency and is preferably the optimal target spot.

Example 5 creation of OPG Gene knockout Swine cells from Jiang by somatic cloning

5.1 preparation of Primary pig fibroblasts

The same as 2.2 in example 2.

5.2 Co-transfecting pig primary fibroblasts with the constructed OPG-E2-gRNA5 plasmid and pKG-GE3 plasmid

The cells were digested as 2.3.2 in example 2, but without 0.25% (Gibco) trypsin and collected in a 1.5mL centrifuge tube.

5.3 screening of OPG Gene knockout monoclonal cell lines

5.3.1 digesting the population cells obtained in the step 5.2 after being electrically transferred for 48h by using trypsin, neutralizing the complete culture medium, centrifuging for 5min at 500g, removing a supernatant, re-suspending the precipitate by using 200 mu L of complete culture medium, appropriately diluting, and picking and transferring the single clone to a 96-well plate of 100 mu L of complete culture medium by using a suction tube;

5.3.2 Culturing at 37 ℃ in an incubator containing 5% CO2 and 5% O2, changing the cell culture medium every 2 to 3 days, and observing the growth of cells in each well with a microscope while excluding the wells containing no cells and non-monoclonal cells;

5.3.3 after the cells in the wells of the 96-well plate were grown to the well bottom, cells were digested and collected using trypsin, 2/3 of the cells were seeded into a 6-well plate containing complete medium, and the remaining 1/3 of the cells were collected in a 1.5mL centrifuge tube;

5.3.4 cells were digested and harvested with 0.25% (Gibco) trypsin when the 6-well plates were up to 80% confluency, and frozen using cell freezing medium (90% complete medium +10% DMSO, vol.).

5.4 Identification of OPG Gene knockout cell lines

5.4.1 the cells obtained in step 5.3 were collected in a 1.5mL centrifuge tube, and then 10. Mu.L of KAPA2G lysate was added to the cells to lyse the cells and extract the genomic DNA of the cells.

The KAPA2G lysate preparation system is as follows:

10X extract Buffer 1μL

Enzyme 0.2μL

ddH2O 8.8μL

5 min-4 ℃ at 75 ℃ to 95 ℃, and storing the genome DNA at-20 ℃ after the reaction is finished;

5.4.2 detecting mutation by using the primer OPG-E2g-F4/OPG-E2g-R869 aiming at the OPG gene E2, wherein the length of a PCR target product is 865bp;

5.4.3 amplification of the OPG target gene using PCR general reactions;

5.4.4 electrophoresis of the PCR reaction products, the electrophoresis results are shown in FIG. 14, lane numbers are consistent with the monoclonal cell numbers. The PCR amplification product was recovered and sequenced.

And 5.4.5, comparing the sequencing result with OPG target point information so as to judge whether the cell line is the OPG gene knockout.

The genotypes of the monoclonal cells numbered 1, 2, 9, 10, 11, 15 and 18 are homozygous mutants. The genotype of the monoclonal cell numbered 6 was biallelic mutant. The genotypes of the monoclonal cells numbered 3, 5, 12, 14 and 17 were heterozygous. The genotypes of the monoclonal cells numbered 4, 7, 8, 13, 16, 19, 20 were homozygous wild-type. The ratio of the obtained OPG gene-editing monoclonal cells was 65%.

Exemplary sequencing alignments are shown in FIGS. 15-18, where FIG. 15 is an alignment of the forward sequencing of clone number OPG-4 with published sequences, judged as wild-type; FIG. 16 shows the comparison of the forward sequencing of clone OPG-1 with published sequences, which was judged as homozygous mutation; FIG. 17 shows the result of comparison of the forward sequencing of clone No. OPG-5 with published sequences, which was judged as a heterozygous mutation; FIG. 18 shows the alignment of the forward and reverse sequencing of clone OPG-6 with published sequences, which was judged as biallelic mutation.

The genotype of each clone of OPG was shown in table 1 by analysis of specific sequences:

TABLE 1 Gene identification of OPG Gene knockout of Jiangxiang pig fibroblasts

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Sequence listing

<110> Nanjing King Gene engineering Co., ltd

<120> OPG gene editing system for constructing osteoporosis clone pig nuclear donor cell line and application thereof

<140> 2020114211978

<141> 2020-12-08

<160> 52

<170> SIPOSequenceListing 1.0

<210> 1

<211> 8484

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaaataag 300

gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttg ttttagagct 360

agaaatagca agttaaaata aggctagtcc gtttttagcg cgtgcgccaa ttctgcagac 420

aaatggctct agaggtaccc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 480

ccaacgaccc ccgcccattg acgtcaatag taacgccaat agggactttc cattgacgtc 540

aatgggtgga gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc 600

caagtacgcc ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tgtgcccagt 660

acatgacctt atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta 720

ccatggtcga ggtgagcccc acgttctgct tcactctccc catctccccc ccctccccac 780

ccccaatttt gtatttattt attttttaat tattttgtgc agcgatgggg gcgggggggg 840

ggggggggcg gggcgagggg cggggcgggg cgaggcggag aggtgcggcg gcagccaatc 900

agagcggcgc gctccgaaag tttcctttta tggcgaggcg gcggcggcgg cggccctata 960

aaaagcgaag cgcgcggcgg gcgggagtcg ctgcgcgctg ccttcgcccc gtgccccgct 1020

ccgccgccgc ctcgcgccgc ccgccccggc tctgactgac cgcgttactc ccacaggtga 1080

gcgggcggga cggcccttct cctccgggct gtaattagct gagcaagagg taagggttta 1140

agggatggtt ggttggtggg gtattaatgt ttaattacct ggagcacctg cctgaaatca 1200

ctttttttca ggttggaccg gtgccaccat ggactataag gaccacgacg gagactacaa 1260

ggatcatgat attgattaca aagacgatga cgataagatg gccccaaaga agaagcggaa 1320

ggtcggtatc cacggagtcc cagcagccga caagaagtac agcatcggcc tggacatcgg 1380

caccaactct gtgggctggg ccgtgatcac cgacgagtac aaggtgccca gcaagaaatt 1440

caaggtgctg ggcaacaccg accggcacag catcaagaag aacctgatcg gagccctgct 1500

gttcgacagc ggcgaaacag ccgaggccac ccggctgaag agaaccgcca gaagaagata 1560

caccagacgg aagaaccgga tctgctatct gcaagagatc ttcagcaacg agatggccaa 1620

ggtggacgac agcttcttcc acagactgga agagtccttc ctggtggaag aggataagaa 1680

gcacgagcgg caccccatct tcggcaacat cgtggacgag gtggcctacc acgagaagta 1740

ccccaccatc taccacctga gaaagaaact ggtggacagc accgacaagg ccgacctgcg 1800

gctgatctat ctggccctgg cccacatgat caagttccgg ggccacttcc tgatcgaggg 1860

cgacctgaac cccgacaaca gcgacgtgga caagctgttc atccagctgg tgcagaccta 1920

caaccagctg ttcgaggaaa accccatcaa cgccagcggc gtggacgcca aggccatcct 1980

gtctgccaga ctgagcaaga gcagacggct ggaaaatctg atcgcccagc tgcccggcga 2040

gaagaagaat ggcctgttcg gaaacctgat tgccctgagc ctgggcctga cccccaactt 2100

caagagcaac ttcgacctgg ccgaggatgc caaactgcag ctgagcaagg acacctacga 2160

cgacgacctg gacaacctgc tggcccagat cggcgaccag tacgccgacc tgtttctggc 2220

cgccaagaac ctgtccgacg ccatcctgct gagcgacatc ctgagagtga acaccgagat 2280

caccaaggcc cccctgagcg cctctatgat caagagatac gacgagcacc accaggacct 2340

gaccctgctg aaagctctcg tgcggcagca gctgcctgag aagtacaaag agattttctt 2400

cgaccagagc aagaacggct acgccggcta cattgacggc ggagccagcc aggaagagtt 2460

ctacaagttc atcaagccca tcctggaaaa gatggacggc accgaggaac tgctcgtgaa 2520

gctgaacaga gaggacctgc tgcggaagca gcggaccttc gacaacggca gcatccccca 2580

ccagatccac ctgggagagc tgcacgccat tctgcggcgg caggaagatt tttacccatt 2640

cctgaaggac aaccgggaaa agatcgagaa gatcctgacc ttccgcatcc cctactacgt 2700

gggccctctg gccaggggaa acagcagatt cgcctggatg accagaaaga gcgaggaaac 2760

catcaccccc tggaacttcg aggaagtggt ggacaagggc gcttccgccc agagcttcat 2820

cgagcggatg accaacttcg ataagaacct gcccaacgag aaggtgctgc ccaagcacag 2880

cctgctgtac gagtacttca ccgtgtataa cgagctgacc aaagtgaaat acgtgaccga 2940

gggaatgaga aagcccgcct tcctgagcgg cgagcagaaa aaggccatcg tggacctgct 3000

gttcaagacc aaccggaaag tgaccgtgaa gcagctgaaa gaggactact tcaagaaaat 3060

cgagtgcttc gactccgtgg aaatctccgg cgtggaagat cggttcaacg cctccctggg 3120

cacataccac gatctgctga aaattatcaa ggacaaggac ttcctggaca atgaggaaaa 3180

cgaggacatt ctggaagata tcgtgctgac cctgacactg tttgaggaca gagagatgat 3240

cgaggaacgg ctgaaaacct atgcccacct gttcgacgac aaagtgatga agcagctgaa 3300

gcggcggaga tacaccggct ggggcaggct gagccggaag ctgatcaacg gcatccggga 3360

caagcagtcc ggcaagacaa tcctggattt cctgaagtcc gacggcttcg ccaacagaaa 3420

cttcatgcag ctgatccacg acgacagcct gacctttaaa gaggacatcc agaaagccca 3480

ggtgtccggc cagggcgata gcctgcacga gcacattgcc aatctggccg gcagccccgc 3540

cattaagaag ggcatcctgc agacagtgaa ggtggtggac gagctcgtga aagtgatggg 3600

ccggcacaag cccgagaaca tcgtgatcga aatggccaga gagaaccaga ccacccagaa 3660

gggacagaag aacagccgcg agagaatgaa gcggatcgaa gagggcatca aagagctggg 3720

cagccagatc ctgaaagaac accccgtgga aaacacccag ctgcagaacg agaagctgta 3780

cctgtactac ctgcagaatg ggcgggatat gtacgtggac caggaactgg acatcaaccg 3840

gctgtccgac tacgatgtgg accatatcgt gcctcagagc tttctgaagg acgactccat 3900

cgacaacaag gtgctgacca gaagcgacaa gaaccggggc aagagcgaca acgtgccctc 3960

cgaagaggtc gtgaagaaga tgaagaacta ctggcggcag ctgctgaacg ccaagctgat 4020

tacccagaga aagttcgaca atctgaccaa ggccgagaga ggcggcctga gcgaactgga 4080

taaggccggc ttcatcaaga gacagctggt ggaaacccgg cagatcacaa agcacgtggc 4140

acagatcctg gactcccgga tgaacactaa gtacgacgag aatgacaagc tgatccggga 4200

agtgaaagtg atcaccctga agtccaagct ggtgtccgat ttccggaagg atttccagtt 4260

ttacaaagtg cgcgagatca acaactacca ccacgcccac gacgcctacc tgaacgccgt 4320

cgtgggaacc gccctgatca aaaagtaccc taagctggaa agcgagttcg tgtacggcga 4380

ctacaaggtg tacgacgtgc ggaagatgat cgccaagagc gagcaggaaa tcggcaaggc 4440

taccgccaag tacttcttct acagcaacat catgaacttt ttcaagaccg agattaccct 4500

ggccaacggc gagatccgga agcggcctct gatcgagaca aacggcgaaa ccggggagat 4560

cgtgtgggat aagggccggg attttgccac cgtgcggaaa gtgctgagca tgccccaagt 4620

gaatatcgtg aaaaagaccg aggtgcagac aggcggcttc agcaaagagt ctatcctgcc 4680

caagaggaac agcgataagc tgatcgccag aaagaaggac tgggacccta agaagtacgg 4740

cggcttcgac agccccaccg tggcctattc tgtgctggtg gtggccaaag tggaaaaggg 4800

caagtccaag aaactgaaga gtgtgaaaga gctgctgggg atcaccatca tggaaagaag 4860

cagcttcgag aagaatccca tcgactttct ggaagccaag ggctacaaag aagtgaaaaa 4920

ggacctgatc atcaagctgc ctaagtactc cctgttcgag ctggaaaacg gccggaagag 4980

aatgctggcc tctgccggcg aactgcagaa gggaaacgaa ctggccctgc cctccaaata 5040

tgtgaacttc ctgtacctgg ccagccacta tgagaagctg aagggctccc ccgaggataa 5100

tgagcagaaa cagctgtttg tggaacagca caagcactac ctggacgaga tcatcgagca 5160

gatcagcgag ttctccaaga gagtgatcct ggccgacgct aatctggaca aagtgctgtc 5220

cgcctacaac aagcaccggg ataagcccat cagagagcag gccgagaata tcatccacct 5280

gtttaccctg accaatctgg gagcccctgc cgccttcaag tactttgaca ccaccatcga 5340

ccggaagagg tacaccagca ccaaagaggt gctggacgcc accctgatcc accagagcat 5400

caccggcctg tacgagacac ggatcgacct gtctcagctg ggaggcgaca aaaggccggc 5460

ggccacgaaa aaggccggcc aggcaaaaaa gaaaaagtaa gaattcctag agctcgctga 5520

tcagcctcga ctgtgccttc tagttgccag ccatctgttg tttgcccctc ccccgtgcct 5580

tccttgaccc tggaaggtgc cactcccact gtcctttcct aataaaatga ggaaattgca 5640

tcgcattgtc tgagtaggtg tcattctatt ctggggggtg gggtggggca ggacagcaag 5700

ggggaggatt gggaagagaa tagcaggcat gctggggagc ggccgcagga acccctagtg 5760

atggagttgg ccactccctc tctgcgcgct cgctcgctca ctgaggccgg gcgaccaaag 5820

gtcgcccgac gcccgggctt tgcccgggcg gcctcagtga gcgagcgagc gcgcagctgc 5880

ctgcaggggc gcctgatgcg gtattttctc cttacgcatc tgtgcggtat ttcacaccgc 5940

atacgtcaaa gcaaccatag tacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg 6000

tggttacgcg cagcgtgacc gctacacttg ccagcgcctt agcgcccgct cctttcgctt 6060

tcttcccttc ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc 6120

tccctttagg gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgatttgg 6180

gtgatggttc acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg 6240

agtccacgtt ctttaatagt ggactcttgt tccaaactgg aacaacactc aactctatct 6300

cgggctattc ttttgattta taagggattt tgccgatttc ggtctattgg ttaaaaaatg 6360

agctgattta acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaattttat 6420

ggtgcactct cagtacaatc tgctctgatg ccgcatagtt aagccagccc cgacacccgc 6480

caacacccgc tgacgcgccc tgacgggctt gtctgctccc ggcatccgct tacagacaag 6540

ctgtgaccgt ctccgggagc tgcatgtgtc agaggttttc accgtcatca ccgaaacgcg 6600

cgagacgaaa gggcctcgtg atacgcctat ttttataggt taatgtcatg ataataatgg 6660

tttcttagac gtcaggtggc acttttcggg gaaatgtgcg cggaacccct atttgtttat 6720

ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga taaatgcttc 6780

aataatattg aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc cttattccct 6840

tttttgcggc attttgcctt cctgtttttg ctcacccaga aacgctggtg aaagtaaaag 6900

atgctgaaga tcagttgggt gcacgagtgg gttacatcga actggatctc aacagcggta 6960

agatccttga gagttttcgc cccgaagaac gttttccaat gatgagcact tttaaagttc 7020

tgctatgtgg cgcggtatta tcccgtattg acgccgggca agagcaactc ggtcgccgca 7080

tacactattc tcagaatgac ttggttgagt actcaccagt cacagaaaag catcttacgg 7140

atggcatgac agtaagagaa ttatgcagtg ctgccataac catgagtgat aacactgcgg 7200

ccaacttact tctgacaacg atcggaggac cgaaggagct aaccgctttt ttgcacaaca 7260

tgggggatca tgtaactcgc cttgatcgtt gggaaccgga gctgaatgaa gccataccaa 7320

acgacgagcg tgacaccacg atgcctgtag caatggcaac aacgttgcgc aaactattaa 7380

ctggcgaact acttactcta gcttcccggc aacaattaat agactggatg gaggcggata 7440

aagttgcagg accacttctg cgctcggccc ttccggctgg ctggtttatt gctgataaat 7500

ctggagccgg tgagcgtgga agccgcggta tcattgcagc actggggcca gatggtaagc 7560

cctcccgtat cgtagttatc tacacgacgg ggagtcaggc aactatggat gaacgaaata 7620

gacagatcgc tgagataggt gcctcactga ttaagcattg gtaactgtca gaccaagttt 7680

actcatatat actttagatt gatttaaaac ttcattttta atttaaaagg atctaggtga 7740

agatcctttt tgataatctc atgaccaaaa tcccttaacg tgagttttcg ttccactgag 7800

cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa 7860

tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg ccggatcaag 7920

agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata ccaaatactg 7980

ttcttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca ccgcctacat 8040

acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag tcgtgtctta 8100

ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc tgaacggggg 8160

gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga tacctacagc 8220

gtgagctatg agaaagcgcc acgcttcccg aagggagaaa ggcggacagg tatccggtaa 8280

gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac gcctggtatc 8340

tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg tgatgctcgt 8400

caggggggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct 8460

tttgctggcc ttttgctcac atgt 8484

<210> 2

<211> 10476

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaaataag 300

gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttc tagcgcgtgc 360

gccaattctg cagacaaatg gctctagagg tacccgttac ataacttacg gtaaatggcc 420

cgcctggctg accgcccaac gacccccgcc cattgacgtc aatagtaacg ccaataggga 480

ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc 540

aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 600

ggcattgtgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 660

tagtcatcgc tattaccatg ggggcagagc gcacatcgcc cacagtcccc gagaagttgg 720

ggggaggggt cggcaattga tccggtgcct agagaaggtg gcgcggggta aactgggaaa 780

gtgatgtcgt gtactggctc cgcctttttc ccgagggtgg gggagaaccg tatataagtg 840

cagtagtcgc cgtgaacgtt ctttttcgca acgggtttgc cgccagaaca caggttggac 900

cggtgccacc atggactata aggaccacga cggagactac aaggatcatg atattgatta 960

caaagacgat gacgataaga tggcccccaa aaagaaacga aaggtgggtg ggtccccaaa 1020

gaagaagcgg aaggtcggta tccacggagt cccagcagcc gacaagaagt acagcatcgg 1080

cctggacatc ggcaccaact ctgtgggctg ggccgtgatc accgacgagt acaaggtgcc 1140

cagcaagaaa ttcaaggtgc tgggcaacac cgaccggcac agcatcaaga agaacctgat 1200

cggagccctg ctgttcgaca gcggcgaaac agccgaggcc acccggctga agagaaccgc 1260

cagaagaaga tacaccagac ggaagaaccg gatctgctat ctgcaagaga tcttcagcaa 1320

cgagatggcc aaggtggacg acagcttctt ccacagactg gaagagtcct tcctggtgga 1380

agaggataag aagcacgagc ggcaccccat cttcggcaac atcgtggacg aggtggccta 1440

ccacgagaag taccccacca tctaccacct gagaaagaaa ctggtggaca gcaccgacaa 1500

ggccgacctg cggctgatct atctggccct ggcccacatg atcaagttcc ggggccactt 1560

cctgatcgag ggcgacctga accccgacaa cagcgacgtg gacaagctgt tcatccagct 1620

ggtgcagacc tacaaccagc tgttcgagga aaaccccatc aacgccagcg gcgtggacgc 1680

caaggccatc ctgtctgcca gactgagcaa gagcagacgg ctggaaaatc tgatcgccca 1740

gctgcccggc gagaagaaga atggcctgtt cggaaacctg attgccctga gcctgggcct 1800

gacccccaac ttcaagagca acttcgacct ggccgaggat gccaaactgc agctgagcaa 1860

ggacacctac gacgacgacc tggacaacct gctggcccag atcggcgacc agtacgccga 1920

cctgtttctg gccgccaaga acctgtccga cgccatcctg ctgagcgaca tcctgagagt 1980

gaacaccgag atcaccaagg cccccctgag cgcctctatg atcaagagat acgacgagca 2040

ccaccaggac ctgaccctgc tgaaagctct cgtgcggcag cagctgcctg agaagtacaa 2100

agagattttc ttcgaccaga gcaagaacgg ctacgccggc tacattgacg gcggagccag 2160

ccaggaagag ttctacaagt tcatcaagcc catcctggaa aagatggacg gcaccgagga 2220

actgctcgtg aagctgaaca gagaggacct gctgcggaag cagcggacct tcgacaacgg 2280

cagcatcccc caccagatcc acctgggaga gctgcacgcc attctgcggc ggcaggaaga 2340

tttttaccca ttcctgaagg acaaccggga aaagatcgag aagatcctga ccttccgcat 2400

cccctactac gtgggccctc tggccagggg aaacagcaga ttcgcctgga tgaccagaaa 2460

gagcgaggaa accatcaccc cctggaactt cgaggaagtg gtggacaagg gcgcttccgc 2520

ccagagcttc atcgagcgga tgaccaactt cgataagaac ctgcccaacg agaaggtgct 2580

gcccaagcac agcctgctgt acgagtactt caccgtgtat aacgagctga ccaaagtgaa 2640

atacgtgacc gagggaatga gaaagcccgc cttcctgagc ggcgagcaga aaaaggccat 2700

cgtggacctg ctgttcaaga ccaaccggaa agtgaccgtg aagcagctga aagaggacta 2760

cttcaagaaa atcgagtgct tcgactccgt ggaaatctcc ggcgtggaag atcggttcaa 2820

cgcctccctg ggcacatacc acgatctgct gaaaattatc aaggacaagg acttcctgga 2880

caatgaggaa aacgaggaca ttctggaaga tatcgtgctg accctgacac tgtttgagga 2940

cagagagatg atcgaggaac ggctgaaaac ctatgcccac ctgttcgacg acaaagtgat 3000

gaagcagctg aagcggcgga gatacaccgg ctggggcagg ctgagccgga agctgatcaa 3060

cggcatccgg gacaagcagt ccggcaagac aatcctggat ttcctgaagt ccgacggctt 3120

cgccaacaga aacttcatgc agctgatcca cgacgacagc ctgaccttta aagaggacat 3180

ccagaaagcc caggtgtccg gccagggcga tagcctgcac gagcacattg ccaatctggc 3240

cggcagcccc gccattaaga agggcatcct gcagacagtg aaggtggtgg acgagctcgt 3300

gaaagtgatg ggccggcaca agcccgagaa catcgtgatc gaaatggcca gagagaacca 3360

gaccacccag aagggacaga agaacagccg cgagagaatg aagcggatcg aagagggcat 3420

caaagagctg ggcagccaga tcctgaaaga acaccccgtg gaaaacaccc agctgcagaa 3480

cgagaagctg tacctgtact acctgcagaa tgggcgggat atgtacgtgg accaggaact 3540

ggacatcaac cggctgtccg actacgatgt ggaccatatc gtgcctcaga gctttctgaa 3600

ggacgactcc atcgacaaca aggtgctgac cagaagcgac aagaaccggg gcaagagcga 3660

caacgtgccc tccgaagagg tcgtgaagaa gatgaagaac tactggcggc agctgctgaa 3720

cgccaagctg attacccaga gaaagttcga caatctgacc aaggccgaga gaggcggcct 3780

gagcgaactg gataaggccg gcttcatcaa gagacagctg gtggaaaccc ggcagatcac 3840

aaagcacgtg gcacagatcc tggactcccg gatgaacact aagtacgacg agaatgacaa 3900

gctgatccgg gaagtgaaag tgatcaccct gaagtccaag ctggtgtccg atttccggaa 3960

ggatttccag ttttacaaag tgcgcgagat caacaactac caccacgccc acgacgccta 4020

cctgaacgcc gtcgtgggaa ccgccctgat caaaaagtac cctaagctgg aaagcgagtt 4080

cgtgtacggc gactacaagg tgtacgacgt gcggaagatg atcgccaaga gcgagcagga 4140

aatcggcaag gctaccgcca agtacttctt ctacagcaac atcatgaact ttttcaagac 4200

cgagattacc ctggccaacg gcgagatccg gaagcggcct ctgatcgaga caaacggcga 4260

aaccggggag atcgtgtggg ataagggccg ggattttgcc accgtgcgga aagtgctgag 4320

catgccccaa gtgaatatcg tgaaaaagac cgaggtgcag acaggcggct tcagcaaaga 4380

gtctatcctg cccaagagga acagcgataa gctgatcgcc agaaagaagg actgggaccc 4440

taagaagtac ggcggcttcg acagccccac cgtggcctat tctgtgctgg tggtggccaa 4500

agtggaaaag ggcaagtcca agaaactgaa gagtgtgaaa gagctgctgg ggatcaccat 4560

catggaaaga agcagcttcg agaagaatcc catcgacttt ctggaagcca agggctacaa 4620

agaagtgaaa aaggacctga tcatcaagct gcctaagtac tccctgttcg agctggaaaa 4680

cggccggaag agaatgctgg cctctgccgg cgaactgcag aagggaaacg aactggccct 4740

gccctccaaa tatgtgaact tcctgtacct ggccagccac tatgagaagc tgaagggctc 4800

ccccgaggat aatgagcaga aacagctgtt tgtggaacag cacaagcact acctggacga 4860

gatcatcgag cagatcagcg agttctccaa gagagtgatc ctggccgacg ctaatctgga 4920

caaagtgctg tccgcctaca acaagcaccg ggataagccc atcagagagc aggccgagaa 4980

tatcatccac ctgtttaccc tgaccaatct gggagcccct gccgccttca agtactttga 5040

caccaccatc gaccggaaga ggtacaccag caccaaagag gtgctggacg ccaccctgat 5100

ccaccagagc atcaccggcc tgtacgagac acggatcgac ctgtctcagc tgggaggcga 5160

caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa aagaaaaagg gcggctccaa 5220

gcggcctgcc gcgacgaaga aagcgggaca ggccaagaaa aagaaaggat ccggcgcaac 5280

aaacttctct ctgctgaaac aagccggaga tgtcgaagag aatcctggac cggtgagcaa 5340

gggcgaggag ctgttcaccg gggtggtgcc catcctggtc gagctggacg gcgacgtaaa 5400

cggccacaag ttcagcgtgt ccggcgaggg cgagggcgat gccacctacg gcaagctgac 5460

cctgaagttc atctgcacca ccggcaagct gcccgtgccc tggcccaccc tcgtgaccac 5520

cctgacctac ggcgtgcagt gcttcagccg ctaccccgac cacatgaagc agcacgactt 5580

cttcaagtcc gccatgcccg aaggctacgt ccaggagcgc accatcttct tcaaggacga 5640

cggcaactac aagacccgcg ccgaggtgaa gttcgagggc gacaccctgg tgaaccgcat 5700

cgagctgaag ggcatcgact tcaaggagga cggcaacatc ctggggcaca agctggagta 5760

caactacaac agccacaacg tctatatcat ggccgacaag cagaagaacg gcatcaaggt 5820

gaacttcaag atccgccaca acatcgagga cggcagcgtg cagctcgccg accactacca 5880

gcagaacacc cccatcggcg acggccccgt gctgctgccc gacaaccact acctgagcac 5940

ccagtccgcc ctgagcaaag accccaacga gaagcgcgat cacatggtcc tgctggagtt 6000

cgtgaccgcc gccgggatca ctctcggcat ggacgagctg tacaagggct ccggcgaggg 6060

caggggaagt cttctaacat gcggggacgt ggaggaaaat cccggcccaa ccgagtacaa 6120

gcccacggtg cgcctcgcca cccgcgacga cgtccccagg gccgtacgca ccctcgccgc 6180

cgcgttcgcc gactaccccg ccacgcgcca caccgtcgat ccggaccgcc acatcgagcg 6240

ggtcaccgag ctgcaagaac tcttcctcac gcgcgtcggg ctcgacatcg gcaaggtgtg 6300

ggtcgcggac gacggcgccg cggtggcggt ctggaccacg ccggagagcg tcgaagcggg 6360

ggcggtgttc gccgagatcg gcccgcgcat ggccgagttg agcggttccc ggctggccgc 6420

gcagcaacag atggaaggcc tcctggcgcc gcaccggccc aaggagcccg cgtggttcct 6480

ggccaccgtc ggagtctcgc ccgaccacca gggcaagggt ctgggcagcg ccgtcgtgct 6540

ccccggagtg gaggcggccg agcgcgccgg ggtgcccgcc ttcctggaga cctccgcgcc 6600

ccgcaacctc cccttctacg agcggctcgg cttcaccgtc accgccgacg tcgaggtgcc 6660

cgaaggaccg cgcacctggt gcatgacccg caagcccggt gcctgaacgc gttaagtcga 6720

caatcaacct ctggattaca aaatttgtga aagattgact ggtattctta actatgttgc 6780

tccttttacg ctatgtggat acgctgcttt aatgcctttg tatcatgcta ttgcttcccg 6840

tatggctttc attttctcct ccttgtataa atcctggttg ctgtctcttt atgaggagtt 6900

gtggcccgtt gtcaggcaac gtggcgtggt gtgcactgtg tttgctgacg caacccccac 6960

tggttggggc attgccacca cctgtcagct cctttccggg actttcgctt tccccctccc 7020

tattgccacg gcggaactca tcgccgcctg ccttgcccgc tgctggacag gggctcggct 7080

gttgggcact gacaattccg tggtgttgtc ggggaaatca tcgtcctttc cttggctgct 7140

cgcctgtgtt gccacctgga ttctgcgcgg gacgtccttc tgctacgtcc cttcggccct 7200

caatccagcg gaccttcctt cccgcggcct gctgccggct ctgcggcctc ttccgcgtct 7260

tcgccttcgc cctcagacga gtcggatctc cctttgggcc gcctccccgc gtcgacttta 7320

agaccaatga cttacaaggc agctgtagat cttagccact ttttaaaaga aaagggggga 7380

ctggaagggc taattcactc ccaacgaaga caagatctgc tttttgcttg tactgggtct 7440

ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt 7500

aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac 7560

tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagggcc 7620

cgtttaaacc cgctgatcag cctcgactgt gccttctagt tgccagccat ctgttgtttg 7680

cccctccccc gtgccttcct tgaccctgga aggtgccact cccactgtcc tttcctaata 7740

aaatgaggaa attgcatcgc attgtctgag taggtgtcat tctattctgg ggggtggggt 7800

ggggcaggac agcaaggggg aggattggga agacaatagc aggcatgctg gggatgcggt 7860

gggctctatg gcctgcaggg gcgcctgatg cggtattttc tccttacgca tctgtgcggt 7920

atttcacacc gcatacgtca aagcaaccat agtacgcgcc ctgtagcggc gcattaagcg 7980

cggcgggtgt ggtggttacg cgcagcgtga ccgctacact tgccagcgcc ttagcgcccg 8040

ctcctttcgc tttcttccct tcctttctcg ccacgttcgc cggctttccc cgtcaagctc 8100

taaatcgggg gctcccttta gggttccgat ttagtgcttt acggcacctc gaccccaaaa 8160

aacttgattt gggtgatggt tcacgtagtg ggccatcgcc ctgatagacg gtttttcgcc 8220

ctttgacgtt ggagtccacg ttctttaata gtggactctt gttccaaact ggaacaacac 8280

tcaactctat ctcgggctat tcttttgatt tataagggat tttgccgatt tcggtctatt 8340

ggttaaaaaa tgagctgatt taacaaaaat ttaacgcgaa ttttaacaaa atattaacgt 8400

ttacaatttt atggtgcact ctcagtacaa tctgctctga tgccgcatag ttaagccagc 8460

cccgacaccc gccaacaccc gctgacgcgc cctgacgggc ttgtctgctc ccggcatccg 8520

cttacagaca agctgtgacc gtctccggga gctgcatgtg tcagaggttt tcaccgtcat 8580

caccgaaacg cgcgagacga aagggcctcg tgatacgcct atttttatag gttaatgtca 8640

tgataataat ggtttcttag acgtcaggtg gcacttttcg gggaaatgtg cgcggaaccc 8700

ctatttgttt atttttctaa atacattcaa atatgtatcc gctcatgaga caataaccct 8760

gataaatgct tcaataatat tgaaaaagga agagtatgag tattcaacat ttccgtgtcg 8820

cccttattcc cttttttgcg gcattttgcc ttcctgtttt tgctcaccca gaaacgctgg 8880

tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt gggttacatc gaactggatc 8940

tcaacagcgg taagatcctt gagagttttc gccccgaaga acgttttcca atgatgagca 9000

cttttaaagt tctgctatgt ggcgcggtat tatcccgtat tgacgccggg caagagcaac 9060

tcggtcgccg catacactat tctcagaatg acttggttga gtactcacca gtcacagaaa 9120

agcatcttac ggatggcatg acagtaagag aattatgcag tgctgccata accatgagtg 9180

ataacactgc ggccaactta cttctgacaa cgatcggagg accgaaggag ctaaccgctt 9240

ttttgcacaa catgggggat catgtaactc gccttgatcg ttgggaaccg gagctgaatg 9300

aagccatacc aaacgacgag cgtgacacca cgatgcctgt agcaatggca acaacgttgc 9360

gcaaactatt aactggcgaa ctacttactc tagcttcccg gcaacaatta atagactgga 9420

tggaggcgga taaagttgca ggaccacttc tgcgctcggc ccttccggct ggctggttta 9480

ttgctgataa atctggagcc ggtgagcgtg gaagccgcgg tatcattgca gcactggggc 9540

cagatggtaa gccctcccgt atcgtagtta tctacacgac ggggagtcag gcaactatgg 9600

atgaacgaaa tagacagatc gctgagatag gtgcctcact gattaagcat tggtaactgt 9660

cagaccaagt ttactcatat atactttaga ttgatttaaa acttcatttt taatttaaaa 9720

ggatctaggt gaagatcctt tttgataatc tcatgaccaa aatcccttaa cgtgagtttt 9780

cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga gatccttttt 9840

ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt 9900

tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc agagcgcaga 9960

taccaaatac tgttcttcta gtgtagccgt agttaggcca ccacttcaag aactctgtag 10020

caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc agtggcgata 10080

agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg cagcggtcgg 10140

gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac accgaactga 10200

gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca 10260

ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt ccagggggaa 10320

acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt 10380

tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg gcctttttac 10440

ggttcctggc cttttgctgg ccttttgctc acatgt 10476

<210> 3

<211> 3120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 60

cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt 120

tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 180

aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt 240

ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg 300

ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga 360

tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc 420

tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac 480

actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg 540

gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca 600

acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg 660

gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg 720

acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg 780

gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag 840

ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg 900

gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct 960

cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac 1020

agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact 1080

catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga 1140

tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 1200

cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct 1260

gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 1320

taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgttc 1380

ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 1440

tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 1500

ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 1560

cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 1620

agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 1680

gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 1740

atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 1800

gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1860

gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 1920

ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 1980

cagtgagcga ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 2040

cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca 2100

acgcaattaa tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc 2160

cggctcgtat gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg 2220

accatgatta cgccaagctt gcatgcaggc ctctgcagtc gacgggcccg ggatccgatg 2280

ataaacatgt gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc 2340

tgttagagag ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac 2400

gtgacgtaga aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat 2460

ggactatcat atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt 2520

gtggaaagga cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag 2580

ttaaaataag gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttc 2640

tagcgcgtgc gccaattctg cagacaaatg gctctagagg tacccataga tctagatgca 2700

ttcgcgaggt accgagctcg aattcactgg ccgtcgtttt acaacgtcgt gactgggaaa 2760

accctggcgt tacccaactt aatcgccttg cagcacatcc ccctttcgcc agctggcgta 2820

atagcgaaga ggcccgcacc gatcgccctt cccaacagtt gcgcagcctg aatggcgaat 2880

ggcgcctgat gcggtatttt ctccttacgc atctgtgcgg tatttcacac cgcatatggt 2940

gcactctcag tacaatctgc tctgatgccg catagttaag ccagccccga cacccgccaa 3000

cacccgctga cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg 3060

tgaccgtctc cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga 3120

<210> 5

<211> 175

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tgtggaaagg acgaaacacc gggtcttcga gaagacctgt tttagagcta gaaatagcaa 60

gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg gtgctttttt 120

ctagcgcgtg cgccaattct gcagacaaat ggctctagag gtacccgtta cataa 175

<210> 4

<211> 554

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tctgcagaca aatggctcta gaggtacccg ttacataact tacggtaaat ggcccgcctg 60

gctgaccgcc caacgacccc cgcccattga cgtcaatagt aacgccaata gggactttcc 120

attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 180

atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 240

gtgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 300

tcgctattac catgggggca gagcgcacat cgcccacagt ccccgagaag ttggggggag 360

gggtcggcaa ttgatccggt gcctagagaa ggtggcgcgg ggtaaactgg gaaagtgatg 420

tcgtgtactg gctccgcctt tttcccgagg gtgggggaga accgtatata agtgcagtag 480

tcgccgtgaa cgttcttttt cgcaacgggt ttgccgccag aacacaggtt ggaccggtgc 540

caccatggac tata 554

<210> 6

<211> 447

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ccagaacaca ggttggaccg gtgccaccat ggactataag gaccacgacg gagactacaa 60

ggatcatgat attgattaca aagacgatga cgataagatg gcccccaaaa agaaacgaaa 120

ggtgggtggg tccccaaaga agaagcggaa ggtcggtatc cacggagtcc cagcagccga 180

caagaagtac agcatcggcc tggacatcgg caccaactct gtgggctggg ccgtgatcac 240

cgacgagtac aaggtgccca gcaagaaatt caaggtgctg ggcaacaccg accggcacag 300

catcaagaag aacctgatcg gagccctgct gttcgacagc ggcgaaacag ccgaggccac 360

ccggctgaag agaaccgcca gaagaagata caccagacgg aagaaccgga tctgctatct 420

gcaagagatc ttcagcaacg agatggc 447

<210> 7

<211> 2727

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cggcggccac gaaaaaggcc ggccaggcaa aaaagaaaaa gggcggctcc aagcggcctg 60

ccgcgacgaa gaaagcggga caggccaaga aaaagaaagg atccggcgca acaaacttct 120

ctctgctgaa acaagccgga gatgtcgaag agaatcctgg accggtgagc aagggcgagg 180

agctgttcac cggggtggtg cccatcctgg tcgagctgga cggcgacgta aacggccaca 240

agttcagcgt gtccggcgag ggcgagggcg atgccaccta cggcaagctg accctgaagt 300

tcatctgcac caccggcaag ctgcccgtgc cctggcccac cctcgtgacc accctgacct 360

acggcgtgca gtgcttcagc cgctaccccg accacatgaa gcagcacgac ttcttcaagt 420

ccgccatgcc cgaaggctac gtccaggagc gcaccatctt cttcaaggac gacggcaact 480

acaagacccg cgccgaggtg aagttcgagg gcgacaccct ggtgaaccgc atcgagctga 540

agggcatcga cttcaaggag gacggcaaca tcctggggca caagctggag tacaactaca 600

acagccacaa cgtctatatc atggccgaca agcagaagaa cggcatcaag gtgaacttca 660

agatccgcca caacatcgag gacggcagcg tgcagctcgc cgaccactac cagcagaaca 720

cccccatcgg cgacggcccc gtgctgctgc ccgacaacca ctacctgagc acccagtccg 780

ccctgagcaa agaccccaac gagaagcgcg atcacatggt cctgctggag ttcgtgaccg 840

ccgccgggat cactctcggc atggacgagc tgtacaaggg ctccggcgag ggcaggggaa 900

gtcttctaac atgcggggac gtggaggaaa atcccggccc aaccgagtac aagcccacgg 960

tgcgcctcgc cacccgcgac gacgtcccca gggccgtacg caccctcgcc gccgcgttcg 1020

ccgactaccc cgccacgcgc cacaccgtcg atccggaccg ccacatcgag cgggtcaccg 1080

agctgcaaga actcttcctc acgcgcgtcg ggctcgacat cggcaaggtg tgggtcgcgg 1140

acgacggcgc cgcggtggcg gtctggacca cgccggagag cgtcgaagcg ggggcggtgt 1200

tcgccgagat cggcccgcgc atggccgagt tgagcggttc ccggctggcc gcgcagcaac 1260

agatggaagg cctcctggcg ccgcaccggc ccaaggagcc cgcgtggttc ctggccaccg 1320

tcggagtctc gcccgaccac cagggcaagg gtctgggcag cgccgtcgtg ctccccggag 1380

tggaggcggc cgagcgcgcc ggggtgcccg ccttcctgga gacctccgcg ccccgcaacc 1440

tccccttcta cgagcggctc ggcttcaccg tcaccgccga cgtcgaggtg cccgaaggac 1500

cgcgcacctg gtgcatgacc cgcaagcccg gtgcctgaac gcgttaagtc gacaatcaac 1560

ctctggatta caaaatttgt gaaagattga ctggtattct taactatgtt gctcctttta 1620

cgctatgtgg atacgctgct ttaatgcctt tgtatcatgc tattgcttcc cgtatggctt 1680

tcattttctc ctccttgtat aaatcctggt tgctgtctct ttatgaggag ttgtggcccg 1740

ttgtcaggca acgtggcgtg gtgtgcactg tgtttgctga cgcaaccccc actggttggg 1800

gcattgccac cacctgtcag ctcctttccg ggactttcgc tttccccctc cctattgcca 1860

cggcggaact catcgccgcc tgccttgccc gctgctggac aggggctcgg ctgttgggca 1920

ctgacaattc cgtggtgttg tcggggaaat catcgtcctt tccttggctg ctcgcctgtg 1980

ttgccacctg gattctgcgc gggacgtcct tctgctacgt cccttcggcc ctcaatccag 2040

cggaccttcc ttcccgcggc ctgctgccgg ctctgcggcc tcttccgcgt cttcgccttc 2100

gccctcagac gagtcggatc tccctttggg ccgcctcccc gcgtcgactt taagaccaat 2160

gacttacaag gcagctgtag atcttagcca ctttttaaaa gaaaaggggg gactggaagg 2220

gctaattcac tcccaacgaa gacaagatct gctttttgct tgtactgggt ctctctggtt 2280

agaccagatc tgagcctggg agctctctgg ctaactaggg aacccactgc ttaagcctca 2340

ataaagcttg ccttgagtgc ttcaagtagt gtgtgcccgt ctgttgtgtg actctggtaa 2400

ctagagatcc ctcagaccct tttagtcagt gtggaaaatc tctagcaggg cccgtttaaa 2460

cccgctgatc agcctcgact gtgccttcta gttgccagcc atctgttgtt tgcccctccc 2520

ccgtgccttc cttgaccctg gaaggtgcca ctcccactgt cctttcctaa taaaatgagg 2580

aaattgcatc gcattgtctg agtaggtgtc attctattct ggggggtggg gtggggcagg 2640

acagcaaggg ggaggattgg gaagacaata gcaggcatgc tggggatgcg gtgggctcta 2700

tggcctgcag gggcgcctga tgcggta 2727

<210> 8

<211> 410

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gataaacatg tgagggccta tttcccatga ttccttcata tttgcatata cgatacaagg 60

ctgttagaga gataattgga attaatttga ctgtaaacac aaagatatta gtacaaaata 120

cgtgacgtag aaagtaataa tttcttgggt agtttgcagt tttaaaatta tgttttaaaa 180

tggactatca tatgcttacc gtaacttgaa agtatttcga tttcttggct ttatatatct 240

tgtggaaagg acgaaacacc gggtcttcga gaagacctgt tttagagcta gaaatagcaa 300

gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg gtgctttttt 360

ctagcgcgtg cgccaattct gcagacaaat ggctctagag gtacccatag 410

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

agttatggca gaactcagtg 20

<210> 10

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

caccgagtta tggcagaact cagtg 25

<210> 11

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

aaaccactga gttctgccat aactc 25

<210> 12

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ccccatccaa agtttttaaa gga 23

<210> 13

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

tgtggcagat gtcacagttt agg 23

<210> 14

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

aguuauggca gaacucagug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 15

<211> 401

<212> PRT

<213> pig (Sus \8194; scrofa)

<400> 15

Met Asn Lys Leu Leu Cys Cys Ala Leu Val Phe Leu Asp Ile Ser Ile

1 5 10 15

Lys Trp Thr Thr Gln Glu Thr Phe Pro Pro Lys Tyr Leu His Tyr Asp

20 25 30

Pro Glu Thr Ser Lys Gln Leu Met Cys Asp Lys Cys Pro Pro Gly Thr

35 40 45

Ser Leu Lys Gln His Cys Thr Ala Arg Arg Lys Thr Val Cys Ala Pro

50 55 60

Cys Pro Asp His Tyr Tyr Thr Asp Ser Trp His Thr Ser Asp Glu Cys

65 70 75 80

Leu Tyr Cys Thr Pro Val Cys Lys Glu Leu Gln Tyr Val Lys Gln Glu

85 90 95

Cys Asn Arg Thr His Asn Arg Val Cys Glu Cys Glu Glu Gly Arg Tyr

100 105 110

Leu Glu Leu Glu Phe Cys Leu Lys His Arg Ser Cys Pro Pro Gly Phe

115 120 125

Gly Val Leu His Ala Gly Thr Pro Glu Arg Asn Thr Val Cys Lys Arg

130 135 140

Cys Pro Asp Gly Phe Phe Ser Asn Glu Thr Ser Ser Lys Ala Pro Cys

145 150 155 160

Arg Lys His Thr Asn Cys Ser Ala Leu Gly Leu Leu Leu Thr Gln Lys

165 170 175

Gly Asn Ala Thr His Asp Asn Ile Cys Ser Xaa Asn Ser Glu Ser Thr

180 185 190

His Lys Cys Gly Ile Asp Val Thr Leu Cys Glu Glu Ala Phe Phe Arg

195 200 205

Phe Ala Val Pro Thr Lys Leu Thr Pro Asn Trp Leu Ser Val Leu Val

210 215 220

Asp Asn Leu Pro Gly Thr Lys Leu Asn Ala Glu Xaa Val Glu Arg Ile

225 230 235 240

Lys Arg Arg His Ser Ser Gln Glu Gln Thr Phe Gln Leu Leu Lys Leu

245 250 255

Trp Lys His Gln Asn Lys Asp Gln Asp Met Val Lys Lys Ile Ile Gln

260 265 270

Gly Ile Asp Leu Cys Glu Asn Ser Val Gln Lys His Ile Gly His Met

275 280 285

Asn Leu Thr Phe Glu Gln Leu Arg Ile Leu Met Gln Ser Leu Pro Gly

290 295 300

Lys Lys Val Pro Thr Glu Asp Ile Glu Glu Thr Val Lys Met Cys Lys

305 310 315 320

Ser Ser Glu Gln Ile Leu Lys Leu Leu Ser Leu Trp Arg Ile Lys Asn

325 330 335

Gly Asp Gln Asp Thr Arg Lys Gly Leu Met His Ala Leu Lys His Leu

340 345 350

Lys Thr Tyr His Phe Pro Lys Thr Val Thr Gln Ser Leu Lys Lys Ile

355 360 365

Ile Arg Phe Leu His Ser Phe Thr Met Tyr Arg Leu Tyr Gln Lys Leu

370 375 380

Phe Leu Glu Met Ile Gly Asn Gln Val Gln Ser Val Lys Ile Ser Cys

385 390 395 400

Leu

<210> 16

<211> 1320

<212> DNA

<213> pig (Sus \8194; scrofa)

<400> 16

ctgataatta ctagttcatc caattcacta aactggagac aatcctgaag cccgggataa 60

actgtcactc agggcacatg aattatgtag cagtgcatct acgtgtaatc attttcagtc 120

tgatgagctt tccactccag ccaactatga gctagattta cttaagatgt tttgctgcta 180

ttgccatctt ggtctttgag gttaagctac tcagaggcaa gaactgtggc ttcttaactt 240

attttctgtg gttgtagctc agtaggcagg gtgggcattg aggctttagg tagtaaagga 300

ctttttgagg ttaacgatgc acagaagaac caccccattt ccatgctaac ctgccgctat 360

ttccctttct tcctctagtt cttggacatc tccattaaat ggaccaccca ggaaactttt 420

cctccaaagt accttcatta tgacccagaa acctctaagc aactgatgtg cgacaaatgt 480

cctcctggca cctccctaaa acagcactgc acggcaaggc ggaagaccgt gtgtgccccc 540

tgtcctgacc actattacac agacagctgg cacaccagtg acgagtgtct gtactgcacc 600

ccagtgtgca aggaactgca gtacgtcaag caggaatgca atcgcaccca taaccgcgtg 660

tgtgaatgcg aggaggggcg ctacctggag ctagagttct gcttgaagca caggagctgt 720

cctcctggat ttggagtgct acacgcaggt aggtatcagc ttccaggtgt ggccaaattc 780

attagcatca ttcaaagtca ggtagtatgg aaaatttgag ggaacatgtt tgtcctgatg 840

acattacagg atagaaagtt gcaaaggtaa tggaacgtgc taggtatgta ccatgtgtct 900

ggatcgctgc caaagaacca ttcctcagag gaacgctctg ccactacggg acaatttagt 960

gacaaatctc aaatgcagca aatcgctttc taatgagatg catggcagac tgctcttttt 1020

taaaggccta ccctcggagc tgcactgttg atagctgatc tatacctctg tgttgcactt 1080

ctgcatggac aacgtcaaac cgcagtgctt tctgacaaac atcagaaatg ttaattgata 1140

ccaagagagt aatgatgctg atattaatga agctctggag tactaacaat gagtagttat 1200

aattaattat gcaaaatatg aaaatggcta ggggaaaggc agctcattat taaaaatgaa 1260

gctggttctt cctttggcat gggagttgag tgtctaggag gataaagacg ggagcaccat 1320

<210> 17

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

actttttgag gttaacgatg c 21

<210> 18

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

tgagatttgt cactaaattg t 21

<210> 19

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

actcagaggc aagaactgtg g 21

<210> 20

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

acacagaggt atagatcagc t 21

<210> 21

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

tgtagcactc caaatccagg 20

<210> 22

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

cctcctcgca ttcacacacg 20

<210> 23

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

ctgcagttcc ttgcacactg 20

<210> 24

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

gtaatagtgg tcaggacagg 20

<210> 25

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

caccgtgtag cactccaaat ccagg 25

<210> 26

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

aaaccctgga tttggagtgc tacac 25

<210> 27

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

caccgcctcc tcgcattcac acacg 25

<210> 28

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

aaaccgtgtg tgaatgcgag gaggc 25

<210> 29

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

caccgctgca gttccttgca cactg 25

<210> 30

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

aaaccagtgt gcaaggaact gcagc 25

<210> 31

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 31

caccgtaata gtggtcagga cagg 24

<210> 32

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

aaaccctgtc ctgaccacta ttac 24

<210> 33

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 33

uguagcacuc caaauccagg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 34

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 34

ccuccucgca uucacacacg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 35

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 35

cugcaguucc uugcacacug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 36

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 36

guaauagugg ucaggacagg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 37

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 37

aacagcactg cacggcaagg 20

<210> 38

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 38

cctcctcgca ttcacacacg 20

<210> 39

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 39

gcagtacaga cactcgtcac 20

<210> 40

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 40

gtactgcacc ccagtgtgca 20

<210> 41

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 41

caccgaacag cactgcacgg caagg 25

<210> 42

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 42

aaacccttgc cgtgcagtgc tgttc 25

<210> 43

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 43

caccgcctcc tcgcattcac acacg 25

<210> 44

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 44

aaaccgtgtg tgaatgcgag gaggc 25

<210> 45

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 45

caccgcagta cagacactcg tcac 24

<210> 46

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 46

aaacgtgacg agtgtctgta ctgc 24

<210> 47

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 47

caccgtactg caccccagtg tgca 24

<210> 48

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 48

aaactgcaca ctggggtgca gtac 24

<210> 49

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 49

aacagcacug cacggcaagg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 50

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 50

ccuccucgca uucacacacg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 51

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 51

gcaguacaga cacucgucac guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 52

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 52

guacugcacc ccagugugca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

Claims (4)

1. A CRISPR/Cas9 system for pig OPG gene editing, which is characterized by comprising a Cas9 expression vector and a gRNA expression vector; the Cas9 expression vector is a pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO vector with the complete sequence of the plasmid shown as SEQ ID NO. 2; the expression sequence of the gRNA expression vector is shown as SEQ ID NO: a gRNA shown at 49; the gRNA expression vector takes pKG-U6gRNA with the complete sequence shown in SEQ ID NO.3 as a vector framework; the gRNA expression vector is prepared by mixing the nucleotide sequence shown in SEQ ID NO:41 and SEQ ID NO:42 to obtain a double-stranded DNA molecule with a sticky end, wherein the double-stranded DNA molecule is obtained by annealing the single-stranded DNA shown in the specification and is cloned to a pKG-U6gRNA skeleton vector; the molar ratio of the gRNA expression vector to the Cas9 expression vector is 3.

2. The use of the CRISPR/Cas9 system of claim 1 in the construction of porcine recombinant porcine fibroblasts knocked-out for the porcine OPG gene.

3. A recombinant porcine fibroblast with a porcine OPG gene knocked out is characterized in that the porcine primary fibroblast cotransfected by the CRISPR/Cas9 system of claim 1 is obtained after verification.

4. Use of the recombinant cell of claim 3 in the construction of OPG knockout cloned pigs.

Images