CN112877362A - Gene editing system for constructing high-quality porcine nuclear transplantation donor cells with high fertility and capability of resisting porcine reproductive and respiratory syndrome and serial diarrhea diseases and application of gene editing system - Google Patents

Abstract

The invention discloses a gene editing system of high-quality pig nuclear transplantation donor cells with high fertility and resistance to porcine reproductive and respiratory syndrome and serial diarrhea diseases and application thereof. A CRISPR/Cas9 system for porcine INHA-CD163-pAPN gene editing comprising a Cas9 expression vector, a gRNA expression vector for porcine INHA gene, a gRNA expression vector for porcine CD163 gene and a gRNA expression vector for porcine pAPN gene; the Cas9 expression vector is a plasmid complete sequence shown in SEQ ID NO. 2. The invention designs corresponding gRNA expression vectors aiming at different targets of INHA, CD163 and pAPN genes respectively, and obtains gRNA with higher editing efficiency and the expression vector thereof by screening. The modified Cas9 high-efficiency expression vector is matched for gene editing, and the editing efficiency is obviously improved compared with that of the original vector.

Description

Gene editing system for constructing high-quality porcine nuclear transplantation donor cells with high fertility and capability of resisting porcine reproductive and respiratory syndrome and serial diarrhea diseases and application of gene editing system

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a CRISPR/Cas9 system for editing INHA, CD163 and pAPN genes and application thereof in constructing high-quality porcine nuclear transplantation donor cells with high fertility and resistance to porcine reproductive and respiratory syndrome and serial diarrhea.

Background

The pig is one of domestic animals domesticated in the earliest time in China, and is an important meat animal for human beings in the historical long river. Chinese people like to eat pork, which is related to the diet culture of thousands of years. Since 2000 years, pork accounts for over 70% of the meat consumption in China, and is the most important meat consumed in China. At present, more than 4000 million breeding sows are kept in a stall in China, if each sow can produce one more piglet on average, the number of 300 plus 400 million sows can be reduced in China according to calculation of two sows per year, the raising cost of each pork pig can be reduced, and the economic benefit of pig raising production is improved. Porcine reproductive and respiratory syndrome (porcine reproductive and respiratory syndrome), transmissible gastroenteritis, epidemic diarrhea and the like are the most common infectious diseases of live pigs under the intensive culture production condition, and the fatality rate of the diseases is extremely high, which causes great economic loss to the pig raising production. Therefore, the breeding of high-quality pig lines with high fertility and resistance to blue ear diseases and series diarrhea diseases can bring more economic benefits to the pig industry.

One of the important factors affecting pig litter size is the number of ovulations in pigs, which are affected by the level of Follicle Stimulating Hormone (FSH), whose secretion is regulated by a sex hormone, Inhibin (Inhibin). Inhibin has strong FSH secretion inhibiting effect, and can feedback inhibit FSH release from anterior pituitary, thereby inhibiting growth and development of follicle. Inhibin is a glycoprotein hormone secreted by the sexual gland and consists of an alpha subunit and a beta subunit. The β subunit is of two subtypes: beta is a_AAnd beta_B，αβ_AForm Inhibin A, alpha beta_BConstituting Inhibin B. The INHA gene encodes the Inhibin alpha subunit, which is essential for the physiological function of Inhibin. It has been proved by research that inhibiting expression of INHA gene can promote follicular development and increase ovulation rate. CD163 has been shown to be a receptor for Porcine Reproductive and Respiratory Syndrome Virus (PRRSV), and interaction with PRRSV is mainly due to Ligand-binding pocket (LBP) in SRCR5 domain of CD163 receptor, whose coding region is located in exon 7 of porcine CD163, and since other parts of SRCR5 domain still have important biological functions, editing only exon 7 of CD163 maximizes the biological functions of CD163 under conditions that disrupt the viral interaction region. Porcine aminopeptidase N (pAPN) has been shown to be a specific receptor for transmissible gastroenteritis virus (TGEV) and has also been shown to be one of the receptors for Porcine Epidemic Diarrhea Virus (PEDV) and porcine delta coronavirus (PDCoV), which are abundantly represented on the brush border of the porcine small intestineSo as to achieve the purpose. The pAPN gene is damaged to inactivate the encoded receptor protein, TGEV cannot infect live pigs, and the infection of PEDV and PDCoV to the pigs is greatly reduced. TGEV and PEDV belong to the genus alphacoronavirus, while PDCoV belongs to the genus delta coronavirus, pAPN being a common receptor for these three coronaviruses.

Gene editing is a biotechnology that has been continuously and significantly developed in recent years, and includes editing technologies from homologous recombination-based gene editing to nuclease-based ZFNs, TALENs, CRISPR/Cas9, and the like, wherein CRISPR/Cas9 technology is currently the most advanced gene editing technology. Therefore, the invention adopts CRISPR/cas9 technology to carry out mutation of INHA, CD163 and pAPN genes and obtains single cell clone with three genes being jointly knocked out, which lays a foundation for cultivating high-quality pig breeds with high reproductive capacity, blue ear disease resistance and serial diarrhea resistance by somatic cell nuclear transfer animal cloning technology in the later period. The loss of the functions of INHA, CD163 and pAPN can effectively improve the ovulation rate of female cloned pigs on one hand, further improve the fertility of the female cloned pigs and increase the economic benefit of the pig industry; on the other hand, the resistance of the cloned pig to the blue ear disease and the serial diarrhea can be effectively improved, the death rate of the live pig is reduced, and the loss of the pig industry is reduced.

Disclosure of Invention

The invention aims to provide a CRISPR/Cas9 system for pig INHA-CD163-pAPN gene editing.

Another object of the present invention is to provide an application of the CRISPR/Cas9 system.

It is still another object of the present invention to provide a recombinant cell and uses thereof.

The purpose of the invention can be realized by the following technical scheme:

a CRISPR/Cas9 system for pig INHA-CD163-pAPN gene editing comprises a Cas9 expression vector, a gRNA expression vector aiming at pig INHA gene, a gRNA expression vector aiming at pig CD163 gene and a gRNA expression vector aiming at pig pAPN gene. Preferably, the whole plasmid sequence of the Cas9 expression vector (named as pKG-GE3) is shown as SEQ ID NO. 2.

The Cas9 vector comprises nucleotide sequences encoding Cas9 protein, EGFP and Puro resistance protein, wherein the Cas9 vector further comprises an EF1a promoter, a WPRE element and a3 ' LTR sequence element, preferably, the nucleotide sequences of the Cas vector are as follows from 5 ' to 3 ': a CMV enhancer, an EF1a promoter, a nuclear localization signal, a nucleotide sequence encoding a Cas9 protein, a nuclear localization signal, a nucleotide sequence encoding a self-splicing polypeptide P2A, a nucleotide sequence encoding an EGFP, a nucleotide sequence encoding a self-cleaving polypeptide T2A, a nucleotide sequence encoding a Puro resistance protein, a WPRE sequence element, a 3' LTR sequence element, and a polyA signal sequence element.

In order to increase the gene editing capacity of the Cas9 vector, the invention obtains the pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO (namely the pKG-GE3 vector) by modifying the vector purchased from addge (Plasmid #42230, from Zhang Feng lab) pX330-U6-Chimeric _ BB-CBh-hSpCas9 (PX 330 for short). The map of PX330 is shown in FIG. 1, and the modification mode is as follows:

1) removing redundant invalid sequences in the original vector gRNA framework;

2) modifying a promoter: the original promoter (chicken beta-actin promoter) is transformed into an EF1a promoter with higher expression activity, and the protein expression capacity of the Cas9 gene is increased;

3) increase of nuclear localization signal: a nuclear localization signal coding sequence (NLS) is added at the N end and the C end of the Cas9, and the nuclear localization capability of the Cas9 is increased;

4) adding double screening marks: the original vector does not have any screening marker, is not beneficial to screening and enriching of positive transformed cells, and is inserted with P2A-EGFP-T2A-PURO at the C end of Cas9 to endow the vector with fluorescence and resistance screening capability;

5) inserting WPRE and 3' LTR and other sequences for regulating gene expression: the protein translation capability of the Cas9 gene can be enhanced by inserting WPRE, 3' LTR and other sequences in the reading frame of the gene.

The modified vector pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO (pKG-GE 3 for short) and the modified site are shown in figure 2, and the whole sequence of the plasmid is shown in SEQ ID NO: 2 is shown in the specification; the main elements of pKG-GE3 are:

1) gRNA expression elements: u6gRNA scaffold;

2) a promoter: the EF1a promoter and CMV enhancer;

3) cas9 gene containing multiple NLS: a Cas9 gene containing N-terminal and C-terminal multinuclear localization signals (NLS);

4) screening for marker genes: the fluorescent and resistant double-selection marker element P2A-EGFP-T2A-PURO;

5) elements that enhance translation: WPRE and 3' LTR enhance the translation efficiency of Cas9 and the screening marker gene;

6) transcription termination signal: a bGHpolyA signal;

7) carrier skeleton: including Amp resistance elements and ori replicons, among others.

The plasmid pKG-GE3 has a specific fusion gene; the specific fusion gene encodes a specific fusion protein;

the specific fusion protein sequentially comprises the following elements from N end to C end: two Nuclear Localization Signals (NLS), Cas9 protein, two nuclear localization signals, self-splicing polypeptide P2A, fluorescent reporter protein, self-cleavage polypeptide T2A, resistance selection marker protein;

in plasmid pKG-GE3, the expression of the specific fusion gene is driven by the EF1a promoter;

in plasmid pKG-GE3, the specific fusion gene has downstream of it a WPRE sequence element, a 3' LTR sequence element and a bGH poly (A) signal sequence element.

The plasmid pKG-GE3 has the following elements in the following order: CMV enhancer, EF1a promoter, the specific fusion gene, WPRE sequence element, 3' LTR sequence element, bGH poly (A) signal sequence element.

In the specific fusion protein, two nuclear localization signals at the upstream of the Cas9 protein are SV40 nuclear localization signals, and two nuclear localization signals at the downstream of the Cas9 protein are nucleoplasmin nuclear localization signals.

In the specific fusion protein, the fluorescent reporter protein can be EGFP protein.

In the specific fusion protein, the resistance screening marker protein can be Puromycin resistance protein.

The amino acid sequence of self-cleaving polypeptide P2A is "ATNFSLLKQAGDVEENPGP" (the cleavage site that occurs self-cleaves is between the first and second amino acid residues from the C-terminus).

The amino acid sequence of self-cleaving polypeptide T2A is "EGRGSLLTCGDVEENPGP" (the cleavage site that occurs self-cleaves is between the first and second amino acid residues from the C-terminus).

The specific fusion gene is specifically shown as SEQ ID NO: 2, nucleotide 911-6706.

The CMV enhancer is as set forth in SEQ ID NO: 2 at nucleotide 395-680.

The EF1a promoter is shown as SEQ ID NO: 2, nucleotide 682-890.

The WPRE sequence element is shown as SEQ ID NO: 2, 6722-7310 nucleotide.

The 3' LTR sequence element is shown in SEQ ID NO: nucleotide 7382-7615 in 2.

The bGH poly (a) signal sequence element is as set forth in SEQ ID NO: 2 as shown by nucleotide 7647-7871.

Preferably, the pKG-GE3 plasmid is a circular plasmid.

In the CRISPR/Cas9 system, vector skeletons of a gRNA expression vector for pig INHA gene, a gRNA expression vector for pig CD163 gene and a gRNA expression vector for pig pAPN gene are all pKG-U6gRNA, and the whole sequence of the plasmid is shown in SEQ ID No. 3.

As further optimization of the invention, the gRNA expression vector aiming at the pig INHA gene expresses the gRNA shown in SEQ ID NO.18, and the target point is shown in SEQ ID NO. 15; a gRNA expression vector aiming at the pig CD163 gene expresses a gRNA shown by SEQ ID NO.24, and the target point of the gRNA is shown by SEQ ID NO. 21; the gRNA expression vector for the porcine pAPN gene expresses gRNA shown in SEQ ID NO.30, and the target point is shown in SEQ ID NO. 27.

As a further preferred mode of the invention, the gRNA expression vector for the pig INHA gene is obtained by inserting a double chain formed by annealing single-stranded DNA shown in SEQ ID NO.16 and SEQ ID NO.17 into a vector skeleton pKG-U6 gRNA; the gRNA expression vector for the pig CD163 gene is obtained by annealing single-stranded DNA shown in SEQ ID No.22 and SEQ ID No.23 to form a double-stranded vector skeleton pKG-U6 gRNA; the gRNA expression vector for the pAPN gene of the pig is obtained by annealing single-stranded DNA shown in SEQ ID NO.28 and SEQ ID NO.29 to form a double-stranded vector skeleton pKG-U6 gRNA.

The CRISPR/Cas9 system disclosed by the invention is applied to construction of INHA, CD163 and pAPN three-gene-mutated porcine recombinant cells.

A recombinant cell is obtained by carrying out verification on a pig primary fibroblast cotransfected by the CRISPR/Cas9 system.

The recombinant cell is applied to construction of an INHA, CD163 and pAPN three-gene knockout cloned pig.

A gRNA expression vector for pig INHA genes expresses gRNA shown in SEQ ID No.18, the vector framework of the expression vector is pKG-U6gRNA, and the whole sequence of the plasmid is shown in SEQ ID No. 3.

A gRNA expression vector for pig CD163 gene, which expresses gRNA shown in SEQ ID No.24, and the vector skeleton of the expression vector is pKG-U6gRNA, and the whole sequence of the plasmid is shown in SEQ ID No. 3.

A gRNA expression vector for a porcine pAPN gene expresses a gRNA shown in SEQ ID No.30, a vector framework of the expression vector is pKG-U6gRNA, and a plasmid complete sequence is shown in SEQ ID No. 3.

Compared with the prior art, the invention has at least the following beneficial effects:

(1) the subject of the invention (pig) has better applicability than other animals (rats, mice, primates).

Rodents such as rats and mice have great differences from humans in body types, organ sizes, physiology, pathology and the like, and cannot truly simulate normal physiological and pathological states of humans. Studies have shown that over 95% of drugs validated to be effective in large mice are not effective in human clinical trials. In large animals, primates are animals that have a close relationship with humans, but are small in size, late in sexual maturity (mating starts at age 6-7), and are single-birth animals, and the population propagation speed is extremely slow, and the raising cost is high. In addition, primate cloning efficiency is low, difficulty is high, and cost is high.

However, pigs, which are animals related to humans other than primates, do not have the above-mentioned disadvantages, and have body types, body weights, organ sizes, and the like similar to those of humans, and are very similar to those of humans in terms of anatomy, physiology, immunology, nutritional metabolism, disease pathogenesis, and the like. Meanwhile, the pigs have early sexual maturity (4-6 months), high reproductive capacity and multiple piglets, and can form a large group within 2-3 years. In addition, the cloning technology of the pig is very mature, and the cloning and feeding cost is much lower than that of a primate. Pigs are therefore very suitable animals as models for human diseases.

(2) According to the invention, experiments prove that the modified pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO vector is replaced by a stronger promoter and an element for enhancing protein translation is added, so that the expression of Cas9 is improved, the number of nuclear localization signals is increased, the nuclear localization capability of Cas9 protein is improved, and the gene editing efficiency is higher compared with the pX330 vector before modification. The invention also adds fluorescent mark and resistance mark in the carrier, which is more convenient to be applied to the screening and enrichment of the positive transformation cell of the carrier. The gene editing is carried out by adopting the Cas9 high-efficiency expression vector jointly modified by the gRNA screened by the invention, and the editing efficiency is improved by more than 100 percent compared with that of the original vector.

(3) The invention designs corresponding expression vectors aiming at different target gRNAs of INHA, CD163 and pAPN genes, and obtains gRNAs with higher editing efficiency and expression vectors thereof by screening. The modified Cas9 high-efficiency expression vector is matched for gene editing, the genotype of the obtained cells can be analyzed through the sequencing result of the target gene PCR product, the probability of obtaining single target gene mutation is 21-41%, and the probability is greatly superior to the probability of obtaining mutation in a gene editing and delivering method (namely injecting a gene editing material by using fertilized eggs) by using an embryo injection technology.

(4) The obtained mutant unicellular clone strain is used for somatic cell nuclear transfer animal cloning to directly obtain the cloned pig containing target gene mutation, and the mutation can be stably inherited.

The invention adopts the method of primary cell in vitro editing with great technical difficulty and high challenge and screening positive editing single cell clone, and directly obtains the corresponding gene editing pig through somatic cell nuclear transfer animal cloning technology at the later stage, thereby greatly shortening the manufacturing period of the gene editing pig and saving manpower, material resources and financial resources.

Drawings

FIG. 1 is a schematic diagram of the structure of plasmid pX 330.

FIG. 2 is a schematic diagram of the structure of plasmid pU6gRNAcas 9.

FIG. 3 is a structural map of the pU6gRNA-eEF1a Cas9 vector.

FIG. 4 is a pU6gRNA-eEF1a Cas9+ nNLS vector map.

FIG. 5 is a schematic diagram of the structure of plasmid pKG-GE 3.

FIG. 6 is a schematic structural diagram of plasmid pKG-U6 gRNA.

FIG. 7 is a schematic diagram showing the insertion of a DNA molecule of about 20bp (a target sequence binding region for transcription to form a gRNA) into a plasmid pKG-U6 gRNA.

FIG. 8 is a graph of the sequencing peaks of step 2.3.3 in example 2.

FIG. 9 is a graph of the sequencing peaks of step 2.4.3 in example 2.

FIG. 10 is an electrophoretogram obtained after PCR amplification of a primer pair consisting of INHA-E2-JDF178/INHA-E2-JDR654 using genomic DNA of 18 pigs as a template in step 3.1 of example 3.

FIG. 11 is a graph of the sequencing peaks in step 3.4 of example 3.

FIG. 12 is an electrophoretogram obtained after PCR amplification of 18 pig genomic DNAs as templates in step 4.1 of example 4 using a primer pair consisting of CD163-JDF121/CD163-JDR 518.

FIG. 13 is a graph of the sequencing peaks in step 4.4 of example 4.

FIG. 14 is an electrophoretogram obtained after PCR amplification of 18 pig genomic DNAs as templates in step 5.1 of example 5 using a primer set consisting of APN-JDF94/APN-JDR 656.

FIG. 15 is a graph of the sequencing peaks in step 5.4 of example 5.

FIG. 16 is an electrophoretogram of PCR amplified in step 6.4.4 of example 6 using genomic DNA as template and primer pair consisting of INHA-E2-JDF178/INHA-E2-JDR 654.

FIG. 17 is an electrophoretogram obtained after PCR amplification using a primer pair consisting of CD163-JDF121/CD163-JDR518 using genomic DNA as a template at step 6.4.4 of example 6.

FIG. 18 is an electrophoretogram obtained after PCR amplification of a primer pair consisting of APN-JDF94/APN-JDR656 using genomic DNA as a template in step 6.4.4 of example 6.

FIG. 19 is a diagram of exemplary sequencing peaks for determining that the target gene is wild-type at step 6.4.5.1 in example 6.

FIG. 20 is a diagram showing an exemplary sequencing peak for determining that the target gene is a hybrid mutant type at step 6.4.5.1 in example 6.

FIG. 21 is a diagram of exemplary sequencing peaks for homozygous mutants determined to have biallelic identity variations in the target gene at step 6.4.5.1 in example 6.

FIG. 22 is a diagram of exemplary sequencing peaks for homozygous mutants determined to be biallelic different variants of the target gene at step 6.4.5.1 in example 6.

FIG. 23 is a diagram of exemplary sequencing peaks for determining that the target gene is wild-type at step 6.4.5.2 in example 6.

FIG. 24 is a diagram showing an exemplary sequencing peak for determining that the target gene is a hybrid mutant type at step 6.4.5.2 in example 6.

FIG. 25 is a diagram of exemplary sequencing peaks for homozygous mutants determined to have biallelic identity variations for the target gene at step 6.4.5.2 in example 6.

FIG. 26 is a diagram of exemplary sequencing peaks for homozygous mutants determined to have biallelic variant in step 6.4.5.2 of example 6.

FIG. 27 is a diagram of exemplary sequencing peaks for determining that the target gene is wild-type at step 6.4.5.3 in example 6.

FIG. 28 is a diagram showing an exemplary sequencing peak for determining that the target gene is a hybrid mutant type at step 6.4.5.3 in example 6.

FIG. 29 is a diagram of exemplary sequencing peaks for homozygous mutants determined to have biallelic identity variations for the target gene at step 6.4.5.3 in example 6.

FIG. 30 is a diagram of exemplary sequencing peaks for homozygous mutants determined to have biallelic variant in step 6.4.5.3 of example 6.

Detailed Description

Example 1 construction of plasmids

1.1 construction of plasmid pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO (plasmid pKG-GE3 for short)

The original plasmid pX330-U6-Chimeric _ BB-CBh-hSpCas9 (plasmid pX330 for short) has the sequence shown in SEQ ID NO. 1. The structure of plasmid pX330 is schematically shown in FIG. 1. In SEQ ID NO.1, the 440-st and 725-th nucleotides constitute the CMV enhancer, the 727-th and 1208-th nucleotides constitute the chicken beta-actin promoter, the 1304-th and 1324-th nucleotides encode the SV40 Nuclear Localization Signal (NLS), the 1325-th and 5449-th nucleotides encode the Cas9 protein, and the 5450-th and 5497-th nucleotides encode the nucleoplasmin Nuclear Localization Signal (NLS).

The plasmid pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO (figure 5) is called plasmid pKG-GE3 for short, and the nucleotide is shown in SEQ ID NO. 2. Compared with plasmid pX330, plasmid pKG-GE3 was mainly modified as follows: removing residual gRNA framework sequences (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTTT) to reduce interference; secondly, the original chicken beta-actin promoter is transformed into an EF1a promoter with higher expression activity, so that the protein expression capacity of the Cas9 gene is improved; ③ the nuclear localization signal coding gene (NLS) is added at the upstream and the downstream of the Cas9 gene, and the nuclear localization capability of the Cas9 protein is increased; the original plasmid does not have any eukaryotic cell screening marker, is not beneficial to screening and enriching of positive transformed cells, and is sequentially inserted with a P2A-EGFP-T2A-PURO coding gene at the downstream of the Cas9 gene to endow the vector with fluorescence and eukaryotic cell resistance screening capacity; inserting WPRE element and 3' LTR sequence element to strengthen the protein translating capacity of Cas9 gene.

The pKG-GE3 plasmid was constructed as follows:

(1) removal of redundant null sequences in the gRNA backbone

Plasmid pX330 was digested with BbsI and XbaI, the vector fragment (about 8313 bp) was recovered, an insert 175bp (SEQ ID NO.4) was synthesized by a multi-fragment recombination method, and the recovered vector fragment was recombined to obtain the pU6gRNAcas9 vector (FIG. 2).

(2) Engineering promoters and enhancers

For the constructed pU6gRNAcas9 vector, XbaI and AgeI endonuclease are used to remove promoter (chicken beta-actin promoter) and enhancer sequence (CMV enhancer), linear vector sequence is recovered about 7650bp, 554bp sequence containing CMV enhancer and EF1a promoter (SEQ ID NO.5) is synthesized by multi-fragment recombination, and pU6gRNAcas9 is recombined with the vector pU6gRNAcas9 after enzyme digestion to obtain pU6 NA-eEF1a Cas9 vector (FIG. 3).

(3) Cas9 gene N-terminal increasing NLS sequence

The constructed vector pU6gRNA-eEF1a Cas9 is cut by AgeI and BglII, a 7786bp vector sequence is recovered, the sequence with increased NLS is supplemented to the enzyme cutting site, namely, a 447bp Cas9 coding sequence (SEQ ID NO.6) comprising 2 nuclear localization signals and partial excision is synthesized by a multi-fragment recombination method, and the pU6gRNA-eEF1a Cas9+ nNLS vector (figure 4) is obtained by recombination.

(4) Adding NLS, P2A-EGFP-T2A-PURO and WPRE-3' LTR-bGH polyA signal into the C end of Cas9 gene

The constructed vector is named as pU6gRNA-eEF1a Cas9+ nNLS, enzyme digestion is carried out by using FseI and SbfI, a vector sequence 7781bp is recovered, 2727bp of fragment (SEQ ID NO.7) comprising NLS-P2A-EGFP-T2A-PURO-WPRE-3' LTR-bGH polyA signal is synthesized by a multi-fragment recombination method, and the vector is recombined with the vector fragment to obtain a vector pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO, which is called pKG-GE3 for short, wherein the plasmid map is shown in figure 5, and the nucleotide sequence (SEQ ID NO. 2).

SEQ ID NO: 2, the 395-680 nucleotide constitutes a CMV enhancer, the 682-890 nucleotide constitutes an EF1a promoter, the 986-1006 nucleotide encodes a Nuclear Localization Signal (NLS), the 1016-1036 nucleotide encodes a Nuclear Localization Signal (NLS), the 1037-5161 nucleotide encodes a Cas9 protein, the 5162-5209 nucleotide encodes a Nuclear Localization Signal (NLS), the 5219-5266 nucleotide encodes a Nuclear Localization Signal (NLS), the 5276-5332 nucleotide encodes a self-splicing polypeptide P2A (the amino acid sequence of the self-splicing polypeptide P2A is "ATNFSLLKQAGDVEENPGP", the cleavage position occurring from the cleavage is between the first amino acid residue and the second amino acid residue from the C-terminal), the 5333-6046 nucleotide encodes an EGFP protein, the 526056-6109 nucleotide encodes a self-splicing polypeptide T2A (the amino acid sequence of the self-splicing polypeptide T2A is "EGRGSLLTCGDVEENPGP", between the first amino acid residue and the second amino acid residue from the C-terminal position of the cleavage site), nucleotides 6110-6703 encode Puromycin protein (Puro protein for short), nucleotides 6722-7310 constitute the WPRE sequence element, nucleotides 7382-7615 constitute the 3' LTR sequence element, and nucleotides 7647-7871 constitute the bGH poly (A) signal sequence element. In SEQ ID NO.2, 911-6706 formed a fusion gene to express a fusion protein. Due to the presence of self-cleaving polypeptide P2A and self-cleaving polypeptide T2A, the fusion protein spontaneously forms the following three proteins: a protein with Cas9 protein, a protein with EGFP protein and a protein with Puro protein.

1.2 construction of pKG-U6gRNA vector

A source pUC57 vector is connected with a pKG-U6gRNA insertion sequence (a DNA fragment containing a U6 promoter, a BbsI digestion site and a sgRNA framework sequence, the sequence is shown as SEQ ID NO. 8) through an EcoRV digestion site and is reversely inserted into a pUC57 vector to obtain a pKG-U6gRNA vector complete sequence (SEQ ID NO.3), in the SEQ ID NO.3, the 2280 + 2539 th nucleotide forms an hU6 promoter, and the 2558 + 2637 th nucleotide is used for transcription to form a gRNA framework. In use, a DNA molecule of about 20bp (target sequence binding region for transcription to form a gRNA) (fig. 7) is inserted into a plasmid pKG-U6gRNA (fig. 6) to form a recombinant plasmid, and the recombinant plasmid is transcribed in a cell to obtain a gRNA.

Example 2 plasmid proportioning optimization and comparison of the Effect of plasmid pX330 and plasmid pKG-GE3

2.1 target gRNA design and construction

2.1.1 target gRNA design of the RAG1 Gene Using Benchling

RAG1-g4：AGTTATGGCAGAACTCAGTG(SEQ ID NO.9)

The synthesis of the insertion sequence complementary DNA Oligo for the RAG1 gene target is as follows:

RAG1-gRNA4S：caccgAGTTATGGCAGAACTCAGTG(SEQ ID NO.10)

RAG1-gRNA4A：aaacCACTGAGTTCTGCCATAACTc(SEQ ID NO.11)

RAG1-gRNA4S, RAG1-gRNA4A are single-stranded DNA molecules.

2.1.2 primers designed for amplification and detection of a target fragment comprising RAG1 gRNA

RAG1-nF126：CCCCATCCAAAGTTTTTAAAGGA

RAG1-nR525：TGTGGCAGATGTCACAGTTTAGG

2.1.3 construction and cloning of gRNA recombinant vector

1) Digesting 1ug pKG-U6gRNA plasmid with restriction enzyme BbsI;

2) separating the digested pKG-U6gRNA plasmid by agarose gel (agarose gel concentration is 1%, namely 1g of agarose gel is added into 100mL of electrophoresis buffer solution), and purifying and recovering the digested product by a gel recovery kit (Vazyme);

3) 2 complementary DNA oligos synthesized from the target of 2.1.1 are annealed to form a DNA double strand complementary to the cleaved sticky end of pKG-U6gRNA vector BbsI, as shown in FIG. 7:

95 deg.C, 5min and then reducing to 25 deg.C at a rate of 5 deg.C/min;

4) the ligation reaction was initiated as follows: reacting at room temperature for 10min

5) Transformation of

The procedure was followed in accordance with the instructions for competent cells (Vazyme).

2.1.4 gRNA vector construction

1) The synthesized RAG1-gRNA4S and RAG1-gRNA4A were mixed and annealed to give a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with cohesive ends was ligated to the vector backbone to give plasmid pKG-U6gRNA (RAG1-gRNA 4). Plasmid pKG-U6gRNA (RAG1-gRNA4) will express RAG1-gRNA4 as shown in SEQ ID No. 12.

2.1.5 gRNA vector identification

Picking a single clone from an LB flat plate, placing the single clone into an LB culture solution added with corresponding antibiotics, culturing the single clone in a constant temperature shaking table at 37 ℃ for 12-16h, sending the small upgraded grains to a general company for sequencing, and confirming that the RAG1-gRNA4 vector is successfully constructed through sequence comparison.

2.2 preparation of Primary pig fibroblasts

2.2.1 taking 0.5g of ear tissues of newborn juniperus domestica, removing hair and bone tissues, and soaking in 75% alcohol for 30-40 s;

2.2.2 washing 5 times with PBS containing 5% P/S (Gibco Penicillin-Streptomyces) and once with PBS without P/S;

wherein the PBS formulation of 5% P/S is: 5% P/S (Gibco Penicillin-Streptomyces) + 95% PBS, 5%, 95% by volume.

2.2.3 cutting the tissue with scissors, adding 5mL of 0.1% collagenase (Sigma) solution, and digesting with a shaker at 37 ℃ for 1 h;

2.2.4500 g were centrifuged for 5min, the supernatant removed, and the pellet resuspended in 1mL complete medium and plated into 10cm cell culture dishes containing 10mL complete medium and sealed with 0.2% gelatin (VWR).

Wherein, the formula of the complete cell culture medium is as follows: 15% fetal bovine serum (Gibco) + 83% DMEM medium

(Gibco) + 1% P/S (Gibco penillilin-Streptomyces) + 1% HEPES (Solambio), 15%, 83%, 1% in volume percentage.

2.2.5 culturing in a constant temperature incubator at 37 deg.C, 5% CO2 (vol.%), 5% O2 (vol.%);

2.2.6 culturing the cells to about 60% of the bottom of the dish, digesting the cells by using 0.25% (Gibco) trypsin, adding a complete culture medium to stop digestion, transferring the cell suspension into a 15mL centrifuge tube, centrifuging for 4min at 400g, discarding the supernatant to obtain cell precipitates for the next cell transfection experiment

2.3 plasmid ratio optimization

2.3.1 Co-transfection grouping

A first group: plasmid pKG-U6gRNA (RAG1-gRNA4) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.44 μ g plasmid pKG-U6gRNA (RAG1-gRNA 4): 1.56. mu.g of plasmid pKG-GE 3. Namely, the molar ratio of the plasmid pKG-U6gRNA (RAG1-gRNA4) to the plasmid pKG-GE3 is 1: 1.

second group: plasmid pKG-U6gRNA (RAG1-gRNA4) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.72 μ g plasmid pKG-U6gRNA (RAG1-gRNA 4): 1.28. mu.g of plasmid pKG-GE 3. Namely, the molar ratio of the plasmid pKG-U6gRNA (RAG1-gRNA4) to the plasmid pKG-GE3 is 2: 1.

third group: plasmid pKG-U6gRNA (RAG1-gRNA4) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (RAG1-gRNA 4): 1.08. mu.g of plasmid pKG-GE 3. Namely, the molar ratio of the plasmid pKG-U6gRNA (RAG1-gRNA4) to the plasmid pKG-GE3 is 3: 1.

and a fourth group: plasmid pKG-U6gRNA (RAG1-gRNA4) was transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: mu.g of plasmid pKG-U6gRNA (RAG1-gRNA 4).

2.3.2 Co-transfection procedure

Transfection experiments were performed using a mammalian fibroblast cell nuclear transfection kit (Neon kit) with a Neon TM transfection system electrotransfer.

1) Preparing an electrotransformation DNA solution according to the above groups, and deliberately not generating bubbles in the process of uniformly mixing;

2) washing the cell precipitate prepared in the 2.2.6 step by using 1ml of PBS phosphate buffer (Solarbio), transferring the cell precipitate into a 1.5ml centrifuge tube, centrifuging the cell precipitate for 6min at 600g, discarding the supernatant, and resuspending the cells by using 11 mu L of electric transfer basic solution Opti-MEM, wherein bubbles are prevented from being generated in the process of resuspension;

3) sucking 10 mu L of cell suspension, adding the cell suspension into the electrotransformation DNA solution obtained in the step 1), and uniformly mixing, wherein no bubbles are generated in the uniformly mixing process;

4) placing an electric rotating cup with the reagent cassette in a cup groove of a Neon (TM) transformation system electric rotating instrument, and adding 3mL of Buffer E;

5) sucking 10 mu L of the mixed solution obtained in the step 3) by using an electric rotating gun, inserting the mixed solution into a click cup, selecting an electric rotating program (1450V 10ms 3pulse), immediately transferring the mixed solution in the electric rotating gun into a 6-hole plate in a super clean bench after electric shock transfection, wherein each hole contains 3mL of complete culture solution (15% fetal bovine serum (Gibco) + 83% DMEM medium (Gibco) + 1% P/S (Gibco penillin-Streptomycin) + 1% HEPES (solarbio));

6) mixing, and culturing in a constant temperature incubator at 37 deg.C and 5% CO2 and 5% O2;

7) after 12-18h of electrotransformation, the solution was changed, and 36-48h were digested with 0.25% (Gibco) trypsin and the cells were collected in a 1.5mL centrifuge tube.

2.3.3 Gene editing efficiency analysis

Extracting the cellular genomic DNA collected in 2.3.2, performing PCR amplification by using a primer pair consisting of RAG1-nF126 and RAG1-nR525, and sequencing the product. The sequencing result utilizes a webpage version synthgo ICE tool to analyze the sequencing peak map to obtain that the editing efficiency of the first group, the second group and the third group is 9%, 53% and 66% in sequence, and an exemplary peak map of the sequencing result is shown in figure 8. Analysis proves that the gene editing efficiency of the third group is the highest, namely the optimal dosage of the gRNA plasmid and the Cas9 plasmid is determined as a molar ratio of 3:1, the actual amount of plasmid is 0.92. mu.g: 1.08. mu.g.

2.4 comparison of the Effect of plasmid pX330 and plasmid pKG-GE3

2.4.1 Co-transfection grouping

RAG1-330 group: plasmid pKG-U6gRNA (RAG1-gRNA4) and plasmid pX330 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (RAG1-gRNA 4): mu.g of plasmid pX330, wherein the molar ratio of pKG-U6gRNA (RAG1-gRNA4) to pX330 was 3: 1.

Group RAG 1-KG: plasmid pKG-U6gRNA (RAG1-gRNA4) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (RAG1-gRNA 4): 1.08 μ g plasmid pKG-GE3, with a molar ratio of pKG-U6gRNA (RAG1-gRNA4) to pKG-GE3 of 3: 1.

Group RAG 1-B: plasmid pKG-U6gRNA (RAG1-gRNA4) was transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92. mu.g of plasmid pKG-U6gRNA (RAG1-gRNA 4).

2.4.2 Co-transfection procedure

As in this example 2.3.2.

2.4.3 Gene editing efficiency analysis

Extracting the cellular genomic DNA collected in 2.4.2, performing PCR amplification by using a primer pair consisting of RAG1-nF126 and RAG1-nR525, and sequencing the product. The sequencing result utilizes a webpage version synthgo ICE tool to analyze a sequencing peak map to obtain that the editing efficiency of a RAG1-330 group and a RAG1-KG group is respectively 28% and 68%, an exemplary peak map of the sequencing result is shown in figure 9, and the result shows that compared with the result of adopting a plasmid pX330, the gene editing efficiency is obviously improved by adopting the plasmid pKG-GE 3.

Example 3 screening of efficient INHA Gene gRNA target

Pig INHA gene information: encodes inhibin subbunit alpha protein; is located on pig chromosome 5; GeneID 397386, Sus scrofa. The protein encoded by pig INHA gene is shown in GENBANK ACCESSION NO. XP-020930352.1 (linear CON 12-JAN-2018), and the amino acid sequence is shown in SEQ ID NO. 13. In the genome DNA, the pig INHA gene has 2 exons, wherein the 2 nd exon and 100bp sequences of the upstream exon and the downstream exon are shown as SEQ ID NO. 14.

3.1 conservative analysis of INHA Gene knockout Preset target and adjacent genomic sequences

18 newborn Jiangxiang pigs, 10 females (named 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, respectively) and 8 males (named A, B, C, D, E, F, G, H, respectively).

The genomic DNA of 18 pigs is taken as a template, PCR amplification is carried out by using a primer pair (the target sequence of the primer pair comprises the 2 nd exon of the pig INHA gene), and then electrophoresis is carried out. And recovering PCR amplification products, sequencing, and comparing and analyzing the sequencing result with an INHA gene sequence in a public database. Based on the alignment, primers for detecting mutations were designed (the primers themselves avoid potential mutation sites). Primers designed to detect mutations were: INHA-E2-JDF178/INHA-E2-JDR 654. The electropherograms of 18 porcine genomic DNAs amplified by PCR using the primer set INHA-E2-JDF178/INHA-E2-JDR654 are shown in FIG. 10.

INHA-E2-JDF178：5’-CTGCGCTGTCCTCTCTGTTC-3’；

INHA-E2-JDR654：5’-AGTGCTGGGTGAGAAGGTTG-3’。

3.2 target gRNA design and construction

And primarily screening a plurality of targets by screening NGG (avoiding possible mutation sites), and further screening 4 targets from the NGG through a preliminary experiment.

The 4 targets were as follows:

sgRNA_INHA-E2-g1and (3) target point: 5' -CCTCTGCAGCAGGCGCAGCG-3’(SEQ ID NO.15)；

sgRNA_INHA-E2-g2And (3) target point: 5'-CCTGCTGCAGAGGCCCCCGG-3', respectively;

sgRNA_INHA-E2-g3and (3) target point: 5'-GTGGCAGTCGGCGTGCACAG-3', respectively;

sgRNA_INHA-E2-g4and (3) target point: 5'-AGATGTTGAGGGAAGCTCTG-3' are provided.

The insert sequence complementary DNA Oligo of the synthesized INHA gene with 4 targets is as follows:

INHA-E2-gRNA1-S：5’-caccgCCTCTGCAGCAGGCGCAGCG-3’(SEQ ID NO.16)；

INHA-E2-gRNA1-A：5’-aaacCGCTGCGCCTGCTGCAGAGGc-3’(SEQ ID NO.17)；

INHA-E2-gRNA2-S：5’-caccgCCTGCTGCAGAGGCCCCCGG-3’；

INHA-E2-gRNA2-A：5’-aaacCCGGGGGCCTCTGCAGCAGGc-3’；

INHA-E2-gRNA3-S：5’-caccGTGGCAGTCGGCGTGCACAG-3’；

INHA-E2-gRNA3-A：5’-aaacCTGTGCACGCCGACTGCCAC-3’；

INHA-E2-gRNA4-S：5’-caccgAGATGTTGAGGGAAGCTCTG-3’；

INHA-E2-gRNA4-A：5’-aaacCAGAGCTTCCCTCAACATCTc-3’。

the INHA-E2-gRNA1-S, INHA-E2-gRNA1-A, INHA-E2-gRNA2-S, INHA-E2-gRNA2-A, INHA-E2-gRNA3-S, INHA-E2-gRNA3-A, INHA-E2-gRNA4-S, INHA-E2-gRNA4-A is a single-stranded DNA molecule.

3.3 preparation of recombinant plasmid gRNA

The plasmid pKG-U6gRNA was digested with the restriction enzyme BbsI, and the vector backbone (approximately 3kb linear large fragment) was recovered.

INHA-E2-gRNA1-S and INHA-E2-gRNA1-a were synthesized separately, mixed and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecule having the cohesive ends was ligated to the vector backbone to obtain plasmid pKG-U6gRNA (INHA-E2-g 1). Plasmid pKG-U6gRNA (INHA-E2-g1) expresses sgRNA shown in SEQ ID No.18_INHA-E2-g1,

CCUCUGCAGCAGGCGCAGCGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggca ccgagucggugcuuuu (SEQ ID NO. 18). INHA-E2-gRNA2-S and INHA-E2-gRNA2-a were synthesized separately, mixed and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecule having the cohesive ends was ligated to the vector backbone to obtain plasmid pKG-U6gRNA (INHA-E2-g 2). Plasmid pKG-U6gRNA (INHA-E2-g2) expresses sgRNA_INHA-E2-g2，sgRNA_INHA-E2-g2The sequence is shown as follows:

CCUGCUGCAGAGGCCCCCGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggca ccgagucggugcuuuu。

INHA-E2-gRNA3-S and INHA-E2-gRNA3-a were synthesized separately, mixed and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecule having the cohesive ends was ligated to the vector backbone to obtain plasmid pKG-U6gRNA (INHA-E2-g 3). Plasmid pKG-U6gRNA (INHA-E2-g3) expresses sgRNA_INHA-E2-g3，sgRNA_INHA-E2-g3The sequence is shown as follows:

GUGGCAGUCGGCGUGCACAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggca ccgagucggugcuuuu。

INHA-E2-gRNA4-S and INHA-E2-gRNA4-a were synthesized separately, mixed and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecule having the cohesive ends was ligated to the vector backbone to obtain plasmid pKG-U6gRNA (INHA-E2-g 4). Plasmid pKG-U6gRNA (INHA-E2-g4) expresses sgRNA_INHA-E2-g4，sgRNA_INHA-E2-g4The sequence is shown as follows:

AGAUGUUGAGGGAAGCUCUGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggc accgagucggugcuuuu。

3.4 comparison of editing efficiency of different target gRNAs of INHA gene

Porcine primary fibroblasts were prepared from ear tissue of newborn Jiangxiang pigs (female, blood group AO).

1. Cotransfection

A first group: plasmid pKG-U6gRNA (INHA-E2-g1) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92. mu.g plasmid pKG-U6gRNA (INHA-E2-g 1): 1.08. mu.g of plasmid pKG-GE 3. Wherein the molar ratio of pKG-U6gRNA (INHA-E2-g1) to pKG-GE3 is 3: 1.

Second group: plasmid pKG-U6gRNA (INHA-E2-g2) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92. mu.g plasmid pKG-U6gRNA (INHA-E2-g 2): 1.08. mu.g of plasmid pKG-GE 3. Wherein the molar ratio of pKG-U6gRNA (INHA-E2-g2) to pKG-GE3 is 3: 1.

Third group: plasmid pKG-U6gRNA (INHA-E2-g3) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92. mu.g plasmid pKG-U6gRNA (INHA-E2-g 3): 1.08. mu.g of plasmid pKG-GE 3. Wherein the molar ratio of pKG-U6gRNA (INHA-E2-g3) to pKG-GE3 is 3: 1.

And a fourth group: plasmid pKG-U6gRNA (INHA-E2-g4) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92. mu.g plasmid pKG-U6gRNA (INHA-E2-g 4): 1.08. mu.g of plasmid pKG-GE 3. Wherein the molar ratio of pKG-U6gRNA (INHA-E2-g4) to pKG-GE3 is 3: 1.

And a fifth group: the pig primary fibroblast is subjected to electrotransfection operation without adding plasmid under the same electrotransformation parameters.

Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, Thermofeisher) and a Neon TM transfection system electrotransformation apparatus (parameters set at 1450V, 10ms, 3 pulses).

2. After step 1, the culture is carried out for 16 to 18 hours by using the complete culture solution, and then the culture is carried out by replacing the complete culture solution with a new one. The total time of incubation was 48 hours.

3. After completion of step 2, cells were trypsinized and collected, then lysed and genomic DNA extracted, PCR amplified using a primer pair consisting of INHA-E2-JDF178 and INHA-E2-JDR654, and then subjected to 1% agarose gel electrophoresis. The target fragment was recovered and sequenced, and the peak pattern of the sequencing is shown in FIG. 11. Analyzing the sequencing peak map by using a syntheo ICE tool to obtain the gene editing efficiency of different targets. The gene editing efficiency of the first group to the fourth group was 62%, 5%, 8%, 1% in this order. No gene editing occurred in the fifth group. The results show that the first group of edits is most efficientHigh, sgRNA_INHA-E2-g1The target point of (2) is the optimal target point.

Example 4 screening of efficient CD163 Gene gRNA target

Porcine CD163 gene information: encoding a CD163 molecule protein; is located on pig chromosome 5; GeneID 397031, Sus scrofa. The protein encoded by the porcine CD163 gene is shown as GENBANK ACCESSION NO. XP _020946779.1(linear CON 12-JAN-2018), and the amino acid sequence is shown as SEQ ID NO. 19. In the genome DNA, the porcine CD163 gene has 18 exons, wherein the 7 th exon and the 400bp sequences of the exon and the upstream and the downstream thereof are shown as SEQ ID NO. 20.

4.1 conservative analysis of CD163 gene knockout preset target and adjacent genome sequence

18 newborn Jiangxiang pigs, 10 females (named 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, respectively) and 8 males (named A, B, C, D, E, F, G, H, respectively).

The genomic DNA of 18 pigs were used as templates, respectively, and PCR amplification was performed using a primer pair (the target sequence of the primer pair includes exon 7 of the porcine CD163 gene), followed by electrophoresis. And recovering PCR amplification products, sequencing, and comparing and analyzing the sequencing result with the CD163 gene sequence in a public database. Based on the alignment, primers for detecting mutations were designed (the primers themselves avoid potential mutation sites). Primers designed to detect mutations were: CD163-JDF121/CD163-JDR 518. The electropherogram of 18 porcine genomic DNAs amplified by PCR using the primer set consisting of CD163-JDF121/CD163-JDR518 is shown in FIG. 12.

CD163-JDF121：5’-GAATCGGCTAAGCCCACTGTA-3’；

CD163-JDR518：5’-ACTGGGCAGAGTGAAAGGTG-3’。

4.2 target gRNA design and construction

And primarily screening a plurality of targets by screening NGG (avoiding possible mutation sites), and further screening 4 targets from the NGG through a preliminary experiment.

The 4 targets were as follows:

sgRNA_CD163-E7-g1and (3) target point: 5'-GGAACTACAGTGCGGCACTG-3', respectively;

sgRNA_CD163-E7-g2and (3) target point: 5'-GGTCGTGTTGAAGTACAACA-3' (SEQ ID NO. 21);

sgRNA_CD163-E7-g3and (3) target point: 5'-GTACAACATGGAGACACGTG-3', respectively;

sgRNA_CD163-E7-g4and (3) target point: 5'-ACTGTGGTTTCCCTCCTGGG-3' are provided.

The synthetic CD163 gene has the following complementary DNA Oligo with the insertion sequence of 4 targets:

CD163-E7-gRNA1-S：5’-caccGGAACTACAGTGCGGCACTG-3’；

CD163-E7-gRNA1-A：5’-aaacCAGTGCCGCACTGTAGTTCC-3’；

CD163-E7-gRNA2-S：5’-caccGGTCGTGTTGAAGTACAACA-3’(SEQ ID NO.22)；

CD163-E7-gRNA2-A：5’-aaacTGTTGTACTTCAACACGACC-3’(SEQ ID NO.23)；

CD163-E7-gRNA3-S：5’-caccGTACAACATGGAGACACGTG-3’；

CD163-E7-gRNA3-A：5’-aaacCACGTGTCTCCATGTTGTAC-3’；

CD163-E7-gRNA4-S：5’-caccgACTGTGGTTTCCCTCCTGGG-3’；

CD163-E7-gRNA4-A：5’-aaacCCCAGGAGGGAAACCACAGTc-3’。

CD163-E7-gRNA1-S, CD163-E7-gRNA1-A, CD163-E7-gRNA2-S, CD163-E7-gRNA2-A, CD163-E7-gRNA3-S, CD163-E7-gRNA3-A, CD163-E7-gRNA4-S, CD163-E7-gRNA4-A are all single-stranded DNA molecules.

4.3 preparation of gRNA recombinant plasmids

The plasmid pKG-U6gRNA was digested with the restriction enzyme BbsI, and the vector backbone (approximately 3kb linear large fragment) was recovered.

CD163-E7-gRNA1-S and CD163-E7-gRNA1-A were synthesized separately, mixed and annealed to obtain a double-stranded DNA molecule having a cohesive end. The double-stranded DNA molecule having the cohesive ends was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (CD163-E7-g 1). Plasmid pKG-U6gRNA (CD163-E7-g1) expresses sgRNA_CD163-E7-g1，sgRNA_CD163-E7-g1The sequence is shown as follows:

GGAACUACAGUGCGGCACUGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggca ccgagucggugcuuuu。

CD163-E7-gRNA2-S and CD163-E7-gRNA2-A were synthesized separately, mixed and annealed to obtain a double-stranded DNA molecule having a cohesive end. The double-stranded DNA molecule having the cohesive ends was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (CD163-E7-g 2). Plasmid pKG-U6gRNA (CD163-E7-g2) expresses sgRNA shown in SEQ ID No.24_CD163-E7-g2：

GGUCGUGUUGAAGUACAACAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggc accgagucggugcuuuu(SEQ ID NO.24)。

CD163-E7-gRNA3-S and CD163-E7-gRNA3-A were synthesized separately, mixed and annealed to obtain a double-stranded DNA molecule having a cohesive end. The double-stranded DNA molecule having the cohesive ends was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (CD163-E7-g 3). Plasmid pKG-U6gRNA (CD163-E7-g3) expresses sgRNA_CD163-E7-g3，sgRNA_CD163-E7-g3The sequence is shown as follows:

GUACAACAUGGAGACACGUGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggca ccgagucggugcuuuu。

CD163-E7-gRNA4-S and CD163-E7-gRNA4-A were synthesized separately, mixed and annealed to obtain a double-stranded DNA molecule having a cohesive end. The double-stranded DNA molecule having the cohesive ends was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (CD163-E7-g 4). Plasmid pKG-U6gRNA (CD163-E7-g4) expresses sgRNA_CD163-E7-g4，sgRNA_CD163-E7-g4The sequence is shown as follows:

ACUGUGGUUUCCCUCCUGGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggca ccgagucggugcuuuu。

4.4 comparison of editing efficiency of different target spots gRNA of CD163 gene

Porcine primary fibroblasts were prepared from ear tissue of newborn Jiangxiang pigs (female, blood group AO).

1. Cotransfection

A first group: plasmid pKG-U6gRNA (CD163-E7-g1) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92. mu.g plasmid pKG-U6gRNA (CD163-E7-g 1): 1.08. mu.g of plasmid pKG-GE 3. Wherein the molar ratio of pKG-U6gRNA (CD163-E7-g1) to pKG-GE3 is 3: 1.

Second group: plasmid pKG-U6gRNA (CD163-E7-g2) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92. mu.g plasmid pKG-U6gRNA (CD163-E7-g 2): 1.08. mu.g of plasmid pKG-GE 3. Wherein the molar ratio of pKG-U6gRNA (CD163-E7-g2) to pKG-GE3 is 3: 1.

Third group: plasmid pKG-U6gRNA (CD163-E7-g3) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92. mu.g plasmid pKG-U6gRNA (CD163-E7-g 3): 1.08. mu.g of plasmid pKG-GE 3. Wherein the molar ratio of pKG-U6gRNA (CD163-E7-g3) to pKG-GE3 is 3: 1.

And a fourth group: plasmid pKG-U6gRNA (CD163-E7-g4) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92. mu.g plasmid pKG-U6gRNA (CD163-E7-g 4): 1.08. mu.g of plasmid pKG-GE 3. Wherein the molar ratio of pKG-U6gRNA (CD163-E7-g4) to pKG-GE3 is 3: 1.

And a fifth group: the pig primary fibroblast is subjected to electrotransfection operation without adding plasmid under the same electrotransformation parameters.

Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, Thermofeisher) and a Neon TM transfection system electrotransformation apparatus (parameters set at 1450V, 10ms, 3 pulses).

2. After step 1, the culture is carried out for 16 to 18 hours by using the complete culture solution, and then the culture is carried out by replacing the complete culture solution with a new one. The total time of incubation was 48 hours.

3. After completion of step 2, cells were digested with trypsin and collected, then lysed and genomic DNA extracted, amplified by PCR using a primer pair consisting of CD163-JDF121 and CD163-JDR518, and then subjected to 1% agarose gel electrophoresis. The target fragment was recovered and sequenced, and the peak pattern of the sequencing is shown in FIG. 13. Analyzing the sequencing peak map by using a syntheo ICE tool to obtain the gene editing efficiency of different targets. The gene editing efficiency of the first group to the fourth group was 16%, 34%, 10% in this order. No gene editing occurred in the fifth group. The results show that the method has the advantages of high yield,second group of most efficient, sgRNA_CD163-E7-g2The target point of (2) is the optimal target point.

Example 5 screening of efficient pAPN Gene gRNA target

Pig apn (papn) gene information: coding alanyl aminopeptidase, membrane protein; is located on pig chromosome 7; GeneID 397520, Sus scrofa. The protein encoded by the pig APN gene is shown as GENBANK ACCESSION NO. NP-999442.1 (linear CON 12-JAN-2018), and the amino acid sequence is shown as SEQ ID NO. 25. In the genome DNA, the pig APN gene has 2 exons, wherein the 2 nd exon and 100bp sequences of the upstream exon and the downstream exon are shown as SEQ ID NO. 26.

5.1 pAPN gene knockout preset target and adjacent genome sequence conservation analysis

18 newborn Jiangxiang pigs, 10 females (named 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, respectively) and 8 males (named A, B, C, D, E, F, G, H, respectively).

The genomic DNA of 18 pigs is taken as a template, PCR amplification is carried out by using a primer pair (the target sequence of the primer pair comprises the 2 nd exon of the pig APN gene), and then electrophoresis is carried out. And recovering PCR amplification products, sequencing, and comparing and analyzing the sequencing result with the pAPN gene sequence in the public database. Based on the alignment, primers for detecting mutations were designed (the primers themselves avoid potential mutation sites). Primers designed to detect mutations were: APN-JDF94/APN-JDR 656. The electropherogram of 18 pigs after PCR amplification of genomic DNA using the primer set APN-JDF94/APN-JDR656 is shown in FIG. 14.

APN-JDF94：5’-GAACCGGAGCAGTGTCTCTA-3’；

APN-JDR656：5’-CCCCTGGGTGGTGTAGTTGA-3’。

5.2 target gRNA design and construction

And primarily screening a plurality of targets by screening NGG (avoiding possible mutation sites), and further screening 4 targets from the NGG through a preliminary experiment.

The 4 targets were as follows:

sgRNA_APN-E2-g1and (3) target point: 5'-GAGGATGCCCAGGATGCCCA-3' (SEQ ID NO. 27);

sgRNA_APN-E2-g2and (3) target point: 5'-CCTGGGCATCCTCCTCGGCG-3', respectively;

sgRNA_APN-E2-g3and (3) target point: 5'-CACAGACAGAGCGATGATGG-3', respectively;

sgRNA_APN-E2-g4and (3) target point: 5'-GCTCTGGTCCAAGGTGATGG-3' are provided.

The insert sequence complementary DNA Oligo of the total 4 targets of the synthesized pAPN gene is as follows:

APN-E2-gRNA1-S：5’-caccGAGGATGCCCAGGATGCCCA-3’(SEQ ID NO.28)；

APN-E2-gRNA1-A：5’-aaacTGGGCATCCTGGGCATCCTC-3’(SEQ ID NO.29)；

APN-E2-gRNA2-S：5’-caccgCCTGGGCATCCTCCTCGGCG-3’；

APN-E2-gRNA2-A：5’-aaacCGCCGAGGAGGATGCCCAGGc-3’；

APN-E2-gRNA3-S：5’-caccgCACAGACAGAGCGATGATGG-3’；

APN-E2-gRNA3-A：5’-aaacCCATCATCGCTCTGTCTGTGc-3’；

APN-E2-gRNA4-S：5’-caccGCTCTGGTCCAAGGTGATGG-3’；

APN-E2-gRNA4-A：5’-aaacCCATCACCTTGGACCAGAGC-3’。

APN-E2-gRNA1-S, APN-E2-gRNA1-A, APN-E2-gRNA2-S, APN-E2-gRNA2-A, APN-E2-gRNA3-S, APN-E2-gRNA3-A, APN-E2-gRNA4-S, APN-E2-gRNA4-A is a single-stranded DNA molecule.

5.3 preparation of gRNA recombinant plasmid

The plasmid pKG-U6gRNA was digested with the restriction enzyme BbsI, and the vector backbone (approximately 3kb linear large fragment) was recovered.

APN-E2-gRNA1-S and APN-E2-gRNA1-A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having a cohesive end. The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (APN-E2-g 1). Plasmid pKG-U6gRNA (APN-E2-g1) expresses sgRNA shown in SEQ ID No.30_APN-E2-g1：

GAGGAUGCCCAGGAUGCCCAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggca ccgagucggugcuuuu(SEQ ID NO.30)。

APN-E2-gRNA2-S and APN-E2-gRNA2-A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having a cohesive end. The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (APN-E2-g 2). Plasmid pKG-U6gRNA (APN-E2-g2) expresses sgRNA_APN-E2-g2，sgRNA_APN-E2-g2The sequence is shown as follows:

CCUGGGCAUCCUCCUCGGCGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggca ccgagucggugcuuuu。

APN-E2-gRNA3-S and APN-E2-gRNA3-A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having a cohesive end. The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (APN-E2-g 3). Plasmid pKG-U6gRNA (APN-E2-g3) expresses sgRNA_APN-E2-g3，sgRNA_APN-E2-g3The sequence is shown as follows:

CACAGACAGAGCGAUGAUGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggca ccgagucggugcuuuu。

APN-E2-gRNA4-S and APN-E2-gRNA4-A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having a cohesive end. The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (APN-E2-g 4). Plasmid pKG-U6gRNA (APN-E2-g4) expresses sgRNA_APN-E2-g4，sgRNA_APN-E2-g4The sequence is shown as follows:

GCUCUGGUCCAAGGUGAUGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggca ccgagucggugcuuuu。

5.4 comparison of editing efficiency of different target gRNAs of pAPN gene

Porcine primary fibroblasts were prepared from ear tissue of newborn Jiangxiang pigs (female, blood group AO).

1. Cotransfection

A first group: the plasmid pKG-U6gRNA (APN-E2-g1) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92. mu.g plasmid pKG-U6gRNA (APN-E2-g 1): 1.08. mu.g of plasmid pKG-GE 3. Wherein the molar ratio of pKG-U6gRNA (APN-E2-g1) to pKG-GE3 is 3: 1.

Second group: the plasmid pKG-U6gRNA (APN-E2-g2) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92. mu.g plasmid pKG-U6gRNA (APN-E2-g 2): 1.08. mu.g of plasmid pKG-GE 3. Wherein the molar ratio of pKG-U6gRNA (APN-E2-g2) to pKG-GE3 is 3: 1.

Third group: the plasmid pKG-U6gRNA (APN-E2-g3) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92. mu.g plasmid pKG-U6gRNA (APN-E2-g 3): 1.08. mu.g of plasmid pKG-GE 3. Wherein the molar ratio of pKG-U6gRNA (APN-E2-g3) to pKG-GE3 is 3: 1.

And a fourth group: the plasmid pKG-U6gRNA (APN-E2-g4) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92. mu.g plasmid pKG-U6gRNA (APN-E2-g 4): 1.08. mu.g of plasmid pKG-GE 3. Wherein the molar ratio of pKG-U6gRNA (APN-E2-g4) to pKG-GE3 is 3: 1.

And a fifth group: the pig primary fibroblast is subjected to electrotransfection operation without adding plasmid under the same electrotransformation parameters.

Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, Thermofeisher) and a Neon TM transfection system electrotransformation apparatus (parameters set at 1450V, 10ms, 3 pulses).

2. After step 1, the culture is carried out for 16 to 18 hours by using the complete culture solution, and then the culture is carried out by replacing the complete culture solution with a new one. The total time of incubation was 48 hours.

3. After completion of step 2, cells were trypsinized and collected, then lysed and genomic DNA extracted, PCR amplified using primer pairs consisting of APN-JDF94 and APN-JDR656, and then subjected to 1% agarose gel electrophoresis. The target fragment was recovered and sequenced, and the peak pattern of the sequencing is shown in FIG. 15. Analyzing the sequencing peak map by using a syntheo ICE tool to obtain the gene editing efficiency of different targets. The gene editing efficiency of the first group to the fourth group was 52%, 15%, 16%, 5% in this order. No gene editing occurred in the fifth group. The result shows that the editing efficiency of the first group is highest, and the sgRNA_APN-E2-g1The target point of (2) is the optimal target point.

Example 6 construction of Single cell clone from Jiangxiang pig with INHA, CD163 and pAPN gene knockout combination

6.1 preparation of Primary pig fibroblasts

The same as 2.2 in example 2.

6.2 Co-transfection of porcine primary fibroblasts with the constructed pKG-U6gRNA (INHA-E2-g1) plasmid, pKG-U6gRNA (CD163-E7-g2), pKG-U6gRNA (APN-E2-g1), pKG-GE3 plasmid

6.2.1 transfection of plasmids pKG-U6gRNA (INHA-E2-g1), pKG-U6gRNA (CD163-E7-g2), pKG-U6gRNA (APN-E2-g1), pKG-GE3 into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.47 μ g plasmid pKG-U6gRNA (INHA-E2-g 1): 0.47 μ g plasmid pKG-U6gRNA (CD163-E7-g 2): 0.47. mu.g plasmid pKG-U6gRNA (APN-E2-g 1): 1.59. mu.g of plasmid pKG-GE3, the molar ratio of each plasmid being: 1:1:1:1, i.e. total gRNA: pKG-GE3 is 3: 1.

6.2.2 Co-transfection procedure

The cells were digested as in 2.3.2 of example 2, but without 0.25% (Gibco) trypsin and collected in a 1.5mL centrifuge tube.

6.3 screening of single cell clone strains with INHA, CD163 and pAPN three gene combined knockout

6.3.1 the population cells electroporated for 48h from step 6.2.2 were digested with trypsin, neutralized with complete medium, centrifuged at 500g for 5min, the supernatant removed, the pellet resuspended in 200. mu.L of complete medium and diluted appropriately, single cells picked with a pipette were transferred to a 96-well plate containing 100. mu.L of complete medium per well, one cell per well;

6.3.237 ℃, culturing in a constant-temperature incubator containing 5% CO2 and 5% O2, changing a cell culture medium every 2-3 days, observing the growth condition of cells in each hole by using a microscope during the culture, and removing the holes without cells and non-single cell clones;

6.3.3 when the wells of the 96-well plate were filled with cells, trypsinized and the cells were collected, 2/3 cells were seeded into a 6-well plate containing complete medium, and the remaining 1/3 cells were collected in a 1.5mL centrifuge tube for subsequent genotyping;

6.3.4 cells were harvested by trypsinization with 0.25% (Gibco) when the 6-well plates were 80% confluent and frozen using cell freezing medium (90% complete medium + 10% DMSO by volume).

6.4 Single cell clone identification by INHA, CD163 and pAPN three-gene combined knockout

6.4.1 to the cells collected in step 6.3.3 in a 1.5mL centrifuge tube, 10. mu.L of KAPA2G lysate was added to lyse the cells, resulting in a lysate of cells that released genomic DNA.

The system for preparing KAPA2G lysate is as follows:

10X extract Buffer 1μL

Enzyme 0.2μL

ddH2O 8.8μL

preserving cell lysate at-20 ℃ after the reaction is finished at 75 ℃ for 15min to 95 ℃ for 5min to 4 ℃;

6.4.2, the cell lysate is used as a DNA template to perform PCR amplification on INHA, CD163 and pAPN gene target areas respectively to detect the target gene mutation condition of single cell clone by adopting the primer pair (INHA-E2-JDF178/INHA-E2-JDR654) aiming at INHA gene E2, the primer pair (CD163-JDF121/CD163-JDR518) aiming at CD163 gene E7 and the primer pair (APN-JDF94/APN-JDR656) aiming at pAPN gene E2, wherein the target PCR product length of INHA gene is 477bp, the target PCR product length of CD163 gene is 398bp and the target PCR product length of pAPN gene is 563 bp;

6.4.3 amplification of INHA, CD163 gene and pAPN gene target regions using PCR general reactions;

6.4.4 the PCR reaction products were electrophoresed as shown in FIG. 16(INHA), FIG. 17(CD163), FIG. 18(pAPN), with lane numbering corresponding to that of single cell clones. The PCR amplification product was recovered and sequenced.

6.4.5 comparing the sequencing result with INHA, CD163 and pAPN target point information respectively, thereby judging whether the single cell clone is subjected to combined knockout of INHA, CD163 and pAPN.

6.4.5.1 for the INHA gene, the genotypes of the single-cell clones numbered 3, 8, 10, 20, 22, 25, 27, 33, 34, 38, 48, 51, 59 are homozygous mutants of the same variation in both alleles; the genotypes of the single-cell clones numbered 7, 18, 29, 42, 44 and 53 are homozygous mutants of different variation of biallelic genes; the genotypes of the single cell clones numbered 4, 11, 14, 24, 32, 55 are heterozygous mutants; the genotypes of the single cell clones with other numbers are wild types; the rate of single cell clones resulting in editing of the INHA gene was 41%.

Exemplary sequencing alignments are shown in FIGS. 19-22, where FIG. 19 is an alignment of clone number 2 with a wild-type reference sequence, and is judged wild-type; FIG. 20 shows the result of alignment of the sequencing result of clone No.4 with the wild-type reference sequence, and it was judged as the heterozygous mutant; FIG. 21 shows the result of comparison of the sequencing result of clone No.8 with the wild-type reference sequence, and it was judged as a homozygous mutant having the same variation in biallelic genes; FIG. 22 shows the result of alignment of the sequencing result of clone No. 53 with the wild-type reference sequence, and it was judged as a homozygous mutant type having different biallelic variations.

Through the analysis of specific sequences, the genotype of each single-cell clone is shown in table 1:

TABLE 1 identification of INHA Gene knockout Single cell clone genotypes

6.4.5.2 for the CD163 gene, the genotypes of the single cell clones numbered 3, 7, 8, 18, 20, 42, 44 are homozygous mutants of the same variation in both alleles; the genotype of the single cell clone with the number of 21 and the number of 27 is homozygous mutant of different variation of double alleles; the genotypes of the single-cell clones numbered 11, 12, 22 and 36 are heterozygous mutants; the genotypes of the single cell clones with other numbers are wild types; the rate of single cell clones obtained for CD163 gene editing was 21%.

Exemplary sequencing alignments are shown in fig. 23-26, where fig. 23 is an alignment of clone No.1 with a wild-type reference sequence, and is judged wild-type; FIG. 24 shows the result of alignment of the sequencing result of clone No.12 with the wild-type reference sequence, and it was judged as the heterozygous mutant; FIG. 25 shows the result of alignment of the sequencing result of clone No.3 with the wild-type reference sequence, and it was judged as a homozygous mutant with the same variation in biallelic genes; FIG. 26 shows the result of alignment of the sequencing result of clone No.27 with the wild-type reference sequence, and it was judged as a homozygous mutant type having different biallelic variations.

Through the analysis of specific sequences, the clone genotypes of each single cell are shown in the table 2:

TABLE 2 identification of the genotype of the CD163 knock-out single-cell clone

6.4.5.3 for the pAPN gene, the genotypes of the single-cell clones numbered 3, 7, 8, 18, 23, 27, 32, 41, 44, 50, 56 are homozygous mutants of the same variation in both alleles; the genotypes of the single-cell clones numbered 9, 14, 42 and 55 are homozygous mutants of different variation of double alleles; the genotypes of the single cell clones numbered 2, 29, 36, 38, 46, 51, 58 are heterozygous mutants; the genotypes of the single cell clones with other numbers are wild types; the rate of resulting pAPN gene-edited single cell clones was 36%.

Exemplary sequencing alignments are shown in fig. 27-30, wherein fig. 27 is an alignment of the sequencing of clone No.1 with a wild-type reference sequence, and is judged wild-type; FIG. 28 shows the result of alignment of the sequencing result of clone No.2 with the wild-type reference sequence, and it was judged as the heterozygous mutant; FIG. 29 shows the result of alignment of the sequencing result of clone No.7 with the wild-type reference sequence, and it was judged as a homozygous mutant having the same variation in biallelic genes; FIG. 30 shows the results of alignment of the clone No. 9 with the wild-type reference sequence, and the results were judged as homozygous mutants having different biallelic variations.

Through analysis of specific sequences, the genotype of each single cell clone is shown in table 3:

TABLE 3 pAPN Gene knockout Single cell clone genotype identification

6.4.6 the single cell clones numbered 3, 7, 8, 18, 27, 42 and 44 are single cell clones with homozygous knockout of INHA, CD163 and pAPN genes, and the homozygous knockout rate of the three genes is about 11 percent.

The heterozygous mutant and the homozygous mutant single-cell clone strains can be used for cloning and producing the gene editing pig.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Sequence listing

<110> Nanjing King Gene engineering Co., Ltd

<120> construction of high-quality pig nuclear transfer donor cell gene editing system with high reproductive capacity and resistance to blue ear disease and serial diarrhea disease and application thereof

<160> 30

<170> SIPOSequenceListing 1.0

<210> 1

<211> 8484

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaaataag 300

gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttg ttttagagct 360

agaaatagca agttaaaata aggctagtcc gtttttagcg cgtgcgccaa ttctgcagac 420

aaatggctct agaggtaccc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 480

ccaacgaccc ccgcccattg acgtcaatag taacgccaat agggactttc cattgacgtc 540

aatgggtgga gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc 600

caagtacgcc ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tgtgcccagt 660

acatgacctt atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta 720

ccatggtcga ggtgagcccc acgttctgct tcactctccc catctccccc ccctccccac 780

ccccaatttt gtatttattt attttttaat tattttgtgc agcgatgggg gcgggggggg 840

ggggggggcg gggcgagggg cggggcgggg cgaggcggag aggtgcggcg gcagccaatc 900

agagcggcgc gctccgaaag tttcctttta tggcgaggcg gcggcggcgg cggccctata 960

aaaagcgaag cgcgcggcgg gcgggagtcg ctgcgcgctg ccttcgcccc gtgccccgct 1020

ccgccgccgc ctcgcgccgc ccgccccggc tctgactgac cgcgttactc ccacaggtga 1080

gcgggcggga cggcccttct cctccgggct gtaattagct gagcaagagg taagggttta 1140

agggatggtt ggttggtggg gtattaatgt ttaattacct ggagcacctg cctgaaatca 1200

ctttttttca ggttggaccg gtgccaccat ggactataag gaccacgacg gagactacaa 1260

ggatcatgat attgattaca aagacgatga cgataagatg gccccaaaga agaagcggaa 1320

ggtcggtatc cacggagtcc cagcagccga caagaagtac agcatcggcc tggacatcgg 1380

caccaactct gtgggctggg ccgtgatcac cgacgagtac aaggtgccca gcaagaaatt 1440

caaggtgctg ggcaacaccg accggcacag catcaagaag aacctgatcg gagccctgct 1500

gttcgacagc ggcgaaacag ccgaggccac ccggctgaag agaaccgcca gaagaagata 1560

caccagacgg aagaaccgga tctgctatct gcaagagatc ttcagcaacg agatggccaa 1620

ggtggacgac agcttcttcc acagactgga agagtccttc ctggtggaag aggataagaa 1680

gcacgagcgg caccccatct tcggcaacat cgtggacgag gtggcctacc acgagaagta 1740

ccccaccatc taccacctga gaaagaaact ggtggacagc accgacaagg ccgacctgcg 1800

gctgatctat ctggccctgg cccacatgat caagttccgg ggccacttcc tgatcgaggg 1860

cgacctgaac cccgacaaca gcgacgtgga caagctgttc atccagctgg tgcagaccta 1920

caaccagctg ttcgaggaaa accccatcaa cgccagcggc gtggacgcca aggccatcct 1980

gtctgccaga ctgagcaaga gcagacggct ggaaaatctg atcgcccagc tgcccggcga 2040

gaagaagaat ggcctgttcg gaaacctgat tgccctgagc ctgggcctga cccccaactt 2100

caagagcaac ttcgacctgg ccgaggatgc caaactgcag ctgagcaagg acacctacga 2160

cgacgacctg gacaacctgc tggcccagat cggcgaccag tacgccgacc tgtttctggc 2220

cgccaagaac ctgtccgacg ccatcctgct gagcgacatc ctgagagtga acaccgagat 2280

caccaaggcc cccctgagcg cctctatgat caagagatac gacgagcacc accaggacct 2340

gaccctgctg aaagctctcg tgcggcagca gctgcctgag aagtacaaag agattttctt 2400

cgaccagagc aagaacggct acgccggcta cattgacggc ggagccagcc aggaagagtt 2460

ctacaagttc atcaagccca tcctggaaaa gatggacggc accgaggaac tgctcgtgaa 2520

gctgaacaga gaggacctgc tgcggaagca gcggaccttc gacaacggca gcatccccca 2580

ccagatccac ctgggagagc tgcacgccat tctgcggcgg caggaagatt tttacccatt 2640

cctgaaggac aaccgggaaa agatcgagaa gatcctgacc ttccgcatcc cctactacgt 2700

gggccctctg gccaggggaa acagcagatt cgcctggatg accagaaaga gcgaggaaac 2760

catcaccccc tggaacttcg aggaagtggt ggacaagggc gcttccgccc agagcttcat 2820

cgagcggatg accaacttcg ataagaacct gcccaacgag aaggtgctgc ccaagcacag 2880

cctgctgtac gagtacttca ccgtgtataa cgagctgacc aaagtgaaat acgtgaccga 2940

gggaatgaga aagcccgcct tcctgagcgg cgagcagaaa aaggccatcg tggacctgct 3000

gttcaagacc aaccggaaag tgaccgtgaa gcagctgaaa gaggactact tcaagaaaat 3060

cgagtgcttc gactccgtgg aaatctccgg cgtggaagat cggttcaacg cctccctggg 3120

cacataccac gatctgctga aaattatcaa ggacaaggac ttcctggaca atgaggaaaa 3180

cgaggacatt ctggaagata tcgtgctgac cctgacactg tttgaggaca gagagatgat 3240

cgaggaacgg ctgaaaacct atgcccacct gttcgacgac aaagtgatga agcagctgaa 3300

gcggcggaga tacaccggct ggggcaggct gagccggaag ctgatcaacg gcatccggga 3360

caagcagtcc ggcaagacaa tcctggattt cctgaagtcc gacggcttcg ccaacagaaa 3420

cttcatgcag ctgatccacg acgacagcct gacctttaaa gaggacatcc agaaagccca 3480

ggtgtccggc cagggcgata gcctgcacga gcacattgcc aatctggccg gcagccccgc 3540

cattaagaag ggcatcctgc agacagtgaa ggtggtggac gagctcgtga aagtgatggg 3600

ccggcacaag cccgagaaca tcgtgatcga aatggccaga gagaaccaga ccacccagaa 3660

gggacagaag aacagccgcg agagaatgaa gcggatcgaa gagggcatca aagagctggg 3720

cagccagatc ctgaaagaac accccgtgga aaacacccag ctgcagaacg agaagctgta 3780

cctgtactac ctgcagaatg ggcgggatat gtacgtggac caggaactgg acatcaaccg 3840

gctgtccgac tacgatgtgg accatatcgt gcctcagagc tttctgaagg acgactccat 3900

cgacaacaag gtgctgacca gaagcgacaa gaaccggggc aagagcgaca acgtgccctc 3960

cgaagaggtc gtgaagaaga tgaagaacta ctggcggcag ctgctgaacg ccaagctgat 4020

tacccagaga aagttcgaca atctgaccaa ggccgagaga ggcggcctga gcgaactgga 4080

taaggccggc ttcatcaaga gacagctggt ggaaacccgg cagatcacaa agcacgtggc 4140

acagatcctg gactcccgga tgaacactaa gtacgacgag aatgacaagc tgatccggga 4200

agtgaaagtg atcaccctga agtccaagct ggtgtccgat ttccggaagg atttccagtt 4260

ttacaaagtg cgcgagatca acaactacca ccacgcccac gacgcctacc tgaacgccgt 4320

cgtgggaacc gccctgatca aaaagtaccc taagctggaa agcgagttcg tgtacggcga 4380

ctacaaggtg tacgacgtgc ggaagatgat cgccaagagc gagcaggaaa tcggcaaggc 4440

taccgccaag tacttcttct acagcaacat catgaacttt ttcaagaccg agattaccct 4500

ggccaacggc gagatccgga agcggcctct gatcgagaca aacggcgaaa ccggggagat 4560

cgtgtgggat aagggccggg attttgccac cgtgcggaaa gtgctgagca tgccccaagt 4620

gaatatcgtg aaaaagaccg aggtgcagac aggcggcttc agcaaagagt ctatcctgcc 4680

caagaggaac agcgataagc tgatcgccag aaagaaggac tgggacccta agaagtacgg 4740

cggcttcgac agccccaccg tggcctattc tgtgctggtg gtggccaaag tggaaaaggg 4800

caagtccaag aaactgaaga gtgtgaaaga gctgctgggg atcaccatca tggaaagaag 4860

cagcttcgag aagaatccca tcgactttct ggaagccaag ggctacaaag aagtgaaaaa 4920

ggacctgatc atcaagctgc ctaagtactc cctgttcgag ctggaaaacg gccggaagag 4980

aatgctggcc tctgccggcg aactgcagaa gggaaacgaa ctggccctgc cctccaaata 5040

tgtgaacttc ctgtacctgg ccagccacta tgagaagctg aagggctccc ccgaggataa 5100

tgagcagaaa cagctgtttg tggaacagca caagcactac ctggacgaga tcatcgagca 5160

gatcagcgag ttctccaaga gagtgatcct ggccgacgct aatctggaca aagtgctgtc 5220

cgcctacaac aagcaccggg ataagcccat cagagagcag gccgagaata tcatccacct 5280

gtttaccctg accaatctgg gagcccctgc cgccttcaag tactttgaca ccaccatcga 5340

ccggaagagg tacaccagca ccaaagaggt gctggacgcc accctgatcc accagagcat 5400

caccggcctg tacgagacac ggatcgacct gtctcagctg ggaggcgaca aaaggccggc 5460

ggccacgaaa aaggccggcc aggcaaaaaa gaaaaagtaa gaattcctag agctcgctga 5520

tcagcctcga ctgtgccttc tagttgccag ccatctgttg tttgcccctc ccccgtgcct 5580

tccttgaccc tggaaggtgc cactcccact gtcctttcct aataaaatga ggaaattgca 5640

tcgcattgtc tgagtaggtg tcattctatt ctggggggtg gggtggggca ggacagcaag 5700

ggggaggatt gggaagagaa tagcaggcat gctggggagc ggccgcagga acccctagtg 5760

atggagttgg ccactccctc tctgcgcgct cgctcgctca ctgaggccgg gcgaccaaag 5820

gtcgcccgac gcccgggctt tgcccgggcg gcctcagtga gcgagcgagc gcgcagctgc 5880

ctgcaggggc gcctgatgcg gtattttctc cttacgcatc tgtgcggtat ttcacaccgc 5940

atacgtcaaa gcaaccatag tacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg 6000

tggttacgcg cagcgtgacc gctacacttg ccagcgcctt agcgcccgct cctttcgctt 6060

tcttcccttc ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc 6120

tccctttagg gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgatttgg 6180

gtgatggttc acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg 6240

agtccacgtt ctttaatagt ggactcttgt tccaaactgg aacaacactc aactctatct 6300

cgggctattc ttttgattta taagggattt tgccgatttc ggtctattgg ttaaaaaatg 6360

agctgattta acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaattttat 6420

ggtgcactct cagtacaatc tgctctgatg ccgcatagtt aagccagccc cgacacccgc 6480

caacacccgc tgacgcgccc tgacgggctt gtctgctccc ggcatccgct tacagacaag 6540

ctgtgaccgt ctccgggagc tgcatgtgtc agaggttttc accgtcatca ccgaaacgcg 6600

cgagacgaaa gggcctcgtg atacgcctat ttttataggt taatgtcatg ataataatgg 6660

tttcttagac gtcaggtggc acttttcggg gaaatgtgcg cggaacccct atttgtttat 6720

ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga taaatgcttc 6780

aataatattg aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc cttattccct 6840

tttttgcggc attttgcctt cctgtttttg ctcacccaga aacgctggtg aaagtaaaag 6900

atgctgaaga tcagttgggt gcacgagtgg gttacatcga actggatctc aacagcggta 6960

agatccttga gagttttcgc cccgaagaac gttttccaat gatgagcact tttaaagttc 7020

tgctatgtgg cgcggtatta tcccgtattg acgccgggca agagcaactc ggtcgccgca 7080

tacactattc tcagaatgac ttggttgagt actcaccagt cacagaaaag catcttacgg 7140

atggcatgac agtaagagaa ttatgcagtg ctgccataac catgagtgat aacactgcgg 7200

ccaacttact tctgacaacg atcggaggac cgaaggagct aaccgctttt ttgcacaaca 7260

tgggggatca tgtaactcgc cttgatcgtt gggaaccgga gctgaatgaa gccataccaa 7320

acgacgagcg tgacaccacg atgcctgtag caatggcaac aacgttgcgc aaactattaa 7380

ctggcgaact acttactcta gcttcccggc aacaattaat agactggatg gaggcggata 7440

aagttgcagg accacttctg cgctcggccc ttccggctgg ctggtttatt gctgataaat 7500

ctggagccgg tgagcgtgga agccgcggta tcattgcagc actggggcca gatggtaagc 7560

cctcccgtat cgtagttatc tacacgacgg ggagtcaggc aactatggat gaacgaaata 7620

gacagatcgc tgagataggt gcctcactga ttaagcattg gtaactgtca gaccaagttt 7680

actcatatat actttagatt gatttaaaac ttcattttta atttaaaagg atctaggtga 7740

agatcctttt tgataatctc atgaccaaaa tcccttaacg tgagttttcg ttccactgag 7800

cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa 7860

tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg ccggatcaag 7920

agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata ccaaatactg 7980

ttcttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca ccgcctacat 8040

acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag tcgtgtctta 8100

ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc tgaacggggg 8160

gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga tacctacagc 8220

gtgagctatg agaaagcgcc acgcttcccg aagggagaaa ggcggacagg tatccggtaa 8280

gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac gcctggtatc 8340

tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg tgatgctcgt 8400

caggggggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct 8460

tttgctggcc ttttgctcac atgt 8484

<210> 2

<211> 10476

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaaataag 300

gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttc tagcgcgtgc 360

gccaattctg cagacaaatg gctctagagg tacccgttac ataacttacg gtaaatggcc 420

cgcctggctg accgcccaac gacccccgcc cattgacgtc aatagtaacg ccaataggga 480

ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc 540

aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 600

ggcattgtgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 660

tagtcatcgc tattaccatg ggggcagagc gcacatcgcc cacagtcccc gagaagttgg 720

ggggaggggt cggcaattga tccggtgcct agagaaggtg gcgcggggta aactgggaaa 780

gtgatgtcgt gtactggctc cgcctttttc ccgagggtgg gggagaaccg tatataagtg 840

cagtagtcgc cgtgaacgtt ctttttcgca acgggtttgc cgccagaaca caggttggac 900

cggtgccacc atggactata aggaccacga cggagactac aaggatcatg atattgatta 960

caaagacgat gacgataaga tggcccccaa aaagaaacga aaggtgggtg ggtccccaaa 1020

gaagaagcgg aaggtcggta tccacggagt cccagcagcc gacaagaagt acagcatcgg 1080

cctggacatc ggcaccaact ctgtgggctg ggccgtgatc accgacgagt acaaggtgcc 1140

cagcaagaaa ttcaaggtgc tgggcaacac cgaccggcac agcatcaaga agaacctgat 1200

cggagccctg ctgttcgaca gcggcgaaac agccgaggcc acccggctga agagaaccgc 1260

cagaagaaga tacaccagac ggaagaaccg gatctgctat ctgcaagaga tcttcagcaa 1320

cgagatggcc aaggtggacg acagcttctt ccacagactg gaagagtcct tcctggtgga 1380

agaggataag aagcacgagc ggcaccccat cttcggcaac atcgtggacg aggtggccta 1440

ccacgagaag taccccacca tctaccacct gagaaagaaa ctggtggaca gcaccgacaa 1500

ggccgacctg cggctgatct atctggccct ggcccacatg atcaagttcc ggggccactt 1560

cctgatcgag ggcgacctga accccgacaa cagcgacgtg gacaagctgt tcatccagct 1620

ggtgcagacc tacaaccagc tgttcgagga aaaccccatc aacgccagcg gcgtggacgc 1680

caaggccatc ctgtctgcca gactgagcaa gagcagacgg ctggaaaatc tgatcgccca 1740

gctgcccggc gagaagaaga atggcctgtt cggaaacctg attgccctga gcctgggcct 1800

gacccccaac ttcaagagca acttcgacct ggccgaggat gccaaactgc agctgagcaa 1860

ggacacctac gacgacgacc tggacaacct gctggcccag atcggcgacc agtacgccga 1920

cctgtttctg gccgccaaga acctgtccga cgccatcctg ctgagcgaca tcctgagagt 1980

gaacaccgag atcaccaagg cccccctgag cgcctctatg atcaagagat acgacgagca 2040

ccaccaggac ctgaccctgc tgaaagctct cgtgcggcag cagctgcctg agaagtacaa 2100

agagattttc ttcgaccaga gcaagaacgg ctacgccggc tacattgacg gcggagccag 2160

ccaggaagag ttctacaagt tcatcaagcc catcctggaa aagatggacg gcaccgagga 2220

actgctcgtg aagctgaaca gagaggacct gctgcggaag cagcggacct tcgacaacgg 2280

cagcatcccc caccagatcc acctgggaga gctgcacgcc attctgcggc ggcaggaaga 2340

tttttaccca ttcctgaagg acaaccggga aaagatcgag aagatcctga ccttccgcat 2400

cccctactac gtgggccctc tggccagggg aaacagcaga ttcgcctgga tgaccagaaa 2460

gagcgaggaa accatcaccc cctggaactt cgaggaagtg gtggacaagg gcgcttccgc 2520

ccagagcttc atcgagcgga tgaccaactt cgataagaac ctgcccaacg agaaggtgct 2580

gcccaagcac agcctgctgt acgagtactt caccgtgtat aacgagctga ccaaagtgaa 2640

atacgtgacc gagggaatga gaaagcccgc cttcctgagc ggcgagcaga aaaaggccat 2700

cgtggacctg ctgttcaaga ccaaccggaa agtgaccgtg aagcagctga aagaggacta 2760

cttcaagaaa atcgagtgct tcgactccgt ggaaatctcc ggcgtggaag atcggttcaa 2820

cgcctccctg ggcacatacc acgatctgct gaaaattatc aaggacaagg acttcctgga 2880

caatgaggaa aacgaggaca ttctggaaga tatcgtgctg accctgacac tgtttgagga 2940

cagagagatg atcgaggaac ggctgaaaac ctatgcccac ctgttcgacg acaaagtgat 3000

gaagcagctg aagcggcgga gatacaccgg ctggggcagg ctgagccgga agctgatcaa 3060

cggcatccgg gacaagcagt ccggcaagac aatcctggat ttcctgaagt ccgacggctt 3120

cgccaacaga aacttcatgc agctgatcca cgacgacagc ctgaccttta aagaggacat 3180

ccagaaagcc caggtgtccg gccagggcga tagcctgcac gagcacattg ccaatctggc 3240

cggcagcccc gccattaaga agggcatcct gcagacagtg aaggtggtgg acgagctcgt 3300

gaaagtgatg ggccggcaca agcccgagaa catcgtgatc gaaatggcca gagagaacca 3360

gaccacccag aagggacaga agaacagccg cgagagaatg aagcggatcg aagagggcat 3420

caaagagctg ggcagccaga tcctgaaaga acaccccgtg gaaaacaccc agctgcagaa 3480

cgagaagctg tacctgtact acctgcagaa tgggcgggat atgtacgtgg accaggaact 3540

ggacatcaac cggctgtccg actacgatgt ggaccatatc gtgcctcaga gctttctgaa 3600

ggacgactcc atcgacaaca aggtgctgac cagaagcgac aagaaccggg gcaagagcga 3660

caacgtgccc tccgaagagg tcgtgaagaa gatgaagaac tactggcggc agctgctgaa 3720

cgccaagctg attacccaga gaaagttcga caatctgacc aaggccgaga gaggcggcct 3780

gagcgaactg gataaggccg gcttcatcaa gagacagctg gtggaaaccc ggcagatcac 3840

aaagcacgtg gcacagatcc tggactcccg gatgaacact aagtacgacg agaatgacaa 3900

gctgatccgg gaagtgaaag tgatcaccct gaagtccaag ctggtgtccg atttccggaa 3960

ggatttccag ttttacaaag tgcgcgagat caacaactac caccacgccc acgacgccta 4020

cctgaacgcc gtcgtgggaa ccgccctgat caaaaagtac cctaagctgg aaagcgagtt 4080

cgtgtacggc gactacaagg tgtacgacgt gcggaagatg atcgccaaga gcgagcagga 4140

aatcggcaag gctaccgcca agtacttctt ctacagcaac atcatgaact ttttcaagac 4200

cgagattacc ctggccaacg gcgagatccg gaagcggcct ctgatcgaga caaacggcga 4260

aaccggggag atcgtgtggg ataagggccg ggattttgcc accgtgcgga aagtgctgag 4320

catgccccaa gtgaatatcg tgaaaaagac cgaggtgcag acaggcggct tcagcaaaga 4380

gtctatcctg cccaagagga acagcgataa gctgatcgcc agaaagaagg actgggaccc 4440

taagaagtac ggcggcttcg acagccccac cgtggcctat tctgtgctgg tggtggccaa 4500

agtggaaaag ggcaagtcca agaaactgaa gagtgtgaaa gagctgctgg ggatcaccat 4560

catggaaaga agcagcttcg agaagaatcc catcgacttt ctggaagcca agggctacaa 4620

agaagtgaaa aaggacctga tcatcaagct gcctaagtac tccctgttcg agctggaaaa 4680

cggccggaag agaatgctgg cctctgccgg cgaactgcag aagggaaacg aactggccct 4740

gccctccaaa tatgtgaact tcctgtacct ggccagccac tatgagaagc tgaagggctc 4800

ccccgaggat aatgagcaga aacagctgtt tgtggaacag cacaagcact acctggacga 4860

gatcatcgag cagatcagcg agttctccaa gagagtgatc ctggccgacg ctaatctgga 4920

caaagtgctg tccgcctaca acaagcaccg ggataagccc atcagagagc aggccgagaa 4980

tatcatccac ctgtttaccc tgaccaatct gggagcccct gccgccttca agtactttga 5040

caccaccatc gaccggaaga ggtacaccag caccaaagag gtgctggacg ccaccctgat 5100

ccaccagagc atcaccggcc tgtacgagac acggatcgac ctgtctcagc tgggaggcga 5160

caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa aagaaaaagg gcggctccaa 5220

gcggcctgcc gcgacgaaga aagcgggaca ggccaagaaa aagaaaggat ccggcgcaac 5280

aaacttctct ctgctgaaac aagccggaga tgtcgaagag aatcctggac cggtgagcaa 5340

gggcgaggag ctgttcaccg gggtggtgcc catcctggtc gagctggacg gcgacgtaaa 5400

cggccacaag ttcagcgtgt ccggcgaggg cgagggcgat gccacctacg gcaagctgac 5460

cctgaagttc atctgcacca ccggcaagct gcccgtgccc tggcccaccc tcgtgaccac 5520

cctgacctac ggcgtgcagt gcttcagccg ctaccccgac cacatgaagc agcacgactt 5580

cttcaagtcc gccatgcccg aaggctacgt ccaggagcgc accatcttct tcaaggacga 5640

cggcaactac aagacccgcg ccgaggtgaa gttcgagggc gacaccctgg tgaaccgcat 5700

cgagctgaag ggcatcgact tcaaggagga cggcaacatc ctggggcaca agctggagta 5760

caactacaac agccacaacg tctatatcat ggccgacaag cagaagaacg gcatcaaggt 5820

gaacttcaag atccgccaca acatcgagga cggcagcgtg cagctcgccg accactacca 5880

gcagaacacc cccatcggcg acggccccgt gctgctgccc gacaaccact acctgagcac 5940

ccagtccgcc ctgagcaaag accccaacga gaagcgcgat cacatggtcc tgctggagtt 6000

cgtgaccgcc gccgggatca ctctcggcat ggacgagctg tacaagggct ccggcgaggg 6060

caggggaagt cttctaacat gcggggacgt ggaggaaaat cccggcccaa ccgagtacaa 6120

gcccacggtg cgcctcgcca cccgcgacga cgtccccagg gccgtacgca ccctcgccgc 6180

cgcgttcgcc gactaccccg ccacgcgcca caccgtcgat ccggaccgcc acatcgagcg 6240

ggtcaccgag ctgcaagaac tcttcctcac gcgcgtcggg ctcgacatcg gcaaggtgtg 6300

ggtcgcggac gacggcgccg cggtggcggt ctggaccacg ccggagagcg tcgaagcggg 6360

ggcggtgttc gccgagatcg gcccgcgcat ggccgagttg agcggttccc ggctggccgc 6420

gcagcaacag atggaaggcc tcctggcgcc gcaccggccc aaggagcccg cgtggttcct 6480

ggccaccgtc ggagtctcgc ccgaccacca gggcaagggt ctgggcagcg ccgtcgtgct 6540

ccccggagtg gaggcggccg agcgcgccgg ggtgcccgcc ttcctggaga cctccgcgcc 6600

ccgcaacctc cccttctacg agcggctcgg cttcaccgtc accgccgacg tcgaggtgcc 6660

cgaaggaccg cgcacctggt gcatgacccg caagcccggt gcctgaacgc gttaagtcga 6720

caatcaacct ctggattaca aaatttgtga aagattgact ggtattctta actatgttgc 6780

tccttttacg ctatgtggat acgctgcttt aatgcctttg tatcatgcta ttgcttcccg 6840

tatggctttc attttctcct ccttgtataa atcctggttg ctgtctcttt atgaggagtt 6900

gtggcccgtt gtcaggcaac gtggcgtggt gtgcactgtg tttgctgacg caacccccac 6960

tggttggggc attgccacca cctgtcagct cctttccggg actttcgctt tccccctccc 7020

tattgccacg gcggaactca tcgccgcctg ccttgcccgc tgctggacag gggctcggct 7080

gttgggcact gacaattccg tggtgttgtc ggggaaatca tcgtcctttc cttggctgct 7140

cgcctgtgtt gccacctgga ttctgcgcgg gacgtccttc tgctacgtcc cttcggccct 7200

caatccagcg gaccttcctt cccgcggcct gctgccggct ctgcggcctc ttccgcgtct 7260

tcgccttcgc cctcagacga gtcggatctc cctttgggcc gcctccccgc gtcgacttta 7320

agaccaatga cttacaaggc agctgtagat cttagccact ttttaaaaga aaagggggga 7380

ctggaagggc taattcactc ccaacgaaga caagatctgc tttttgcttg tactgggtct 7440

ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt 7500

aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac 7560

tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagggcc 7620

cgtttaaacc cgctgatcag cctcgactgt gccttctagt tgccagccat ctgttgtttg 7680

cccctccccc gtgccttcct tgaccctgga aggtgccact cccactgtcc tttcctaata 7740

aaatgaggaa attgcatcgc attgtctgag taggtgtcat tctattctgg ggggtggggt 7800

ggggcaggac agcaaggggg aggattggga agacaatagc aggcatgctg gggatgcggt 7860

gggctctatg gcctgcaggg gcgcctgatg cggtattttc tccttacgca tctgtgcggt 7920

atttcacacc gcatacgtca aagcaaccat agtacgcgcc ctgtagcggc gcattaagcg 7980

cggcgggtgt ggtggttacg cgcagcgtga ccgctacact tgccagcgcc ttagcgcccg 8040

ctcctttcgc tttcttccct tcctttctcg ccacgttcgc cggctttccc cgtcaagctc 8100

taaatcgggg gctcccttta gggttccgat ttagtgcttt acggcacctc gaccccaaaa 8160

aacttgattt gggtgatggt tcacgtagtg ggccatcgcc ctgatagacg gtttttcgcc 8220

ctttgacgtt ggagtccacg ttctttaata gtggactctt gttccaaact ggaacaacac 8280

tcaactctat ctcgggctat tcttttgatt tataagggat tttgccgatt tcggtctatt 8340

ggttaaaaaa tgagctgatt taacaaaaat ttaacgcgaa ttttaacaaa atattaacgt 8400

ttacaatttt atggtgcact ctcagtacaa tctgctctga tgccgcatag ttaagccagc 8460

cccgacaccc gccaacaccc gctgacgcgc cctgacgggc ttgtctgctc ccggcatccg 8520

cttacagaca agctgtgacc gtctccggga gctgcatgtg tcagaggttt tcaccgtcat 8580

caccgaaacg cgcgagacga aagggcctcg tgatacgcct atttttatag gttaatgtca 8640

tgataataat ggtttcttag acgtcaggtg gcacttttcg gggaaatgtg cgcggaaccc 8700

ctatttgttt atttttctaa atacattcaa atatgtatcc gctcatgaga caataaccct 8760

gataaatgct tcaataatat tgaaaaagga agagtatgag tattcaacat ttccgtgtcg 8820

cccttattcc cttttttgcg gcattttgcc ttcctgtttt tgctcaccca gaaacgctgg 8880

tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt gggttacatc gaactggatc 8940

tcaacagcgg taagatcctt gagagttttc gccccgaaga acgttttcca atgatgagca 9000

cttttaaagt tctgctatgt ggcgcggtat tatcccgtat tgacgccggg caagagcaac 9060

tcggtcgccg catacactat tctcagaatg acttggttga gtactcacca gtcacagaaa 9120

agcatcttac ggatggcatg acagtaagag aattatgcag tgctgccata accatgagtg 9180

ataacactgc ggccaactta cttctgacaa cgatcggagg accgaaggag ctaaccgctt 9240

ttttgcacaa catgggggat catgtaactc gccttgatcg ttgggaaccg gagctgaatg 9300

aagccatacc aaacgacgag cgtgacacca cgatgcctgt agcaatggca acaacgttgc 9360

gcaaactatt aactggcgaa ctacttactc tagcttcccg gcaacaatta atagactgga 9420

tggaggcgga taaagttgca ggaccacttc tgcgctcggc ccttccggct ggctggttta 9480

ttgctgataa atctggagcc ggtgagcgtg gaagccgcgg tatcattgca gcactggggc 9540

cagatggtaa gccctcccgt atcgtagtta tctacacgac ggggagtcag gcaactatgg 9600

atgaacgaaa tagacagatc gctgagatag gtgcctcact gattaagcat tggtaactgt 9660

cagaccaagt ttactcatat atactttaga ttgatttaaa acttcatttt taatttaaaa 9720

ggatctaggt gaagatcctt tttgataatc tcatgaccaa aatcccttaa cgtgagtttt 9780

cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga gatccttttt 9840

ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt 9900

tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc agagcgcaga 9960

taccaaatac tgttcttcta gtgtagccgt agttaggcca ccacttcaag aactctgtag 10020

caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc agtggcgata 10080

agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg cagcggtcgg 10140

gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac accgaactga 10200

gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca 10260

ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt ccagggggaa 10320

acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt 10380

tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg gcctttttac 10440

ggttcctggc cttttgctgg ccttttgctc acatgt 10476

<210> 3

<211> 3120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 60

cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt 120

tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 180

aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt 240

ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg 300

ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga 360

tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc 420

tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac 480

actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg 540

gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca 600

acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg 660

gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg 720

acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg 780

gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag 840

ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg 900

gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct 960

cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac 1020

agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact 1080

catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga 1140

tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 1200

cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct 1260

gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 1320

taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgttc 1380

ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 1440

tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 1500

ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 1560

cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 1620

agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 1680

gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 1740

atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 1800

gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1860

gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 1920

ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 1980

cagtgagcga ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 2040

cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca 2100

acgcaattaa tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc 2160

cggctcgtat gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg 2220

accatgatta cgccaagctt gcatgcaggc ctctgcagtc gacgggcccg ggatccgatg 2280

ataaacatgt gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc 2340

tgttagagag ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac 2400

gtgacgtaga aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat 2460

ggactatcat atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt 2520

gtggaaagga cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag 2580

ttaaaataag gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttc 2640

tagcgcgtgc gccaattctg cagacaaatg gctctagagg tacccataga tctagatgca 2700

ttcgcgaggt accgagctcg aattcactgg ccgtcgtttt acaacgtcgt gactgggaaa 2760

accctggcgt tacccaactt aatcgccttg cagcacatcc ccctttcgcc agctggcgta 2820

atagcgaaga ggcccgcacc gatcgccctt cccaacagtt gcgcagcctg aatggcgaat 2880

ggcgcctgat gcggtatttt ctccttacgc atctgtgcgg tatttcacac cgcatatggt 2940

gcactctcag tacaatctgc tctgatgccg catagttaag ccagccccga cacccgccaa 3000

cacccgctga cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg 3060

tgaccgtctc cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga 3120

<210> 4

<211> 175

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tgtggaaagg acgaaacacc gggtcttcga gaagacctgt tttagagcta gaaatagcaa 60

gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg gtgctttttt 120

ctagcgcgtg cgccaattct gcagacaaat ggctctagag gtacccgtta cataa 175

<210> 5

<211> 554

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tctgcagaca aatggctcta gaggtacccg ttacataact tacggtaaat ggcccgcctg 60

gctgaccgcc caacgacccc cgcccattga cgtcaatagt aacgccaata gggactttcc 120

attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 180

atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 240

gtgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 300

tcgctattac catgggggca gagcgcacat cgcccacagt ccccgagaag ttggggggag 360

gggtcggcaa ttgatccggt gcctagagaa ggtggcgcgg ggtaaactgg gaaagtgatg 420

tcgtgtactg gctccgcctt tttcccgagg gtgggggaga accgtatata agtgcagtag 480

tcgccgtgaa cgttcttttt cgcaacgggt ttgccgccag aacacaggtt ggaccggtgc 540

caccatggac tata 554

<210> 6

<211> 447

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ccagaacaca ggttggaccg gtgccaccat ggactataag gaccacgacg gagactacaa 60

ggatcatgat attgattaca aagacgatga cgataagatg gcccccaaaa agaaacgaaa 120

ggtgggtggg tccccaaaga agaagcggaa ggtcggtatc cacggagtcc cagcagccga 180

caagaagtac agcatcggcc tggacatcgg caccaactct gtgggctggg ccgtgatcac 240

cgacgagtac aaggtgccca gcaagaaatt caaggtgctg ggcaacaccg accggcacag 300

catcaagaag aacctgatcg gagccctgct gttcgacagc ggcgaaacag ccgaggccac 360

ccggctgaag agaaccgcca gaagaagata caccagacgg aagaaccgga tctgctatct 420

gcaagagatc ttcagcaacg agatggc 447

<210> 7

<211> 2727

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cggcggccac gaaaaaggcc ggccaggcaa aaaagaaaaa gggcggctcc aagcggcctg 60

ccgcgacgaa gaaagcggga caggccaaga aaaagaaagg atccggcgca acaaacttct 120

ctctgctgaa acaagccgga gatgtcgaag agaatcctgg accggtgagc aagggcgagg 180

agctgttcac cggggtggtg cccatcctgg tcgagctgga cggcgacgta aacggccaca 240

agttcagcgt gtccggcgag ggcgagggcg atgccaccta cggcaagctg accctgaagt 300

tcatctgcac caccggcaag ctgcccgtgc cctggcccac cctcgtgacc accctgacct 360

acggcgtgca gtgcttcagc cgctaccccg accacatgaa gcagcacgac ttcttcaagt 420

ccgccatgcc cgaaggctac gtccaggagc gcaccatctt cttcaaggac gacggcaact 480

acaagacccg cgccgaggtg aagttcgagg gcgacaccct ggtgaaccgc atcgagctga 540

agggcatcga cttcaaggag gacggcaaca tcctggggca caagctggag tacaactaca 600

acagccacaa cgtctatatc atggccgaca agcagaagaa cggcatcaag gtgaacttca 660

agatccgcca caacatcgag gacggcagcg tgcagctcgc cgaccactac cagcagaaca 720

cccccatcgg cgacggcccc gtgctgctgc ccgacaacca ctacctgagc acccagtccg 780

ccctgagcaa agaccccaac gagaagcgcg atcacatggt cctgctggag ttcgtgaccg 840

ccgccgggat cactctcggc atggacgagc tgtacaaggg ctccggcgag ggcaggggaa 900

gtcttctaac atgcggggac gtggaggaaa atcccggccc aaccgagtac aagcccacgg 960

tgcgcctcgc cacccgcgac gacgtcccca gggccgtacg caccctcgcc gccgcgttcg 1020

ccgactaccc cgccacgcgc cacaccgtcg atccggaccg ccacatcgag cgggtcaccg 1080

agctgcaaga actcttcctc acgcgcgtcg ggctcgacat cggcaaggtg tgggtcgcgg 1140

acgacggcgc cgcggtggcg gtctggacca cgccggagag cgtcgaagcg ggggcggtgt 1200

tcgccgagat cggcccgcgc atggccgagt tgagcggttc ccggctggcc gcgcagcaac 1260

agatggaagg cctcctggcg ccgcaccggc ccaaggagcc cgcgtggttc ctggccaccg 1320

tcggagtctc gcccgaccac cagggcaagg gtctgggcag cgccgtcgtg ctccccggag 1380

tggaggcggc cgagcgcgcc ggggtgcccg ccttcctgga gacctccgcg ccccgcaacc 1440

tccccttcta cgagcggctc ggcttcaccg tcaccgccga cgtcgaggtg cccgaaggac 1500

cgcgcacctg gtgcatgacc cgcaagcccg gtgcctgaac gcgttaagtc gacaatcaac 1560

ctctggatta caaaatttgt gaaagattga ctggtattct taactatgtt gctcctttta 1620

cgctatgtgg atacgctgct ttaatgcctt tgtatcatgc tattgcttcc cgtatggctt 1680

tcattttctc ctccttgtat aaatcctggt tgctgtctct ttatgaggag ttgtggcccg 1740

ttgtcaggca acgtggcgtg gtgtgcactg tgtttgctga cgcaaccccc actggttggg 1800

gcattgccac cacctgtcag ctcctttccg ggactttcgc tttccccctc cctattgcca 1860

cggcggaact catcgccgcc tgccttgccc gctgctggac aggggctcgg ctgttgggca 1920

ctgacaattc cgtggtgttg tcggggaaat catcgtcctt tccttggctg ctcgcctgtg 1980

ttgccacctg gattctgcgc gggacgtcct tctgctacgt cccttcggcc ctcaatccag 2040

cggaccttcc ttcccgcggc ctgctgccgg ctctgcggcc tcttccgcgt cttcgccttc 2100

gccctcagac gagtcggatc tccctttggg ccgcctcccc gcgtcgactt taagaccaat 2160

gacttacaag gcagctgtag atcttagcca ctttttaaaa gaaaaggggg gactggaagg 2220

gctaattcac tcccaacgaa gacaagatct gctttttgct tgtactgggt ctctctggtt 2280

agaccagatc tgagcctggg agctctctgg ctaactaggg aacccactgc ttaagcctca 2340

ataaagcttg ccttgagtgc ttcaagtagt gtgtgcccgt ctgttgtgtg actctggtaa 2400

ctagagatcc ctcagaccct tttagtcagt gtggaaaatc tctagcaggg cccgtttaaa 2460

cccgctgatc agcctcgact gtgccttcta gttgccagcc atctgttgtt tgcccctccc 2520

ccgtgccttc cttgaccctg gaaggtgcca ctcccactgt cctttcctaa taaaatgagg 2580

aaattgcatc gcattgtctg agtaggtgtc attctattct ggggggtggg gtggggcagg 2640

acagcaaggg ggaggattgg gaagacaata gcaggcatgc tggggatgcg gtgggctcta 2700

tggcctgcag gggcgcctga tgcggta 2727

<210> 8

<211> 410

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gataaacatg tgagggccta tttcccatga ttccttcata tttgcatata cgatacaagg 60

ctgttagaga gataattgga attaatttga ctgtaaacac aaagatatta gtacaaaata 120

cgtgacgtag aaagtaataa tttcttgggt agtttgcagt tttaaaatta tgttttaaaa 180

tggactatca tatgcttacc gtaacttgaa agtatttcga tttcttggct ttatatatct 240

tgtggaaagg acgaaacacc gggtcttcga gaagacctgt tttagagcta gaaatagcaa 300

gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg gtgctttttt 360

ctagcgcgtg cgccaattct gcagacaaat ggctctagag gtacccatag 410

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

agttatggca gaactcagtg 20

<210> 10

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

caccgagtta tggcagaact cagtg 25

<210> 11

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

aaaccactga gttctgccat aactc 25

<210> 12

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

aguuauggca gaacucagug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 13

<211> 339

<212> PRT

<213> pig (Sus scrofa)

<400> 13

Met Gly Arg Gly Asp Trp Gly Gly Pro Gly Gln Thr Leu Thr Glu Gly

1 5 10 15

Ala Gln Gly Trp Val Trp Val His Arg Trp Gln Gly Gln Val Ser Tyr

20 25 30

Val Ala Ser Ala Ala Pro Leu Ala Val Gly Pro Thr Glu Trp Ala Trp

35 40 45

Leu Pro Gly Pro Gly Ala Gly Pro Gly Ala Cys Pro Gly Gln Gly Ala

50 55 60

Arg Cys Gly Asp Glu Pro Ala Ala Gly Glu Leu Ala Arg Glu Ala Glu

65 70 75 80

Glu Gly Leu Phe Thr Tyr Val Phe Arg Pro Ser Gln His Thr Arg Ser

85 90 95

Arg Gln Val Thr Ser Ala Gln Leu Trp Phe His Thr Gly Leu Asp Arg

100 105 110

Gln Gly Met Ala Ala Ala Asn Ser Ser Gly Pro Leu Leu Asp Leu Leu

115 120 125

Ala Leu Ser Ser Arg Gly Pro Val Ala Val Pro Met Ser Leu Gly Gln

130 135 140

Ala Pro Pro Arg Trp Ala Val Leu His Leu Ala Ala Ser Ala Leu Pro

145 150 155 160

Leu Leu Thr His Pro Val Leu Val Leu Leu Leu Arg Cys Pro Leu Cys

165 170 175

Ser Cys Ser Ala Arg Pro Glu Ala Thr Pro Phe Leu Val Ala His Thr

180 185 190

Arg Ala Arg Pro Pro Ser Gly Gly Glu Arg Ala Arg Arg Ser Thr Ala

195 200 205

Pro Leu Pro Trp Pro Trp Ser Pro Ala Ala Leu Arg Leu Leu Gln Arg

210 215 220

Pro Pro Glu Glu Pro Ala Val His Ala Asp Cys His Arg Ala Ser Leu

225 230 235 240

Asn Ile Ser Phe Gln Glu Leu Gly Trp Asp Arg Trp Ile Val His Pro

245 250 255

Pro Ser Phe Ile Phe His Tyr Cys His Gly Gly Cys Gly Leu Pro Thr

260 265 270

Leu Pro Asn Leu Pro Leu Ser Val Pro Gly Ala Pro Pro Thr Pro Val

275 280 285

Gln Pro Leu Leu Leu Val Pro Gly Ala Gln Pro Cys Cys Ala Ala Leu

290 295 300

Pro Gly Thr Met Arg Ser Leu Arg Val Arg Thr Thr Ser Asp Gly Gly

305 310 315 320

Tyr Ser Phe Lys Tyr Glu Thr Val Pro Asn Leu Leu Thr Gln His Cys

325 330 335

Ala Cys Ile

<210> 14

<211> 1034

<212> DNA

<213> pig (Sus scrofa)

<400> 14

gcaggctcct gagtggcagc cagatcctgc ctgttgagga ggaggggtcc caggttctgc 60

cagtcagggc tgccctctcc cttccttctg cctcctgcag gtgcccgctg tggggacgag 120

ccagctgctg gagagctggc ccgggaggct gaggagggcc tcttcacata tgtattccgg 180

ccgtcccagc acacacgcag ccgccaggtg acttcagctc agctgtggtt ccacacggga 240

ctggacagac aggggatggc agccgccaat agctctgggc ccctgctgga cctgctggca 300

ctatcatcca ggggtcctgt ggctgtgccc atgtcactgg gccaggcgcc ccctcgctgg 360

gctgtgctgc acctggccgc ctctgccctc cctttgttga cccacccagt cctggtgctg 420

ctgctgcgct gtcctctctg ttcctgctca gcccggcccg aggccacccc cttcctggtg 480

gcccacactc gggccaggcc acccagcgga gggggagagg gcccgacgct ccaccgcccc 540

tctgccctgg ccttggtccc ccgccgcgct gcgcctgctg cagaggcccc cggaggaacc 600

cgctgtgcac gccgactgcc acagagcttc cctcaacatc tccttccagg agctgggctg 660

ggaccggtgg atcgtgcacc ctcccagttt catcttccac tactgtcacg ggggctgcgg 720

gctgccgacc ctgcccaacc tgcccctgtc tgtccctggg gcccccccta cccctgtcca 780

gcccctgttg ttggtgccag gggctcagcc ctgctgcgct gctctcccgg ggaccatgag 840

gtccctacgc gttcgcacca cctcggatgg aggttactct ttcaagtacg agacagtgcc 900

caaccttctc acccagcact gtgcctgcat ctaagggtgt cccgctggtg gccaagctcc 960

cacaggcacc agcctggagg aaggcagagt tcccacctcc cctttccttc cgcctctccg 1020

cctggaggct cccc 1034

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

cctctgcagc aggcgcagcg 20

<210> 16

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

caccgcctct gcagcaggcg cagcg 25

<210> 17

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

aaaccgctgc gcctgctgca gaggc 25

<210> 18

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

ccucugcagc aggcgcagcg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 19

<211> 1113

<212> PRT

<213> pig (Sus scrofa)

<400> 19

Met Asp Lys Leu Arg Met Val Leu His Glu Asn Ser Gly Ser Ala Asp

1 5 10 15

Phe Arg Arg Cys Ser Ala His Leu Ser Ser Phe Thr Phe Ala Val Val

20 25 30

Ala Val Leu Ser Ala Cys Leu Val Thr Ser Ser Leu Gly Gly Lys Asp

35 40 45

Lys Glu Leu Arg Leu Thr Gly Gly Glu Asn Lys Cys Ser Gly Arg Val

50 55 60

Glu Val Lys Val Gln Glu Glu Trp Gly Thr Val Cys Asn Asn Gly Trp

65 70 75 80

Asp Met Asp Val Val Ser Val Val Cys Arg Gln Leu Gly Cys Pro Thr

85 90 95

Ala Ile Lys Ala Thr Gly Trp Ala Asn Phe Ser Ala Gly Ser Gly Arg

100 105 110

Ile Trp Met Asp His Val Ser Cys Arg Gly Asn Glu Ser Ala Leu Trp

115 120 125

Asp Cys Lys His Asp Gly Trp Gly Lys His Asn Cys Thr His Gln Gln

130 135 140

Asp Ala Gly Val Thr Cys Ser Asp Gly Ser Asp Leu Glu Met Arg Leu

145 150 155 160

Val Asn Gly Gly Asn Arg Cys Leu Gly Arg Ile Glu Val Lys Phe Gln

165 170 175

Gly Arg Trp Gly Thr Val Cys Asp Asp Asn Phe Asn Ile Asn His Ala

180 185 190

Ser Val Val Cys Lys Gln Leu Glu Cys Gly Ser Ala Val Ser Phe Ser

195 200 205

Gly Ser Ala Asn Phe Gly Glu Gly Ser Gly Pro Ile Trp Phe Asp Asp

210 215 220

Leu Val Cys Asn Gly Asn Glu Ser Ala Leu Trp Asn Cys Lys His Glu

225 230 235 240

Gly Trp Gly Lys His Asn Cys Asp His Ala Glu Asp Ala Gly Val Ile

245 250 255

Cys Leu Asn Gly Ala Asp Leu Lys Leu Arg Val Val Asp Gly Val Thr

260 265 270

Glu Cys Ser Gly Arg Leu Glu Val Lys Phe Gln Gly Glu Trp Gly Thr

275 280 285

Ile Cys Asp Asp Gly Trp Asp Ser Asp Asp Ala Ala Val Ala Cys Lys

290 295 300

Gln Leu Gly Cys Pro Thr Ala Val Thr Ala Ile Gly Arg Val Asn Ala

305 310 315 320

Ser Glu Gly Thr Gly His Ile Trp Leu Asp Ser Val Ser Cys His Gly

325 330 335

His Glu Ser Ala Leu Trp Gln Cys Arg His His Glu Trp Gly Lys His

340 345 350

Tyr Cys Asn His Asn Glu Asp Ala Gly Val Thr Cys Ser Asp Gly Ser

355 360 365

Asp Leu Glu Leu Arg Leu Lys Gly Gly Gly Ser His Cys Ala Gly Thr

370 375 380

Val Glu Val Glu Ile Gln Lys Leu Val Gly Lys Val Cys Asp Arg Ser

385 390 395 400

Trp Gly Leu Lys Glu Ala Asp Val Val Cys Arg Gln Leu Gly Cys Gly

405 410 415

Ser Ala Leu Lys Thr Ser Tyr Gln Val Tyr Ser Lys Thr Lys Ala Thr

420 425 430

Asn Thr Trp Leu Phe Val Ser Ser Cys Asn Gly Asn Glu Thr Ser Leu

435 440 445

Trp Asp Cys Lys Asn Trp Gln Trp Gly Gly Leu Ser Cys Asp His Tyr

450 455 460

Asp Glu Ala Lys Ile Thr Cys Ser Ala His Arg Lys Pro Arg Leu Val

465 470 475 480

Gly Gly Asp Ile Pro Cys Ser Gly Arg Val Glu Val Gln His Gly Asp

485 490 495

Thr Trp Gly Thr Val Cys Asp Ser Asp Phe Ser Leu Glu Ala Ala Ser

500 505 510

Val Leu Cys Arg Glu Leu Gln Cys Gly Thr Val Val Ser Leu Leu Gly

515 520 525

Gly Ala His Phe Gly Glu Gly Ser Gly Gln Ile Trp Ala Glu Glu Phe

530 535 540

Gln Cys Glu Gly His Glu Ser His Leu Ser Leu Cys Pro Val Ala Pro

545 550 555 560

Arg Pro Asp Gly Thr Cys Ser His Ser Arg Asp Val Gly Val Val Cys

565 570 575

Ser Arg Tyr Thr Gln Ile Arg Leu Val Asn Gly Lys Thr Pro Cys Glu

580 585 590

Gly Arg Val Glu Leu Asn Ile Leu Gly Ser Trp Gly Ser Leu Cys Asn

595 600 605

Ser His Trp Asp Met Glu Asp Ala His Val Leu Cys Gln Gln Leu Lys

610 615 620

Cys Gly Val Ala Leu Ser Ile Pro Gly Gly Ala Pro Phe Gly Lys Gly

625 630 635 640

Ser Glu Gln Val Trp Arg His Met Phe His Cys Thr Gly Thr Glu Lys

645 650 655

His Met Gly Asp Cys Ser Val Thr Ala Leu Gly Ala Ser Leu Cys Ser

660 665 670

Ser Gly Gln Val Ala Ser Val Ile Cys Ser Gly Asn Gln Ser Gln Thr

675 680 685

Leu Ser Pro Cys Asn Ser Ser Ser Ser Asp Pro Ser Ser Ser Ile Ile

690 695 700

Ser Glu Glu Asn Gly Val Ala Cys Ile Gly Ser Gly Gln Leu Arg Leu

705 710 715 720

Val Asp Gly Gly Gly Arg Cys Ala Gly Arg Val Glu Val Tyr His Glu

725 730 735

Gly Ser Trp Gly Thr Ile Cys Asp Asp Ser Trp Asp Leu Asn Asp Ala

740 745 750

His Val Val Cys Lys Gln Leu Ser Cys Gly Trp Ala Ile Asn Ala Thr

755 760 765

Gly Ser Ala His Phe Gly Glu Gly Thr Gly Pro Ile Trp Leu Asp Glu

770 775 780

Ile Asn Cys Asn Gly Lys Glu Ser His Ile Trp Gln Cys His Ser His

785 790 795 800

Gly Trp Gly Arg His Asn Cys Arg His Lys Glu Asp Ala Gly Val Ile

805 810 815

Cys Ser Glu Phe Met Ser Leu Arg Leu Ile Ser Glu Asn Ser Arg Glu

820 825 830

Thr Cys Ala Gly Arg Leu Glu Val Phe Tyr Asn Gly Ala Trp Gly Ser

835 840 845

Val Gly Lys Asn Ser Met Ser Pro Ala Thr Val Gly Val Val Cys Arg

850 855 860

Gln Leu Gly Cys Ala Asp Arg Gly Asp Ile Ser Pro Ala Ser Ser Asp

865 870 875 880

Lys Thr Val Ser Arg His Met Trp Val Asp Asn Val Gln Cys Pro Lys

885 890 895

Gly Pro Asp Thr Leu Trp Gln Cys Pro Ser Ser Pro Trp Lys Lys Arg

900 905 910

Leu Ala Ser Pro Ser Glu Glu Thr Trp Ile Thr Cys Ala Asn Lys Ile

915 920 925

Arg Leu Gln Glu Gly Asn Thr Asn Cys Ser Gly Arg Val Glu Ile Trp

930 935 940

Tyr Gly Gly Ser Trp Gly Thr Val Cys Asp Asp Ser Trp Asp Leu Glu

945 950 955 960

Asp Ala Gln Val Val Cys Arg Gln Leu Gly Cys Gly Ser Ala Leu Glu

965 970 975

Ala Gly Lys Glu Ala Ala Phe Gly Gln Gly Thr Gly Pro Ile Trp Leu

980 985 990

Asn Glu Val Lys Cys Lys Gly Asn Glu Thr Ser Leu Trp Asp Cys Pro

995 1000 1005

Ala Arg Ser Trp Gly His Ser Asp Cys Gly His Lys Glu Asp Ala Ala

1010 1015 1020

Val Thr Cys Ser Glu Ile Ala Lys Ser Arg Glu Ser Leu His Ala Thr

1025 1030 1035 1040

Gly Arg Ser Ser Phe Val Ala Leu Ala Ile Phe Gly Val Ile Leu Leu

1045 1050 1055

Ala Cys Leu Ile Ala Phe Leu Ile Trp Thr Gln Lys Arg Arg Gln Arg

1060 1065 1070

Gln Arg Leu Ser Val Phe Ser Gly Gly Glu Asn Ser Val His Gln Ile

1075 1080 1085

Gln Tyr Arg Glu Met Asn Ser Cys Leu Lys Ala Asp Glu Thr Asp Met

1090 1095 1100

Leu Asn Pro Ser Glu Asn Ser Asn Glu

1105 1110

<210> 20

<211> 1115

<212> DNA

<213> pig (Sus scrofa)

<400> 20

tggcaaagat tgtctttaaa atctgagctc catgtcttct gctttatttc tggtgtgcct 60

ttgactccag attacagtaa atggaggact gagtataggg ctaaaaagta gagagaatgg 120

atgcatatta tctgtggtct ccaatgtgat gaatgaagta ggcaaatact caaaggaaag 180

agaaagcatg ctccaagaat tatgggttcc agaaggcaaa gtcccagaat tgtctccagg 240

gaaggacagg gaggtctaga atcggctaag cccactgtag gcagaaaaac caagaggcat 300

gaatggcttc cctttctcac ttttcactct ctggcttact cctatcatga aggaaaatat 360

tggaatcata ttctccctca ccgaaatgct attttttcag cccacaggaa acccaggctg 420

gttggagggg acattccctg ctctggtcgt gttgaagtac aacatggaga cacgtggggc 480

accgtctgtg attctgactt ctctctggag gcggccagcg tgctgtgcag ggaactacag 540

tgcggcactg tggtttccct cctgggggga gctcactttg gagaaggaag tggacagatc 600

tgggctgaag aattccagtg tgaggggcac gagtcccacc tttcactctg cccagtagca 660

ccccgccctg acgggacatg tagccacagc agggacgtcg gcgtagtctg ctcaagtgag 720

acccagggaa tgtgttcact ttgttcccat gccatgaaga gggtagggtt aggtagtcac 780

agacatcttt ttaaagccct gtctccttcc aggatacaca caaatccgct tggtgaatgg 840

caagacccca tgtgaaggaa gagtggagct caacattctt gggtcctggg ggtccctctg 900

caactctcac tgggacatgg aagatgccca tgttttatgc cagcagctta aatgtggagt 960

tgccctttct atcccgggag gagcaccttt tgggaaagga agtgagcagg tctggaggca 1020

catgtttcac tgcactggga ctgagaagca catgggagat tgttccgtca ctgctctggg 1080

cgcatcactc tgttcttcag ggcaagtggc ctctg 1115

<210> 21

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

ggtcgtgttg aagtacaaca 20

<210> 22

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

caccggtcgt gttgaagtac aaca 24

<210> 23

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

aaactgttgt acttcaacac gacc 24

<210> 24

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

ggucguguug aaguacaaca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 25

<211> 963

<212> PRT

<213> pig (Sus scrofa)

<400> 25

Met Ala Lys Gly Phe Tyr Ile Ser Lys Ala Leu Gly Ile Leu Gly Ile

1 5 10 15

Leu Leu Gly Val Ala Ala Val Ala Thr Ile Ile Ala Leu Ser Val Val

20 25 30

Tyr Ala Gln Glu Lys Asn Lys Asn Ala Glu His Val Pro Gln Ala Pro

35 40 45

Thr Ser Pro Thr Ile Thr Thr Thr Ala Ala Ile Thr Leu Asp Gln Ser

50 55 60

Lys Pro Trp Asn Arg Tyr Arg Leu Pro Thr Thr Leu Leu Pro Asp Ser

65 70 75 80

Tyr Phe Val Thr Leu Arg Pro Tyr Leu Thr Pro Asn Ala Asp Gly Leu

85 90 95

Tyr Ile Phe Lys Gly Lys Ser Ile Val Arg Leu Leu Cys Gln Glu Pro

100 105 110

Thr Asp Val Ile Ile Ile His Ser Lys Lys Leu Asn Tyr Thr Thr Gln

115 120 125

Gly His Met Val Val Leu Arg Gly Val Gly Asp Ser Gln Val Pro Glu

130 135 140

Ile Asp Arg Thr Glu Leu Val Glu Leu Thr Glu Tyr Leu Val Val His

145 150 155 160

Leu Lys Gly Ser Leu Gln Pro Gly His Met Tyr Glu Met Glu Ser Glu

165 170 175

Phe Gln Gly Glu Leu Ala Asp Asp Leu Ala Gly Phe Tyr Arg Ser Glu

180 185 190

Tyr Met Glu Gly Asn Val Lys Lys Val Leu Ala Thr Thr Gln Met Gln

195 200 205

Ser Thr Asp Ala Arg Lys Ser Phe Pro Cys Phe Asp Glu Pro Ala Met

210 215 220

Lys Ala Thr Phe Asn Ile Thr Leu Ile His Pro Asn Asn Leu Thr Ala

225 230 235 240

Leu Ser Asn Met Pro Pro Lys Gly Ser Ser Thr Pro Leu Ala Glu Asp

245 250 255

Pro Asn Trp Ser Val Thr Glu Phe Glu Thr Thr Pro Val Met Ser Thr

260 265 270

Tyr Leu Leu Ala Tyr Ile Val Ser Glu Phe Gln Ser Val Asn Glu Thr

275 280 285

Ala Gln Asn Gly Val Leu Ile Arg Ile Trp Ala Arg Pro Asn Ala Ile

290 295 300

Ala Glu Gly His Gly Met Tyr Ala Leu Asn Val Thr Gly Pro Ile Leu

305 310 315 320

Asn Phe Phe Ala Asn His Tyr Asn Thr Ser Tyr Pro Leu Pro Lys Ser

325 330 335

Asp Gln Ile Ala Leu Pro Asp Phe Asn Ala Gly Ala Met Glu Asn Trp

340 345 350

Gly Leu Val Thr Tyr Arg Glu Asn Ala Leu Leu Phe Asp Pro Gln Ser

355 360 365

Ser Ser Ile Ser Asn Lys Glu Arg Val Val Thr Val Ile Ala His Glu

370 375 380

Leu Ala His Gln Trp Phe Gly Asn Leu Val Thr Leu Ala Trp Trp Asn

385 390 395 400

Asp Leu Trp Leu Asn Glu Gly Phe Ala Ser Tyr Val Glu Tyr Leu Gly

405 410 415

Ala Asp His Ala Glu Pro Thr Trp Asn Leu Lys Asp Leu Ile Val Pro

420 425 430

Gly Asp Val Tyr Arg Val Met Ala Val Asp Ala Leu Ala Ser Ser His

435 440 445

Pro Leu Thr Thr Pro Ala Glu Glu Val Asn Thr Pro Ala Gln Ile Ser

450 455 460

Glu Met Phe Asp Ser Ile Ser Tyr Ser Lys Gly Ala Ser Val Ile Arg

465 470 475 480

Met Leu Ser Asn Phe Leu Thr Glu Asp Leu Phe Lys Glu Gly Leu Ala

485 490 495

Ser Tyr Leu His Ala Phe Ala Tyr Gln Asn Thr Thr Tyr Leu Asp Leu

500 505 510

Trp Glu His Leu Gln Lys Ala Val Asp Ala Gln Thr Ser Ile Arg Leu

515 520 525

Pro Asp Thr Val Arg Ala Ile Met Asp Arg Trp Thr Leu Gln Met Gly

530 535 540

Phe Pro Val Ile Thr Val Asp Thr Lys Thr Gly Asn Ile Ser Gln Lys

545 550 555 560

His Phe Leu Leu Asp Ser Glu Ser Asn Val Thr Arg Ser Ser Ala Phe

565 570 575

Asp Tyr Leu Trp Ile Val Pro Ile Ser Ser Ile Lys Asn Gly Val Met

580 585 590

Gln Asp His Tyr Trp Leu Arg Asp Val Ser Gln Ala Gln Asn Asp Leu

595 600 605

Phe Lys Thr Ala Ser Asp Asp Trp Val Leu Leu Asn Val Asn Val Thr

610 615 620

Gly Tyr Phe Gln Val Asn Tyr Asp Glu Asp Asn Trp Arg Met Ile Gln

625 630 635 640

His Gln Leu Gln Thr Asn Leu Ser Val Ile Pro Val Ile Asn Arg Ala

645 650 655

Gln Val Ile Tyr Asp Ser Phe Asn Leu Ala Thr Ala His Met Val Pro

660 665 670

Val Thr Leu Ala Leu Asp Asn Thr Leu Phe Leu Asn Gly Glu Lys Glu

675 680 685

Tyr Met Pro Trp Gln Ala Ala Leu Ser Ser Leu Ser Tyr Phe Ser Leu

690 695 700

Met Phe Asp Arg Ser Glu Val Tyr Gly Pro Met Lys Lys Tyr Leu Arg

705 710 715 720

Lys Gln Val Glu Pro Leu Phe Gln His Phe Glu Thr Leu Thr Lys Asn

725 730 735

Trp Thr Glu Arg Pro Glu Asn Leu Met Asp Gln Tyr Ser Glu Ile Asn

740 745 750

Ala Ile Ser Thr Ala Cys Ser Asn Gly Leu Pro Gln Cys Glu Asn Leu

755 760 765

Ala Lys Thr Leu Phe Asp Gln Trp Met Ser Asp Pro Glu Asn Asn Pro

770 775 780

Ile His Pro Asn Leu Arg Ser Thr Ile Tyr Cys Asn Ala Ile Ala Gln

785 790 795 800

Gly Gly Gln Asp Gln Trp Asp Phe Ala Trp Gly Gln Leu Gln Gln Ala

805 810 815

Gln Leu Val Asn Glu Ala Asp Lys Leu Arg Ser Ala Leu Ala Cys Ser

820 825 830

Asn Glu Val Trp Leu Leu Asn Arg Tyr Leu Gly Tyr Thr Leu Asn Pro

835 840 845

Asp Leu Ile Arg Lys Gln Asp Ala Thr Ser Thr Ile Asn Ser Ile Ala

850 855 860

Ser Asn Val Ile Gly Gln Pro Leu Ala Trp Asp Phe Val Gln Ser Asn

865 870 875 880

Trp Lys Lys Leu Phe Gln Asp Tyr Gly Gly Gly Ser Phe Ser Phe Ser

885 890 895

Asn Leu Ile Gln Gly Val Thr Arg Arg Phe Ser Ser Glu Phe Glu Leu

900 905 910

Gln Gln Leu Glu Gln Phe Lys Lys Asn Asn Met Asp Val Gly Phe Gly

915 920 925

Ser Gly Thr Arg Ala Leu Glu Gln Ala Leu Glu Lys Thr Lys Ala Asn

930 935 940

Ile Lys Trp Val Lys Glu Asn Lys Glu Val Val Leu Asn Trp Phe Ile

945 950 955 960

Glu His Ser

<210> 26

<211> 1203

<212> DNA

<213> pig (Sus scrofa)

<400> 26

ctgccacctg cccttcagcc cttggtgggc tcccaggctc ctgcagcctg taaccagacc 60

ctgtttgctc ccagcaggca cccctgagcc gcactccgca cgctgttcct gaatctcccc 120

tccagaaccg gagcagtgtc tctacccagt tcagtgacct tcgtctgtct gagccctggt 180

taatttttgc ccagtctgca ggctgtgggg ctcctcccct tcagggatat aagcctggtc 240

cgaagctgcc ctgtcccctg cccgtcctga gcctccccga gctcccttct caccctcacc 300

atggccaagg gattctacat ttccaaggcc ctgggcatcc tgggcatcct cctcggcgtg 360

gcggccgtgg ccaccatcat cgctctgtct gtggtgtacg cccaggagaa gaacaagaat 420

gccgagcatg tcccccaggc ccccacgtcg cccaccatca ccaccacagc cgccatcacc 480

ttggaccaga gcaagccgtg gaaccggtac cgcctaccca caacgctgtt gcctgattcc 540

tacaacgtga cgctgagacc ctacctcact cccaacgcgg atggcctgta catcttcaag 600

ggcaaaagca tcgtccgctt catctgccag gagcccaccg atgtcatcat catccatagc 660

aagaagctca actacaccac ccaggggcac atggtggtcc tgcggggcgt gggggactcc 720

caggtcccag agatcgacag gactgagctg gtagagctca ctgagtacct ggtggtccac 780

ctcaagggct cgctgcagcc cggccacatg tacgagatgg agagtgaatt ccagggggaa 840

cttgccgacg acctggcagg cttctaccgc agcgagtaca tggagggcaa cgtcaaaaag 900

taagtcaggt gggggcacac cctagatgct gaggcagagc tggatcctgg gggccaagga 960

agggcttgga ttcgggacct tggaaccttc tggagacttt ggctggcccg tcgctccatc 1020

cgcagctctg gtagagaagc tatctagaca atcagccctt tcccggagag cccccctaac 1080

cttagggagt caggggtgag tgatccaagt gcccccttgg gtagaaagga aaacaggctc 1140

tgaggacaga aatttgccca aggtctccca gctaattcag gggtggagcc tgcccggact 1200

ttg 1203

<210> 27

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

gaggatgccc aggatgccca 20

<210> 28

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

caccgaggat gcccaggatg ccca 24

<210> 29

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

aaactgggca tcctgggcat cctc 24

<210> 30

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

gaggaugccc aggaugccca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

Claims (10)

1. A CRISPR/Cas9 system for porcine INHA-CD163-pAPN gene editing, comprising a Cas9 expression vector, a gRNA expression vector for porcine INHA gene, a gRNA expression vector for porcine CD163 gene and a gRNA expression vector for porcine pAPN gene; the whole plasmid sequence of the Cas9 expression vector is shown as SEQ ID NO. 2.

2. The CRISPR/Cas9 system according to claim 1, characterized in that the vector skeletons of gRNA expression vector for pig INHA gene, gRNA expression vector for pig CD163 gene and gRNA expression vector for pig pAPN gene are all pKG-U6gRNA, and the whole sequence of the plasmid is shown in SEQ ID No. 3.

3. The CRISPR/Cas9 system according to claim 2, characterized in that a gRNA expression vector for pig INHA gene expresses gRNA shown in SEQ ID No.18, and the target point is shown in SEQ ID No. 15; a gRNA expression vector aiming at the pig CD163 gene expresses a gRNA shown by SEQ ID NO.24, and the target point of the gRNA is shown by SEQ ID NO. 21; the gRNA expression vector for the porcine pAPN gene expresses gRNA shown in SEQ ID NO.30, and the target point is shown in SEQ ID NO. 27.

4. The CRISPR/Cas9 system according to claim 3, characterized in that the gRNA expression vector for pig INHA gene is obtained by inserting double-stranded DNA formed by annealing single-stranded DNA shown in SEQ ID No.16 and SEQ ID No.17 into vector backbone pKG-U6 gRNA; the gRNA expression vector for the pig CD163 gene is obtained by annealing single-stranded DNA shown in SEQ ID No.22 and SEQ ID No.23 to form a double-stranded vector skeleton pKG-U6 gRNA; the gRNA expression vector for the pAPN gene of the pig is obtained by annealing single-stranded DNA shown in SEQ ID NO.28 and SEQ ID NO.29 to form a double-stranded vector skeleton pKG-U6 gRNA.

5. Use of the CRISPR/Cas9 system of any one of claims 1-4 in construction of porcine recombinant cells with mutation of INHA, CD163 and pAPN genes.

6. A recombinant cell, which is obtained by co-transfecting porcine primary fibroblasts with the CRISPR/Cas9 system of any one of claims 1-4 after validation.

7. The use of the recombinant cell of claim 6 in the construction of INHA, CD163 and pAPN triple knockout cloned pigs.

8. A gRNA expression vector for pig INHA genes is characterized in that the expression vector expresses gRNA shown in SEQ ID No.18, the vector framework of the expression vector is pKG-U6gRNA, and the whole sequence of the plasmid is shown in SEQ ID No. 3.

9. A gRNA expression vector for pig CD163 gene is characterized in that the expression vector expresses gRNA shown in SEQ ID No.24, the vector framework of the expression vector is pKG-U6gRNA, and the whole sequence of the plasmid is shown in SEQ ID No. 3.

10. A gRNA expression vector for a porcine pAPN gene is characterized in that the expression vector expresses gRNA shown in SEQ ID No.30, the vector framework of the expression vector is pKG-U6gRNA, and the whole sequence of a plasmid is shown in SEQ ID No. 3.

Images