CN112522257B - System for preparing severe immunodeficiency pig source recombinant cells with RRIP four genes knocked out in combined mode - Google Patents

System for preparing severe immunodeficiency pig source recombinant cells with RRIP four genes knocked out in combined mode Download PDF

Info

Publication number
CN112522257B
CN112522257B CN202010946436.5A CN202010946436A CN112522257B CN 112522257 B CN112522257 B CN 112522257B CN 202010946436 A CN202010946436 A CN 202010946436A CN 112522257 B CN112522257 B CN 112522257B
Authority
CN
China
Prior art keywords
leu
ser
sgrna
ala
glu
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010946436.5A
Other languages
Chinese (zh)
Other versions
CN112522257A (en
Inventor
牛冬
汪滔
马翔
曾为俊
王磊
程锐
赵泽英
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Qizhen Genetic Engineering Co Ltd
Original Assignee
Nanjing Qizhen Genetic Engineering Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Qizhen Genetic Engineering Co Ltd filed Critical Nanjing Qizhen Genetic Engineering Co Ltd
Priority to CN202010946436.5A priority Critical patent/CN112522257B/en
Publication of CN112522257A publication Critical patent/CN112522257A/en
Application granted granted Critical
Publication of CN112522257B publication Critical patent/CN112522257B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A01K67/0276—Knock-out vertebrates
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C07K14/4705—Regulators; Modulating activity stimulating, promoting or activating activity
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • C07K14/7155—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for interleukins [IL]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0656—Adult fibroblasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/11—Protein-serine/threonine kinases (2.7.11)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/108—Swine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/035—Animal model for multifactorial diseases
    • A01K2267/0387—Animal model for diseases of the immune system
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/09—Fusion polypeptide containing a localisation/targetting motif containing a nuclear localisation signal
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/60—Fusion polypeptide containing spectroscopic/fluorescent detection, e.g. green fluorescent protein [GFP]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/48—Vector systems having a special element relevant for transcription regulating transport or export of RNA, e.g. RRE, PRE, WPRE, CTE
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/50—Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/11—Protein-serine/threonine kinases (2.7.11)
    • C12Y207/11001—Non-specific serine/threonine protein kinase (2.7.11.1), i.e. casein kinase or checkpoint kinase

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Veterinary Medicine (AREA)
  • Environmental Sciences (AREA)
  • Rheumatology (AREA)
  • Immunology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a system for preparing a severe immunodeficiency pig source recombinant cell with four RRIP genes knocked out in a combined mode, and particularly relates to a system for preparing a severe immunodeficiency pig source recombinant cell with four genes knocked out in a combined mode, namely an RAG1 gene, an RAG2 gene, an IL2RG gene and a PRKDC gene. The invention provides a combination of sgRNAs, from which RAG1‑g4 、sgRNA RAG2‑g2 、sgRNA IL2RG‑g7 And sgRNA PRKDC‑g6 Composition is prepared. sgRNA RAG1‑g4 The target sequence binding region of (a) is as set forth in SEQ ID NO:9 from nucleotide 1 to nucleotide 20; sgRNA RAG2‑g2 The target sequence binding region of (a) is as set forth in SEQ ID NO:13 from nucleotide 1 to nucleotide 20; sgRNA IL2RG‑g7 The target sequence binding region of (a) is as set forth in SEQ ID NO:24 from nucleotide 1 to nucleotide 20; sgRNA PRKDC‑g6 The target sequence binding region of (a) is as set forth in SEQ ID NO:34 from nucleotide 1 to nucleotide 20. The invention lays a solid foundation for the preparation of the severe immunodeficiency pig model, and has great application value for the research and development of severe immunodeficiency medicines.

Description

System for preparing severe immunodeficiency pig source recombinant cells with RRIP four genes knocked out in combined mode
Technical Field
The invention relates to a system for preparing a severe immunodeficiency pig source recombinant cell with four RRIP genes knocked out in a combined mode, in particular to a system for preparing a severe immunodeficiency pig source recombinant cell with four genes knocked out in a combined mode, namely an RAG1 gene, an RAG2 gene, an IL2RG gene and a PRKDC gene.
Background
Severe combined immunodeficiency (severe combined immunodeficiency, SCID) is the most severe phenotype in primary immunodeficiency disease, and refers to the simultaneous development, differentiation, proliferation, metabolism or dysfunction of T cells, B cells and NK cells due to genetic, developmental or infectious factors. In 1950, glanzmann and Riniker reported SCID disease in human infants for the first time. Worldwide, the neonatal morbidity of SCID is about 1/50000, the disease is early in onset, the clinical manifestation is heavy, and the mortality rate is high. Most SCIDs are caused by abnormalities in immune-related genes, and the primary genetic means of SCIDs include both X-linked recessive inheritance and autosomal recessive inheritance. The disease has a certain regional and blood-related nature, and is frequently seen in male patients due to the characteristic of X-linked recessive inheritance.
SCID caused by X-linked recessive inheritance is one of the most common types, and the pathogenic mutation is that IL2RG gene encoding IL-2 Rgamma chain is mutated, thereby causing dysfunction of IL-2 Rgamma chain. The IL-2 Rgamma chain is also called a common gamma chain (common gamma chain), and is a signal transduction molecule commonly used when a plurality of cytokine receptors such as IL-2, IL-4, IL-7 and the like involved in regulating the differentiation, development and maturation processes of immune cells are combined with corresponding ligands thereof, and then signals are transduced into the immune cells. Thus, dysfunction of the consensus gamma chain can lead to dysfunction or dysplasia of immune cells, thereby eliciting SCID. SCID initiated by IL2RG gene mutation accounts for 50% -60%, and another 10% of SCID onset is due to RAG gene mutation. RAG gene mutations can affect VDJ region rearrangements, affect T and B cell differentiation, interfere with antigen receptor formation and immunoglobulin expression. RAG1 acts as a catalyst component of RAG complexes, while RAG2, although not a catalyst, is involved in the catalytic process of RAG1 known to date. Thus, RAG1 and RAG2 are both closely related to SCID. In addition, PRKDC encodes a DNA-dependent protein kinase catalytic subunit, and this product can also affect B-cell, T-cell differentiation by affecting VDJ rearrangement during B-cell, T-cell differentiation, and thus PRKDC is also an important gene for triggering SCID.
Currently, therapies aimed at SCID mainly include bone marrow or hematopoietic stem cell transplantation and gene therapy. Bone marrow or stem cell transplantation is the best approach to treat SCID, but finding a donor of the appropriate ligand to the patient is quite difficult. As large animals, pigs are main meat source animals for a long time, are easy to breed and raise on a large scale, have lower requirements on ethical morals, animal protection and the like, have similar body sizes and organ functions to human beings, and are ideal human disease model animals. In addition, in the study of the effects of bioactive macromolecule or cell therapy, the use of heterologous animals will result in immune rejection, and thus, effective animal testing is not possible. The severe combined immunodeficiency model animals avoid the problem of immunological rejection between xenogeneics. Therefore, the human SCID pig model is developed for carrying out the researches of drug (especially bioactive molecules) screening, drug effect detection, disease pathology, gene and cell therapy, and the like, can provide effective experimental data for further clinical application, and also provides a powerful experimental means for successfully treating human SCID diseases.
Disclosure of Invention
The invention aims to provide a system for preparing a severe immunodeficiency pig source recombinant cell with four RRIP genes knocked out in a combined mode, and particularly relates to a system for preparing a severe immunodeficiency pig source recombinant cell with four genes of RAG1 genes, RAG2 genes, IL2RG genes and PRKDC genes knocked out in a combined mode.
The invention provides a combination of sgRNAs, from which RAG1-g4 、sgRNA RAG2-g2 、sgRNA IL2RG-g7 And sgRNA PRKDC-g6 Composition is prepared.
The invention provides a plasmid combination, which consists of a plasmid pKG-U6gRNA (RAG 1-g 4), a plasmid pKG-U6gRNA (RAG 2-g 2), a plasmid pKG-U6gRNA (IL 2RG-g 7) and a plasmid pKG-U6gRNA (PRKDC-g 6).
The invention also provides a kit comprising the sgRNA combination.
The invention also provides a kit comprising the plasmid combination. The kit also comprises plasmid pKG-GE3.
The invention also protects the application of the sgRNA combination in preparing a kit.
The invention also protects the application of the plasmid combination in preparing a kit.
The invention also protects the plasmid combination and the application of the plasmid pKG-GE3 in the preparation of the kit.
The use of any of the above kits is as follows (a) or (b): (a) preparing a recombinant cell; (b) preparing an immunodeficiency animal model. When the immunodeficiency animal model is prepared, the recombinant cells are prepared first, and then the recombinant cells are used as donor cells to obtain cloned animals by adopting a somatic cell cloning technology, namely the immunodeficiency animal model. An immunodeficiency cell model can also be prepared by using the immunodeficiency animal model, namely, corresponding cells of the immunodeficiency animal model are separated to be used as the immunodeficiency cell model. The animal may specifically be a pig. The recombinant cells are porcine recombinant cells. The immunodeficiency animal model is an immunodeficiency pig model. The transformed recipient cell of the recombinant cell is a porcine cell. The porcine cells may be porcine fibroblasts. The porcine cells may specifically be porcine primary fibroblasts. The pig may be a river fragrant pig.
The invention also protects the application of any one of the sgRNA combinations or any one of the plasmid combinations or any one of the kits in preparing recombinant cells. The recombinant cells are porcine recombinant cells. The transformed recipient cell of the recombinant cell is a porcine cell. The porcine cells may be porcine fibroblasts. The porcine cells may specifically be porcine primary fibroblasts. The pig may be a river fragrant pig.
The invention also protects the application of any one of the sgRNA combinations or any one of the plasmid combinations or any one of the kits in preparing an immunodeficiency animal model. When the method is applied, the recombinant cells are prepared first, and then the recombinant cells are used as donor cells to obtain cloned animals by adopting a somatic cell cloning technology, namely the immunodeficiency animal model. An immunodeficiency cell model can also be prepared by using the immunodeficiency animal model, namely, corresponding cells of the immunodeficiency animal model are separated to be used as the immunodeficiency cell model. The animal may specifically be a pig. The recombinant cells are porcine recombinant cells. The immunodeficiency animal model is an immunodeficiency pig model. The transformed recipient cell of the recombinant cell is a porcine cell. The porcine cells may be porcine fibroblasts. The porcine cells may specifically be porcine primary fibroblasts. The pig may be a river fragrant pig.
The invention also provides a method for preparing recombinant cells, comprising the steps of: the plasmid pKG-U6gRNA (RAG 1-g 4), the plasmid pKG-U6gRNA (RAG 2-g 2), the plasmid pKG-U6gRNA (IL 2RG-g 7), the plasmid pKG-U6gRNA (PRKDC-g 6) and the plasmid pKG-GE3 are transfected into pig cells to obtain recombinant cells with mutated RAG1 genes, RAG2 genes, IL2RG genes and PRKDC genes. The porcine cells may be porcine fibroblasts. The porcine cells may specifically be porcine primary fibroblasts. The pig may be a river fragrant pig.
The recombinant cells prepared by the method also belong to the protection scope of the invention.
Any of the above recombinant cells is deficient in any of RAG1 gene, RAG2 gene, IL2RG gene and PRKDC gene.
Any of the recombinant cells is a recombinant cell in which the RAG1 gene, the RAG2 gene, the IL2RG gene and the PRKDC gene are mutated. The mutation may be a heterozygous mutation (corresponding genotype is heterozygous mutant) or a homozygous mutation (corresponding genotype is biallelic identical mutant or biallelic different mutant).
Specifically, the recombinant cell may be any one of the following: the monoclonal cell lines numbered 4, 6, 10, 13, 36, 45, 50, 54, 69, 72, 78, 80, 84, 88, 94, 101, 107 in tables 1 to 4.
The invention also protects the application of the recombinant cells in preparing an immunodeficiency animal model. When the immunodeficiency animal model is prepared, the recombinant cells are used as donor cells, and a somatic cell cloning technology is adopted to obtain cloned animals, namely the immunodeficiency animal model. An immunodeficiency cell model can also be prepared by using the immunodeficiency animal model, namely, corresponding cells of the immunodeficiency animal model are separated to be used as the immunodeficiency cell model. The animal may specifically be a pig. The recombinant cells are porcine recombinant cells. The immunodeficiency animal model is an immunodeficiency pig model.
sgRNA RAG1-g4 Target point: 5'-AGTTATGGCAGAACTCAGTG-3'.
sgRNA RAG2-g2 Target point: 5'-GATAACAGTTGGTAATAACA-3'.
sgRNA IL2RG-g7 Target point: 5'-TCCCTTCAGAGAATAGATAG-3'.
sgRNA PRKDC-g6 Target point: 5'-TATGCAAAGGGGTGCAGCCA-3'.
The sgRNA RAG1-g4 The target sequence binding region of (a) is as set forth in SEQ ID NO:9 from nucleotide 1 to nucleotide 20.
The sgRNA RAG2-g2 The target sequence binding region of (a) is as set forth in SEQ ID NO:13 from nucleotide 1 to nucleotide 20.
The sgRNA IL2RG-g7 The target sequence binding region of (a) is as set forth in SEQ ID NO:24 from nucleotide 1 to nucleotide 20.
The sgRNA PRKDC-g6 The target sequence binding region of (a) is as set forth in SEQ ID NO:34 from nucleotide 1 to nucleotide 20.
The sgRNA RAG1-g4 As set forth in SEQ ID NO: shown at 9.
The sgRNA RAG2-g2 As set forth in SEQ ID NO: shown at 13.
The sgRNA IL2RG-g7 As set forth in SEQ ID NO: shown at 24.
The sgRNA PRKDC-g6 As set forth in SEQ ID NO: shown at 34.
The plasmid pKG-U6gRNA (RAG 1-g 4) was transcribed to give sgRNA RAG1-g4 。
Transcription of the plasmid pKG-U6gRNA (RAG 2-g 2)Obtaining sgRNA RAG2-g2 。
The plasmid pKG-U6gRNA (IL 2RG-g 7) is transcribed to give sgRNA IL2RG-g7 。
The plasmid pKG-U6gRNA (PRKDC-g 6) was transcribed to give the sgRNA PRKDC-g6 。
Specifically, the plasmid pKG-U6gRNA (RAG 1-g 4) was used to introduce the sgRNA with the aid of the restriction enzyme BbsI RAG1-g4 Is inserted into a pKG-U6gRNA vector.
Specifically, the present invention relates to a method for manufacturing a semiconductor device. The plasmid pKG-U6gRNA (RAG 2-g 2) was obtained by introducing the sgRNA with the aid of the restriction enzyme BbsI RAG2-g2 Is inserted into a pKG-U6gRNA vector.
Specifically, the plasmid pKG-U6gRNA (IL 2RG-g 7) was used to introduce the sgRNA by means of the restriction enzyme BbsI IL2RG-g7 Is inserted into a pKG-U6gRNA vector.
Specifically, the present invention relates to a method for manufacturing a semiconductor device. The plasmid pKG-U6gRNA (PRKDC-g 6) was obtained by introducing the sgRNA with the aid of the restriction enzyme BbsI PRKDC-g6 Is inserted into a pKG-U6gRNA vector.
The plasmid pKG-GE3 has a specific fusion gene; the specific fusion gene codes for a specific fusion protein;
The specific fusion protein sequentially comprises the following elements from the N end to the C end: two Nuclear Localization Signals (NLS), cas9 protein, two nuclear localization signals, self-cleaving polypeptide P2A, fluorescent reporter protein, self-cleaving polypeptide T2A, resistance selection marker protein;
in the plasmid pKG-GE3, the EF1a promoter is used for promoting the expression of the specific fusion gene;
in plasmid pKG-GE3, the specific fusion gene has downstream a WPRE sequence element, a 3' LTR sequence element and a bGH poly (A) signal sequence element.
The plasmid pKG-GE3 has the following elements in this order: CMV enhancer, EF1a promoter, the specific fusion gene, WPRE sequence element, 3' LTR sequence element, bGH poly (A) signal sequence element.
In the specific fusion protein, two nuclear localization signals at the upstream of the Cas9 protein are SV40 nuclear localization signals, and two nuclear localization signals at the downstream of the Cas9 protein are nucleoplasin nuclear localization signals.
In the specific fusion protein, the fluorescent reporter protein can be EGFP protein.
In the specific fusion protein, the resistance screening marker protein can be a Puromycin protein.
The amino acid sequence of the self-cleaving polypeptide P2A is "ATNFSLLKQAGDVEENPGP" (the cleavage site where self-cleavage occurs is between the first amino acid residue and the second amino acid residue from the C-terminus).
The amino acid sequence of the self-cleaving polypeptide T2A is "EGRGSLLTCGDVEENPGP" (the cleavage site where self-cleavage occurs is between the first amino acid residue and the second amino acid residue from the C-terminus).
Specific fusion genes are specifically shown as SEQ ID NO:2 from nucleotide numbers 911-6706.
CMV enhancer as set forth in SEQ ID NO:2 from nucleotide 395 to 680.
The EF1a promoter is shown in SEQ ID NO:2 from nucleotide 682 to nucleotide 890.
WPRE sequence element is shown as SEQ ID NO:2 from nucleotide 6722 to nucleotide 7310.
The 3' LTR sequence element is shown in SEQ ID NO:2 from nucleotide 7382 to nucleotide 7615.
The bGH poly (A) signal sequence element is shown as SEQ ID NO:2 from nucleotide 7647 to nucleotide 7871.
Plasmid pKG-GE3 is specifically shown in SEQ ID NO: 2.
Plasmid pKG-U6gRNA has the sequence of SEQ ID NO:3 from nucleotide 2280 to nucleotide 2637.
The plasmid pKG-U6gRNA is specifically shown as SEQ ID NO: 3.
Pig RAG1 gene information: coding recombination-activating protein 1; is located on chromosome 2; geneID is 397506,Sus scrofa. The protein coded by the pig RAG1 gene is shown as SEQ ID NO: 4. In genomic DNA, the pig RAG1 gene has 2 exons, wherein the 2 nd exon sequence is shown in SEQ ID NO: shown at 5.
Pig RAG2 gene information: coding recombination-activating protein 2; is located on chromosome 2; geneID is 100151744,Sus scrofa. The protein coded by the pig RAG2 gene is shown as SEQ ID NO: shown at 10. In the genome DNA, the pig RAG2 gene has 2 exons, wherein the 2 nd exon and 500bp sequences of the 2 nd exon and the upstream and downstream thereof are shown in SEQ ID NO: 11.
Porcine IL2RG gene information: encoding an interleukin 2receptor subunit gamma; located on the X chromosome; geneID is 397156,Sus scrofa. The protein coded by the pig IL2RG gene is shown as SEQ ID NO: shown at 16. In the genome DNA, the pig IL2RG gene has 9 exons, wherein the 4 th exon and 500bp sequences of the 4 th exon and the upstream and downstream thereof are shown in SEQ ID NO: shown at 17.
Porcine PRKDC gene information: encoding DNA-dependent protein kinase catalytic subunit; chromosome 4; geneID is 100156379,Sus scrofa. The protein coded by the PRKDC gene of the pig is shown as SEQ ID NO: shown at 27. In the genome DNA, the PRKDC gene of the pig has 86 exons, wherein the 18 th exon and 500bp sequences of the 18 th exon and the upstream and downstream thereof are shown in SEQ ID NO: 28.
Any of the above immunodeficiency may be specifically a severe immunodeficiency.
The invention can be used for obtaining the severe immunodeficiency pig model by a gene editing means, is used for carrying out researches such as drug screening, drug effect detection, disease pathology, gene therapy and cell therapy, can provide effective experimental data for further clinical application, and lays a solid foundation for curing the severe immunodeficiency of human in the future.
Compared with the prior art, the invention has at least the following beneficial effects:
(1) The subject (pig) of the invention has better applicability than other animals (rats, mice, primates). No model of Dunaliella muscular dystrophy disease is currently being successfully developed in any large animal. Rodents such as rats and mice have great differences from humans in terms of body type, organ size, physiology, pathology and the like, and cannot truly simulate normal physiological and pathological states of humans. Studies have shown that more than 95% of drugs that are validated in mice are ineffective in human clinical trials. In the case of large animals, primates are animals with the closest relationship to humans, but are small in size, late in sexual maturity (mating begins at 6-7 years old), and single animals, the population expansion rate is extremely slow, and the raising cost is also high. In addition, primate cloning is inefficient, difficult and costly. The pig is an animal which has the closest relationship with human except primate, and has the similar body shape, weight, organ size and the like as human, and has the similar anatomy, physiology, nutrition metabolism, disease pathogenesis and the like as human. Meanwhile, the pig has early sexual maturity (4-6 months), high fertility and multiple fetuses in one litter, and can form a larger group within 2-3 years. In addition, the cloning technology of pigs is very mature, and the cloning and feeding cost is much lower than that of primates; and pigs are taken as meat animals of human beings for a long time, and the resistance of the pigs taken as disease model animals in animal protection, ethics and the like is relatively small.
(2) The cas9 high-efficiency expression vector modified by the invention is adopted for gene editing, and the editing efficiency is obviously improved compared with the original vector.
The invention lays a solid foundation for the preparation of the severe immunodeficiency pig model, and has great application value for the research and development of severe immunodeficiency medicines.
Drawings
FIG. 1 is a schematic diagram of the structure of plasmid pX 330.
FIG. 2 is a schematic diagram of the structure of plasmid pKG-GE 3.
FIG. 3 is a schematic diagram of the structure of plasmid pKG-U6 gRNA.
FIG. 4 is a schematic representation of the insertion of a DNA molecule of about 20bp (target sequence binding region for transcription to form gRNA) into plasmid pKG-U6 gRNA.
FIG. 5 is an electrophoretogram of three groups of MSTN in step three of example 2.
FIG. 6 is an electrophoretogram of three sets of FNDC5 in step three of example 2.
FIG. 7 is an electrophoretogram of example 3 after PCR amplification using 8 pig genomic DNAs as templates and primer sets of RAG1-GT-F4699/RAG 1-GT-R5306.
FIG. 8 shows various double-stranded DNA molecules having cohesive ends in step three of example 3.
FIG. 9 is a plot of sequencing peaks in step four of example 3.
FIG. 10 is an electrophoretogram of example 4 after PCR amplification using 8 pig genomic DNAs as templates and primer pairs consisting of RAG2-GT-F4181/RAG 2-GT-R4927.
FIG. 11 shows various double-stranded DNA molecules having cohesive ends in step three of example 4.
FIG. 12 is a plot of sequencing peaks in step four of example 4.
FIG. 13 is an electrophoretogram of example 5 after PCR amplification using 8 pig genomic DNAs as templates and a primer set of IL2RG-GT-F4543/IL2 RG-GT-R5180.
FIG. 14 shows various double-stranded DNA molecules having cohesive ends in step three of example 5.
FIG. 15 is a plot of sequencing peaks in step four of example 5.
FIG. 16 is an electrophoretogram of example 6 after PCR amplification using 8 pig genomic DNA as a template and a primer set consisting of PRKDC-nF7/PRKDC-nR 358.
FIG. 17 shows various double-stranded DNA molecules having cohesive ends in step three of example 6.
FIG. 18 is a plot of sequencing peaks in step four of example 6.
FIG. 19 is an electrophoresis chart of target gene PCR products of the monoclonal cells obtained in example 7 (using a primer pair consisting of RAG1-nF126/RAG1-nR 525).
FIG. 20 is an electrophoresis chart of target gene PCR products of the monoclonal cells obtained in example 7 (primer set consisting of RAG2-nF138/RAG2-nR600 was used).
FIG. 21 is an electrophoresis chart of the target gene PCR products of the monoclonal cells obtained in example 7 (using a primer set consisting of IL2RG-nF33/IL2RG-nR 460).
FIG. 22 is an electrophoresis chart of target gene PCR products of the monoclonal cells obtained in example 7 (primer set consisting of PRKDC-nF7/PRKDC-nR358 was used).
FIG. 23 is a graph showing the peak sequencing of the target gene of a part of the monoclonal cells in Table 1.
FIG. 24 is a graph showing the peak sequencing of target genes of a part of the monoclonal cells in Table 2.
FIG. 25 is a graph showing the peak sequencing of the target gene of a part of the monoclonal cells in Table 3.
FIG. 26 is a graph showing the peak sequencing of the target gene of a part of the monoclonal cells in Table 4.
Detailed Description
The following detailed description of the invention is provided in connection with the accompanying drawings that are presented to illustrate the invention and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the invention in any way.
The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified. Unless otherwise indicated, the quantitative tests in the examples below were all performed in triplicate, and the results averaged. Complete culture solution (% by volume): 15% fetal bovine serum (Gibco) +83% DMEM medium (Gibco) +1% Penicillin-Streptomycin (Gibco) +1% HEPES (Solarbio). Cell culture conditions: 37 ℃,5% CO 2 、5％O 2 Is a constant temperature incubator.
8 pigs in examples 3 to 6 were all from the birth river of the fragrant pigs, of which 4 females (named 1, 2, 3, 4 respectively) and 4 males (named A, B, C, D respectively) were female.
A method of preparing porcine primary fibroblasts: (1) taking 0.5g of pig ear tissue, removing hair, soaking in 75% alcohol for 30-40s, washing with PBS buffer solution containing 5% (volume ratio) Penicillin-Streptomycin (Gibco) for 5 times, and washing with PBS buffer solution for one time; (2) shearing the tissue with scissors, digesting with 5mL 1% collagenase solution (Sigma) at 37deg.C for 1h, centrifuging 500g for 5min, and discarding the supernatant; (3) the pellet was resuspended in 1mL of complete medium, then plated into a 9cm diameter cell culture dish containing 10mL of complete medium and capped with 0.2% gelatin (VWR), and cultured until the cells grew to about 60% of the bottom of the dish; (4) after step (3) is completed, cells are digested with trypsin and collected, and frozen using cell frozen stock (90% complete medium+10% dmso, volume ratio).
The porcine primary fibroblasts used in examples 2 to 7 were obtained from the above-described swine designated 2 (female, blood group AO).
Example 1 preparation of plasmids
Preparing a plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9, as shown in SEQ ID NO: 1. Plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9, abbreviated as plasmid pX330.
Preparing a plasmid pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO, and performing the following steps: 2. Plasmid pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO, abbreviated as plasmid pKG-GE3.
Plasmid pKG-U6gRNA was prepared as shown in SEQ ID NO: 3.
Plasmid pX330, plasmid pKG-GE3, plasmid pKG-U6gRNA are all circular plasmids.
The schematic structure of plasmid pX330 is shown in fig. 1.SEQ ID NO:1, nucleotides 440-725 constitute the CMV enhancer, nucleotides 727-1208 constitute the chicken β -actin promoter, nucleotides 1304-1324 encode the SV40 Nuclear Localization Signal (NLS), nucleotides 1325-5449 encode the Cas9 protein, and nucleotides 5450-5497 encode the nucleoplasin Nuclear Localization Signal (NLS).
The schematic structure of plasmid pKG-GE3 is shown in FIG. 2.SEQ ID NO:2, nucleotides 395 to 680 comprising the CMV enhancer, nucleotides 682 to 890 comprising the EF1a promoter, nucleotides 986 to 1006 comprising the Nuclear Localization Signal (NLS), nucleotides 1016 to 1036 comprising the Nuclear Localization Signal (NLS), nucleotides 1037 to 5161 comprising the Cas9 protein, nucleotides 5162 to 5209 comprising the Nuclear Localization Signal (NLS), nucleotides 5219 to 5266 comprising the Nuclear Localization Signal (NLS), nucleotides 5276 to 5332 comprising the self-cleaving polypeptide P2A (the amino acid sequence of the self-cleaving polypeptide P2A is "ATNFSLLKQAGDVEENPGP", the cleavage site for the self-cleaving is between the first amino acid residue and the second amino acid residue from the C-terminus), nucleotide numbers 5333-6046 encode EGFP protein, nucleotide numbers 6056-6109 encode self-cleaving polypeptide T2A (the amino acid sequence of self-cleaving polypeptide T2A is EGRGSLLTCGDVEENPGP, the cleavage site where self-cleavage occurs is between the first amino acid residue and the second amino acid residue from the C-terminus), nucleotide numbers 6110-6703 encode Puromycin protein (called Puro protein for short), nucleotide numbers 6722-7310 constitute WPRE sequence element, nucleotide numbers 7382-7615 constitute 3' LTR sequence element, and nucleotide numbers 7647-7871 constitute bGH poly (A) signal sequence element. SEQ ID NO:2, 911-6706 form a fusion gene, expressing a fusion protein. Due to the presence of self-cleaving polypeptide P2A and self-cleaving polypeptide T2A, the fusion protein spontaneously forms three proteins: proteins with Cas9 protein, proteins with EGFP protein, and proteins with Puro protein.
Compared with plasmid pX330, plasmid pKG-GE3 was mainly modified as follows: (1) removing residual gRNA backbone sequences (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTTT), reducing interference; (2) the original chicken beta-actin promoter is modified into an EF1a promoter with higher expression activity, so that the protein expression capacity of the Cas9 gene is increased; (3) adding nuclear localization signal coding genes (NLS) at the upstream and downstream of the Cas9 gene, and increasing the nuclear localization capability of the Cas9 protein; (4) the original plasmid has no eukaryotic cell screening mark, is not beneficial to screening and enrichment of positive transformed cells, and is sequentially inserted with P2A-EGFP-T2A-PURO coding genes at the downstream of Cas9 genes, so that the carrier fluorescence and eukaryotic cell resistance screening capability are endowed; (5) the insertion of the WPRE element and the 3' ltr sequence element enhances the protein translation capacity of the Cas9 gene.
The schematic structure of plasmid pKG-U6gRNA is shown in FIG. 3.SEQ ID NO:3, nucleotides 2280 to 2539 constitute the hU6 promoter and nucleotides 2558 to 2637 are used for transcription to form the gRNA backbone. When in use, a DNA molecule (target sequence binding region for transcription to form gRNA) of about 20bp is inserted into plasmid pKG-U6gRNA to form a recombinant plasmid, the schematic diagram is shown in FIG. 4, and the recombinant plasmid is transcribed in cells to obtain gRNA.
Example 2 comparison of the effects of plasmid pX330 and plasmid pKG-GE3
Two gRNA targets located at the MSTN gene were selected:
target of MSTN-gRNA 1: 5'-GCTGATTGTTGCTGGTCCCG-3';
target of MSTN-gRNA 2: 5'-TTTCCAGGCGAAGTTTACTG-3'.
Two gRNA targets located at the FNDC5 gene were selected:
target for FNDC5-gRNA 1: 5'-TGTACTCAGTGTCCTCCTCC-3';
target for FNDC5-gRNA 2: 5'-GCTCTTCAAGACGCCTCGCG-3'.
Primers used to amplify fragments containing the target were:
MSTN-F896：5’-TCTCTCAGACAGTGCAGGCATTA-3’；
MSTN-R1351：5’-CGTTTCCGTCGTAGCGTGATAAT-3’。
FNDC5-F209：5’-CAGTTCTCACTTGATGGCCTTGG-3’；
FNDC5-R718：5’-AGGGGTCTGGGGAGGAATGG-3’。
1. preparation of recombinant plasmids
Plasmid pKG-U6gRNA was taken and digested with restriction enzyme BbsI, and the vector backbone (about 3kb linear fragment) was recovered.
MSTN-1S and MSTN-1A were synthesized separately, and then mixed and annealed to obtain double-stranded DNA molecules having cohesive ends. The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (MSTN-1).
MSTN-2S and MSTN-2A were synthesized separately, and then mixed and annealed to obtain double-stranded DNA molecules having cohesive ends. The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (MSTN-2).
FNDC5-1S and FNDC5-1A were synthesized separately, and then mixed and annealed to obtain double-stranded DNA molecules having cohesive ends. The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (FNDC 5-1).
FNDC5-2S and FNDC5-2A were synthesized separately, and then mixed and annealed to obtain double-stranded DNA molecules having cohesive ends. The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (FNDC 5-2).
MSTN-1S：5’-caccGCTGATTGTTGCTGGTCCCG-3’；
MSTN-1A：5’-aaacCGGGACCAGCAACAATCAGC-3’。
MSTN-2S：5’-caccgTTTCCAGGCGAAGTTTACTG-3’；
MSTN-2A：5’-aaacCAGTAAACTTCGCCTGGAAAc-3’。
FNDC5-1S：5’-caccgTGTACTCAGTGTCCTCCTCC-3’；
FNDC5-1A：5’-aaacGGAGGAGGACACTGAGTACAc-3’。
FNDC5-2S：5’-caccGCTCTTCAAGACGCCTCGCG-3’；
FNDC5-2A：5’-aaacCGCGAGGCGTCTTGAAGAGC-3’。
2. Comparison of the effects of plasmid pX330 and plasmid pKG-GE3
1. Co-transfection
MSTN-B group: plasmid pKG-U6gRNA (MSTN-1) and plasmid pKG-U6gRNA (MSTN-2) were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.46. Mu.g of plasmid pKG-U6gRNA (MSTN-1): 0.46. Mu.g of plasmid pKG-U6gRNA (MSTN-2).
MSTN-330 group: plasmid pKG-U6gRNA (MSTN-1), plasmid pKG-U6gRNA (MSTN-2) and plasmid pX330 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.46. Mu.g of plasmid pKG-U6gRNA (MSTN-1): 0.46. Mu.g of plasmid pKG-U6gRNA (MSTN-2): 1.08 μg of plasmid pX330.
MSTN-KG group: the plasmid pKG-U6gRNA (MSTN-1), plasmid pKG-U6gRNA (MSTN-2) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.46. Mu.g of plasmid pKG-U6gRNA (MSTN-1): plasmid 0.46. Mu.g pKG-U6gRNA (MSTN-2): 1.08 μg of plasmid pKG-GE3.
FNDC5-B group: the plasmid pKG-U6gRNA (FNDC 5-1) and the plasmid pKG-U6gRNA (FNDC 5-2) were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.46. Mu.g of plasmid pKG-U6gRNA (FNDC 5-1): 0.46. Mu.g of plasmid pKG-U6gRNA (FNDC 5-2).
FNDC5-330 group: the plasmid pKG-U6gRNA (FNDC 5-1), plasmid pKG-U6gRNA (FNDC 5-2) and plasmid pX330 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.46. Mu.g of plasmid pKG-U6gRNA (FNDC 5-1): 0.46. Mu.g of plasmid pKG-U6gRNA (FNDC 5-2): 1.08 μg of plasmid pX330.
FNDC5-KG group: the plasmid pKG-U6gRNA (FNDC 5-1), plasmid pKG-U6gRNA (FNDC 5-2) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.46. Mu.g of plasmid pKG-U6gRNA (FNDC 5-1): 0.46. Mu.g of plasmid pKG-U6gRNA (FNDC 5-2): 1.08 μg of plasmid pKG-GE3.
Co-transfection was performed by electric shock transfection using a mammalian nuclear transfection kit (Neon kit, thermofiser) and a Neon TM transfection system electrotransfection apparatus (parameters set to 1450V, 10ms, 3 pulses).
2. After the step 1 is completed, the culture is carried out for 16 to 18 hours by adopting the complete culture solution, and then the culture is carried out by replacing the new complete culture solution. The total incubation time was 48 hours.
3. After step 2 was completed, cells were digested with trypsin and collected, genomic DNA was extracted, PCR amplification was performed using a primer pair (three sets of MSTN) composed of MSTN-F896 and MSTN-R1351, or PCR amplification was performed using a primer pair (three sets of FNDC 5) composed of FNDC5-F209 and FNDC5-R718, followed by electrophoresis.
The results of three groups of MSTNs are shown in FIG. 5.
The results of three groups of FNDC5 are shown in FIG. 6.
The deletion mutation efficiency of the MSTN-330 group gene is 27.6%, and the deletion mutation efficiency of the MSTN-KG group gene is 86.5%. The deletion mutation efficiency of the gene of the FNDC5-330 group is 18.6%, and the deletion mutation efficiency of the gene of the FNDC5-KG group is 81.7%. The results show that the use of plasmid pKG-GE3 results in a significant increase in gene editing efficiency compared to the use of plasmid pX 330.
Example 3 screening of target sites for RAG1 Gene knockout
1. RAG1 gene knockout preset target spot and adjacent genome sequence conservation analysis
Pig RAG1 gene information: coding recombination-activating protein 1; is located on chromosome 2; geneID is 397506,Sus scrofa. The protein coded by the pig RAG1 gene is shown as SEQ ID NO: 4. In genomic DNA, the pig RAG1 gene has 2 exons, wherein the 2 nd exon sequence is shown in SEQ ID NO: shown at 5.
The PCR amplification was performed using 8 pig genomic DNAs as templates, respectively, using primer pairs consisting of primers RAG1-GT-F4699/RAG1-GT-R5306, followed by electrophoresis, see FIG. 7. And (3) recovering PCR amplification products, sequencing, and comparing the sequencing results with RAG1 gene sequences in a public database for analysis. Based on the results of the alignment, primers for detecting the mutation (the primers themselves avoid possible mutation sites) were designed. The primers designed for mutation detection were: RAG1-nF126/RAG1-nR525.
RAG1-GT-F4699：5’-CACCTGAAAAGGCTCAAACGGAA-3’；
RAG1-GT-R5306：5’-CGCTCGGTCAATCACAGTTTTGA-3’；
RAG1-nF126：5’-CCCCATCCAAAGTTTTTAAAGGA-3’；
RAG1-nR525：5’-TGTGGCAGATGTCACAGTTTAGG-3’。
2. Screening target
A plurality of targets are initially screened by screening NGG (avoiding possible mutation sites), and 4 targets are further screened from the targets through preliminary experiments.
The 4 targets were as follows:
sgRNA RAG1-g1 target point: 5'-GGGAATTCTTTCAACACCAC-3';
sgRNA RAG1-g2 target point: 5'-AGAGAAGGTATCCAGTCCAC-3';
sgRNA RAG1-g3 target point: 5'-AATGAGGTCTGGCCAGGACG-3';
sgRNA RAG1-g4 target point: 5'-AGTTATGGCAGAACTCAGTG-3'.
3. Preparation of recombinant plasmids
Plasmid pKG-U6gRNA was taken and digested with restriction enzyme BbsI, and the vector backbone (about 3kb linear fragment) was recovered.
RAG1-g1S and RAG1-g1A were synthesized separately, and then mixed and annealed to give a double-stranded DNA molecule having cohesive ends (FIG. 8A). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to obtain plasmid pKG-U6gRNA (RAG 1-g 1). Plasmid pKG-U6gRNA (RAG 1-g 1) expresses the sequence of SEQ ID NO: 6. SgRNA as shown in FIG. 6 RAG1-g1 。
SEQ ID NO：6：
GGGAAUUCUUUCAACACCACguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
RAG1-g2S and RAG1-g2A were synthesized separately, and then mixed and annealed to give a double-stranded DNA molecule having cohesive ends (FIG. 8B). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (RAG 1-g 2). Plasmid pKG-U6gRNA (RAG 1-g 2) expresses the sequence of SEQ ID NO: 7. SgRNA RAG1-g2 。
SEQ ID NO：7：
AGAGAAGGUAUCCAGUCCACguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
RAG1-g3S and RAG1-g3A were synthesized separately, and then mixed and annealed to give a double-stranded DNA molecule having cohesive ends (FIG. 8C). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (RAG 1-g 3). Plasmid pKG-U6gRNA (RAG 1-g 3) expresses the sequence of SEQ ID NO:8, sgRNA shown in FIG. 8 RAG1-g3 。
SEQ ID NO：8：
AAUGAGGUCUGGCCAGGACGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
RAG1-g4S and RAG1-g4A were synthesized separately, and then mixed and annealed to give double-stranded DNA molecules having cohesive ends (FIG. 8D). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (RAG 1-g 4). Plasmid pKG-U6gRNA (RAG 1-g 4) expresses the sequence of SEQ ID NO: 9. SgRNA as shown in FIG. 9 RAG1-g4 。
SEQ ID NO：9：
AGUUAUGGCAGAACUCAGUGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
sgRNA-RAG1-1S：5’-caccGGGAATTCTTTCAACACCAC-3’；
sgRNA-RAG1-1A：5’-aaacGTGGTGTTGAAAGAATTCCc-3’。
sgRNA-RAG1-2S：5’-caccgAGAGAAGGTATCCAGTCCAC-3’；
sgRNA-RAG1-2A：5’-aaacGTGGACTGGATACCTTCTCTc-3’。
sgRNA-RAG1-3S：5’-caccgAATGAGGTCTGGCCAGGACG-3’；
sgRNA-RAG1-3A：5’-aaacCGTCCTGGCCAGACCTCATTc-3’。
sgRNA-RAG1-4S：5’-caccgAGTTATGGCAGAACTCAGTG-3’；
sgRNA-RAG1-4A：5’-aaacCACTGAGTTCTGCCATAACTc-3’。
The sgRNA-RAG1-1S, sgRNA-RAG1-1A, sgRNA-RAG1-2S, sgRNA-RAG1-2A, sgRNA-RAG1-3S, sgRNA-RAG1-3A, sgRNA-RAG1-4S, sgRNA-RAG1-4A is a single-stranded DNA molecule.
4. Editing efficiency comparison of different targets
1. Co-transfection
A first group: the plasmid pKG-U6gRNA (RAG 1-g 1) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (RAG 1-g 1): 1.238. Mu.g of plasmid pKG-GE3.
Second group: the plasmid pKG-U6gRNA (RAG 1-g 2) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (RAG 1-g 2): 1.238. Mu.g of plasmid pKG-GE3.
Third group: the plasmid pKG-U6gRNA (RAG 1-g 3) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (RAG 1-g 3): 1.238. Mu.g of plasmid pKG-GE3.
Fourth group: the plasmid pKG-U6gRNA (RAG 1-g 4) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (RAG 1-g 4): 1.238. Mu.g of plasmid pKG-GE3.
Fifth group: pig primary fibroblasts were not subjected to any transfection procedure.
Co-transfection was performed by electric shock transfection using a mammalian nuclear transfection kit (Neon kit, thermofiser) and a Neon TM transfection system electrotransfection apparatus (parameters set to 1450V, 10ms, 3 pulses).
2. After the step 1 is completed, the culture is carried out for 16 to 18 hours by adopting the complete culture solution, and then the culture is carried out by replacing the new complete culture solution. The total incubation time was 48 hours.
3. After step 2 was completed, cells were digested with trypsin and collected, genomic DNA was extracted, PCR amplification was performed using a primer set consisting of RAG1-nF126 and RAG1-nR525, followed by electrophoresis and sequencing, and the results are shown in FIG. 9.
The efficiency of editing of different targets was obtained by analyzing the sequencing peak plots using the synthetic ICE tool. The editing efficiency of the first group to the fifth group was 51%, 56%, 52%, 77%, and 0% in this order. The results showed that the fourth set of editing was most efficient, sgRNA RAG1-g4 Is an optimal target point.
Example 4 screening of target sites for RAG2 Gene knockout
1. RAG2 gene knockout preset target spot and adjacent genome sequence conservation analysis
Pig RAG2 gene information: coding recombination-activating protein 2; is located on chromosome 2; geneID is 100151744,Sus scrofa. The protein coded by the pig RAG2 gene is shown as SEQ ID NO: shown at 10. In the genome DNA, the pig RAG2 gene has 2 exons, wherein the 2 nd exon and 500bp sequences of the 2 nd exon and the upstream and downstream thereof are shown in SEQ ID NO: 11.
The PCR amplification was performed using 8 pig genomic DNAs as templates, respectively, using primer pairs consisting of primers RAG2-GT-F4181/RAG2-GT-R4927, followed by electrophoresis, see FIG. 10. And (3) recovering PCR amplification products, sequencing, and comparing the sequencing results with RAG2 gene sequences in a public database for analysis. Based on the results of the alignment, primers for detecting the mutation (the primers themselves avoid possible mutation sites) were designed. The primers designed for mutation detection were: RAG2-nF138/RAG2-nR600.
RAG2-GT-F4181：5’-CCACGTCTTAAACTTGTCCCAGC-3’；
RAG2-GT-R4927：5’-TGAGCAGAAGGGATGTATGACCG-3’；
RAG2-nnF138：5’-GGCTTTTTATGTGTGAGGGATCT-3’；
RAG2-nnR600：5’-TTGTTCTTGCAAACCACAGACAT-3’。
2. Screening target
A plurality of targets are initially screened by screening NGG (avoiding possible mutation sites), and 4 targets are further screened from the targets through preliminary experiments.
The 4 targets were as follows:
sgRNA RAG2-g1 Target point: 5'-TCACTACAGATGATAACAGT-3';
sgRNA RAG2-g2 target point: 5'-GATAACAGTTGGTAATAACA-3';
sgRNA RAG2-g3 target point: 5'-GTGCAGGCTTCAGTTTGAGA-3';
sgRNA RAG2-g4 target point: 5'-CAAGTGGCTGGGTAGCGGAG-3'.
3. Preparation of recombinant plasmids
Plasmid pKG-U6gRNA was taken and digested with restriction enzyme BbsI, and the vector backbone (about 3kb linear fragment) was recovered.
RAG2-g1S and RAG2-g1A were synthesized separately, and then mixed and annealed to give a double-stranded DNA molecule having cohesive ends (FIG. 11A). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (RAG 2-g 1). Plasmid pKG-U6gRNA (RAG 2-g 1) expresses the sequence of SEQ ID NO:12, sgRNA shown in FIG. 12 RAG2-g1 。
SEQ ID NO：12：
UCACUACAGAUGAUAACAGUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
RAG2-g2S and RAG2-g2A were synthesized separately, and then mixed and annealed to give a double-stranded DNA molecule having cohesive ends (FIG. 11B). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (RAG 2-g 2). Plasmid pKG-U6gRNA (RAG 2-g 2) expresses the sequence of SEQ ID NO:13, sgRNA shown in FIG. 13 RAG2-g2 。
SEQ ID NO：13：
GAUAACAGUUGGUAAUAACAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
RAG2-g3S and RAG2-g3A were synthesized separately, and then mixed and annealed to give double-stranded DNA molecules having cohesive ends (FIG. 11C). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (RAG 2-g 3). Plasmid pKG-U6gRNA (RAG 2-g 3) expresses the sequence of SEQ ID NO:14, sgRNA shown in FIG. 14 RAG2-g3 。
SEQ ID NO：14：
GUGCAGGCUUCAGUUUGAGAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
RAG2-g4S and RAG2-g4A were synthesized separately, and then mixed and annealed to give double-stranded DNA molecules having cohesive ends (FIG. 11D). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (RAG 2-g 4). Plasmid pKG-U6gRNA (RAG 2-g 4) expresses the sequence of SEQ ID NO:15, sgRNA shown in FIG. 15 RAG2-g4 。
SEQ ID NO：15：
CAAGUGGCUGGGUAGCGGAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
sgRNA-RAG2-1S：5’-caccgTCACTACAGATGATAACAGT-3’；
sgRNA-RAG2-1A：5’-aaacACTGTTATCATCTGTAGTGAc-3’。
sgRNA-RAG2-2S：5’-caccGATAACAGTTGGTAATAACA-3’；
sgRNA-RAG2-2A：5’-aaacTGTTATTACCAACTGTTATC-3’。
sgRNA-RAG2-3S：5’-caccGTGCAGGCTTCAGTTTGAGA-3’；
sgRNA-RAG2-3A：5’-aaacTCTCAAACTGAAGCCTGCAC-3’。
sgRNA-RAG2-4S：5’-caccgCAAGTGGCTGGGTAGCGGAG-3’；
sgRNA-RAG2-4A：5’-aaacCTCCGCTACCCAGCCACTTGc-3’。
The sgRNA-RAG2-1S, sgRNA-RAG2-1A, sgRNA-RAG2-2S, sgRNA-RAG2-2A, sgRNA-RAG2-3S, sgRNA-RAG2-3A, sgRNA-RAG2-4S, sgRNA-RAG2-4A is a single-stranded DNA molecule.
4. Editing efficiency comparison of different targets
1. Co-transfection
A first group: the plasmid pKG-U6gRNA (RAG 2-g 1) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (RAG 2-g 1): 1.238. Mu.g of plasmid pKG-GE3.
Second group: the plasmid pKG-U6gRNA (RAG 2-g 2) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (RAG 2-g 2): 1.238. Mu.g of plasmid pKG-GE3.
Third group: the plasmid pKG-U6gRNA (RAG 2-g 3) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (RAG 2-g 3): 1.238. Mu.g of plasmid pKG-GE3.
Fourth group: the plasmid pKG-U6gRNA (RAG 2-g 4) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (RAG 2-g 4): 1.238. Mu.g of plasmid pKG-GE3.
Fifth group: pig primary fibroblasts were not subjected to any transfection procedure.
Co-transfection was performed by electric shock transfection using a mammalian nuclear transfection kit (Neon kit, thermofiser) and a Neon TM transfection system electrotransfection apparatus (parameters set to 1450V, 10ms, 3 pulses).
2. After the step 1 is completed, the culture is carried out for 16 to 18 hours by adopting the complete culture solution, and then the culture is carried out by replacing the new complete culture solution. The total incubation time was 48 hours.
3. After step 2 is completed, cells are digested and collected by trypsin, genomic DNA is extracted, PCR amplification is performed by using a primer pair consisting of RAG2-nF138 and RAG2-nR600, electrophoresis is performed, and sequencing is performed, and the result is shown in FIG. 12.
The efficiency of editing of different targets was obtained by analyzing the sequencing peak plots using the synthetic ICE tool. The editing efficiencies of the first to fifth sets of different targets were 66%, 69%, 34%, 50% and 0% in this order. The results showed that the second set of editing was most efficient, sgRNA RAG2-g2 Is an optimal target point.
EXAMPLE 5 screening of targets for IL2RG Gene knockout
1. IL2RG gene knockout preset target point and adjacent genome sequence conservation analysis
Porcine IL2RG gene information: encoding an interleukin 2receptor subunit gamma; located on the X chromosome; geneID is 397156,Sus scrofa. The protein coded by the pig IL2RG gene is shown as SEQ ID NO: shown at 16. In the genome DNA, the pig IL2RG gene has 9 exons, wherein the 4 th exon and 500bp sequences of the 4 th exon and the upstream and downstream thereof are shown in SEQ ID NO: shown at 17.
The PCR amplification was performed using 8 pig genomic DNAs as templates, respectively, and primer pairs consisting of primers IL2RG-GT-F4543/IL2RG-GT-R5180, followed by electrophoresis, as shown in FIG. 13. And (3) recovering PCR amplification products, sequencing, and comparing the sequencing results with IL2RG gene sequences in a public database for analysis. Based on the results of the alignment, primers for detecting the mutation (the primers themselves avoid possible mutation sites) were designed. The primers designed for mutation detection were: IL2RG-nF33/IL2RG-nR460.
IL2RG-GT-F4543：5’-ATATAGCACAGGGGAGGGAGGAA-3’；
IL2RG-GT-R5180：5’-AGGGTGCGAAGGGTCAGATTC-3’；
IL2RG-nF33：5’-CCCAGGCTTCCCACTATATTCTC-3’；
IL2RG-nR460：5’-CCATTGGATCCCTCACTTCTTCT-3’。
2. Screening target
Several targets were initially screened by screening NGG (avoiding possible mutation sites), from which 9 targets were further screened by pre-experiments.
The 9 targets were as follows:
sgRNA IL2RG-g1 Target point: 5'-CCTGTAGTTTTAGCGTCTGT-3';
sgRNA IL2RG-g2 target point: 5'-CAACAAATGTTTGGTAGAGG-3';
sgRNA IL2RG-g3 target point: 5'-GATGATAAAGTCCAGGAGTG-3';
sgRNA IL2RG-g4 target point: 5'-CTGGACTTTATCATCATTAG-3';
sgRNA IL2RG-g5 target point: 5'-TTGTCCAGCTCCAGGACCCA-3';
sgRNA IL2RG-g6 target point: 5'-GGCCACTATCTATTCTCTGA-3';
sgRNA IL2RG-g7 target point: 5'-TCCCTTCAGAGAATAGATAG-3';
sgRNA IL2RG-g8 target point: 5'-AACATTTGTTGTCCAGCTCC-3';
sgRNA IL2RG-g9 target point: 5'-TGTCCAGCTCCAGGACCCAC-3'.
3. Preparation of recombinant plasmids
Plasmid pKG-U6gRNA was taken and digested with restriction enzyme BbsI, and the vector backbone (about 3kb linear fragment) was recovered.
IL2RG-g1S and IL2RG-g1A were synthesized separately, and then mixed and annealed to give double-stranded DNA molecules having cohesive ends (FIG. 14A). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to obtain plasmid pKG-U6gRNA (IL 2RG-g 1). Plasmid pKG-U6gRNA (IL 2RG-g 1) expresses the sequence of SEQ ID NO:18, sgRNA shown in FIG. 18 IL2RG-g1 。
SEQ ID NO：18：
CCUGUAGUUUUAGCGUCUGUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
IL2RG-g2S and IL2RG-g2A were synthesized separately, and then mixed and annealed to give double-stranded DNA molecules having cohesive ends (FIG. 14B). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to obtain plasmid pKG-U6gRNA (IL 2RG-g 2). Plasmid pKG-U6gRNA (IL 2RG-g 2) expresses the sequence of SEQ ID NO:19, sgRNA shown in FIG. 19 IL2RG-g2 。
SEQ ID NO：19：
CAACAAAUGUUUGGUAGAGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
IL2RG-g3S and IL2RG-g3A were synthesized separately, and then mixed and annealed to give double-stranded DNA molecules having cohesive ends (FIG. 14C). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to obtain plasmid pKG-U6gRNA (IL 2RG-g 3). Plasmid pKG-U6gRNA (IL 2RG-g 3) expresses the sequence of SEQ ID NO:20, sgRNA shown in FIG. 20 IL2RG-g3 。
SEQ ID NO：20：
GAUGAUAAAGUCCAGGAGUGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
IL2RG-g4S and IL2RG-g4A were synthesized separately, and then mixed and annealed to give double-stranded DNA molecules having cohesive ends (FIG. 14D). Will have a viscosityThe terminal double-stranded DNA molecule was ligated to the vector backbone to obtain plasmid pKG-U6gRNA (IL 2RG-g 4). Plasmid pKG-U6gRNA (IL 2RG-g 4) expresses the sequence of SEQ ID NO:21, sgRNA as indicated in FIG. 21 IL2RG-g4 。
SEQ ID NO：21：
CUGGACUUUAUCAUCAUUAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
IL2RG-g5S and IL2RG-g5A were synthesized separately, and then mixed and annealed to give double-stranded DNA molecules having cohesive ends (FIG. 14E). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to obtain plasmid pKG-U6gRNA (IL 2RG-g 5). Plasmid pKG-U6gRNA (IL 2RG-g 5) expresses the sequence of SEQ ID NO:22, sgrnas as shown IL2RG-g5 。
SEQ ID NO：22：
UUGUCCAGCUCCAGGACCCAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
IL2RG-g6S and IL2RG-g6A were synthesized separately, and then mixed and annealed to give double-stranded DNA molecules having cohesive ends (FIG. 14F). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to obtain plasmid pKG-U6gRNA (IL 2RG-g 6). Plasmid pKG-U6gRNA (IL 2RG-g 6) expresses the sequence of SEQ ID NO:23, sgRNA shown in FIG. 23 IL2RG-g6 。
SEQ ID NO：23：
GGCCACUAUCUAUUCUCUGAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
IL2RG-G7S and IL2RG-G7A were synthesized separately, and then mixed and annealed to give double-stranded DNA molecules having cohesive ends (FIG. 14G). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to obtain plasmid pKG-U6gRNA (IL 2RG-g 7). Plasmid pKG-U6gRNA (IL 2RG-g 7) expresses the sequence of SEQ ID NO:24, sgRNA shown in FIG. 24 IL2RG-g7 。
SEQ ID NO：24：
UCCCUUCAGAGAAUAGAUAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
IL2RG-g8S and IL2RG-g8A were synthesized separately, and then mixed and annealed to give a viscous powderA terminal double-stranded DNA molecule (fig. 14H). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to obtain plasmid pKG-U6gRNA (IL 2RG-g 8). Plasmid pKG-U6gRNA (IL 2RG-g 8) expresses the sequence of SEQ ID NO:25, sgRNA as indicated in FIG. 25 IL2RG-g8 。
SEQ ID NO：25：
AACAUUUGUUGUCCAGCUCCguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
IL2RG-g9S and IL2RG-g9A were synthesized separately, and then mixed and annealed to give double-stranded DNA molecules having cohesive ends (FIG. 14I). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to obtain plasmid pKG-U6gRNA (IL 2RG-g 9). Plasmid pKG-U6gRNA (IL 2RG-g 9) expresses the sequence of SEQ ID NO:26, sgRNA shown in FIG. 26 IL2RG-g9 。
SEQ ID NO：26：
UGUCCAGCUCCAGGACCCACguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
sgRNA-IL2RG-1S：5’-caccgCCTGTAGTTTTAGCGTCTGT-3’；
sgRNA-IL2RG-1A：5’-aaacACAGACGCTAAAACTACAGGc-3’。
sgRNA-IL2RG-2S：5’-caccgCAACAAATGTTTGGTAGAGG-3’；
sgRNA-IL2RG-2A：5’-aaacCCTCTACCAAACATTTGTTGc-3’。
sgRNA-IL2RG-3S：5’-caccGATGATAAAGTCCAGGAGTG-3’；
sgRNA-IL2RG-3A：5’-aaacCACTCCTGGACTTTATCATC-3’。
sgRNA-IL2RG-4S：5’-caccgCTGGACTTTATCATCATTAG-3’；
sgRNA-IL2RG-4A：5’-aaacCTAATGATGATAAAGTCCAGc-3’。
sgRNA-IL2RG-5S：5’-caccgTTGTCCAGCTCCAGGACCCA-3’；
sgRNA-IL2RG-5A：5’-aaacTGGGTCCTGGAGCTGGACAAc-3’。
sgRNA-IL2RG-6S：5’-caccgGGCCACTATCTATTCTCTGA-3’；
sgRNA-IL2RG-6A：5’-aaacTCAGAGAATAGATAGTGGCCc-3’。
sgRNA-IL2RG-7S：5’-caccgTCCCTTCAGAGAATAGATAG-3’；
sgRNA-IL2RG-7A：5’-aaacCTATCTATTCTCTGAAGGGAc-3’。
sgRNA-IL2RG-8S：5’-caccgAACATTTGTTGTCCAGCTCC-3’；
sgRNA-IL2RG-8A：5’-aaacGGAGCTGGACAACAAATGTTc-3’。
sgRNA-IL2RG-9S：5’-caccgTGTCCAGCTCCAGGACCCAC-3’；
sgRNA-IL2RG-9A：5’-aaacGTGGGTCCTGGAGCTGGACAc-3’。
The sgRNA-IL2RG-1S, sgRNA-IL2RG-1A, sgRNA-IL2RG-2S, sgRNA-IL2RG-2A, sgRNA-IL2RG-3S, sgRNA-IL2RG-3A, sgRNA-IL2RG-4S, sgRNA-IL2RG-4A, sgRNA-IL2RG-5S, sgRNA-IL2RG-5A, sgRNA-IL2RG-6S, sgRNA-IL2RG-6A, sgRNA-IL2RG-7S, sgRNA-IL2RG-7A, sgRNA-IL2RG-8S, sgRNA-IL2RG-8A, sgRNA-IL2RG-9S, sgRNA-IL2RG-9A are single-stranded DNA molecules.
4. Editing efficiency comparison of different targets
1. Co-transfection
A first group: the plasmid pKG-U6gRNA (IL 2RG-g 1) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (IL 2RG-g 1): 1.238. Mu.g of plasmid pKG-GE3.
Second group: the plasmid pKG-U6gRNA (IL 2RG-g 2) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (IL 2RG-g 2): 1.238. Mu.g of plasmid pKG-GE3.
Third group: the plasmid pKG-U6gRNA (IL 2RG-g 3) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (IL 2RG-g 3): 1.238. Mu.g of plasmid pKG-GE3.
Fourth group: the plasmid pKG-U6gRNA (IL 2RG-g 4) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (IL 2RG-g 4): 1.238. Mu.g of plasmid pKG-GE3.
Fifth group: the plasmid pKG-U6gRNA (IL 2RG-g 5) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (IL 2RG-g 5): 1.238. Mu.g of plasmid pKG-GE3.
Sixth group: the plasmid pKG-U6gRNA (IL 2RG-g 6) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (IL 2RG-g 6): 1.238. Mu.g of plasmid pKG-GE3.
Seventh group: the plasmid pKG-U6gRNA (IL 2RG-g 7) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (IL 2RG-g 7): 1.238. Mu.g of plasmid pKG-GE3.
Eighth group: the plasmid pKG-U6gRNA (IL 2RG-g 8) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (IL 2RG-g 8): 1.238. Mu.g of plasmid pKG-GE3.
Ninth group: the plasmid pKG-U6gRNA (IL 2RG-g 9) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (IL 2RG-g 9): 1.238. Mu.g of plasmid pKG-GE3.
Tenth group: pig primary fibroblasts were not subjected to any transfection procedure.
Co-transfection was performed by electric shock transfection using a mammalian nuclear transfection kit (Neon kit, thermofiser) and a Neon TM transfection system electrotransfection apparatus (parameters set to 1450V, 10ms, 3 pulses).
2. After the step 1 is completed, the culture is carried out for 16 to 18 hours by adopting the complete culture solution, and then the culture is carried out by replacing the new complete culture solution. The total incubation time was 48 hours.
3. After step 2 was completed, cells were digested with trypsin and collected, genomic DNA was extracted, PCR amplification was performed using a primer set consisting of IL2RG-nF33 and IL2RG-nR460, followed by electrophoresis and sequencing, and the results are shown in FIG. 15.
The efficiency of editing of different targets was obtained by analyzing the sequencing peak plots using the synthetic ICE tool. The editing efficiency of the first group to the tenth group of different targets is sequentially 1%, 0%, 3%, 5%, 0%, 46%, 65% and 18%34% and 0%. The results showed that the seventh set of editing was most efficient, sgRNA IL2RG-g7 Is an optimal target point.
EXAMPLE 6 screening of target sites for PRKDC Gene knockout
1. PRKDC gene knockout preset target point and adjacent genome sequence conservation analysis
Porcine PRKDC gene information: encoding DNA-dependent protein kinase catalytic subunit; chromosome 4; geneID is 100156379,Sus scrofa. The protein coded by the PRKDC gene of the pig is shown as SEQ ID NO: shown at 27. In the genome DNA, the PRKDC gene of the pig has 86 exons, wherein the 18 th exon and 500bp sequences of the 18 th exon and the upstream and downstream thereof are shown in SEQ ID NO: 28.
The PCR amplification was performed using 8 pig genomic DNAs as templates, respectively, using a primer pair consisting of primers PRKDC-nF7/PRKDC-nR358, followed by electrophoresis, see FIG. 16. And (3) recovering PCR amplification products, sequencing, and comparing the sequencing results with PRKDC gene sequences in a public database for analysis.
PRKDC-nF7：5’-ACCTGAAAATGCTATGTAATGGAAT-3’；
PRKDC-nF358：5’-ACACTTATACACACTCACGCAACC-3’。
2. Screening target
Several targets were initially screened by screening NGG (avoiding possible mutation sites), from which 9 targets were further screened by pre-experiments.
The 9 targets were as follows:
sgRNA PRKDC-g1 target point: 5'-GAATTATCTCATATGCAAAG-3';
sgRNA PRKDC-g2 target point: 5'-AGATAATTCTGCAGTCTACA-3';
sgRNA PRKDC-g3 target point: 5'-TTGTAGAAACCACTAATTAG-3';
sgRNA PRKDC-g4 target point: 5'-TATCTTCTTGGCATTTCTCA-3';
sgRNA PRKDC-g5 target point: 5'-CTCAAAATATTTTATCTTCT-3';
sgRNA PRKDC-g6 target point: 5'-TATGCAAAGGGGTGCAGCCA-3';
sgRNA PRKDC-g7 target point: 5'-AGAATTATCTCATATGCAAA-3';
sgRNA PRKDC-g8 target point: 5'-CAGAATTATCTCATATGCAA-3';
sgRNA PRKDC-g9 target point: 5'-ACACGGTCACCGCTAATTAG-3'.
3. Preparation of recombinant plasmids
Plasmid pKG-U6gRNA was taken and digested with restriction enzyme BbsI, and the vector backbone (about 3kb linear fragment) was recovered.
PRKDC-g1S and PRKDC-g1A were synthesized separately, and then mixed and annealed to give double-stranded DNA molecules having cohesive ends (FIG. 17A). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (PRKDC-g 1). Plasmid pKG-U6gRNA (PRKDC-g 1) expresses the sequence of SEQ ID NO:29 sgRNA as shown in FIG. 29 PRKDC-g1 。
SEQ ID NO：29：
GAAUUAUCUCAUAUGCAAAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
PRKDC-g2S and PRKDC-g2A were synthesized separately, and then mixed and annealed to give double-stranded DNA molecules having cohesive ends (FIG. 17B). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (PRKDC-g 2). Plasmid pKG-U6gRNA (PRKDC-g 2) expresses the sequence of SEQ ID NO:30, sgRNA shown in FIG. 30 PRKDC-g2 。
SEQ ID NO：30：
AGAUAAUUCUGCAGUCUACAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
PRKDC-g3S and PRKDC-g3A were synthesized separately, and then mixed and annealed to give double-stranded DNA molecules having cohesive ends (FIG. 17C). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (PRKDC-g 3). Plasmid pKG-U6gRNA (PRKDC-g 3) expressed SEQ ID NO:31 sgRNA as indicated PRKDC-g3 。
SEQ ID NO：31：
UUGUAGAAACCACUAAUUAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
PRKDC-g4S and PRKDC-g4A were synthesized separately, and then mixed and annealed to give double-stranded DNA molecules having cohesive ends (FIG. 17D). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (PRKDC-g 4). Plasmid pKG-U6gRNA (PRKDC-g 4) expresses the sequence of SEQ ID NO:32, sgRNA as shown in FIG. 32 PRKDC-g4 。
SEQ ID NO：32：
UAUCUUCUUGGCAUUUCUCAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
PRKDC-g5S and PRKDC-g5A were synthesized separately, and then mixed and annealed to give double-stranded DNA molecules having cohesive ends (FIG. 17E). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (PRKDC-g 5). Plasmid pKG-U6gRNA (PRKDC-g 5) expressed SEQ ID NO:33, sgrnas as shown in fig. 33 PRKDC-g5 。
SEQ ID NO：33：
CUCAAAAUAUUUUAUCUUCUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
PRKDC-g6S and PRKDC-g6A were synthesized separately, and then mixed and annealed to give a double-stranded DNA molecule having cohesive ends (FIG. 17F). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (PRKDC-g 6). Plasmid pKG-U6gRNA (PRKDC-g 6) expresses the sequence of SEQ ID NO:34, sgRNA as indicated in FIG. 34 PRKDC-g6 。
SEQ ID NO：34：
UAUGCAAAGGGGUGCAGCCAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
PRKDC-G7S and PRKDC-G7A were synthesized separately, and then mixed and annealed to give a double-stranded DNA molecule having cohesive ends (FIG. 17G). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (PRKDC-g 7). Plasmid pKG-U6gRNA (PRKDC-g 7) expresses the sequence of SEQ ID NO:35, sgRNA as indicated in FIG. 35 PRKDC-g7 。
SEQ ID NO：35：
AGAAUUAUCUCAUAUGCAAAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
PRKDC-g8S and PRKDC-g8A were synthesized separately, and then mixed and annealed to give double-stranded DNA molecules having cohesive ends (FIG. 17H). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (PRKDC-g 8). Plasmid pKG-U6gRNA (PRKDC-g 8) expresses the sequence of SEQ ID NO:36, sgRNA as indicated in FIG. 36 PRKDC-g8 。
SEQ ID NO：36：
CAGAAUUAUCUCAUAUGCAAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
PRKDC-g9S and PRKDC-g9A were synthesized separately, and then mixed and annealed to give a double-stranded DNA molecule having cohesive ends (FIG. 17I). The double-stranded DNA molecule having a cohesive end was ligated to the vector backbone to give plasmid pKG-U6gRNA (PRKDC-g 9). Plasmid pKG-U6gRNA (PRKDC-g 9) expressed SEQ ID NO:37, sgRNA shown in FIG PRKDC-g9 。
SEQ ID NO：37：
ACACGGUCACCGCUAAUUAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
sgRNA-PRKDC-1S：5’-caccGAATTATCTCATATGCAAAG-3’；
sgRNA-PRKDC-1A：5’-aaacCTTTGCATATGAGATAATTC-3’。
sgRNA-PRKDC-2S：5’-caccgAGATAATTCTGCAGTCTACA-3’；
sgRNA-PRKDC-2A：5’-aaacTGTAGACTGCAGAATTATCTc-3’。
sgRNA-PRKDC-3S：5’-caccgTTGTAGAAACCACTAATTAG-3’；
sgRNA-PRKDC-3A：5’-aaacCTAATTAGTGGTTTCTACAAc-3’。
sgRNA-PRKDC-4S：5’-caccgTATCTTCTTGGCATTTCTCA-3’；
sgRNA-PRKDC-4A：5’-aaacTGAGAAATGCCAAGAAGATAc-3’。
sgRNA-PRKDC-5S：5’-caccgCTCAAAATATTTTATCTTCT-3’；
sgRNA-PRKDC-5A：5’-aaacAGAAGATAAAATATTTTGAGc-3’。
sgRNA-PRKDC-6S：5’-caccgTATGCAAAGGGGTGCAGCCA-3’；
sgRNA-PRKDC-6A：5’-aaacTGGCTGCACCCCTTTGCATAc-3’。
sgRNA-PRKDC-7S：5’-caccgAGAATTATCTCATATGCAAA-3’；
sgRNA-PRKDC-7A：5’-aaacTTTGCATATGAGATAATTCTc-3’。
sgRNA-PRKDC-8S：5’-caccgCAGAATTATCTCATATGCAA-3’；
sgRNA-PRKDC-8A：5’-aaacTTGCATATGAGATAATTCTGc-3’。
sgRNA-PRKDC-9S：5’-caccgACACGGTCACCGCTAATTAG-3’；
sgRNA-PRKDC-9A：5’-aaacCTAATTAGCGGTGACCGTGTc-3’。
The sgRNA-PRKDC-1S, sgRNA-PRKDC-1A, sgRNA-PRKDC-2S, sgRNA-PRKDC-2A, sgRNA-PRKDC-3S, sgRNA-PRKDC-3A, sgRNA-PRKDC-4S, sgRNA-PRKDC-4A, sgRNA-PRKDC-5S, sgRNA-PRKDC-5A, sgRNA-PRKDC-6S, sgRNA-PRKDC-6A, sgRNA-PRKDC-7S, sgRNA-PRKDC-7A, sgRNA-PRKDC-8S, sgRNA-PRKDC-8A, sgRNA-PRKDC-9S, sgRNA-PRKDC-9A is a single-stranded DNA molecule.
4. Editing efficiency comparison of different targets
1. Co-transfection
A first group: the plasmid pKG-U6gRNA (PRKDC-g 1) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (PRKDC-g 1): 1.238. Mu.g of plasmid pKG-GE3.
Second group: the plasmid pKG-U6gRNA (PRKDC-g 2) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (PRKDC-g 2): 1.238. Mu.g of plasmid pKG-GE3.
Third group: the plasmid pKG-U6gRNA (PRKDC-g 3) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (PRKDC-g 3): 1.238. Mu.g of plasmid pKG-GE3.
Fourth group: the plasmid pKG-U6gRNA (PRKDC-g 4) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (PRKDC-g 4): 1.238. Mu.g of plasmid pKG-GE3.
Fifth group: the plasmid pKG-U6gRNA (PRKDC-g 5) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (PRKDC-g 5): 1.238. Mu.g of plasmid pKG-GE3.
Sixth group: the plasmid pKG-U6gRNA (PRKDC-g 6) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g plasmid pKG-U6gRNA (PRKDC-g 6): 1.238. Mu.g of plasmid pKG-GE3.
Seventh group: the plasmid pKG-U6gRNA (PRKDC-g 7) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (PRKDC-g 7): 1.238. Mu.g of plasmid pKG-GE3.
Eighth group: the plasmid pKG-U6gRNA (PRKDC-g 8) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (PRKDC-g 8): 1.238. Mu.g of plasmid pKG-GE3.
Ninth group: the plasmid pKG-U6gRNA (PRKDC-g 9) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.762. Mu.g of plasmid pKG-U6gRNA (PRKDC-g 9): 1.238. Mu.g of plasmid pKG-GE3.
Tenth group: pig primary fibroblasts were not subjected to any transfection procedure.
Co-transfection was performed by electric shock transfection using a mammalian nuclear transfection kit (Neon kit, thermofiser) and a Neon TM transfection system electrotransfection apparatus (parameters set to 1450V, 10ms, 3 pulses).
2. After the step 1 is completed, the culture is carried out for 16 to 18 hours by adopting the complete culture solution, and then the culture is carried out by replacing the new complete culture solution. The total incubation time was 48 hours.
3. After step 2 was completed, cells were digested with trypsin and collected, genomic DNA was extracted, PCR amplification was performed using a primer set consisting of PRKDC-nF7 and PRKDC-nR358, followed by electrophoresis and sequencing, and the results are shown in FIG. 18.
By using synthesisThe ICE tool analyzes the sequencing peak diagram to obtain the editing efficiency of different targets. The editing efficiency of the first to tenth sets of different targets was 17%, 24%, 3%, 5%, 0%, 35%, 8%, 11% and 0% in this order. The results showed that the sixth set of editing was most efficient, sgRNA PRKDC-g6 Is an optimal target point.
EXAMPLE 7 preparation of RAG1, RAG2, IL2RG and PRKDC Gene editing monoclonal cells
1. Co-transfection
The plasmid pKG-U6gRNA (RAG 1-g 4), plasmid pKG-U6gRNA (RAG 2-g 2), plasmid pKG-U6gRNA (IL 2RG-g 7), plasmid pKG-U6gRNA (PRKDC-g 6) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.34. Mu.g plasmid pKG-U6gRNA (RAG 1-g 4): 0.34. Mu.g plasmid pKG-U6gRNA (RAG 2-g 2): 0.34. Mu.g plasmid pKG-U6gRNA (IL 2RG-g 7): 0.34. Mu.g plasmid pKG-U6gRNA (PRKDC-g 6): 1.64. Mu.g of plasmid pKG-GE3.
Co-transfection was performed by electric shock transfection using a mammalian nuclear transfection kit (Neon kit, thermofiser) and a Neon TM transfection system electrotransfection apparatus (parameters set to 1450V, 10ms, 3 pulses).
2. After the step 1 is completed, the culture is carried out for 16 to 18 hours by adopting the complete culture solution, and then the culture is carried out by replacing the new complete culture solution. The total incubation time was 48 hours.
3. After completion of step 2, the cells were digested with trypsin and collected, then washed with complete medium, then resuspended with complete medium, and then each individual monoclonal was individually picked and transferred to 96-well plates (1 cell per well, 200. Mu.l of complete medium per well) and cultured for 2 weeks (new complete medium was changed every 2-3 days).
4. After completion of step 3, cells were digested with trypsin and collected (about 2/3 of the resulting cells per well were inoculated into 6-well plates filled with complete culture medium, and the remaining 1/3 were collected in 1.5mL centrifuge tubes).
5. Taking the 6-hole plate in the step 4, culturing until the cells grow to 50% plumpness, digesting and collecting the cells by trypsin, and freezing the cells by using cell freezing solution (90% complete culture medium+10% DMSO, volume ratio).
6. Taking the centrifuge tube in the step 4, taking cells, extracting genome DNA, performing PCR amplification (respectively adopting a primer pair consisting of RAG1-nF126 and RAG1-nR525, a primer pair consisting of RAG2-nF138 and RAG2-nR600, a primer pair consisting of IL2RG-nF33 and IL2RG-nR460, and a primer pair consisting of PRKDC-nF7 and PRKDC-nR 358), and then performing electrophoresis. Porcine primary fibroblasts were used as wild-type controls.
The electrophoretogram of the primer pair consisting of RAG1-nF126 and RAG1-nR525 is shown in FIG. 19.
The electrophoretogram of the primer pair consisting of RAG2-nF138 and RAG2-nR600 is shown in FIG. 20.
The electrophoretogram of the primer pair consisting of IL2RG-nF33 and IL2RG-nR460 is shown in FIG. 21.
The electrophoresis pattern of the primer pair consisting of PRKDC-nF7 and PRKDC-nR358 is shown in FIG. 22.
7. After step 6 is completed, the PCR amplification product is recovered and sequenced.
The sequencing result of the primary fibroblast of the pig is only one, and the genotype of the primary fibroblast is homozygous wild type. If there are two kinds of sequencing results of a certain monoclonal cell, one kind is consistent with the sequencing result of the primary fibroblast of the pig, the other kind is mutated (mutation comprises deletion, insertion or substitution of one or more nucleotides) compared with the sequencing result of the primary fibroblast of the pig, the genotype of the monoclonal cell is heterozygous; if the sequencing result of a certain monoclonal cell is two, compared with the sequencing result of a primary fibroblast of a pig, the mutation (the mutation comprises deletion, insertion or replacement of one or more nucleotides) is generated, and the genotype of the monoclonal cell is a double-allele different mutant type; if the sequencing result of a monoclonal cell is one and a mutation (mutation includes deletion, insertion or substitution of one or more nucleotides) is generated compared with the sequencing result of a swine primary fibroblast, the genotype of the monoclonal cell is the same mutant type of the double allele; if the sequencing result of a certain monoclonal cell is one and is consistent with the sequencing result of a primary fibroblast of a pig, the genotype of the monoclonal cell is homozygous wild type.
The editing result of the RAG1 gene is shown in Table 1. The genotypes of the monoclonal cells numbered 6, 10, 15, 38, 54, 57, 61, 68, 69, 80, 84, 94, 96, 101, 107, 109 were double allelic identical mutants. The genotypes of the monoclonal cells numbered 4, 36, 45, 50, 72, 78, 88, 98, 102 are the different mutants of the bi-allele. The genotypes of the monoclonal cells numbered 58, 105 were heterozygous. The monoclonal cells numbered 11, 13, 21, 23, 32, 42, 70, 100 all showed complex sets of peaks, and therefore, an effective sequence could not be obtained, and the genotype and specific form could not be determined, but it could be judged that gene editing occurred. The ratio of RAG1 gene-editing monoclonal cells obtained was 35/106. The sequencing peaks for exemplary RAG1 are shown in FIG. 23.
TABLE 1 detection of RAG1 Gene Using primer set consisting of RAG1-nF126 and RAG1-nR525
Figure BDA0002675441490000211
/>
Figure BDA0002675441490000221
/>
Figure BDA0002675441490000231
/>
Figure BDA0002675441490000241
The editing result of the RAG2 gene is shown in Table 2. The genotypes of the monoclonal cells numbered 6, 36, 50, 54, 69, 75, 78, 80, 84, 88, 94, 100, 101, 107 are double-allele identical mutants. The genotypes of the monoclonal cells numbered 4, 45 and 72 are the different mutants of the bi-allele. The genotypes of the monoclonal cells numbered 11 and 70 are heterozygous. The monoclonal cells numbered 10 and 13 all showed complex sets of peaks, and therefore, effective sequences could not be obtained, and genotypes and specific forms could not be determined, but it could be judged that gene editing occurred. The ratio of RAG2 gene-editing monoclonal cells obtained was 21/106. The sequencing peak diagram of exemplary RAG2 is shown in fig. 24.
TABLE 2 detection of RAG2 Gene Using primer set consisting of RAG2-nF138 and RAG2-nR600
Figure BDA0002675441490000242
/>
Figure BDA0002675441490000251
/>
Figure BDA0002675441490000261
The results of editing IL2RG gene are shown in Table 3. The genotypes of the monoclonal cells numbered 4, 6, 10, 54, 84, 88, 94, 101, 107, 109 were double allelic identical mutants. The genotypes of the monoclonal cells numbered 36, 50, 78, 93 are the different mutants of the bi-allele. The genotypes of the monoclonal cells numbered 80, 96, 98, 102 were heterozygous. The monoclonal cells numbered 13, 15, 23, 45, 52, 61, 69, 72, 75 all showed complex sets of peaks, and therefore, an effective sequence could not be obtained, and the genotype and specific form could not be determined, but it could be judged that gene editing occurred. The ratio of IL2RG gene editing monoclonal cells obtained was 27/108. Exemplary IL2RG sequencing peak diagram is shown in FIG. 25.
TABLE 3 detection of IL2RG Gene Using primer pairs consisting of IL2RG-nF33 and IL2RG-nR460
Figure BDA0002675441490000271
/>
Figure BDA0002675441490000281
/>
Figure BDA0002675441490000291
The editing result of PRKDC gene is shown in Table 4. The genotypes of the monoclonal cells numbered 4, 6, 10, 54, 84, 94, 101, 102, 109 are identical mutants of the double alleles. 36. The genotypes of the monoclonal cells 45, 50, 78 and 80 are different mutants of the double alleles. The genotypes of the monoclonal cells numbered 53, 69, 88, 107 were heterozygous. The monoclonal cells numbered 13, 15, 72, and 100 all showed complex sets of peaks, and therefore, an effective sequence could not be obtained, and the genotype and specific form could not be determined, but it could be judged that gene editing occurred. The PRKDC gene editing monoclonal cells were obtained at a ratio of 22/107. Exemplary PRKDC sequencing peaks are shown in fig. 26.
TABLE 4 Table 4
Figure BDA0002675441490000301
/>
Figure BDA0002675441490000311
/>
Figure BDA0002675441490000321
8. After step 7 is completed, monoclonal cells with RAG1, RAG2, IL2RG and PRKDC genes knocked out simultaneously are selected.
By analysis, the monoclonal cells numbered 4, 6, 10, 13, 36, 45, 50, 54, 69, 72, 78, 80, 84, 88, 94, 101, 107 were monoclonal cells from which the RAG1, RAG2, IL2RG and PRKDC genes were simultaneously knocked out.
The present invention is described in detail above. It will be apparent to those skilled in the art that the present invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with respect to specific embodiments, it will be appreciated that the invention may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.
SEQUENCE LISTING
<110> Nanjing Kidney Gene engineering Co., ltd
<120> System for preparing severe immunodeficiency pig-derived recombinant cells in which four RRIP genes are knocked out in combination
<130> GNCYX201921
<160> 37
<170> PatentIn version 3.5
<210> 1
<211> 8484
<212> DNA
<213> Artificial sequence
<400> 1
gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60
ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120
aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180
atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240
cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaaataag 300
gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttg ttttagagct 360
agaaatagca agttaaaata aggctagtcc gtttttagcg cgtgcgccaa ttctgcagac 420
aaatggctct agaggtaccc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 480
ccaacgaccc ccgcccattg acgtcaatag taacgccaat agggactttc cattgacgtc 540
aatgggtgga gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc 600
caagtacgcc ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tgtgcccagt 660
acatgacctt atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta 720
ccatggtcga ggtgagcccc acgttctgct tcactctccc catctccccc ccctccccac 780
ccccaatttt gtatttattt attttttaat tattttgtgc agcgatgggg gcgggggggg 840
ggggggggcg gggcgagggg cggggcgggg cgaggcggag aggtgcggcg gcagccaatc 900
agagcggcgc gctccgaaag tttcctttta tggcgaggcg gcggcggcgg cggccctata 960
aaaagcgaag cgcgcggcgg gcgggagtcg ctgcgcgctg ccttcgcccc gtgccccgct 1020
ccgccgccgc ctcgcgccgc ccgccccggc tctgactgac cgcgttactc ccacaggtga 1080
gcgggcggga cggcccttct cctccgggct gtaattagct gagcaagagg taagggttta 1140
agggatggtt ggttggtggg gtattaatgt ttaattacct ggagcacctg cctgaaatca 1200
ctttttttca ggttggaccg gtgccaccat ggactataag gaccacgacg gagactacaa 1260
ggatcatgat attgattaca aagacgatga cgataagatg gccccaaaga agaagcggaa 1320
ggtcggtatc cacggagtcc cagcagccga caagaagtac agcatcggcc tggacatcgg 1380
caccaactct gtgggctggg ccgtgatcac cgacgagtac aaggtgccca gcaagaaatt 1440
caaggtgctg ggcaacaccg accggcacag catcaagaag aacctgatcg gagccctgct 1500
gttcgacagc ggcgaaacag ccgaggccac ccggctgaag agaaccgcca gaagaagata 1560
caccagacgg aagaaccgga tctgctatct gcaagagatc ttcagcaacg agatggccaa 1620
ggtggacgac agcttcttcc acagactgga agagtccttc ctggtggaag aggataagaa 1680
gcacgagcgg caccccatct tcggcaacat cgtggacgag gtggcctacc acgagaagta 1740
ccccaccatc taccacctga gaaagaaact ggtggacagc accgacaagg ccgacctgcg 1800
gctgatctat ctggccctgg cccacatgat caagttccgg ggccacttcc tgatcgaggg 1860
cgacctgaac cccgacaaca gcgacgtgga caagctgttc atccagctgg tgcagaccta 1920
caaccagctg ttcgaggaaa accccatcaa cgccagcggc gtggacgcca aggccatcct 1980
gtctgccaga ctgagcaaga gcagacggct ggaaaatctg atcgcccagc tgcccggcga 2040
gaagaagaat ggcctgttcg gaaacctgat tgccctgagc ctgggcctga cccccaactt 2100
caagagcaac ttcgacctgg ccgaggatgc caaactgcag ctgagcaagg acacctacga 2160
cgacgacctg gacaacctgc tggcccagat cggcgaccag tacgccgacc tgtttctggc 2220
cgccaagaac ctgtccgacg ccatcctgct gagcgacatc ctgagagtga acaccgagat 2280
caccaaggcc cccctgagcg cctctatgat caagagatac gacgagcacc accaggacct 2340
gaccctgctg aaagctctcg tgcggcagca gctgcctgag aagtacaaag agattttctt 2400
cgaccagagc aagaacggct acgccggcta cattgacggc ggagccagcc aggaagagtt 2460
ctacaagttc atcaagccca tcctggaaaa gatggacggc accgaggaac tgctcgtgaa 2520
gctgaacaga gaggacctgc tgcggaagca gcggaccttc gacaacggca gcatccccca 2580
ccagatccac ctgggagagc tgcacgccat tctgcggcgg caggaagatt tttacccatt 2640
cctgaaggac aaccgggaaa agatcgagaa gatcctgacc ttccgcatcc cctactacgt 2700
gggccctctg gccaggggaa acagcagatt cgcctggatg accagaaaga gcgaggaaac 2760
catcaccccc tggaacttcg aggaagtggt ggacaagggc gcttccgccc agagcttcat 2820
cgagcggatg accaacttcg ataagaacct gcccaacgag aaggtgctgc ccaagcacag 2880
cctgctgtac gagtacttca ccgtgtataa cgagctgacc aaagtgaaat acgtgaccga 2940
gggaatgaga aagcccgcct tcctgagcgg cgagcagaaa aaggccatcg tggacctgct 3000
gttcaagacc aaccggaaag tgaccgtgaa gcagctgaaa gaggactact tcaagaaaat 3060
cgagtgcttc gactccgtgg aaatctccgg cgtggaagat cggttcaacg cctccctggg 3120
cacataccac gatctgctga aaattatcaa ggacaaggac ttcctggaca atgaggaaaa 3180
cgaggacatt ctggaagata tcgtgctgac cctgacactg tttgaggaca gagagatgat 3240
cgaggaacgg ctgaaaacct atgcccacct gttcgacgac aaagtgatga agcagctgaa 3300
gcggcggaga tacaccggct ggggcaggct gagccggaag ctgatcaacg gcatccggga 3360
caagcagtcc ggcaagacaa tcctggattt cctgaagtcc gacggcttcg ccaacagaaa 3420
cttcatgcag ctgatccacg acgacagcct gacctttaaa gaggacatcc agaaagccca 3480
ggtgtccggc cagggcgata gcctgcacga gcacattgcc aatctggccg gcagccccgc 3540
cattaagaag ggcatcctgc agacagtgaa ggtggtggac gagctcgtga aagtgatggg 3600
ccggcacaag cccgagaaca tcgtgatcga aatggccaga gagaaccaga ccacccagaa 3660
gggacagaag aacagccgcg agagaatgaa gcggatcgaa gagggcatca aagagctggg 3720
cagccagatc ctgaaagaac accccgtgga aaacacccag ctgcagaacg agaagctgta 3780
cctgtactac ctgcagaatg ggcgggatat gtacgtggac caggaactgg acatcaaccg 3840
gctgtccgac tacgatgtgg accatatcgt gcctcagagc tttctgaagg acgactccat 3900
cgacaacaag gtgctgacca gaagcgacaa gaaccggggc aagagcgaca acgtgccctc 3960
cgaagaggtc gtgaagaaga tgaagaacta ctggcggcag ctgctgaacg ccaagctgat 4020
tacccagaga aagttcgaca atctgaccaa ggccgagaga ggcggcctga gcgaactgga 4080
taaggccggc ttcatcaaga gacagctggt ggaaacccgg cagatcacaa agcacgtggc 4140
acagatcctg gactcccgga tgaacactaa gtacgacgag aatgacaagc tgatccggga 4200
agtgaaagtg atcaccctga agtccaagct ggtgtccgat ttccggaagg atttccagtt 4260
ttacaaagtg cgcgagatca acaactacca ccacgcccac gacgcctacc tgaacgccgt 4320
cgtgggaacc gccctgatca aaaagtaccc taagctggaa agcgagttcg tgtacggcga 4380
ctacaaggtg tacgacgtgc ggaagatgat cgccaagagc gagcaggaaa tcggcaaggc 4440
taccgccaag tacttcttct acagcaacat catgaacttt ttcaagaccg agattaccct 4500
ggccaacggc gagatccgga agcggcctct gatcgagaca aacggcgaaa ccggggagat 4560
cgtgtgggat aagggccggg attttgccac cgtgcggaaa gtgctgagca tgccccaagt 4620
gaatatcgtg aaaaagaccg aggtgcagac aggcggcttc agcaaagagt ctatcctgcc 4680
caagaggaac agcgataagc tgatcgccag aaagaaggac tgggacccta agaagtacgg 4740
cggcttcgac agccccaccg tggcctattc tgtgctggtg gtggccaaag tggaaaaggg 4800
caagtccaag aaactgaaga gtgtgaaaga gctgctgggg atcaccatca tggaaagaag 4860
cagcttcgag aagaatccca tcgactttct ggaagccaag ggctacaaag aagtgaaaaa 4920
ggacctgatc atcaagctgc ctaagtactc cctgttcgag ctggaaaacg gccggaagag 4980
aatgctggcc tctgccggcg aactgcagaa gggaaacgaa ctggccctgc cctccaaata 5040
tgtgaacttc ctgtacctgg ccagccacta tgagaagctg aagggctccc ccgaggataa 5100
tgagcagaaa cagctgtttg tggaacagca caagcactac ctggacgaga tcatcgagca 5160
gatcagcgag ttctccaaga gagtgatcct ggccgacgct aatctggaca aagtgctgtc 5220
cgcctacaac aagcaccggg ataagcccat cagagagcag gccgagaata tcatccacct 5280
gtttaccctg accaatctgg gagcccctgc cgccttcaag tactttgaca ccaccatcga 5340
ccggaagagg tacaccagca ccaaagaggt gctggacgcc accctgatcc accagagcat 5400
caccggcctg tacgagacac ggatcgacct gtctcagctg ggaggcgaca aaaggccggc 5460
ggccacgaaa aaggccggcc aggcaaaaaa gaaaaagtaa gaattcctag agctcgctga 5520
tcagcctcga ctgtgccttc tagttgccag ccatctgttg tttgcccctc ccccgtgcct 5580
tccttgaccc tggaaggtgc cactcccact gtcctttcct aataaaatga ggaaattgca 5640
tcgcattgtc tgagtaggtg tcattctatt ctggggggtg gggtggggca ggacagcaag 5700
ggggaggatt gggaagagaa tagcaggcat gctggggagc ggccgcagga acccctagtg 5760
atggagttgg ccactccctc tctgcgcgct cgctcgctca ctgaggccgg gcgaccaaag 5820
gtcgcccgac gcccgggctt tgcccgggcg gcctcagtga gcgagcgagc gcgcagctgc 5880
ctgcaggggc gcctgatgcg gtattttctc cttacgcatc tgtgcggtat ttcacaccgc 5940
atacgtcaaa gcaaccatag tacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg 6000
tggttacgcg cagcgtgacc gctacacttg ccagcgcctt agcgcccgct cctttcgctt 6060
tcttcccttc ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc 6120
tccctttagg gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgatttgg 6180
gtgatggttc acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg 6240
agtccacgtt ctttaatagt ggactcttgt tccaaactgg aacaacactc aactctatct 6300
cgggctattc ttttgattta taagggattt tgccgatttc ggtctattgg ttaaaaaatg 6360
agctgattta acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaattttat 6420
ggtgcactct cagtacaatc tgctctgatg ccgcatagtt aagccagccc cgacacccgc 6480
caacacccgc tgacgcgccc tgacgggctt gtctgctccc ggcatccgct tacagacaag 6540
ctgtgaccgt ctccgggagc tgcatgtgtc agaggttttc accgtcatca ccgaaacgcg 6600
cgagacgaaa gggcctcgtg atacgcctat ttttataggt taatgtcatg ataataatgg 6660
tttcttagac gtcaggtggc acttttcggg gaaatgtgcg cggaacccct atttgtttat 6720
ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga taaatgcttc 6780
aataatattg aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc cttattccct 6840
tttttgcggc attttgcctt cctgtttttg ctcacccaga aacgctggtg aaagtaaaag 6900
atgctgaaga tcagttgggt gcacgagtgg gttacatcga actggatctc aacagcggta 6960
agatccttga gagttttcgc cccgaagaac gttttccaat gatgagcact tttaaagttc 7020
tgctatgtgg cgcggtatta tcccgtattg acgccgggca agagcaactc ggtcgccgca 7080
tacactattc tcagaatgac ttggttgagt actcaccagt cacagaaaag catcttacgg 7140
atggcatgac agtaagagaa ttatgcagtg ctgccataac catgagtgat aacactgcgg 7200
ccaacttact tctgacaacg atcggaggac cgaaggagct aaccgctttt ttgcacaaca 7260
tgggggatca tgtaactcgc cttgatcgtt gggaaccgga gctgaatgaa gccataccaa 7320
acgacgagcg tgacaccacg atgcctgtag caatggcaac aacgttgcgc aaactattaa 7380
ctggcgaact acttactcta gcttcccggc aacaattaat agactggatg gaggcggata 7440
aagttgcagg accacttctg cgctcggccc ttccggctgg ctggtttatt gctgataaat 7500
ctggagccgg tgagcgtgga agccgcggta tcattgcagc actggggcca gatggtaagc 7560
cctcccgtat cgtagttatc tacacgacgg ggagtcaggc aactatggat gaacgaaata 7620
gacagatcgc tgagataggt gcctcactga ttaagcattg gtaactgtca gaccaagttt 7680
actcatatat actttagatt gatttaaaac ttcattttta atttaaaagg atctaggtga 7740
agatcctttt tgataatctc atgaccaaaa tcccttaacg tgagttttcg ttccactgag 7800
cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa 7860
tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg ccggatcaag 7920
agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata ccaaatactg 7980
ttcttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca ccgcctacat 8040
acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag tcgtgtctta 8100
ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc tgaacggggg 8160
gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga tacctacagc 8220
gtgagctatg agaaagcgcc acgcttcccg aagggagaaa ggcggacagg tatccggtaa 8280
gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac gcctggtatc 8340
tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg tgatgctcgt 8400
caggggggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct 8460
tttgctggcc ttttgctcac atgt 8484
<210> 2
<211> 10476
<212> DNA
<213> Artificial sequence
<400> 2
gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60
ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120
aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180
atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240
cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaaataag 300
gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttc tagcgcgtgc 360
gccaattctg cagacaaatg gctctagagg tacccgttac ataacttacg gtaaatggcc 420
cgcctggctg accgcccaac gacccccgcc cattgacgtc aatagtaacg ccaataggga 480
ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc 540
aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 600
ggcattgtgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 660
tagtcatcgc tattaccatg ggggcagagc gcacatcgcc cacagtcccc gagaagttgg 720
ggggaggggt cggcaattga tccggtgcct agagaaggtg gcgcggggta aactgggaaa 780
gtgatgtcgt gtactggctc cgcctttttc ccgagggtgg gggagaaccg tatataagtg 840
cagtagtcgc cgtgaacgtt ctttttcgca acgggtttgc cgccagaaca caggttggac 900
cggtgccacc atggactata aggaccacga cggagactac aaggatcatg atattgatta 960
caaagacgat gacgataaga tggcccccaa aaagaaacga aaggtgggtg ggtccccaaa 1020
gaagaagcgg aaggtcggta tccacggagt cccagcagcc gacaagaagt acagcatcgg 1080
cctggacatc ggcaccaact ctgtgggctg ggccgtgatc accgacgagt acaaggtgcc 1140
cagcaagaaa ttcaaggtgc tgggcaacac cgaccggcac agcatcaaga agaacctgat 1200
cggagccctg ctgttcgaca gcggcgaaac agccgaggcc acccggctga agagaaccgc 1260
cagaagaaga tacaccagac ggaagaaccg gatctgctat ctgcaagaga tcttcagcaa 1320
cgagatggcc aaggtggacg acagcttctt ccacagactg gaagagtcct tcctggtgga 1380
agaggataag aagcacgagc ggcaccccat cttcggcaac atcgtggacg aggtggccta 1440
ccacgagaag taccccacca tctaccacct gagaaagaaa ctggtggaca gcaccgacaa 1500
ggccgacctg cggctgatct atctggccct ggcccacatg atcaagttcc ggggccactt 1560
cctgatcgag ggcgacctga accccgacaa cagcgacgtg gacaagctgt tcatccagct 1620
ggtgcagacc tacaaccagc tgttcgagga aaaccccatc aacgccagcg gcgtggacgc 1680
caaggccatc ctgtctgcca gactgagcaa gagcagacgg ctggaaaatc tgatcgccca 1740
gctgcccggc gagaagaaga atggcctgtt cggaaacctg attgccctga gcctgggcct 1800
gacccccaac ttcaagagca acttcgacct ggccgaggat gccaaactgc agctgagcaa 1860
ggacacctac gacgacgacc tggacaacct gctggcccag atcggcgacc agtacgccga 1920
cctgtttctg gccgccaaga acctgtccga cgccatcctg ctgagcgaca tcctgagagt 1980
gaacaccgag atcaccaagg cccccctgag cgcctctatg atcaagagat acgacgagca 2040
ccaccaggac ctgaccctgc tgaaagctct cgtgcggcag cagctgcctg agaagtacaa 2100
agagattttc ttcgaccaga gcaagaacgg ctacgccggc tacattgacg gcggagccag 2160
ccaggaagag ttctacaagt tcatcaagcc catcctggaa aagatggacg gcaccgagga 2220
actgctcgtg aagctgaaca gagaggacct gctgcggaag cagcggacct tcgacaacgg 2280
cagcatcccc caccagatcc acctgggaga gctgcacgcc attctgcggc ggcaggaaga 2340
tttttaccca ttcctgaagg acaaccggga aaagatcgag aagatcctga ccttccgcat 2400
cccctactac gtgggccctc tggccagggg aaacagcaga ttcgcctgga tgaccagaaa 2460
gagcgaggaa accatcaccc cctggaactt cgaggaagtg gtggacaagg gcgcttccgc 2520
ccagagcttc atcgagcgga tgaccaactt cgataagaac ctgcccaacg agaaggtgct 2580
gcccaagcac agcctgctgt acgagtactt caccgtgtat aacgagctga ccaaagtgaa 2640
atacgtgacc gagggaatga gaaagcccgc cttcctgagc ggcgagcaga aaaaggccat 2700
cgtggacctg ctgttcaaga ccaaccggaa agtgaccgtg aagcagctga aagaggacta 2760
cttcaagaaa atcgagtgct tcgactccgt ggaaatctcc ggcgtggaag atcggttcaa 2820
cgcctccctg ggcacatacc acgatctgct gaaaattatc aaggacaagg acttcctgga 2880
caatgaggaa aacgaggaca ttctggaaga tatcgtgctg accctgacac tgtttgagga 2940
cagagagatg atcgaggaac ggctgaaaac ctatgcccac ctgttcgacg acaaagtgat 3000
gaagcagctg aagcggcgga gatacaccgg ctggggcagg ctgagccgga agctgatcaa 3060
cggcatccgg gacaagcagt ccggcaagac aatcctggat ttcctgaagt ccgacggctt 3120
cgccaacaga aacttcatgc agctgatcca cgacgacagc ctgaccttta aagaggacat 3180
ccagaaagcc caggtgtccg gccagggcga tagcctgcac gagcacattg ccaatctggc 3240
cggcagcccc gccattaaga agggcatcct gcagacagtg aaggtggtgg acgagctcgt 3300
gaaagtgatg ggccggcaca agcccgagaa catcgtgatc gaaatggcca gagagaacca 3360
gaccacccag aagggacaga agaacagccg cgagagaatg aagcggatcg aagagggcat 3420
caaagagctg ggcagccaga tcctgaaaga acaccccgtg gaaaacaccc agctgcagaa 3480
cgagaagctg tacctgtact acctgcagaa tgggcgggat atgtacgtgg accaggaact 3540
ggacatcaac cggctgtccg actacgatgt ggaccatatc gtgcctcaga gctttctgaa 3600
ggacgactcc atcgacaaca aggtgctgac cagaagcgac aagaaccggg gcaagagcga 3660
caacgtgccc tccgaagagg tcgtgaagaa gatgaagaac tactggcggc agctgctgaa 3720
cgccaagctg attacccaga gaaagttcga caatctgacc aaggccgaga gaggcggcct 3780
gagcgaactg gataaggccg gcttcatcaa gagacagctg gtggaaaccc ggcagatcac 3840
aaagcacgtg gcacagatcc tggactcccg gatgaacact aagtacgacg agaatgacaa 3900
gctgatccgg gaagtgaaag tgatcaccct gaagtccaag ctggtgtccg atttccggaa 3960
ggatttccag ttttacaaag tgcgcgagat caacaactac caccacgccc acgacgccta 4020
cctgaacgcc gtcgtgggaa ccgccctgat caaaaagtac cctaagctgg aaagcgagtt 4080
cgtgtacggc gactacaagg tgtacgacgt gcggaagatg atcgccaaga gcgagcagga 4140
aatcggcaag gctaccgcca agtacttctt ctacagcaac atcatgaact ttttcaagac 4200
cgagattacc ctggccaacg gcgagatccg gaagcggcct ctgatcgaga caaacggcga 4260
aaccggggag atcgtgtggg ataagggccg ggattttgcc accgtgcgga aagtgctgag 4320
catgccccaa gtgaatatcg tgaaaaagac cgaggtgcag acaggcggct tcagcaaaga 4380
gtctatcctg cccaagagga acagcgataa gctgatcgcc agaaagaagg actgggaccc 4440
taagaagtac ggcggcttcg acagccccac cgtggcctat tctgtgctgg tggtggccaa 4500
agtggaaaag ggcaagtcca agaaactgaa gagtgtgaaa gagctgctgg ggatcaccat 4560
catggaaaga agcagcttcg agaagaatcc catcgacttt ctggaagcca agggctacaa 4620
agaagtgaaa aaggacctga tcatcaagct gcctaagtac tccctgttcg agctggaaaa 4680
cggccggaag agaatgctgg cctctgccgg cgaactgcag aagggaaacg aactggccct 4740
gccctccaaa tatgtgaact tcctgtacct ggccagccac tatgagaagc tgaagggctc 4800
ccccgaggat aatgagcaga aacagctgtt tgtggaacag cacaagcact acctggacga 4860
gatcatcgag cagatcagcg agttctccaa gagagtgatc ctggccgacg ctaatctgga 4920
caaagtgctg tccgcctaca acaagcaccg ggataagccc atcagagagc aggccgagaa 4980
tatcatccac ctgtttaccc tgaccaatct gggagcccct gccgccttca agtactttga 5040
caccaccatc gaccggaaga ggtacaccag caccaaagag gtgctggacg ccaccctgat 5100
ccaccagagc atcaccggcc tgtacgagac acggatcgac ctgtctcagc tgggaggcga 5160
caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa aagaaaaagg gcggctccaa 5220
gcggcctgcc gcgacgaaga aagcgggaca ggccaagaaa aagaaaggat ccggcgcaac 5280
aaacttctct ctgctgaaac aagccggaga tgtcgaagag aatcctggac cggtgagcaa 5340
gggcgaggag ctgttcaccg gggtggtgcc catcctggtc gagctggacg gcgacgtaaa 5400
cggccacaag ttcagcgtgt ccggcgaggg cgagggcgat gccacctacg gcaagctgac 5460
cctgaagttc atctgcacca ccggcaagct gcccgtgccc tggcccaccc tcgtgaccac 5520
cctgacctac ggcgtgcagt gcttcagccg ctaccccgac cacatgaagc agcacgactt 5580
cttcaagtcc gccatgcccg aaggctacgt ccaggagcgc accatcttct tcaaggacga 5640
cggcaactac aagacccgcg ccgaggtgaa gttcgagggc gacaccctgg tgaaccgcat 5700
cgagctgaag ggcatcgact tcaaggagga cggcaacatc ctggggcaca agctggagta 5760
caactacaac agccacaacg tctatatcat ggccgacaag cagaagaacg gcatcaaggt 5820
gaacttcaag atccgccaca acatcgagga cggcagcgtg cagctcgccg accactacca 5880
gcagaacacc cccatcggcg acggccccgt gctgctgccc gacaaccact acctgagcac 5940
ccagtccgcc ctgagcaaag accccaacga gaagcgcgat cacatggtcc tgctggagtt 6000
cgtgaccgcc gccgggatca ctctcggcat ggacgagctg tacaagggct ccggcgaggg 6060
caggggaagt cttctaacat gcggggacgt ggaggaaaat cccggcccaa ccgagtacaa 6120
gcccacggtg cgcctcgcca cccgcgacga cgtccccagg gccgtacgca ccctcgccgc 6180
cgcgttcgcc gactaccccg ccacgcgcca caccgtcgat ccggaccgcc acatcgagcg 6240
ggtcaccgag ctgcaagaac tcttcctcac gcgcgtcggg ctcgacatcg gcaaggtgtg 6300
ggtcgcggac gacggcgccg cggtggcggt ctggaccacg ccggagagcg tcgaagcggg 6360
ggcggtgttc gccgagatcg gcccgcgcat ggccgagttg agcggttccc ggctggccgc 6420
gcagcaacag atggaaggcc tcctggcgcc gcaccggccc aaggagcccg cgtggttcct 6480
ggccaccgtc ggagtctcgc ccgaccacca gggcaagggt ctgggcagcg ccgtcgtgct 6540
ccccggagtg gaggcggccg agcgcgccgg ggtgcccgcc ttcctggaga cctccgcgcc 6600
ccgcaacctc cccttctacg agcggctcgg cttcaccgtc accgccgacg tcgaggtgcc 6660
cgaaggaccg cgcacctggt gcatgacccg caagcccggt gcctgaacgc gttaagtcga 6720
caatcaacct ctggattaca aaatttgtga aagattgact ggtattctta actatgttgc 6780
tccttttacg ctatgtggat acgctgcttt aatgcctttg tatcatgcta ttgcttcccg 6840
tatggctttc attttctcct ccttgtataa atcctggttg ctgtctcttt atgaggagtt 6900
gtggcccgtt gtcaggcaac gtggcgtggt gtgcactgtg tttgctgacg caacccccac 6960
tggttggggc attgccacca cctgtcagct cctttccggg actttcgctt tccccctccc 7020
tattgccacg gcggaactca tcgccgcctg ccttgcccgc tgctggacag gggctcggct 7080
gttgggcact gacaattccg tggtgttgtc ggggaaatca tcgtcctttc cttggctgct 7140
cgcctgtgtt gccacctgga ttctgcgcgg gacgtccttc tgctacgtcc cttcggccct 7200
caatccagcg gaccttcctt cccgcggcct gctgccggct ctgcggcctc ttccgcgtct 7260
tcgccttcgc cctcagacga gtcggatctc cctttgggcc gcctccccgc gtcgacttta 7320
agaccaatga cttacaaggc agctgtagat cttagccact ttttaaaaga aaagggggga 7380
ctggaagggc taattcactc ccaacgaaga caagatctgc tttttgcttg tactgggtct 7440
ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt 7500
aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac 7560
tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagggcc 7620
cgtttaaacc cgctgatcag cctcgactgt gccttctagt tgccagccat ctgttgtttg 7680
cccctccccc gtgccttcct tgaccctgga aggtgccact cccactgtcc tttcctaata 7740
aaatgaggaa attgcatcgc attgtctgag taggtgtcat tctattctgg ggggtggggt 7800
ggggcaggac agcaaggggg aggattggga agacaatagc aggcatgctg gggatgcggt 7860
gggctctatg gcctgcaggg gcgcctgatg cggtattttc tccttacgca tctgtgcggt 7920
atttcacacc gcatacgtca aagcaaccat agtacgcgcc ctgtagcggc gcattaagcg 7980
cggcgggtgt ggtggttacg cgcagcgtga ccgctacact tgccagcgcc ttagcgcccg 8040
ctcctttcgc tttcttccct tcctttctcg ccacgttcgc cggctttccc cgtcaagctc 8100
taaatcgggg gctcccttta gggttccgat ttagtgcttt acggcacctc gaccccaaaa 8160
aacttgattt gggtgatggt tcacgtagtg ggccatcgcc ctgatagacg gtttttcgcc 8220
ctttgacgtt ggagtccacg ttctttaata gtggactctt gttccaaact ggaacaacac 8280
tcaactctat ctcgggctat tcttttgatt tataagggat tttgccgatt tcggtctatt 8340
ggttaaaaaa tgagctgatt taacaaaaat ttaacgcgaa ttttaacaaa atattaacgt 8400
ttacaatttt atggtgcact ctcagtacaa tctgctctga tgccgcatag ttaagccagc 8460
cccgacaccc gccaacaccc gctgacgcgc cctgacgggc ttgtctgctc ccggcatccg 8520
cttacagaca agctgtgacc gtctccggga gctgcatgtg tcagaggttt tcaccgtcat 8580
caccgaaacg cgcgagacga aagggcctcg tgatacgcct atttttatag gttaatgtca 8640
tgataataat ggtttcttag acgtcaggtg gcacttttcg gggaaatgtg cgcggaaccc 8700
ctatttgttt atttttctaa atacattcaa atatgtatcc gctcatgaga caataaccct 8760
gataaatgct tcaataatat tgaaaaagga agagtatgag tattcaacat ttccgtgtcg 8820
cccttattcc cttttttgcg gcattttgcc ttcctgtttt tgctcaccca gaaacgctgg 8880
tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt gggttacatc gaactggatc 8940
tcaacagcgg taagatcctt gagagttttc gccccgaaga acgttttcca atgatgagca 9000
cttttaaagt tctgctatgt ggcgcggtat tatcccgtat tgacgccggg caagagcaac 9060
tcggtcgccg catacactat tctcagaatg acttggttga gtactcacca gtcacagaaa 9120
agcatcttac ggatggcatg acagtaagag aattatgcag tgctgccata accatgagtg 9180
ataacactgc ggccaactta cttctgacaa cgatcggagg accgaaggag ctaaccgctt 9240
ttttgcacaa catgggggat catgtaactc gccttgatcg ttgggaaccg gagctgaatg 9300
aagccatacc aaacgacgag cgtgacacca cgatgcctgt agcaatggca acaacgttgc 9360
gcaaactatt aactggcgaa ctacttactc tagcttcccg gcaacaatta atagactgga 9420
tggaggcgga taaagttgca ggaccacttc tgcgctcggc ccttccggct ggctggttta 9480
ttgctgataa atctggagcc ggtgagcgtg gaagccgcgg tatcattgca gcactggggc 9540
cagatggtaa gccctcccgt atcgtagtta tctacacgac ggggagtcag gcaactatgg 9600
atgaacgaaa tagacagatc gctgagatag gtgcctcact gattaagcat tggtaactgt 9660
cagaccaagt ttactcatat atactttaga ttgatttaaa acttcatttt taatttaaaa 9720
ggatctaggt gaagatcctt tttgataatc tcatgaccaa aatcccttaa cgtgagtttt 9780
cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga gatccttttt 9840
ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt 9900
tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc agagcgcaga 9960
taccaaatac tgttcttcta gtgtagccgt agttaggcca ccacttcaag aactctgtag 10020
caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc agtggcgata 10080
agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg cagcggtcgg 10140
gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac accgaactga 10200
gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca 10260
ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt ccagggggaa 10320
acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt 10380
tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg gcctttttac 10440
ggttcctggc cttttgctgg ccttttgctc acatgt 10476
<210> 3
<211> 3120
<212> DNA
<213> Artificial sequence
<400> 3
gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 60
cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt 120
tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 180
aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt 240
ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg 300
ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga 360
tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc 420
tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac 480
actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg 540
gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca 600
acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg 660
gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg 720
acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg 780
gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag 840
ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg 900
gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct 960
cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac 1020
agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact 1080
catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga 1140
tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 1200
cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct 1260
gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 1320
taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgttc 1380
ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 1440
tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 1500
ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 1560
cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 1620
agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 1680
gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 1740
atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 1800
gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1860
gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 1920
ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 1980
cagtgagcga ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 2040
cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca 2100
acgcaattaa tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc 2160
cggctcgtat gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg 2220
accatgatta cgccaagctt gcatgcaggc ctctgcagtc gacgggcccg ggatccgatg 2280
ataaacatgt gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc 2340
tgttagagag ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac 2400
gtgacgtaga aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat 2460
ggactatcat atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt 2520
gtggaaagga cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag 2580
ttaaaataag gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttc 2640
tagcgcgtgc gccaattctg cagacaaatg gctctagagg tacccataga tctagatgca 2700
ttcgcgaggt accgagctcg aattcactgg ccgtcgtttt acaacgtcgt gactgggaaa 2760
accctggcgt tacccaactt aatcgccttg cagcacatcc ccctttcgcc agctggcgta 2820
atagcgaaga ggcccgcacc gatcgccctt cccaacagtt gcgcagcctg aatggcgaat 2880
ggcgcctgat gcggtatttt ctccttacgc atctgtgcgg tatttcacac cgcatatggt 2940
gcactctcag tacaatctgc tctgatgccg catagttaag ccagccccga cacccgccaa 3000
cacccgctga cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg 3060
tgaccgtctc cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga 3120
<210> 4
<211> 1043
<212> PRT
<213> Sus scrofa
<400> 4
Met Ala Val Ser Leu Pro Pro Thr Leu Gly Leu Ser Ser Ala Pro Asp
1 5 10 15
Glu Ile Gln His Pro His Ile Lys Phe Ser Glu Trp Lys Phe Lys Leu
20 25 30
Phe Arg Val Arg Ser Phe Glu Lys Ala Pro Glu Lys Ala Gln Thr Glu
35 40 45
Lys Gln Asp Ser Ser Glu Gly Lys Pro Ser Leu Glu Gln Ser Pro Ala
50 55 60
Val Leu Asp Lys Pro Gly Gly Gln Lys Ser Ala Leu Pro Gln Pro Ala
65 70 75 80
Phe Lys Pro His Pro Lys Phe Leu Lys Glu Ser His Glu Asp Gly Lys
85 90 95
Ala Arg Asp Lys Ala Ile His Gln Ala Asn Leu Arg Arg Leu Cys Arg
100 105 110
Ile Cys Gly Asn Ser Phe Asn Thr Thr Gly His Lys Arg Arg Tyr Pro
115 120 125
Val His Gly Pro Val Asp Gly Lys Thr Gln Val Leu Leu Arg Lys Lys
130 135 140
Glu Lys Arg Ala Thr Ser Trp Pro Asp Leu Ile Ala Lys Val Phe Arg
145 150 155 160
Ile Asp Val Lys Ala Asp Val Asp Ser Ile His Pro Thr Glu Phe Cys
165 170 175
His Asn Cys Trp Ser Phe Met His Arg Lys Phe Ser Ser Thr Pro Cys
180 185 190
Glu Val Tyr Ser Pro Arg Asn Ala Thr Met Glu Trp His Pro His Thr
195 200 205
Leu Asn Cys Asp Ile Cys His Ile Ala Arg Arg Gly Leu Lys Arg Lys
210 215 220
Ser Gln Gln Pro Asn Met Gln Leu Ser Lys Lys Leu Lys Thr Val Ile
225 230 235 240
Asp Arg Ala Arg Gln Ala Arg Gln Arg Lys Arg Arg Ala Gln Ala Arg
245 250 255
Ile Ser Ser Lys Glu Leu Met Lys Lys Ile Ala Asn Cys Gly Gln Ile
260 265 270
His Leu Ser Pro Lys Leu Leu Ala Val Asp Phe Pro Ala His Phe Val
275 280 285
Lys Ser Ile Ser Cys Gln Ile Cys Glu His Ile Leu Ala Asp Pro Val
290 295 300
Glu Thr Ser Cys Lys His Val Phe Cys Arg Ile Cys Ile Leu Arg Cys
305 310 315 320
Leu Lys Val Met Gly Ser Ser Cys Pro Ser Cys His Tyr Pro Cys Phe
325 330 335
Pro Thr Asp Leu Glu Ser Pro Val Lys Ser Phe Leu Ser Ile Leu Asn
340 345 350
Thr Leu Met Val Lys Cys Pro Ala Lys Glu Cys Asn Glu Glu Ile Ser
355 360 365
Leu Glu Lys Tyr Asn His His Ile Ser Ser His Lys Glu Ser Lys Glu
370 375 380
Thr Phe Val His Ile Asn Lys Gly Gly Arg Pro Arg Gln His Leu Leu
385 390 395 400
Ser Leu Thr Arg Arg Ala Gln Lys His Arg Leu Arg Glu Leu Lys Leu
405 410 415
Gln Val Lys Ala Phe Ala Asp Lys Glu Glu Gly Gly Asp Val Lys Ser
420 425 430
Val Cys Leu Thr Leu Phe Leu Leu Val Leu Arg Ala Arg Asn Glu His
435 440 445
Arg Gln Ala Asp Glu Leu Glu Ala Ile Met Arg Gly Gln Gly Ser Gly
450 455 460
Leu Gln Pro Ala Val Cys Leu Ala Ile Arg Val Asn Thr Phe Leu Ser
465 470 475 480
Cys Ser Gln Tyr His Lys Met Tyr Arg Thr Val Lys Ala Ile Thr Gly
485 490 495
Arg Gln Ile Phe Gln Pro Leu His Ala Leu Arg Asn Ala Glu Lys Val
500 505 510
Leu Leu Pro Gly Tyr His Pro Phe Glu Trp Gln Pro Pro Leu Lys Asn
515 520 525
Val Ser Ser Ser Thr Asp Val Gly Ile Ile Asp Gly Leu Ser Gly Leu
530 535 540
Ser Ser Ser Val Asp Asp Tyr Pro Val Asp Thr Ile Ala Lys Arg Phe
545 550 555 560
Arg Tyr Asp Ser Ala Leu Val Ser Ala Leu Met Asp Met Glu Glu Asp
565 570 575
Ile Leu Glu Gly Met Arg Ala Gln Asp Leu Asp Asp Tyr Leu Asn Gly
580 585 590
Pro Phe Thr Val Val Val Lys Glu Ser Cys Asp Gly Met Gly Asp Val
595 600 605
Ser Glu Lys His Gly Ser Gly Pro Val Val Pro Glu Lys Ala Val Arg
610 615 620
Phe Ser Phe Thr Val Met Lys Ile Thr Ile Ala His Gly Ser Gln Asn
625 630 635 640
Val Lys Val Phe Glu Glu Ala Lys Pro Asn Ser Glu Leu Cys Cys Lys
645 650 655
Pro Leu Cys Leu Met Leu Ala Asp Glu Ser Asp His Glu Thr Leu Thr
660 665 670
Ala Ile Leu Ser Pro Leu Ile Ala Glu Arg Glu Ala Met Lys Ser Ser
675 680 685
Gln Leu Met Leu Glu Met Gly Gly Ile Leu Arg Thr Phe Lys Phe Ile
690 695 700
Phe Arg Gly Thr Gly Tyr Asp Glu Lys Leu Val Arg Glu Val Glu Gly
705 710 715 720
Leu Glu Ala Ser Gly Ser Val Tyr Ile Cys Thr Leu Cys Asp Ala Thr
725 730 735
Arg Leu Glu Ala Ser Gln Asn Leu Val Phe His Ser Ile Thr Arg Ser
740 745 750
His Ala Glu Asn Leu Glu Arg Tyr Glu Val Trp Arg Ser Asn Pro Tyr
755 760 765
His Glu Thr Val Asp Glu Leu Arg Asp Arg Val Lys Gly Val Ser Ala
770 775 780
Lys Pro Phe Ile Glu Thr Val Pro Ser Ile Asp Ala Leu His Cys Asp
785 790 795 800
Ile Gly Asn Ala Ala Glu Phe Tyr Lys Ile Phe Gln Leu Glu Ile Gly
805 810 815
Glu Ala Tyr Lys Asn Pro His Ala Ser Lys Glu Glu Arg Lys Arg Trp
820 825 830
Gln Ala Thr Leu Asp Lys His Leu Arg Lys Lys Met Asn Leu Lys Pro
835 840 845
Ile Met Arg Met Asn Gly Asn Phe Ala Arg Lys Leu Met Thr Lys Glu
850 855 860
Thr Val Glu Ala Val Cys Glu Leu Ile Pro Ser Glu Glu Arg His Glu
865 870 875 880
Ala Leu Arg Glu Leu Met Asp Leu Tyr Leu Lys Met Lys Pro Val Trp
885 890 895
Arg Ser Ser Cys Pro Ala Lys Glu Cys Pro Glu Ser Leu Cys Gln Tyr
900 905 910
Ser Phe Asn Ser Gln Arg Phe Ala Glu Leu Leu Ser Thr Lys Phe Lys
915 920 925
Tyr Arg Tyr Glu Gly Lys Ile Thr Asn Tyr Phe His Lys Thr Leu Ala
930 935 940
His Val Pro Glu Ile Ile Glu Arg Asp Gly Ser Ile Gly Ala Trp Ala
945 950 955 960
Ser Glu Gly Asn Glu Ser Gly Asn Lys Leu Phe Arg Arg Phe Arg Lys
965 970 975
Met Asn Ala Arg Gln Ser Lys Tyr Tyr Glu Met Glu Asp Val Leu Lys
980 985 990
His His Trp Leu Tyr Thr Ser Lys Tyr Leu Gln Lys Phe Met Asn Ala
995 1000 1005
His Lys Ala Phe Lys Asn Ser Gly Phe Thr Ile Asn Leu Gln Arg
1010 1015 1020
Ser Ser Gly Asp Thr Leu Asp Leu Glu Asn Ser Pro Glu Ser Gln
1025 1030 1035
Asp Leu Met Glu Phe
1040
<210> 5
<211> 3132
<212> DNA
<213> Sus scrofa
<400> 5
atggctgtct ctttgccacc cactctggga ctcagttccg ccccagatga aatccagcac 60
ccccacatta aattttcaga atggaagttt aagctattca gggtgagatc ctttgaaaag 120
gcacctgaaa aggctcaaac ggaaaagcag gattcctccg aggggaaacc ctcgctggag 180
caatctccag cagtcctgga caagcctggt ggtcagaagt cagccctgcc tcaaccagca 240
ttcaagcccc atccaaagtt tttaaaggaa tcccacgaag atgggaaagc aagagacaaa 300
gccatccacc aagccaacct gagacgtctc tgccgcatct gtgggaattc tttcaacacc 360
actgggcaca agagaaggta tccagtccac gggcctgtgg atggtaaaac ccaagtcctt 420
ttacggaaga aggaaaagag ggccacgtcc tggccagacc tcattgccaa agttttccgg 480
atcgatgtga aggcagatgt tgactcgatc caccccactg agttctgcca taactgctgg 540
agcttcatgc acaggaagtt tagcagcacc ccatgtgagg tttactcccc aaggaatgca 600
accatggagt ggcaccccca caccctaaac tgtgacatct gccacattgc acgtcgggga 660
ctcaagagga agagtcagca gccaaacatg cagctcagca aaaaactcaa aactgtgatt 720
gaccgagcga gacaagcccg tcagcgcaag aggagagctc aggccaggat cagcagcaag 780
gaactgatga agaagatcgc caactgcggt cagatacatc ttagccccaa gctcctggca 840
gtggacttcc cggcgcactt tgtgaaatct atctcctgcc agatttgtga acacatcctg 900
gccgacccgg tggagaccag ctgcaagcac gtgttttgca ggatctgcat tctcaggtgc 960
ctcaaagtca tgggcagcag ttgtccctct tgccactatc cctgtttccc tactgacctg 1020
gagagtccag tgaagtcttt tctgagcatc ttgaataccc tgatggtgaa atgcccagca 1080
aaggagtgca acgaggagat cagcttggaa aaatataatc accatatctc aagccacaag 1140
gagtcgaagg agacatttgt gcatattaat aaagggggcc ggccccgcca gcatctcctg 1200
tccctgacgc ggagggctca gaaacaccgt ctgagggagc tcaagctgca agtcaaggcc 1260
ttcgccgaca aagaagaagg tggcgacgtg aagtcagtgt gcctgacctt gttcctgcta 1320
gtgctgaggg cgaggaatga gcacagacaa gctgacgagc tggaggccat catgcgaggc 1380
cagggttccg gcctgcagcc tgctgtttgc ttggccatcc gcgtcaacac cttcctcagc 1440
tgcagccagt accacaagat gtacaggact gtgaaggcca tcacgggcag gcagattttc 1500
cagcctttgc atgcccttcg gaatgcggag aaggtccttc tgcccggcta ccaccccttc 1560
gagtggcagc cacctctgaa gaatgtgtct tccagcacgg acgtgggcat tattgatggg 1620
ctgtctggac tctcctcctc tgtggacgat tacccagtgg acaccattgc caagcgcttc 1680
cgctatgact cggctctggt gtccgctctc atggacatgg aagaagacat cctggagggt 1740
atgagagccc aagaccttga cgactacctg aatggcccct tcactgtggt ggtgaaggag 1800
tcttgtgatg ggatgggaga cgtgagtgag aagcacggca gtgggccggt cgtgccggaa 1860
aaggccgttc ggttttcctt cacagtcatg aaaatcacca tcgcacacgg gtcacagaac 1920
gtgaaggtgt ttgaggaagc caagcctaac tctgaactat gctgcaagcc cttgtgcctc 1980
atgctggccg acgaatccga ccatgagacc ctgacggcca tcctgagccc tctcattgcc 2040
gagagggagg ccatgaagag cagccagcta atgctggaga tgggaggcat cctccggact 2100
ttcaagttca tcttcagggg caccggatat gatgagaaac tggtccggga agtggaaggc 2160
cttgaggctt ctggctctgt ctacatctgt actctctgtg atgccacccg cctggaagcc 2220
tctcaaaatc tggtcttcca ctccataacc agaagccacg cggagaattt ggagcgctat 2280
gaggtctggc gttccaaccc ataccatgag acggtggatg aacttcggga ccgggtgaaa 2340
ggggtctcgg ccaaaccctt cattgagacg gtgccttcca tagatgccct ccactgtgac 2400
attggcaatg cagccgagtt ctacaagatt ttccagctcg agatagggga ggcgtataag 2460
aacccccatg cctccaagga ggaaaggaag agatggcagg cgaccttgga caagcacctc 2520
cgcaagaaga tgaatctgaa gcccatcatg aggatgaatg gcaactttgc caggaagctc 2580
atgaccaaag agactgtgga agcagtctgt gagttaattc cctccgagga gaggcatgaa 2640
gctctgaggg aactgatgga cctttacctg aagatgaaac ccgtctggcg atcgtcatgc 2700
cctgctaaag agtgcccgga atccctctgc cagtatagtt tcaattcgca gcgttttgct 2760
gagctcctct ccaccaagtt caagtacaga tatgagggca aaatcaccaa ttattttcac 2820
aagacactgg cccacgtccc ggaaattatc gagagggacg gctccattgg ggcatgggct 2880
agcgagggaa atgagtctgg gaacaagctg ttcaggcgct tccgaaaaat gaatgccagg 2940
cagtccaagt actatgaaat ggaagatgtt ttgaaacatc actggttgta cacctccaaa 3000
tacctgcaga agtttatgaa tgctcataaa gcatttaaaa actcagggtt taccataaac 3060
ttgcagagaa gttcagggga cacattagac ctagagaact ctccagaatc tcaagatttg 3120
atggaatttt aa 3132
<210> 6
<211> 100
<212> RNA
<213> Artificial sequence
<400> 6
gggaauucuu ucaacaccac guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
<210> 7
<211> 100
<212> RNA
<213> Artificial sequence
<400> 7
agagaaggua uccaguccac guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
<210> 8
<211> 100
<212> RNA
<213> Artificial sequence
<400> 8
aaugaggucu ggccaggacg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
<210> 9
<211> 100
<212> RNA
<213> Artificial sequence
<400> 9
aguuauggca gaacucagug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
<210> 10
<211> 527
<212> PRT
<213> Sus scrofa
<400> 10
Met Ser Leu Gln Met Ile Thr Val Gly Asn Asn Met Ala Leu Ile Gln
1 5 10 15
Pro Gly Phe Ser Leu Met Asn Phe Asp Gly Gln Ile Phe Phe Phe Gly
20 25 30
Gln Lys Gly Trp Pro Lys Arg Ser Cys Pro Thr Gly Val Phe His Phe
35 40 45
Asp Val Lys His Asn His Leu Lys Leu Lys Pro Ala Leu Phe Ser Lys
50 55 60
Asp Ser Cys Tyr Leu Pro Pro Leu Arg Tyr Pro Ala Thr Cys Thr Phe
65 70 75 80
Lys Ser Ser Leu Glu Ser Glu Lys His Gln Tyr Ile Ile His Gly Gly
85 90 95
Lys Thr Pro Asn Asn Glu Leu Ser Asp Lys Ile Tyr Val Met Ser Val
100 105 110
Val Cys Lys Asn Asn Lys Lys Val Thr Phe Arg Cys Arg Glu Lys Asp
115 120 125
Leu Val Gly Asp Val Pro Glu Gly Arg Tyr Gly His Ser Ile Asp Val
130 135 140
Val Tyr Ser Arg Gly Lys Ser Met Gly Val Leu Phe Gly Gly Arg Ser
145 150 155 160
Tyr Ile Pro Ser Ala Gln Arg Thr Thr Glu Lys Trp Asn Ser Val Ala
165 170 175
Asp Cys Leu Pro His Ile Phe Leu Val Asp Phe Glu Phe Gly Cys Ser
180 185 190
Thr Ser Tyr Ile Leu Pro Glu Leu Gln Asp Gly Leu Ser Phe His Val
195 200 205
Ser Ile Ala Arg Asn Asp Thr Ile Tyr Ile Leu Gly Gly His Ser Leu
210 215 220
Ala Asn Asn Ile Arg Pro Ala Asn Leu Tyr Lys Ile Arg Val Asp Leu
225 230 235 240
Pro Leu Gly Ser Pro Ala Val Thr Cys Thr Val Leu Pro Gly Gly Ile
245 250 255
Ser Val Ser Ser Ala Ile Leu Thr Gln Thr Ser Ser Asp Glu Phe Val
260 265 270
Ile Val Gly Gly Tyr Gln Leu Glu Asn Gln Lys Arg Met Val Cys Asn
275 280 285
Ile Ile Ser Phe Lys Asp Asn Lys Ile Gly Ile His Glu Met Glu Thr
290 295 300
Pro Asp Trp Thr Pro Asp Ile Lys His Ser Lys Ile Trp Phe Gly Ser
305 310 315 320
Asn Met Gly Asn Gly Thr Val Phe Leu Gly Ile Pro Gly Asp Asn Lys
325 330 335
Gln Ala Leu Ser Glu Ala Phe Tyr Phe Tyr Thr Leu Lys Cys Thr Glu
340 345 350
Asp Asp Val Asn Glu Asp Gln Lys Thr Phe Thr Asn Ser Gln Thr Ser
355 360 365
Thr Glu Asp Pro Gly Asp Ser Thr Pro Phe Glu Asp Ser Glu Glu Phe
370 375 380
Cys Phe Ser Ala Glu Ala Asn Ser Phe Asp Gly Asp Asp Glu Phe Asp
385 390 395 400
Thr Tyr Asn Glu Asp Asp Glu Glu Asp Glu Ser Glu Thr Gly Tyr Trp
405 410 415
Ile Thr Cys Cys Pro Thr Cys Asp Met Asp Ile Asn Thr Trp Val Pro
420 425 430
Phe Tyr Ser Thr Glu Leu Asn Lys Pro Ala Met Ile Tyr Cys Ser His
435 440 445
Gly Asp Gly His Trp Val His Ala Gln Cys Met Asp Leu Ala Glu His
450 455 460
Thr Leu Ile His Leu Ser Glu Gly Ser Ser Lys Tyr Tyr Cys Lys Glu
465 470 475 480
His Val Glu Ile Ala Arg Ala Leu Gln Thr Pro Lys Arg Val Leu Pro
485 490 495
Leu Lys Lys Pro Pro Leu Lys Ser Leu His Lys Lys Gly Ser Gly Lys
500 505 510
Ile Ile Thr Pro Ala Lys Lys Ser Phe Leu Arg Arg Leu Phe Asp
515 520 525
<210> 11
<211> 2584
<212> DNA
<213> Sus scrofa
<400> 11
tctacgtcag ccattctcac ctcccattcc ctagtttttc gccttggctt ccatctagtc 60
acttcgcact cttggcgtct ttattcagag agactcttaa agacttcttt cctggggcaa 120
taaagacaaa ctctgtagcc acacatccca tagagaatgg attcctggga aatgtagttc 180
tttctgggga caagtggtta gtctttaagg gaaaaggact acagttccca gaaatctaag 240
ggaggccagt ccacgtctta aacttgtccc agctgcatgg attgtattag gcaggaaggt 300
tctgtggcgt tttctttacc cagctgcctg gatttttgct aattcaatcc cactacaagc 360
ttgtggaaca actctctttt tttaacaggc tttttatgtg tgagggatct aaacacagtg 420
attttaatga agagatatag taagttaaaa aatgtttttt aattctttca gataaaaaaa 480
gagctaccca ctgtcagaaa atgtcactac agatgataac agttggtaat aacatggcct 540
taattcagcc aggcttctca ttgatgaatt ttgatgggca aatcttcttc tttggccaaa 600
aaggctggcc caagaggtcc tgccccactg gagtttttca ttttgatgta aagcataacc 660
atctcaaact gaagcctgca cttttctcta aggattcctg ctaccttcct cctctccgct 720
acccagccac ttgcacattc aaaagcagct tagagtctga aaaacatcag tacatcatcc 780
atggagggaa aacaccaaat aatgagcttt cggataagat ttatgtcatg tctgtggttt 840
gcaagaacaa caaaaaagtt acttttcgct gcagagagaa agacttggta ggagatgttc 900
ctgaaggcag atatggtcat tccattgatg tcgtgtatag tcgagggaaa agtatgggtg 960
ttctctttgg aggacggtca tacatccctt ctgctcaaag aaccacagaa aaatggaata 1020
gtgtagctga ctgcctgccc cacattttct tggtagattt tgaatttggt tgctctacat 1080
catacattct tccagaactt caagatgggc tatcttttca tgtctccatt gccagaaatg 1140
ataccattta tattttagga ggacactcac ttgccaataa catccgtcct gccaatctat 1200
ataaaataag ggttgatctc cccctgggta gcccagctgt gacttgcaca gtcctgccag 1260
gaggaatctc tgtctccagt gcaatcctga ctcaaacgag cagtgatgaa tttgttattg 1320
ttggtggcta tcagcttgaa aatcaaaaaa gaatggtctg caacatcatc tctttcaagg 1380
acaacaagat aggaattcat gagatggaaa ctccagattg gaccccagat attaagcaca 1440
gcaagatatg gtttggaagc aacatgggaa atggaaccgt tttccttggc ataccaggag 1500
acaataaaca ggctctttca gaagcattct atttctatac attgaaatgt actgaagacg 1560
atgtgaacga agatcaaaaa acattcacaa atagtcagac atcaacagaa gatccagggg 1620
actccactcc ctttgaagac tcagaagaat tttgtttcag tgcagaagca aatagttttg 1680
atggtgatga tgaatttgac acctataacg aagatgatga ggaagatgag tctgagacgg 1740
gctactggat tacatgctgc cctacttgtg atatggatat caacacttgg gtaccatttt 1800
attcaactga gctcaacaaa cctgccatga tctactgctc tcatggagat gggcattggg 1860
tccatgccca gtgcatggat ctggcagaac acacactcat ccatctgtca gaaggaagca 1920
gcaagtatta ctgcaaggag catgtggaga tagcaagagc actgcaaacc cccaaaagag 1980
ttttaccctt aaaaaagcct ccactgaaat ccctccacaa aaaaggttct gggaaaatta 2040
ttacccctgc caagaaatcc tttcttagaa gattattcga ttagtttcac aaaagctttt 2100
ctgatccaag tgcatcaggt ttttaaacat attttcaaga atcctgacaa tgataaaaat 2160
tatattctta tttttgttat tgaaaatatc tgttttcttt tagttatatg aattaagttc 2220
cagagaaaag tcttataatg caatacaaaa tacagtcatt gtgtttagac ttatatagga 2280
cctataatat tttgaaaatt ctttactcaa aggatcttca gtgagtattt ttgatctgaa 2340
tttctttgtt caaggaatgt tcaacactga gacagtagta ataactaatg tatgcttatg 2400
tccattatat gactttcggt aacaaataat ctatagaata gttgagacaa gtttaaacag 2460
tagagaaact aagagctaaa ggaattaaag gaattctttt gcatgatgta gcaatttggt 2520
tgatgttgct tgatgctgta actccaacat ggccctttgg ttatgcccat gtacagaaaa 2580
agct 2584
<210> 12
<211> 100
<212> RNA
<213> Artificial sequence
<400> 12
ucacuacaga ugauaacagu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
<210> 13
<211> 100
<212> RNA
<213> Artificial sequence
<400> 13
gauaacaguu gguaauaaca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
<210> 14
<211> 100
<212> RNA
<213> Artificial sequence
<400> 14
gugcaggcuu caguuugaga guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
<210> 15
<211> 100
<212> RNA
<213> Artificial sequence
<400> 15
caaguggcug gguagcggag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
<210> 16
<211> 368
<212> PRT
<213> Sus scrofa
<400> 16
Met Leu Lys Pro Pro Leu Pro Val Lys Ser Leu Leu Phe Leu Gln Leu
1 5 10 15
Pro Leu Leu Gly Val Gly Leu Asn Pro Lys Val Leu Thr His Ser Gly
20 25 30
Asn Glu Asp Ile Thr Ala Asp Phe Leu Leu Leu Ser Thr Pro Pro Gly
35 40 45
Thr Leu Asn Val Ser Thr Leu Pro Leu Pro Lys Val Gln Cys Phe Val
50 55 60
Phe Asn Val Glu Tyr Met Asn Cys Thr Trp Asn Ser Ser Ser Glu Leu
65 70 75 80
Gln Pro Thr Asn Leu Thr Leu His Tyr Trp Tyr Lys Thr Ser Asn Asp
85 90 95
Asp Lys Val Gln Glu Cys Gly His Tyr Leu Phe Ser Glu Gly Ile Thr
100 105 110
Ser Gly Cys Trp Phe Gly Lys Glu Glu Ile Arg Leu Tyr Gln Thr Phe
115 120 125
Val Val Gln Leu Gln Asp Pro Arg Glu Pro Arg Arg Gln Asp Pro Gln
130 135 140
Thr Leu Lys Leu Gln Asp Leu Val Ile Pro Trp Ala Pro Ala Asn Leu
145 150 155 160
Thr Leu Arg Thr Leu Ser Glu Ser Gln Leu Glu Leu Asn Trp Ser Asn
165 170 175
Arg Tyr Leu Asp His Cys Leu Glu His Leu Val Gln Tyr Arg Ser Asp
180 185 190
Arg Asp Arg Ser Trp Thr Glu Gln Ser Val Asp His Arg Gln Ser Phe
195 200 205
Ser Leu Pro Ser Val Asp Ala Gln Lys Leu Tyr Thr Phe Arg Val Arg
210 215 220
Ser Arg Tyr Asn Pro Leu Cys Gly Ser Ala Gln Arg Trp Ser Asp Trp
225 230 235 240
Ser His Pro Ile His Trp Gly Asn Thr Ser Lys Glu Asn Pro Leu Leu
245 250 255
Phe Ala Leu Glu Ala Val Leu Ile Pro Leu Gly Ser Met Gly Leu Ile
260 265 270
Val Gly Leu Met Cys Val Tyr Cys Trp Leu Glu Arg Thr Met Pro Arg
275 280 285
Ile Pro Thr Leu Lys Asn Leu Glu Asp Leu Val Thr Glu Tyr His Gly
290 295 300
Asn Phe Ser Ala Trp Ser Gly Val Ser Lys Gly Leu Ala Glu Ser Leu
305 310 315 320
Gln Pro Asp Tyr Ser Glu Arg Leu Cys His Val Ser Glu Ile Ser Pro
325 330 335
Lys Gly Gly Ala Leu Gly Glu Gly Pro Gly Gly Ser Pro Cys Ser Gln
340 345 350
His Ser Pro Tyr Trp Ala Pro Pro Cys Tyr Thr Leu Lys Pro Glu Thr
355 360 365
<210> 17
<211> 1185
<212> DNA
<213> Sus scrofa
<400> 17
aaattttaga gtactggggg gagggcaagg ggaagggttc cctgcctagt gctgcttctt 60
cttctgacca tcatgtcttc cctttgcctc ccccacttca ttttctcccc gtcctagatt 120
tcctcctgct ctctacaccc cctgggactc tcaacgtttc cactctaccc ctcccaaagg 180
ttcagtgttt tgtgttcaat gttgagtaca tgaattgcac ttggaacagc agctctgagc 240
tccagcctac caacctaact ctgcactact ggtatgagaa gggaagaggg gatatagcac 300
aggggaggga ggaagaggcg ctgggctaga tgtgagagat tgtgtgagga ccaagaaaga 360
ggttagccag catcccaggc ttcccactat attctcgtgg ggtaagtcat aagtcagttc 420
gtaggagctg aggctggact gtggaatctg tggtattcac atttacctca ctgttattct 480
tccttgaaat ccttctctag gtacaagacc tctaatgatg ataaagtcca ggagtgtggc 540
cactatctat tctctgaagg gatcacttct ggctgttggt ttggaaaaga ggagatccgc 600
ctctaccaaa catttgttgt ccagctccag gacccacggg aacccaggag gcaggaccca 660
cagacgctaa aactacagga tctgggtaat ttggaaatgg ggagggtcaa gggatattgt 720
gggggtattg gtgtatgtag agtggtattc ttgcaccata agggtacttg ggcagaaaag 780
aagaagtgag ggatccaatg gggtcgggag gagggatcag gagcactgcc ctcaggatcc 840
tgacttgtct aggccagggg aatgaccaca cacgcacaca tatctccagt gatcccctgg 900
gcgccggcga atctgaccct tcgcaccctg agtgaatccc agctagaact cagctggagc 960
aaccgatact tggaccactg tttggagcac ctcgtgcaat accggagtga ccgggaccgc 1020
agctggactg tgagtgagtg ggaacagcag ctggggctga gcaagtgggg ataaaggatt 1080
caatcagtcc agtaggaagg cttgattccc agctcctatt ctctgcatcc tggtgcctct 1140
gcccaccttc tcccctcctt ggactccttt ctctgtcgtc accat 1185
<210> 18
<211> 100
<212> RNA
<213> Artificial sequence
<400> 18
ccuguaguuu uagcgucugu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
<210> 19
<211> 100
<212> RNA
<213> Artificial sequence
<400> 19
caacaaaugu uugguagagg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
<210> 20
<211> 100
<212> RNA
<213> Artificial sequence
<400> 20
gaugauaaag uccaggagug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
<210> 21
<211> 100
<212> RNA
<213> Artificial sequence
<400> 21
cuggacuuua ucaucauuag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
<210> 22
<211> 100
<212> RNA
<213> Artificial sequence
<400> 22
uuguccagcu ccaggaccca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
<210> 23
<211> 100
<212> RNA
<213> Artificial sequence
<400> 23
ggccacuauc uauucucuga guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
<210> 24
<211> 100
<212> RNA
<213> Artificial sequence
<400> 24
ucccuucaga gaauagauag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
<210> 25
<211> 100
<212> RNA
<213> Artificial sequence
<400> 25
aacauuuguu guccagcucc guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
<210> 26
<211> 100
<212> RNA
<213> Artificial sequence
<400> 26
uguccagcuc caggacccac guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
<210> 27
<211> 4136
<212> PRT
<213> Sus scrofa
<400> 27
Met Ala Asp Ser Gly Ser Gly Val Arg Leu Ser Leu Leu Gln Leu Gln
1 5 10 15
Glu Ser Leu Ser Ala Ser Asp Arg Cys Ser Ala Ala Val Ala Ser Cys
20 25 30
Gln Leu Leu Arg Gly Leu Gly Gln Glu Cys Val Leu Ser Ser Gly Pro
35 40 45
Ala Leu Leu Ala Leu Gln Thr Ser Leu Val Phe Ser Lys Asp Phe Gly
50 55 60
Val Leu Val Phe Val Arg Lys Ser Leu Ser Ile Asp Glu Phe Arg Asp
65 70 75 80
Cys Arg Glu Glu Ala Leu Lys Phe Leu Tyr Ile Phe Leu Glu Lys Ile
85 90 95
Gly Gln Lys Ile Thr Pro Tyr Ser Leu Asp Ile Lys Asn Thr Cys Thr
100 105 110
Ser Val Tyr Thr Lys Asp Lys Ala Ala Lys Cys Lys Ile Pro Ala Leu
115 120 125
Asp Leu Leu Ile Lys Leu Leu Gln Thr Leu Arg Ser Ser Arg Leu Met
130 135 140
Asp Glu Phe Lys Val Gly Glu Leu Phe Ser Lys Phe Tyr Gly Glu Leu
145 150 155 160
Ala Leu Lys Thr Lys Ile Ser Asp Thr Val Leu Glu Lys Ile Tyr Glu
165 170 175
Leu Leu Gly Val Leu Gly Glu Val His Pro Ser Glu Met Ile Asn Asn
180 185 190
Ser Asp Lys Leu Phe Arg Ala Phe Leu Gly Glu Leu Lys Thr Gln Met
195 200 205
Thr Ser Thr Val Arg Glu Pro Lys Leu Pro Val Val Ala Gly Cys Leu
210 215 220
Lys Gly Leu Ala Ser Leu Leu Cys Asn Phe Thr Lys Ser Met Glu Glu
225 230 235 240
Asp Pro Gln Thr Ser Arg Glu Ile Phe Asp Phe Ala Leu Lys Ala Ile
245 250 255
Arg Pro Gln Ile Asp Leu Lys Arg Tyr Ala Val Pro Leu Ala Gly Leu
260 265 270
Cys Leu Phe Thr Leu His Ala Ser Gln Phe Ser Thr Cys Leu Leu Asp
275 280 285
Asn Tyr Val Ser Leu Phe Glu Val Leu Ser Lys Trp Cys Ser His Pro
290 295 300
Asn Met Glu Leu Lys Lys Ala Ala His Ser Ala Leu Glu Ser Phe Leu
305 310 315 320
Lys Gln Val Ser Leu Met Val Ala Gly Asp Ala Glu Lys His Arg Ser
325 330 335
Lys Leu Gln Tyr Phe Met Glu Gln Phe Tyr Gly Ile Ile Arg Asp Ser
340 345 350
Asp Ala Ser Ser Lys Asp Leu Ser Val Ala Ile Arg Gly Tyr Gly Leu
355 360 365
Phe Ala Gly Pro Cys Lys Ala Ile Asn Ala Lys Asp Val Asp Phe Met
370 375 380
Tyr Val Glu Leu Ile Gln Arg Cys Lys Gln Leu Phe Leu Val Glu Thr
385 390 395 400
Asp Thr Ala Glu Asp His Ala Tyr Gln Met Pro Ala Phe Leu Gln Ser
405 410 415
Leu Ala Ser Val Leu Leu Tyr Leu Asp Thr Leu Pro Glu Val Tyr Thr
420 425 430
Pro Val Leu Glu His Leu Ile Val Ala Gln Ile Asp Thr Phe Pro Gln
435 440 445
Tyr Ser Pro Lys Met Gln Ser Val Cys Cys Lys Ala Ile Val Lys Val
450 455 460
Phe Leu Ala Leu Ala Glu Lys Gly Pro Val Leu Trp Asn Cys Ile Gly
465 470 475 480
Thr Val Val His Gln Gly Leu Ile Arg Ile Cys Ser Lys Pro Val Val
485 490 495
Leu Gln Lys Gly Ala Glu Ser Glu Ser Glu Asp Ala His Ala Ser Glu
500 505 510
Glu Val Arg Thr Arg Gly Trp Lys Val Pro Thr Tyr Arg Asp Tyr Leu
515 520 525
Asp Leu Phe Arg Asn Leu Leu Ser Cys Asp Gln Thr Met Asp Ser Leu
530 535 540
Leu Ala Asp Glu Ala Phe Leu Phe Val Asn Ser Ser Pro Arg Ser Leu
545 550 555 560
Ser Arg Met Leu Tyr Asp Glu Phe Val Lys Ser Val Leu Lys Ile Val
565 570 575
Glu Lys Leu Asp Leu Thr Leu Glu Arg Gln Asn Val Ala Glu Lys Glu
580 585 590
Gly Glu Asn Glu Ala Thr Gly Val Trp Val Ile Pro Thr Ser Asp Pro
595 600 605
Ala Ala Asn Leu His Pro Ala Lys Pro Lys Asp Phe Ser Ala Phe Ile
610 615 620
Asn Leu Val Glu Phe Cys Arg Asp Ile Leu Pro Glu Thr His Ile Glu
625 630 635 640
Phe Phe Glu Pro Trp Leu His Pro Phe Ala Tyr Glu Ile Ile Leu Gln
645 650 655
Ser Thr Arg Ser Pro Leu Ile Ser Gly Phe Tyr Lys Leu Leu Ser Val
660 665 670
Ala Val Arg Asn Ala Lys Lys Ile Lys Tyr Phe Glu Gly Val Gly Pro
675 680 685
Gln Ser Gln Lys Gln Ser Pro Glu Asp Pro Gly Lys Tyr Ser Cys Phe
690 695 700
Ala Leu Phe Ala Lys Phe Gly Lys Glu Val Ser Val Lys Met Lys Gln
705 710 715 720
Tyr Lys Asp Glu Leu Leu Ala Ser Cys Leu Thr Phe Val Leu Ser Leu
725 730 735
Pro His Ala Ile Ile Glu Leu Asp Val Arg Ala Tyr Val Pro Ala Leu
740 745 750
Gln Met Ala Phe Lys Leu Gly Leu Ser His Thr Pro Leu Ala Glu Val
755 760 765
Gly Leu Asn Ala Leu Glu Glu Trp Ser Val Cys Ile Cys Arg Glu Val
770 775 780
Met Gln Pro Tyr Tyr Lys Asp Ile Leu Pro Thr Leu Asp Gly Tyr Leu
785 790 795 800
Lys Thr Ser Ala Leu Ser Asp Glu Thr Arg Thr Asn Trp Glu Val Ser
805 810 815
Ala Leu Ser Arg Ala Ala Gln Lys Gly Phe Asn Arg Asp Val Leu Lys
820 825 830
His Leu Lys Arg Thr Lys Asn Ile Ser Ser Leu Ser Ala His Ser Gln
835 840 845
Ser Glu Ala Leu Ser Leu Glu Glu Val Arg Val Arg Val Val His Val
850 855 860
Leu Gly Arg Leu Gly Gly Gln Val Asn Lys Asn Leu Leu Thr Gly Val
865 870 875 880
Ser Ser Arg Asp Cys Leu Arg Lys Cys Val Ala Trp Asp Pro Gln Arg
885 890 895
Arg Leu Ser Phe Ala Val Pro Phe Pro Asp Met Lys Pro Val Val His
900 905 910
Leu Asp Glu Phe Leu Pro Arg Val Ser Glu Leu Ala Leu Ser Ala Gly
915 920 925
Asp Arg Arg Thr Lys Val Ala Ala Cys Glu Leu Leu His Ser Met Val
930 935 940
Val Phe Met Leu Gly Lys Ala Asn Gln Met Pro Asp Gly Gly Gln Gly
945 950 955 960
Pro Pro Pro Met Tyr Gln Leu Tyr Arg Arg Thr Leu Pro Val Leu Leu
965 970 975
Arg Leu Ala Cys Asp Val Asp Gln Val Thr Arg Gln Leu Phe Glu Pro
980 985 990
Leu Val Met Gln Leu Ile His Trp Phe Thr Asn Asn Lys Lys Phe Glu
995 1000 1005
Ser Gln Asp Thr Val Ala Leu Leu Glu Thr Ile Leu Asp Gly Ile
1010 1015 1020
Val Asp Pro Val Asp Ser Thr Leu Arg Asp Phe Ser Gly Arg Cys
1025 1030 1035
Ile Gln Glu Phe Leu Lys Trp Ser Ile Lys Gln Thr Thr Pro Gln
1040 1045 1050
Gln Gln Glu Asn Ser Pro Val Asn Thr Lys Ser Leu Phe Lys Arg
1055 1060 1065
Leu Tyr Ser Phe Ala Leu His Pro Asn Ala Phe Lys Arg Leu Gly
1070 1075 1080
Ala Ala Leu Ala Phe Asn Asn Ile Tyr Arg Glu Phe Arg Glu Glu
1085 1090 1095
Glu Ala Leu Val Glu Gln Phe Val Phe Glu Ala Leu Val Thr Tyr
1100 1105 1110
Val Glu Ser Leu Ala Leu Ala His Ala Asp Asp Arg Ser Leu Gly
1115 1120 1125
Thr Ala Gln Gln Cys Cys Asp Ala Val Asp His Leu Ala Arg Ile
1130 1135 1140
Ile Glu Lys Lys His Val Ser Leu Asn Lys Ala Lys Asn Arg Arg
1145 1150 1155
Arg Pro Arg Gly Phe Pro Pro Ala Ala Ser Leu Cys Leu Ser Asp
1160 1165 1170
Val Val Leu Trp Leu Phe Ala His Cys Gly Arg Pro Gln Thr Glu
1175 1180 1185
Cys Arg His Lys Ser Ile Glu Leu Phe Tyr Lys Phe Val Pro Leu
1190 1195 1200
Leu Pro Gly Asn Lys Ser Pro Ser Leu Trp Leu Arg Asp Val Ile
1205 1210 1215
Gln Lys Glu Asp Ile Ser Phe Leu Ile Asn Thr Phe Glu Gly Gly
1220 1225 1230
Gly Glu Thr Cys Asp Arg Pro Ser Gly Ile Leu Ala Gln Pro Thr
1235 1240 1245
Leu Ser His Leu Arg Gly Pro Phe Ser Leu Arg Ala Val Leu Gln
1250 1255 1260
Trp Met Asp Met Leu Leu Ala Ala Leu Glu Cys Tyr Asn Thr Phe
1265 1270 1275
Leu Gly Ala Arg Thr Leu Glu Ala Ala Gln Ile Ile Gly Pro Asp
1280 1285 1290
Thr Gln Ser Ser Leu Trp Lys Ala Val Ala Phe Phe Leu Glu Ser
1295 1300 1305
Ile Ala Leu Gln Asp Ile Ser Ala Ala Glu Lys Cys Phe Gly Ala
1310 1315 1320
Arg Ala Ala Gly Glu Arg Pro Ser Pro Gln Glu Gly Glu Arg Tyr
1325 1330 1335
Asn Tyr Ser Lys Cys Thr Ala Val Val Arg Val Leu Glu Phe Cys
1340 1345 1350
Thr Thr Leu Leu Gly Ile Ser Thr Asp Ala Ala Trp Lys Leu Leu
1355 1360 1365
Gly Thr Gly Ser Cys Ser Thr Asn Leu Met Arg Leu Leu Val Thr
1370 1375 1380
Thr Leu Cys Ala Pro Ser Ser Val Gly Phe Asn Val Gly Asp Val
1385 1390 1395
Arg Val Met Asp His Leu Pro Asp Val Cys Val Gly Leu Leu Lys
1400 1405 1410
Ala Leu Lys Pro Ser Pro Tyr Cys Asp Ala Leu Glu Thr Leu Leu
1415 1420 1425
Arg Ala Glu Val Pro Ala Arg Ser Ile Glu Glu Leu Cys Ala Val
1430 1435 1440
Asp Leu Tyr Cys Pro Asp Ala His Val Ser Arg Ala Arg Leu Ala
1445 1450 1455
Ser Val Val Ser Ala Cys Lys Gln Leu His Arg Ala Gly Phe Leu
1460 1465 1470
His Val Thr Ala Pro Ser Gln Ser Thr Glu Gln Gln His Ser Pro
1475 1480 1485
Gly Thr Glu Leu Leu Ser Leu Val Tyr Lys Ser Ile Ala Pro Gly
1490 1495 1500
Val Glu Gly Gln Cys Leu Pro Ser Leu Asp Pro Ser Cys Arg Arg
1505 1510 1515
Leu Ala Ser Gly Leu Leu Glu Leu Ala Phe Ala Tyr Gly Gly Leu
1520 1525 1530
Cys Glu Arg Leu Val Gly Leu Leu Leu Asp Thr Ala Val Val Ser
1535 1540 1545
Met Pro Val Ser Gly Ala Ser Lys Arg Gly Ile Val Thr Phe Ser
1550 1555 1560
His Gly Gln Tyr Phe Tyr Ser Leu Phe Ser Glu Thr Ile Asn Thr
1565 1570 1575
Glu Leu Leu Lys Asn Val Asp Leu Ala Val Leu Glu Leu Leu Lys
1580 1585 1590
Ser Ser Val Asp Asn Pro Lys Met Val Ser Ala Val Leu Asn Gly
1595 1600 1605
Leu Leu Asp Gln Ser Phe Arg Asp Arg Gly Ser Gln Lys Gln Gln
1610 1615 1620
Gly Leu Lys Leu Ala Ser Thr Ile Leu Gln His Trp Trp Arg Cys
1625 1630 1635
Asp Ala Trp Trp Ala Glu Gly Ser Ala Pro Asp Gly Lys Met Ala
1640 1645 1650
Val Leu Thr Leu Leu Ala Lys Ile Leu Gln Ile Asp Ser Ser Val
1655 1660 1665
Thr Phe Asn Ala Asn His Ser Ser Phe Pro Glu Val Phe Thr Thr
1670 1675 1680
Tyr Leu Ser Leu Leu Ala Asp Ser Asp Leu Gly Leu His Leu Lys
1685 1690 1695
Gly Gln Ala Val Val Leu Leu Pro Phe Phe Thr Ser Val Pro Cys
1700 1705 1710
Gly Arg Leu Glu Glu Leu Arg Cys Val Leu Glu Lys Leu Ile Val
1715 1720 1725
Ser Ser Phe Pro Met Lys Ser Glu Glu Phe Pro Pro Gly Thr Leu
1730 1735 1740
Arg Tyr Asn Asn Tyr Val Asp Cys Met Lys Lys Phe Leu Asp Ala
1745 1750 1755
Leu Glu Leu Ser Gln Ser Pro Met Leu Leu Gln Leu Met Thr Glu
1760 1765 1770
Ile Leu Cys Arg Glu Gln Gln His Val Met Glu Glu Leu Phe Gln
1775 1780 1785
Ser Thr Phe Arg Lys Ile Ala Arg Lys Ser Ser Cys Ala Thr Gln
1790 1795 1800
Leu Gly Leu Leu Glu Ser Val Tyr Arg Met Phe Arg Arg Asp Asp
1805 1810 1815
Leu Leu Ser Ser Val Thr Arg Gln Ala Ile Val Asp Arg Ala Leu
1820 1825 1830
Leu Thr Leu Leu Arg His Cys Asp Leu Arg Ala Leu Arg Asp Phe
1835 1840 1845
Phe Ser Arg Ile Val Val Asp Ala Ile Asp Val Leu Asn Ser Arg
1850 1855 1860
Phe Met Lys Leu Asn Glu Ser Ala Phe Asp Thr Gln Ile Thr Lys
1865 1870 1875
Lys Met Gly Tyr Tyr Lys Met Leu Asp Val Met Tyr Ser Arg Leu
1880 1885 1890
Pro Lys Asp Asp Val His Ser Lys Lys Ser Glu Ile Asn Gln Val
1895 1900 1905
Phe His Gly Ser Ser Ile Thr Glu Gly Asn Glu Leu Thr Lys Ala
1910 1915 1920
Leu Ile Lys Leu Cys His Asp Ala Phe Ser Glu Asn Met Ala Gly
1925 1930 1935
Glu Thr Arg Leu Leu Glu Arg Arg Arg Leu Tyr His Cys Ala Ala
1940 1945 1950
Tyr Asn Cys Ala Ile Ser Val Val Cys Cys Val Phe Thr Asp Leu
1955 1960 1965
Arg Phe Tyr Gln Gly Phe Leu Leu Ser Glu Lys Pro Glu Lys Asn
1970 1975 1980
Leu Leu Ile Phe Glu Asn Leu Ile Asp Leu Lys Arg Cys Tyr Thr
1985 1990 1995
Phe Pro Val Glu Val Glu Val Pro Met Glu Arg Lys Lys Lys Tyr
2000 2005 2010
Ile Glu Ile Arg Arg Glu Ala Arg Glu Ala Ala Ser Gly Asp Ser
2015 2020 2025
Gly Asn Pro Gln Tyr Met Ser Ser Leu Ser His Leu Ala Asp Ser
2030 2035 2040
Ser Leu Ser Glu Glu Met Ser Gln Phe Asp Phe Ser Thr Gly Val
2045 2050 2055
Gln Ser Tyr Ser Tyr Gly Ser Gln Asp Pro Lys Ser Thr Ala Gly
2060 2065 2070
Arg Leu Gln Lys Gln Glu Arg Arg Asp Ala Ala Val Leu Ser Asp
2075 2080 2085
Val Leu Glu Met Glu Met Asp Glu Leu Asn Gln His Glu Cys Met
2090 2095 2100
Ala Arg Met Val Ala Leu Leu Arg His Met Gln Thr Val Gln Ala
2105 2110 2115
Glu Gln Thr Gly Glu Glu Gly Ser Val Leu Ser Asp Leu Pro Pro
2120 2125 2130
Trp Met Lys Phe Leu Arg Asp Lys Leu Gly Asn Pro Ser Val Ser
2135 2140 2145
Leu Asn Ile Arg Leu Phe Leu Ala Lys Leu Val Ile Asn Ala Glu
2150 2155 2160
Glu Val Phe Arg Pro His Ala Lys His Trp Leu Gly Pro Leu Leu
2165 2170 2175
Gln Leu Val Val Ser Glu Asn Asn Gly Gly Asp Gly Ile His Tyr
2180 2185 2190
Met Val Val Glu Ile Val Ala Thr Val Leu Ser Trp Thr Gly Ile
2195 2200 2205
Ala Thr Pro Ala Gly Val Pro Lys Asp Glu Val Leu Ala Asn Arg
2210 2215 2220
Leu Leu His Phe Leu Met Lys His Val Phe His Pro Lys Arg Ala
2225 2230 2235
Val Phe Arg His Asn Leu Glu Ile Ile Lys Thr Leu Val Glu Cys
2240 2245 2250
Trp Lys Asp Cys Leu Ser Val Pro Tyr Arg Leu Ile Phe Glu Lys
2255 2260 2265
Phe Ser Ser Glu Asp Ser Asn Ser Lys Asp Asn Ser Ile Gly Ile
2270 2275 2280
Gln Leu Leu Gly Ile Val Met Ala Asn Asn Leu Pro Pro Tyr Asp
2285 2290 2295
Ser Lys Cys Gly Ile Glu Ser Met Lys Tyr Phe Lys Ala Leu Ala
2300 2305 2310
Ser Asn Met Ser Phe Val Arg His Lys Glu Val Tyr Ala Ala Ala
2315 2320 2325
Ala Glu Ala Leu Gly Leu Val Leu Arg Arg Leu Ala Glu Gly Glu
2330 2335 2340
Ser Met Leu Glu Glu Ser Val Cys Glu Leu Val Val Thr Gln Leu
2345 2350 2355
Lys Gln Leu Gln Asn Arg Met Glu Asp Lys Phe Ile Val Cys Leu
2360 2365 2370
Asn Arg Ala Thr Lys Asn Phe Pro Ser Leu Ala Asp Arg Phe Met
2375 2380 2385
Asn Thr Val Leu Phe Leu Leu Pro Arg Phe His Gly Val Met Lys
2390 2395 2400
Thr Leu Cys Leu Glu Val Val Leu Cys Arg Ala Glu Gln Ile Thr
2405 2410 2415
Asp Leu Tyr Leu His Leu Lys Ser Lys Asp Phe Val Gln Ile Met
2420 2425 2430
Arg His Arg Asp Asp Glu Arg Gln Lys Val Cys Leu Asp Ile Ile
2435 2440 2445
Tyr Lys Val Met Ala Lys Leu Lys Pro Val Glu Leu Arg Glu Leu
2450 2455 2460
Leu Ser Pro Val Val Glu Phe Leu Ser His Pro Ser Thr Arg Cys
2465 2470 2475
Arg Gly Gln Met Tyr Asp Ile Leu Met Trp Val His Asp Asn Tyr
2480 2485 2490
Arg Asp Pro Glu Ser Gln Ala Asp Gly Asp Ser Gln Glu Val Phe
2495 2500 2505
Lys Leu Ala Lys Asp Val Leu Ile Gln Gly Leu Thr Asp Glu Asn
2510 2515 2520
Pro Gly Leu Gln Leu Ile Ile Arg Asn Phe Trp Ser His Glu Thr
2525 2530 2535
Arg Leu Pro Ser Arg Thr Leu Asp Arg Leu Leu Ala Leu Asn Ser
2540 2545 2550
Leu Tyr Ser Pro Lys Ile Glu Met His Phe Leu Ser Leu Ala Thr
2555 2560 2565
Asp Phe Leu Leu Glu Met Thr Ser Met Ser Pro Asp Phe Arg Asn
2570 2575 2580
Pro Met Phe Glu His Pro Leu Ser Glu Cys Glu Phe Gln Glu Cys
2585 2590 2595
Ala Ile Arg Pro Asp Trp Arg Phe Arg Ser Thr Val Leu Thr Pro
2600 2605 2610
Leu Phe Val His Thr Gln Ala Ser Gln Ser Ala Val Gln Thr Arg
2615 2620 2625
Thr Gln Ala Gly Pro Pro Ser Ala Trp Gly Val Met Ala Gly Gln
2630 2635 2640
Val Arg Ala Thr Gln Gln Gln His Asp Phe Thr Pro Thr Gln Ser
2645 2650 2655
Ser Gly Gly Arg Gly Ser Tyr His Trp Leu Thr Gly Gly Ser Ile
2660 2665 2670
Asp Leu Leu Gly Asp Asp Met Ala Ser Ala Glu Glu Ser Ser Ser
2675 2680 2685
Ser Ser Leu Leu Phe Ala His Lys Arg Pro Glu Arg Ser Gln Arg
2690 2695 2700
Ala Thr Leu Met Ser Val Gly Pro Asp Phe Gly Lys Lys Arg Leu
2705 2710 2715
Gly Leu Pro Gly Asp Glu Val Asp Ser Gly Thr Lys Gly Ser Asp
2720 2725 2730
Asn Arg Ala Glu Ile Leu Arg Leu Arg Arg Arg Phe Leu Lys Asp
2735 2740 2745
Arg Glu Lys Leu Ser Leu Ile Tyr Ala Arg Lys Gly Val Asn Glu
2750 2755 2760
Gln Lys Arg Glu Lys Glu Ile Gln Ser Glu Leu Arg Leu Lys His
2765 2770 2775
Glu Ala Gln Val Val Leu Tyr Arg Ser Tyr Arg His Gly Asp Leu
2780 2785 2790
Pro Asp Val Gln Ile Pro His Ser Ser Leu Ile Val Pro Leu Gln
2795 2800 2805
Ala Val Ala Gln Arg Asp Pro Ile Val Ala Lys Gln Leu Phe Val
2810 2815 2820
Ser Leu Phe Ser Gly Ile Leu Lys Glu Thr Asp Lys Ser Lys Ala
2825 2830 2835
Ala Ala Glu Arg Leu Ser Ile Ala Gln Gln Leu Leu Gln Asp Leu
2840 2845 2850
Thr Arg Phe Leu Gly Thr Thr Phe Ser Phe Phe Pro Pro Phe Val
2855 2860 2865
Ser Cys Ile Gln Glu Val Ser Cys Arg His Thr Asp Leu Leu Ser
2870 2875 2880
Leu Asp Pro Ala Cys Val Ser Val Gly Gly Leu Ala Ser Leu Gln
2885 2890 2895
Gln Pro Gly Ala Ile Arg Leu Leu Glu Glu Ala Leu Leu His Leu
2900 2905 2910
Thr Pro Gln Glu Pro Pro Ala Lys Arg Ala Arg Arg Arg Pro Ser
2915 2920 2925
Leu Pro Pro Asp Thr Val Arg Trp Met Glu Leu Ala Lys Leu Tyr
2930 2935 2940
Arg Ser Ile Gly Glu Tyr Asp Ile Leu Arg Gly Ile Phe Ser Ser
2945 2950 2955
Glu Ile Gly Thr Lys Gln Ile Thr Gln Asp Ala Leu Leu Ala Glu
2960 2965 2970
Ala Arg Ser Asp Tyr Ser Glu Ala Ala Arg Leu Tyr Asn Glu Ala
2975 2980 2985
Leu Asn Lys Gln Glu Trp Ala Asp Gly Glu Pro Ala Glu Ala Glu
2990 2995 3000
Lys Asp Phe Trp Glu Leu Ala Ser Leu Asp Cys Tyr Asn Gln Leu
3005 3010 3015
Ala Glu Trp Gly Ser Leu Ala Tyr Cys Ser Thr Ala Thr Val Asp
3020 3025 3030
Gly Ala Ser Pro Pro Asp Leu Thr Lys Val Trp Ser Asp Pro Phe
3035 3040 3045
Tyr Gln Glu Ala Cys Leu Pro Ser Ile Met Arg Ser Lys Leu Lys
3050 3055 3060
Leu Leu Leu Gln Gly Ala Gly Asp Gln Thr Leu Leu Ser Phe Val
3065 3070 3075
Asp Gln Ala Val Thr Ser Glu Leu His Lys Ala Leu Leu Glu Leu
3080 3085 3090
His Tyr Ser Gln Glu Leu Ser Leu Leu Tyr Leu Leu Gln Asp Asp
3095 3100 3105
Val Asp Arg Ala Gln Tyr Tyr Ile Glu Asn Cys Ile Gln Ala Phe
3110 3115 3120
Met Gln Asn Tyr Ser Ser Ile Asp Ala Leu Leu His Arg Ser Arg
3125 3130 3135
Leu Thr Lys Leu Gln Ser Val Gln Thr Phe Ile Glu Leu Gln Glu
3140 3145 3150
Phe Ile Asn Phe Ile Ser Lys Gln Gly Asn Leu Ser Ser Gln Val
3155 3160 3165
Pro Leu Lys Arg Leu Leu Lys Thr Trp Thr Asn Arg Tyr Pro Asp
3170 3175 3180
Ala Lys Thr Asp Pro Met Thr Ile Trp Asp Asp Val Ile Thr Asn
3185 3190 3195
Arg Cys Phe Phe Leu Ser Lys Ile Glu Glu Lys Leu Ala Leu Leu
3200 3205 3210
Pro Asp Asp Ala Asp Val Gly Val Asp Gly Gly Gly Gly Pro Gly
3215 3220 3225
His Gln Val Glu Lys Glu Ala Gln Ser Leu Ile Ser Ser Cys Lys
3230 3235 3240
Phe Ser Met Lys Leu Glu Met Ile Ala Gly Ala Arg Lys Gln Ser
3245 3250 3255
Asn Phe Ser Leu Ala Met Lys Leu Leu Lys Glu Leu His Arg Glu
3260 3265 3270
Ala Arg Thr Arg Asp Asp Trp Leu Ala Arg Trp Val Gln Ser Tyr
3275 3280 3285
Cys Gln Leu Ser His Ser Arg Ala Arg Ala Gln Arg Pro Ser Glu
3290 3295 3300
Gln Leu Cys Thr Val Leu Arg Thr Val Ser Leu Leu Ala Gly Glu
3305 3310 3315
Ser Thr Leu Ser Asp Ser Ser Gly Asn Leu Pro Ser Ser Trp Asp
3320 3325 3330
Gln Asn Val Leu Leu Gly Thr Thr Tyr Arg Ile Met Ala Asp Ala
3335 3340 3345
Leu Ser Ser Glu Ser Ala Cys Leu Ala Glu Ile Glu Ala Ser Lys
3350 3355 3360
Ala Arg Arg Val Val Glu Leu Ser Gly Ser Ser Ser Glu Gly Thr
3365 3370 3375
Glu Glu Val Ala Ala Gly Leu Tyr Gln Arg Ala Phe His His Leu
3380 3385 3390
Ser Glu Ala Val Arg Thr Val Glu Glu Glu Ala Gly Pro Ser Thr
3395 3400 3405
Gln Gly Gln Gly Pro Val Ala Ala Met Ile Asp Ala Tyr Leu Thr
3410 3415 3420
Leu Ala Glu Phe Cys Asp Gln Gln Leu Arg Thr Gln Glu Glu Gly
3425 3430 3435
Pro Ala Val Phe Arg Ser Ala Asp Val Gln Ala Tyr Pro Ala Arg
3440 3445 3450
Val Val Asp Ser Thr Leu Lys Ala Leu Lys Leu Asp Ser Ser Glu
3455 3460 3465
Ala Arg Leu Lys Phe Pro Arg Leu Leu Gln Ile Val Glu Gln His
3470 3475 3480
Pro Glu Glu Thr Leu Ser Leu Met Thr Arg Glu Ile Ser Ser Ile
3485 3490 3495
Pro Cys Trp Gln Phe Ile Gly Trp Ile Ser His Met Val Ala Leu
3500 3505 3510
Leu Asp Lys Asp Glu Ala Ile Ala Val Gln Arg Thr Val Glu Asp
3515 3520 3525
Ile Ala Asp His Tyr Pro Gln Ala Ile Ile Tyr Pro Phe Ile Ile
3530 3535 3540
Ser Ser Glu Ser Tyr Ser Phe Lys Gly Thr Ser Ala Gly His Lys
3545 3550 3555
Asn Lys Glu Phe Val Ala Arg Ile Lys Ala Lys Leu Asp Arg Gly
3560 3565 3570
Gly Val Val Gln Asp Phe Ile Asn Ala Leu Glu Gln Leu Ser Asn
3575 3580 3585
Pro Asp Met Leu Phe Gln Asp Trp Met Glu Asp Met Lys Val Glu
3590 3595 3600
Leu Glu Lys Thr Pro Val Asn Lys Lys Lys Ile Glu Lys Met Tyr
3605 3610 3615
Glu Arg Met Tyr Ala Ala Leu Gly Asp Pro Gln Val Pro Gly Leu
3620 3625 3630
Gly Ser Phe Arg Arg Arg Phe Ile Gln Ala Phe Gly Lys Glu Phe
3635 3640 3645
Asp Lys His Phe Gly Arg Gly Gly Ser Lys Leu His Gly Met Arg
3650 3655 3660
Leu Gln Asp Phe Ser Val Ile Ala Ser Ser Leu Leu Glu Arg Met
3665 3670 3675
Gly Arg Ala Ser Lys Ala Pro Gly Asn Leu Lys Glu Phe Ser Pro
3680 3685 3690
Trp Leu Ser Asp Phe Arg Ala Glu Ala Leu Arg Asp Glu Leu Glu
3695 3700 3705
Val Pro Gly Gln Tyr Asp Gly Gly Gly Lys Pro Leu Pro Glu Tyr
3710 3715 3720
His Ala Arg Ile Ala Gly Phe Asp Glu Arg Val Lys Val Met Ala
3725 3730 3735
Ser Leu Arg Lys Pro Lys Arg Ile Val Ala His Gly His Asp Glu
3740 3745 3750
Arg Asp Tyr Pro Phe Leu Val Lys Gly Gly Glu Asp Leu Arg Gln
3755 3760 3765
Asp Gln Arg Val Gln Gln Leu Leu Gln Val Met Asn Gly Val Leu
3770 3775 3780
Ala Arg Asp Ala Ala Cys Ser Gln Arg Gly Leu Gln Leu Glu Thr
3785 3790 3795
Tyr Arg Val Val Pro Met Thr Ser Arg Leu Gly Leu Ile Glu Trp
3800 3805 3810
Ile Glu Asn Thr Cys Thr Leu Lys Glu Phe Leu Met Ser Asn Met
3815 3820 3825
Ser Gln Glu Glu Lys Ala Ala Tyr Thr Ser Gly Pro Thr Ala Pro
3830 3835 3840
Ala His Asp Tyr Arg Asn Trp Leu Met Arg Met Ser Gly Arg Arg
3845 3850 3855
Asp Pro Gly Ala Tyr Met Leu Met Phe Lys Gly Ala Ser Arg Thr
3860 3865 3870
Glu Thr Val Thr Ser Phe Arg Lys Arg Glu Ser Gln Val Pro Ala
3875 3880 3885
Asp Leu Leu Lys Arg Ala Phe Leu Arg Met Ser Thr Gly Pro Glu
3890 3895 3900
Ala Phe Leu Ala Leu Arg Ser His Phe Ala Ser Ser His Ala Leu
3905 3910 3915
Leu Cys Val Gly His Trp Ile Leu Gly Ile Gly Asp Arg His Leu
3920 3925 3930
Asn Asn Phe Met Val Ser Leu Glu Thr Gly Gly Val Ile Gly Ile
3935 3940 3945
Asp Phe Gly His Ala Phe Gly Ser Ala Thr Gln Phe Leu Pro Val
3950 3955 3960
Pro Glu Leu Met Pro Phe Arg Leu Thr Arg Gln Phe Ile Asn Leu
3965 3970 3975
Met Leu Pro Leu Lys Glu Thr Gly Leu Val Cys Ser Val Met Val
3980 3985 3990
Cys Ala Leu Arg Ala Leu Arg Ala Arg Pro Asp Leu Leu Ile Thr
3995 4000 4005
Thr Met Asp Val Phe Val Lys Glu Pro Ser Phe Asp Trp Arg Asn
4010 4015 4020
Phe Glu Gln Lys Met Leu Lys Lys Gly Gly Ser Trp Leu Gln Lys
4025 4030 4035
Val Asn Val Thr Glu Lys Asn Trp Tyr Pro Arg Gln Lys Val His
4040 4045 4050
Tyr Ala Lys Arg Lys Leu Ala Gly Ala Asn Pro Ala Val Ile Thr
4055 4060 4065
Cys Asp Glu Leu Phe Leu Gly His Glu Lys Ala Pro Ala Phe Arg
4070 4075 4080
Asp Tyr Val Ala Val Ala Arg Gly Ser Ser Asp His Asn Val Arg
4085 4090 4095
Ala Gln Glu Pro Glu Ser Gly Leu Ser Glu Glu Val Gln Val Lys
4100 4105 4110
Cys Leu Ile Asp Gln Ala Thr Asp Pro Asn Ile Leu Gly Arg Thr
4115 4120 4125
Trp Glu Gly Trp Glu Pro Trp Met
4130 4135
<210> 28
<211> 1160
<212> DNA
<213> Sus scrofa
<400> 28
gtgtgggtcg cagacgcggc tcggatcccg cgttgctgtg gctctggcgt aggctggtgg 60
ctacagctcc gattcgaccc ctagcctggg aacctccata tgccgctgga gtggaccaaa 120
gaaatggcaa aataaataaa taaagaaata aaaataaaga aaatcttaca tgtttaagag 180
tggaattatc agttattggc tataatatag gaagatcact tttggagatg taagaagtga 240
aattgtaggg cttaaaatat aaaaccactt ctgcgaagct ttaaactcta tctaaatgta 300
ccagctgagg cttttttttt tttttaatat attttaaaaa gtcctcaggt agggaaaata 360
aggaatgtat atatacctga aaatgctatg taatggaatc acagattata attttcatta 420
tgttccttat aatttcaaag ccaaataaaa acagtttatg atgagaactt ctacattaag 480
ttttgagttt gtttttatag agacattctt cctgagacac acatagagtt ttttgagcca 540
tggctgcacc cctttgcata tgagataatt ctgcagtcta cacggtcacc gctaattagt 600
ggtttctaca aattgctttc tgttgccgtg agaaatgcca agaagataaa atattttgag 660
gtaagcgttt tttggaggac atcgaatatt cctttgttta taggttgcgt gagtgtgtat 720
aagtgtatta taaaatacag cattatagtg tattgcagtt ttaagggata ttggttttat 780
gataatatat gtatgtatgt atttattttt ggtctttttt tgtcttttct agggctgcac 840
ccacggcata tggaggttcc caggccaggg gtcgaatcgg agttgttgcc gccagcctac 900
accacagcca cagcaacgcc agatctgagc cttgtctgtg acctatacta cagctcacag 960
caacactgga tgcttaaccc attgagtgag accagggatc aaacccgtaa cctcatggtt 1020
cctagtcgga tccattaacc actgtgccag gacgggaact cccaatatgt attttttaag 1080
aaaagtggta gtgtgagctg atggcactct ttttaaaaag ttaactagtt gccctccctg 1140
cacctggctg actatgtgag 1160
<210> 29
<211> 100
<212> RNA
<213> Artificial sequence
<400> 29
gaauuaucuc auaugcaaag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
<210> 30
<211> 100
<212> RNA
<213> Artificial sequence
<400> 30
agauaauucu gcagucuaca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
<210> 31
<211> 100
<212> RNA
<213> Artificial sequence
<400> 31
uuguagaaac cacuaauuag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
<210> 32
<211> 100
<212> RNA
<213> Artificial sequence
<400> 32
uaucuucuug gcauuucuca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
<210> 33
<211> 100
<212> RNA
<213> Artificial sequence
<400> 33
cucaaaauau uuuaucuucu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
<210> 34
<211> 100
<212> RNA
<213> Artificial sequence
<400> 34
uaugcaaagg ggugcagcca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
<210> 35
<211> 100
<212> RNA
<213> Artificial sequence
<400> 35
agaauuaucu cauaugcaaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
<210> 36
<211> 100
<212> RNA
<213> Artificial sequence
<400> 36
cagaauuauc ucauaugcaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
<210> 37
<211> 100
<212> RNA
<213> Artificial sequence
<400> 37
acacggucac cgcuaauuag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

Claims (10)

  1. Combination of sgrnas, consisting of sgrnas RAG1-g4 、sgRNA RAG2-g2 、sgRNA IL2RG-g7 And sgRNA PRKDC-g6 Composition;
    the sgRNA RAG1-g4 The target sequence binding region of (a) is as set forth in SEQ ID NO:9 from nucleotide 1 to nucleotide 20;
    the sgRNA RAG2-g2 The target sequence binding region of (a) is as set forth in SEQ ID NO:13 from nucleotide 1 to nucleotide 20;
    the sgRNA IL2RG-g7 The target sequence binding region of (a) is as set forth in SEQ ID NO:24 1 st to 20 th nucleotidesShown;
    the sgRNA PRKDC-g6 The target sequence binding region of (a) is as set forth in SEQ ID NO:34 from nucleotide 1 to nucleotide 20.
  2. 2. Plasmid combinations, consisting of carrying sgRNA RAG1-g4 Plasmid carrying sgRNA of gene RAG2-g2 Plasmid carrying sgRNA of gene IL2RG-g7 Plasmid and carrying sgRNA for genes PRKDC-g6 Plasmid composition of the genes;
    will sgRNA RAG1-g4 The coding sequence of the target sequence binding region of (2) is inserted into a pKG-U6gRNA vector to obtain a vector carrying sgRNA RAG1-g4 A plasmid of the gene; the sgRNA RAG1-g4 The target sequence binding region of (a) is as set forth in SEQ ID NO:9 from nucleotide 1 to nucleotide 20;
    will sgRNA RAG2-g2 The coding sequence of the target sequence binding region of (2) is inserted into a pKG-U6gRNA vector to obtain a vector carrying sgRNA RAG2-g2 A plasmid of the gene; the sgRNA RAG2-g2 The target sequence binding region of (a) is as set forth in SEQ ID NO:13 from nucleotide 1 to nucleotide 20;
    will sgRNA IL2RG-g7 The coding sequence of the target sequence binding region of (2) is inserted into a pKG-U6gRNA vector to obtain a vector carrying sgRNA IL2RG-g7 A plasmid of the gene; the sgRNA IL2RG-g7 The target sequence binding region of (a) is as set forth in SEQ ID NO:24 from nucleotide 1 to nucleotide 20;
    Will sgRNA PRKDC-g6 The coding sequence of the target sequence binding region of (2) is inserted into a pKG-U6gRNA vector to obtain a vector carrying sgRNA PRKDC-g6 A plasmid of the gene; the sgRNA PRKDC-g6 The target sequence binding region of (a) is as set forth in SEQ ID NO:34 from nucleotide 1 to nucleotide 20;
    plasmid pKG-U6gRNA is shown as SEQ ID NO: 3.
  3. 3. A kit comprising the sgRNA combination of claim 1 or the plasmid combination of claim 2; the kit is used as follows (a) or (b): (a) preparing a recombinant cell; (b) preparing an immunodeficiency animal model.
  4. 4. A kit according to claim 3, wherein: the kit also comprises a plasmid pKG-GE3; plasmid pKG-GE3 is shown in SEQ ID NO: 2.
  5. 5. Use of the sgRNA combination of claim 1 or the plasmid combination of claim 2 in the preparation of a kit; the kit is used as follows (a) or (b): (a) preparing a recombinant cell; (b) preparing an immunodeficiency animal model.
  6. 6. Use of the plasmid combination according to claim 2 and the plasmid pKG-GE3 according to claim 4 for the preparation of a kit; the kit is used as follows (a) or (b): (a) preparing a recombinant cell; (b) preparing an immunodeficiency animal model.
  7. 7. The use of the sgRNA combination of claim 1 or the plasmid combination of claim 2 or the kit of claim 3 or the kit of claim 4, as follows (a) or (b): (a) preparing a recombinant cell; (b) preparing an immunodeficiency animal model.
  8. 8. A method of preparing a recombinant cell comprising the steps of: will carry sgRNA RAG1-g4 Plasmid carrying sgRNA of gene RAG2-g2 Plasmid carrying sgRNA of gene IL2RG-g7 Plasmid carrying sgRNA of gene PRKDC-g6 The plasmid of the gene and plasmid pKG-GE3 are transfected into pig cells to obtain recombinant cells with mutation of RAG1 gene, RAG2 gene, IL2RG gene and PRKDC gene;
    carrying sgRNA RAG1-g4 Plasmid carrying sgRNA of gene RAG2-g2 Plasmid carrying sgRNA of gene IL2RG-g7 Plasmid carrying sgRNA and gene PRKDC-g6 The plasmid of the gene is the corresponding plasmid as described in claim 2;
    plasmid pKG-GE3 is the plasmid pKG-GE3 of claim 4.
  9. 9. The recombinant cell prepared by the method of claim 8.
  10. 10. Use of the recombinant cell of claim 9 in the preparation of an immunodeficient animal model.
CN202010946436.5A 2020-09-10 2020-09-10 System for preparing severe immunodeficiency pig source recombinant cells with RRIP four genes knocked out in combined mode Active CN112522257B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010946436.5A CN112522257B (en) 2020-09-10 2020-09-10 System for preparing severe immunodeficiency pig source recombinant cells with RRIP four genes knocked out in combined mode

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010946436.5A CN112522257B (en) 2020-09-10 2020-09-10 System for preparing severe immunodeficiency pig source recombinant cells with RRIP four genes knocked out in combined mode

Publications (2)

Publication Number Publication Date
CN112522257A CN112522257A (en) 2021-03-19
CN112522257B true CN112522257B (en) 2023-06-20

Family

ID=74978863

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010946436.5A Active CN112522257B (en) 2020-09-10 2020-09-10 System for preparing severe immunodeficiency pig source recombinant cells with RRIP four genes knocked out in combined mode

Country Status (1)

Country Link
CN (1) CN112522257B (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105813456A (en) * 2013-11-13 2016-07-27 建国大学校产业学校协力团 Recombination activating gene 2 gene targeting vector, production of scid-like miniature pigs by talen-mediated gene targeting and use thereof
CN109777834A (en) * 2019-02-25 2019-05-21 中国科学院广州生物医药与健康研究院 A kind of severe immune deficiency pig model and its construction method and application

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2016528890A (en) * 2013-07-09 2016-09-23 プレジデント アンド フェローズ オブ ハーバード カレッジ Therapeutic use of genome editing using the CRISPR / Cas system
US9616090B2 (en) * 2014-07-30 2017-04-11 Sangamo Biosciences, Inc. Gene correction of SCID-related genes in hematopoietic stem and progenitor cells

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105813456A (en) * 2013-11-13 2016-07-27 建国大学校产业学校协力团 Recombination activating gene 2 gene targeting vector, production of scid-like miniature pigs by talen-mediated gene targeting and use thereof
CN109777834A (en) * 2019-02-25 2019-05-21 中国科学院广州生物医药与健康研究院 A kind of severe immune deficiency pig model and its construction method and application

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
RAG2/IL2RG双基因缺陷小鼠杂交群体的建立;赵亚;吴朋朋;张彩勤;谭邓旭;赵勇;白冰;张海;师长宏;;实验动物科学(第04期);摘要 *
基因组编辑系统CRISPR-Cas9研究进展及其在猪研究中的应用;刘贵生;吴俊静;乔木;彭先文;梅书棋;;湖北农业科学(第24期);摘要 *

Also Published As

Publication number Publication date
CN112522257A (en) 2021-03-19

Similar Documents

Publication Publication Date Title
US20040072352A1 (en) Expression vector for animal cell containing nuclear matrix attachment region of interferon beta
CN112779292B (en) Method for constructing high-quality pig nuclear transplantation donor cells with high lean meat percentage and rapid growth and capable of resisting blue ear diseases and serial diarrhea diseases and application of donor cells
CN112779291B (en) Method for constructing high-quality pig nuclear transplantation donor cells with high lean meat percentage, fast growth, high reproductive capacity and resistance to series epidemic diseases and application thereof
CN112522260B (en) CRISPR system and application thereof in preparing TTN gene mutation dilated cardiomyopathy clone pig nuclear donor cells
CN112877362A (en) Gene editing system for constructing high-quality porcine nuclear transplantation donor cells with high fertility and capability of resisting porcine reproductive and respiratory syndrome and serial diarrhea diseases and application of gene editing system
CN112522309B (en) Severe immunodeficiency pig source recombinant cell, preparation method and kit thereof
CN112522261B (en) CRISPR system for preparing LMNA gene mutation dilated cardiomyopathy clone pig nuclear donor cell and application thereof
CN112522264B (en) CRISPR/Cas9 system causing congenital deafness and application thereof in preparation of model pig nuclear donor cells
CN113046388B (en) CRISPR system for constructing atherosclerosis pig nuclear transfer donor cells with double genes in combined knockout mode and application of CRISPR system
CN112522313B (en) CRISPR/Cas9 system for constructing depression cloned pig nuclear donor cells with TPH2 gene mutation
CN114958762B (en) Method for constructing nerve tissue specific overexpression humanized SNCA parkinsonism model pig and application
CN112522257B (en) System for preparing severe immunodeficiency pig source recombinant cells with RRIP four genes knocked out in combined mode
CN112522258B (en) Recombinant cell with IL2RG gene and ADA gene knocked out in combined mode and application of recombinant cell in preparation of immunodeficiency pig model
CN112522202B (en) Method for preparing ADDI four-gene combined knockout severe immunodeficiency swine-derived recombinant cell and special kit thereof
CN112522256B (en) CRISPR/Cas9 system and application thereof in construction of dystrophin gene-deficient porcine recombinant cells
CN112795566B (en) OPG gene editing system for constructing osteoporosis clone pig nuclear donor cell line and application thereof
CN112575033B (en) CRISPR system and application thereof in construction of SCN1A gene mutated epileptic encephalopathy clone pig nuclear donor cell
CN112899306B (en) CRISPR system and application thereof in construction of GABRG2 gene mutation cloned pig nuclear donor cells
CN112680444B (en) CRISPR system for OCA2 gene mutation and application thereof in construction of albino clone pig nuclear donor cells
CN112813101B (en) Gene editing system for constructing high-quality pig nuclear transplantation donor cells with high lean meat percentage and rapid growth and application thereof
CN112608941B (en) CRISPR system for constructing obese pig nuclear transplantation donor cells with MC4R gene mutation and application of CRISPR system
CN112680453B (en) CRISPR system and application thereof in construction of STXBP1 mutant epileptic encephalopathy clone pig nuclear donor cell
CN112522311B (en) CRISPR system for ADCY3 gene editing and application thereof in construction of obese pig nuclear transfer donor cells
CN113584078B (en) CRISPR system for double-target gene editing and application thereof in construction of depressive pig nuclear transfer donor cells
CN112522255B (en) CRISPR/Cas9 system and application thereof in construction of porcine recombinant cell with insulin receptor substrate gene defect

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant