CN107619829A - The method for carrying out GINS2 gene knockouts to mescenchymal stem cell using CRISPR cas systems - Google Patents

Abstract

GINS2 gene editings are carried out for mescenchymal stem cell using CRISPR cas9 systems the invention provides one kind, more particularly to a kind of foundation of the mescenchymal stem cell cell line of structure GINS2 gene knockouts.New synergistic protein CREnhancer1.0 is which used, intracellular CRISPR/Cas9 gene editings efficiency can be significantly improved.Mesenchymal stem cells MSCs GINS2 provided by the invention, which knocks out plasmid, has preferable genetic stability.

Description

GINS2 gene knockouts are carried out to mescenchymal stem cell using CRISPR-CAS systems Method

Technical field

The present invention provides one kind and carries out GINS2 gene editings for mescenchymal stem cell using CRISPR-cas systems, special It is not to be related to a kind of foundation of the mescenchymal stem cell cell line of structure GINS2 gene knockouts.

Background technology

Mescenchymal stem cell (mesenchymal stem cells, MSC), it is a kind of with the of self-replication capacity and multidirectional The adult stem cell of differentiation potential, this stem cell can develop into os osseum, cartilage, fat and other kinds of cell.Between fill Matter stem cell can receive transplanting, and they can grow into what type of cell and depend on its position being injected into.For example, by The mescenchymal stem cell of injection heart can form new tissue of health etc..

Mescenchymal stem cell (MSCs) is a kind of multipotential stem cell, comes from the mesoderm and ectoderm of mesoderm growing early stage.Mainly It is present in connective tissue and organ interstitial, it is the abundantest with content in myeloid tissue, because marrow is its main source, therefore It is referred to as mesenchymal stem cells MSCs.Mescenchymal stem cell belongs to non-terminally differentiated cells, its existing interstitial cell, there is endothelium again The feature of cell and epithelial cell.Mescenchymal stem cell is in vitro under specific inductive condition, can be divided into fat, cartilage, bone, The Various Tissues cell such as muscle, tendon, nerve, liver, cardiac muscle, beta Cell of islet and endothelium, after continuous passage culture and freezen protective Still there is multi-lineage potential.Whether autologous or allogenic mescenchymal stem cell, typically all without causing host's Immune response.Due to this immunological characteristic that mescenchymal stem cell possesses, make it in autoimmune disease and various replace Generation treatment etc. has wide potential applicability in clinical practice.The 26S Proteasome Structure and Function of histoorgan can be rebuild by autotransplantation, And immunological rejection can be avoided.

The clinical research of mescenchymal stem cell is carried out in many countries, and the U.S. have approved 60 remainder clinical tests, with The increasingly mature of mescenchymal stem cell and its correlation technique, China also have approved multinomial clinical test, has entered into mesenchyma and has done The stage of cell core technical research.The development of stem-cell research work, including the high match cell of country are strengthened energetically in China More authoritative research institutions and each place umbilical cord including genetic engineering Co., Ltd, cell products National Engineering Research Centre Into clinic is guided investigative technique by blood bank.It is used for the Therapy study for treating more than ten kind refractory diseases for mescenchymal stem cell, Except for promoting to recover hematopoiesis, being improved with candidate stem cell co-transplantation beyond leukaemia and refractory anemia etc., being additionally operable to the heart Cranial vascular disease, hepatic sclerosis, bone and muscle degenerative disease, brain and neurologic defict, senile dementia and lupus erythematosus and hard The Therapy study of the autoimmune diseases such as skin disease, the partial clinical result of the test having been achieved with are encouraging.Research so far Show, the mescenchymal stem cell in umbilical cord source is not only able to the ideal substitute as mesenchymal stem cells MSCs, and has Bigger application potential.Umbilical cord mesenchymal stem cells express the peculiar molecular marker of a variety of embryonic stem cells, have differentiation potential Greatly, multiplication capacity is strong, immunogenicity is low, the limitation of convenient material drawing, amoral ethics problem, is easy to the features such as preparation of industrialization, It is therefore possible to the multipotential stem cell as most potential applicability in clinical practice.

GINS2 is one of DNA replication dna complex GINS family members, and on human chromosome 16q24, its mRNA length is 1196bp, the protein that coding relative molecular mass is 21000.GINS is a kind of replicative helicase, before replication fork is moved to Open DNA double chain.Research shows that GINS family members play a role in the generation of cancer, as GINS family members are invading Be overexpressed in attacking property melanoma, also there is document to show, DNA replication dna GAP-associated protein GAP play the role of in different cells it is different, such as In terms of determining that centerbody replicates quantity and the pathogenetic different phase of disease, GINS has played certain function, particularly with dye The separation of colour solid is closely related.

It is and seldom in the report of tumour association area on GINS2 at present.In CN106620703 A, for people GINS2 The siRNA sequence of gene, rna interference vector and RNA interference slow virus, further have detected the heavy of GINS2 genes The silent influence of efficiency, GINS2-siRNA slow virus to tumor cell proliferation ability and level of apoptosis, as a result display use RNAi side Transferred person under method GINS2 genes expression after can effectively suppress the propagation of tumour cell and growth and promote its apoptosis, show GINS2 Gene is proto-oncogene, can be used as suppression by the expression of RNAi mode silence GINS2 genes as the target spot of oncotherapy The effective means of tumor development.But in this study, disturbed using SiRNA, methods described has knockout not thorough Bottom, it is impossible to the defects of stable knockout heredity.In (Integration of Genomic, Biologic, and Chemical Approaches to Target p53 Loss and Gain-of-Function in Triple Negative BreastCancer in), although refer to CRISPR/Cas can be used for MCM2, GINS2, C19orf43, ELOVL2, ARL4D, DNM3OS, FGFR2, IFIT2, MPPED2, B2M, ERRFI1, GLUL CASP4, CPED1, SPTLC2, CMTM6, CFH, CARS2, SUMF1, but a simply conception, do not implement.CRISPR modifications are carried out for different genes not simply easily to set Meter, it is necessary to overcome numerous obstacles, have greatly experiment difficult.

Versatility based on mescenchymal stem cell, controlled to study the mescenchymal stem cell of knockout GINS2 genes in cancer Function in terms for the treatment of, establishing the mescenchymal stem cell cell line of knockout GINS2 genes becomes particularly important.

The content of the invention

It is an object of the invention to provide a kind of mescenchymal stem cell of knockout GINS2 genes, prior art is effectively overcome The technological deficiency of heredity can not be stablized by carrying out interference using siRNA.

To achieve the above object, the present invention provides a kind of target of CRISPR-cas systems, according to GINS2 gene sequence Row, the specific selectable target site of design are following (dashed part represents PAM motifs)：

GINS2-sgRNA1:5’to 3’gcgtctcctccgggacgctgagg

GINS2-sgRNA2:5’to 3’ccgaggagaccgtgaggctctgg

GINS2-sgRNA3:5’to 3’attcctcgccgagaaggagctgg

GINS2-sgRNA4:5’to 3’gtcgcctgctccctccagagtgg

GINS2-sgRNA5:5’to 3’cctgctccctccagagtggatgg

GINS2-sgRNA6:5’to 3’gtggatggatgtagaaaagttgg

GINS2-sgRNA7:5’to 3’aatgcccagcccttactacatgg

GINS2-sgRNA8:5’to 3’tcccgaaggcagacgaaatccgg

GINS2-sgRNA9:5’to 3’ggcagacgaaatccggaccctgg

GINS2-sgRNA10:5’to 3’tgacagctttgtgagacagcagg

GINS2-sgRNA11:5’to 3’cagctttgtgagacagcaggagg

GINS2-sgRNA12:5’to 3’gctggataacttgaccttgatgg

GINS2-sgRNA13:5’to 3’ttgatggagatcaacaccagcgg

GINS2-sgRNA14:5’to 3’ccgcacgaacctccagcctctgg

GINS2-sgRNA15:5’to 3’tctggagagtactcagtctcagg

GINS2-sgRNA16:5’to 3’gtctcaggacttctagagaaagg

GINS2-sgRNA17:5’to 3’gatgcatgaaaaatgtgtgatgg

GINS2-sgRNA18:5’to 3’gaaaaatgtgtgatggtgcaagg

GINS2-sgRNA19:5’to 3’atggtgcaaggaatggattcagg

GINS2-sgRNA20:5’to 3’gtccttaaaacttagctccctgg

GINS2-sgRNA21:5’to 3’tccttaaaacttagctccctggg

GINS2-sgRNA22:5’to 3’tctccctagcagagccacttggg

GINS2-sgRNA23:5’to 3’tgcatggaagccatcacacttgg

GINS2-sgRNA24:5’to 3’gcaggtgttcagtgactggtagg

GINS2-sgRNA25:5’to 3’ctggtaggtgtagatacagcagg。

According to these target sites, it is as follows to design specific sgRNA：

GINS2-sgRNA1:5’to 3’gcgtctcctccgggacgctg

GINS2-sgRNA2:5’to 3’ccgaggagaccgtgaggctc

GINS2-sgRNA3:5’to 3’attcctcgccgagaaggagc

GINS2-sgRNA4:5’to 3’gtcgcctgctccctccagag

GINS2-sgRNA5:5’to 3’cctgctccctccagagtgga

GINS2-sgRNA6:5’to 3’gtggatggatgtagaaaagt

GINS2-sgRNA7:5’to 3’aatgcccagcccttactaca

GINS2-sgRNA8:5’to 3’tcccgaaggcagacgaaatc

GINS2-sgRNA9:5’to 3’ggcagacgaaatccggaccc

GINS2-sgRNA10:5’to 3’tgacagctttgtgagacagc

GINS2-sgRNA11:5’to 3’cagctttgtgagacagcagg

GINS2-sgRNA12:5’to 3’gctggataacttgaccttga

GINS2-sgRNA13:5’to 3’ttgatggagatcaacaccag

GINS2-sgRNA14:5’to 3’ccgcacgaacctccagcctc

GINS2-sgRNA15:5’to 3’tctggagagtactcagtctc

GINS2-sgRNA16:5’to 3’gtctcaggacttctagagaa

GINS2-sgRNA17:5’to 3’gatgcatgaaaaatgtgtga

GINS2-sgRNA18:5’to 3’gaaaaatgtgtgatggtgca

GINS2-sgRNA19:5’to 3’atggtgcaaggaatggattc

GINS2-sgRNA20:5’to 3’gtccttaaaacttagctccc

GINS2-sgRNA21:5’to 3’tccttaaaacttagctccct

GINS2-sgRNA22:5’to 3’tctccctagcagagccactt

GINS2-sgRNA23:5’to 3’tgcatggaagccatcacact

GINS2-sgRNA24:5’to 3’gcaggtgttcagtgactggt

GINS2-sgRNA25:5’to 3’ctggtaggtgtagatacagc

In order to improve gene editing efficiency, including synergistic protein is introduced into mescenchymal stem cell, the synergistic protein CREnhancer1.0 is by SEQ ID NO:Nucleotide sequence coded protein shown in 1.

Further, the synergistic protein is comprising a) or b)：

a)SEQ ID NO:The polynucleotide sequence of nucleotide sequence coded protein shown in 1；

b)SEQ ID NO:Amino acid sequence shown in 2.

Further, synergistic protein CREnhancer1.0 genes, the synergistic protein of structure EGFP marks are cloned CREnhancer1.0 Lentivirals, slow virus, modified stem cell are packed with GP2-293T cells.

Further, there is provided a kind of system for carrying out gene editing using CRISPR/Cas9 in mescenchymal stem cell, It is characterized in that the system includes：(1) it is used to express SEQ ID NO：The plasmid of CREnhancer1.0 genes described in 1； (2) plasmid for the expression PX330 that sgRNA is already inserted into (it can express sgRNA and cas9).

Further, sgRNA the and cas9 expression vectors can also be other expression vectors commonly used in the art.

To achieve the above object, the present invention also provides a kind of mescenchymal stem cell cell line of structure GINS2 gene knockouts Method, including editor's positive cell will be obtained in the gene editing system introducing mescenchymal stem cell, then breed, harvest The stem cell.

Specific mescenchymal stem cell is human marrow mesenchymal stem cell (hMSCs) PC015, is bought from Shanghai Ai Yan biologies Science and Technology Ltd..

The invention provides a kind of mescenchymal stem cell cell system, method of structure GINS2 gene knockouts, has following excellent Point：The present invention in mescenchymal stem cell, construct the cell line of GINS2 gene knockouts, screen and optimize obtain it is optimal SgRNA, knocks out efficiency high, and passage is stable.

Below by drawings and examples, technical scheme is described in further detail.

Brief description of the drawings

Fig. 1 PX330 plasmid figures；

SgRNA insertion points figure in Fig. 2 PX330；

25 sgRNA genetic marker efficiency schematic diagrames of Fig. 3；

Embodiment

Further illustrate that the present invention improves the technical scheme of the method for genome editorial efficiency below by specific embodiment.

The structure of embodiment 1, CRISPR expression vectors

GRNA design

According to the gene order of target gene, by the unique Optimization Design of applicant, specific screening obtains specific SgRNA form is as follows：

GINS2-sgRNA1:5’to 3’gcgtctcctccgggacgctg

GINS2-sgRNA2:5’to 3’ccgaggagaccgtgaggctc

GINS2-sgRNA3:5’to 3’attcctcgccgagaaggagc

GINS2-sgRNA4:5’to 3’gtcgcctgctccctccagag

GINS2-sgRNA5:5’to 3’cctgctccctccagagtgga

GINS2-sgRNA6:5’to 3’gtggatggatgtagaaaagt

GINS2-sgRNA7:5’to 3’aatgcccagcccttactaca

GINS2-sgRNA8:5’to 3’tcccgaaggcagacgaaatc

GINS2-sgRNA9:5’to 3’ggcagacgaaatccggaccc

GINS2-sgRNA10:5’to 3’tgacagctttgtgagacagc

GINS2-sgRNA11:5’to 3’cagctttgtgagacagcagg

GINS2-sgRNA12:5’to 3’gctggataacttgaccttga

GINS2-sgRNA13:5’to 3’ttgatggagatcaacaccag

GINS2-sgRNA14:5’to 3’ccgcacgaacctccagcctc

GINS2-sgRNA15:5’to 3’tctggagagtactcagtctc

GINS2-sgRNA16:5’to 3’gtctcaggacttctagagaa

GINS2-sgRNA17:5’to 3’gatgcatgaaaaatgtgtga

GINS2-sgRNA18:5’to 3’gaaaaatgtgtgatggtgca

GINS2-sgRNA19:5’to 3’atggtgcaaggaatggattc

GINS2-sgRNA20:5’to 3’gtccttaaaacttagctccc

GINS2-sgRNA21:5’to 3’tccttaaaacttagctccct

GINS2-sgRNA22:5’to 3’tctccctagcagagccactt

GINS2-sgRNA23:5’to 3’tgcatggaagccatcacact

GINS2-sgRNA24:5’to 3’gcaggtgttcagtgactggt

GINS2-sgRNA25:5’to 3’ctggtaggtgtagatacagc

According to above-mentioned gRNA, positive oligonucleotide sequence is obtained plus CACC at its 5' end, at the 5' ends of its complementary strand Reverse oligonucleotide sequence is obtained plus AAAC, is respectively synthesized forward and reverse oligonucleotide sequence, then by the sequence of synthesis Denaturation, annealing, obtain the double chain DNA fragment with BbsI cohesive ends, as follows：It is positive：5’- CACCNNNNNNNNNNNNNNNNNNNN is reverse：NNNNNNNNNNNNNNNNNNNNCAAA-5 ', denaturation, annealing system are：2μl The positive μ ll*NEBbuffer of 2 μ l reverse oligonucleotides chain (50 μM) of oligonucleotide chain (50 μM) 46 press following procedure in PCR instrument Operation：90 DEG C, 4min；70 DEG C, 10min；37 DEG C, 20min；25 DEG C, 20min.

Double chain oligonucleotide chain after annealing contains BbsI cohesive end, directly with by the pX330- of BbsI digestions U6-Chimeric_BB-CBh-hSpCas9 (hereinafter referred to as PX330) (SEQ ID NO.3) carrier is attached, can obtained PX330-gRNA-Cas9 recombinant plasmids.

Digestion system：39.3 μ l, 10*FD buffer of water 5,2 3.7 37 DEG C of water-baths of μ l (2 μ g) of μ l, PX330 of μ l, BbsI Plasmid after 2h digestions is directly reclaimed with glue reclaim kit.

Linked system：The μ l of annealed product 0.5, the μ l of PX330 plasmids 2 μ 1,5*ligation buffer 2 of linearisation, T4DNA Ligase (3units/ μ 1), 1 μ l, the connection product that water 4.5 μ l, 16 DEG C of water-bath 2h obtains above-mentioned steps convert JM109 competent cells, Amp+ LB flat boards are coated on, picking positive colony connects bacterium, and 37 DEG C of shaking tables shake bacterium and stayed overnight, plasmid extraction Kit extracts plasmid and carries out sequencing identification, obtains PX330-gRNA plasmids.

Embodiment 2 clones synergistic protein CREnhancer1.0 and carrier construction

Synergistic protein CREnhancer1.0 genes are cloned, the method synthesized by full genome, obtain SEQ ID NO：1 institute The gene order stated, it is respectively 5'- according to upstream and downstream primer sequence using the sequence as template ATGCAGGAGAACCTGGCCCCCTG-3', 5'-CAGGCAGCTCACGCTCCTCTCG-3', primer and full-length genome are by Shanghai Sheng Gong Co., Ltds synthesize.PCR reaction amplification CREnhancer1.0 gene target gene fragments, amplification reaction system are as follows:95 DEG C, 40s, 57 DEG C, 1min, 72 DEG C, 1min, 72 DEG C, 10min, circulate 35 times, PCR primer by Shanghai Sheng Gong Co., Ltds carry out Sequencing, by sequencing, with reference to SEQ ID NO：1 matching completely.Then, the PCR target gene expanded is connected to empty carrier On slow virus carrier pHIV-CS-CDF-CG-PRE, expanded by PCR, digestion, sequencing the methods of identify recombined lentivirus vector. Successfully constructed with reference to proof recombined lentivirus vector.Then by the recombined lentivirus vector plasmid with helper plasmid together coinfection Human marrow mesenchymal stem cell (hMSCs) PC015, people's bones of CREnhancer1.0 genes can be expressed to be packaged into by restructuring Marrow interstital stem cell.By PCR Screening and Identifications, the stem cell of stable transfection is applied for subsequent gene editor.

Applications of the CRISPR/Cas9 of embodiment 3 in bone marrow interstital stem cell

CRISPR/Cas9 based on the pBGN plasmids of fusion containing BSD-fsEGFP edits carrier

(1) BSD-fsEGFP fusions：Using Standard PCR, BSD genes known to amplification, 5 '-PCR primer band HindIII sites, 3 '-PCR primer introduce I-SceI and EcoRI sites.PCR primer (BSD) is inserted into EGFP plasmid (EGFP cores The sequence that nucleotide sequence is known in the art, such as shown in sequence 1 and sequence 2 in CN105647968A) in CMV drivings and HindIII and EcoRI sites between EGFP code areas, generate the plasmid pBGN, BSD- of the fusion containing BSD-fsEGFP FsEGFP fusion nucleotides sequences are classified as shown in sequence 3 and sequence 4 in CN105647968A).The fusion is by CMV Driving or PGK driving son drivings, but EGFP is inactive due to frameshit, therefore claim fsEGFP.

5 '-PCR primer is

CTCAAGCTTAACTAAACCATGGCCAAGCCTTTGTCTCAAGAAG,

3 '-PCR primer is

AGAATTCCAGTAGGGATAACAGGGTAATGCCAGGTCCGCCCTCCCACACATAACCAGAG。

(2) plasmid pBGN, expression plasmid cotransfection bone marrow interstital stem cell prepared by embodiment 1 will be tested.With untransfected The stem cell of the synergy gene of embodiment 2 as positive control, meanwhile, by the parallel transfectional cell of GFP expression plasmids routinely To determine transfection efficiency, the CRISPR/Cas9 gene editing relative efficiencies obtained are corrected using transfection efficiency.

(4) after transfecting 2-3 days, measured by flow cytometry GFP is utilized⁺The frequency of cell.

(5) the CRISPR/Cas9 gene editing relative efficiencies of specific sgRNA mediations are calculated.This relative efficiency is by GFP sun Property cell frequencies and transfection efficiency ratio represent, as a result as shown in Figure 3.We have found that the synergistic protein of untransfected embodiment 2 Stem cell in GFP positive cells frequency be significantly lower than transfected embodiment 2 synergistic protein cell.Wherein at 25 In sgRNA, only GINS2-sgRNA7 and GINS2-sgRNA23 have preferable gene editing effect.Prepared using empty carrier Negative control there is no a GFP positive cells, wherein P values are respectively less than 0.01, have statistical significance.

Bone marrow interstital stem cell GINS2-sgRNA23 (is obtained after being edited using GINS2-sgRNA23 progress CRISPR Stem cell) and bone marrow interstital stem cell GINS2-sgRNA7 stablize Secondary Culture, after culture 40 instead of, by for GINS2PCR is sequenced, and it is still mutant inactive to find the gene, maintains the effect that gene is knocked.This absolutely proves, this The system that knocks out of invention has preferable stability.

It should be noted last that the above embodiments are merely illustrative of the technical solutions of the present invention and it is unrestricted, although ginseng The present invention is described in detail according to preferred embodiment, it will be understood by those within the art that, can be to the present invention Technical scheme modify or equivalent substitution, without departing from the spirit and scope of technical solution of the present invention.

Sequence table

<110>Luoyang Xuan Zhi bio tech ltd

<120>The method for carrying out GINS2 gene knockouts to mescenchymal stem cell using CRISPR-CAS systems

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1578

<212> DNA

<213>Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 1

atgcaggaga acctggcccc ctggggcgag ctggccaccg acaacatcat cctgaccgtg 60

cccaccacca acctgcaggc cctgaaggac cccgagcccg tgctgaggct gtgggacgag 120

atgatgcagg ccgtggccag gctggccgcc gagcccttcc ccttcaggag gcccgagagg 180

atcgtggccg acgtgcagat cagcgccggc tggatgcaca gcggctaccc catcatgtgc 240

cacctggaga gcgtgaagga gatcatcaac gagatggaca tgaggagcag gggcgtgtgg 300

ggccccatcc acgagctggg ccacaaccag cagaggcacg gctgggagtt ccccccccac 360

accaccgagg ccacctgcaa cctgtggagc gtgtacgtgc acgagaccgt gctgggcatc 420

cccagggccc aggcccacga ggccctgagc ccccccgaga gggagaggag gatcaaggcc 480

cacctgggca agggcgcccc cctgtgcgac tggaacgtgt ggaccgccct ggagacctac 540

ctgcaggtgc tgagcaggaa cagcggcagg aggggcgtgg acggcaggct ggtgcacacc 600

tgcatcaagg ccggcgccgt gaggtggctg gccaggggcc agaccggcaa ggtgggcgtg 660

aacaccaacc tgaaggacct gtgccccctg ctgagcgagc acggcctgca gtgcagcctg 720

gagccccacc tgaacagcga cctgtgcgtg tactgctgca aggcctacag cgacaaggag 780

gccaagcagc tgcaggagtt cgtggccgag ggcggcggcc tgctgatcgg cggccaggcc 840

tggtggtggg ccagccagaa ccccggccac tgccccctgg ccggcttccc cggcaacatc 900

atcctgaact gcttcggcct gagcatcctg ccccagaccc tgaaggccgg ctgcttcccc 960

gtgcccaccc ccgagatgag gagctaccac ttcaggaagg ccctgagcca gttccaggcc 1020

atcctgaacc acgagaacgg caacctggag aagagctgcc tggccaagct gagggtggac 1080

ggcgccgcct tcctgcagat ccccgccgag ggcgtgcccg cctacatcag cctgcacagg 1140

ctgctgagga agatgctgag gggcagcggc ctgcccgccg tgagcaggga gaaccccgtg 1200

gccagcgaca gctacgaggc cgccgtgctg agcctggcca ccggcctggc ccacagcggc 1260

accgactgca gccagctggc ccagggcctg ggcacctgga cctgcagcag cagcctgtac 1320

cccagcaagc accccatcac cgtggagatc aacggcatca accccggcaa caacgactgc 1380

tgggtgagca ccggcctgta cctgctggag ggccagaacg ccgaggtgag cctgagcgag 1440

gccgccgcca gcgccggcct gagggtgcag atcggctgcc acaccgacga cctgaccaag 1500

gccaggaagc tgagcagggc ccccatggtg acccaccagt gctggatgga caggaccgag 1560

aggagcgtga gctgcctg 1578

<210> 2

<211> 526

<212> PRT

<213>Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 2

Met Gln Glu Asn Leu Ala Pro Trp Gly Glu Leu Ala Thr Asp Asn Ile

1 5 10 15

Ile Leu Thr Val Pro Thr Thr Asn Leu Gln Ala Leu Lys Asp Pro Glu

20 25 30

Pro Val Leu Arg Leu Trp Asp Glu Met Met Gln Ala Val Ala Arg Leu

35 40 45

Ala Ala Glu Pro Phe Pro Phe Arg Arg Pro Glu Arg Ile Val Ala Asp

50 55 60

Val Gln Ile Ser Ala Gly Trp Met His Ser Gly Tyr Pro Ile Met Cys

65 70 75 80

His Leu Glu Ser Val Lys Glu Ile Ile Asn Glu Met Asp Met Arg Ser

85 90 95

Arg Gly Val Trp Gly Pro Ile His Glu Leu Gly His Asn Gln Gln Arg

100 105 110

His Gly Trp Glu Phe Pro Pro His Thr Thr Glu Ala Thr Cys Asn Leu

115 120 125

Trp Ser Val Tyr Val His Glu Thr Val Leu Gly Ile Pro Arg Ala Gln

130 135 140

Ala His Glu Ala Leu Ser Pro Pro Glu Arg Glu Arg Arg Ile Lys Ala

145 150 155 160

His Leu Gly Lys Gly Ala Pro Leu Cys Asp Trp Asn Val Trp Thr Ala

165 170 175

Leu Glu Thr Tyr Leu Gln Val Leu Ser Arg Asn Ser Gly Arg Arg Gly

180 185 190

Val Asp Gly Arg Leu Val His Thr Cys Ile Lys Ala Gly Ala Val Arg

195 200 205

Trp Leu Ala Arg Gly Gln Thr Gly Lys Val Gly Val Asn Thr Asn Leu

210 215 220

Lys Asp Leu Cys Pro Leu Leu Ser Glu His Gly Leu Gln Cys Ser Leu

225 230 235 240

Glu Pro His Leu Asn Ser Asp Leu Cys Val Tyr Cys Cys Lys Ala Tyr

245 250 255

Ser Asp Lys Glu Ala Lys Gln Leu Gln Glu Phe Val Ala Glu Gly Gly

260 265 270

Gly Leu Leu Ile Gly Gly Gln Ala Trp Trp Trp Ala Ser Gln Asn Pro

275 280 285

Gly His Cys Pro Leu Ala Gly Phe Pro Gly Asn Ile Ile Leu Asn Cys

290 295 300

Phe Gly Leu Ser Ile Leu Pro Gln Thr Leu Lys Ala Gly Cys Phe Pro

305 310 315 320

Val Pro Thr Pro Glu Met Arg Ser Tyr His Phe Arg Lys Ala Leu Ser

325 330 335

Gln Phe Gln Ala Ile Leu Asn His Glu Asn Gly Asn Leu Glu Lys Ser

340 345 350

Cys Leu Ala Lys Leu Arg Val Asp Gly Ala Ala Phe Leu Gln Ile Pro

355 360 365

Ala Glu Gly Val Pro Ala Tyr Ile Ser Leu His Arg Leu Leu Arg Lys

370 375 380

Met Leu Arg Gly Ser Gly Leu Pro Ala Val Ser Arg Glu Asn Pro Val

385 390 395 400

Ala Ser Asp Ser Tyr Glu Ala Ala Val Leu Ser Leu Ala Thr Gly Leu

405 410 415

Ala His Ser Gly Thr Asp Cys Ser Gln Leu Ala Gln Gly Leu Gly Thr

420 425 430

Trp Thr Cys Ser Ser Ser Leu Tyr Pro Ser Lys His Pro Ile Thr Val

435 440 445

Glu Ile Asn Gly Ile Asn Pro Gly Asn Asn Asp Cys Trp Val Ser Thr

450 455 460

Gly Leu Tyr Leu Leu Glu Gly Gln Asn Ala Glu Val Ser Leu Ser Glu

465 470 475 480

Ala Ala Ala Ser Ala Gly Leu Arg Val Gln Ile Gly Cys His Thr Asp

485 490 495

Asp Leu Thr Lys Ala Arg Lys Leu Ser Arg Ala Pro Met Val Thr His

500 505 510

Gln Cys Trp Met Asp Arg Thr Glu Arg Ser Val Ser Cys Leu

515 520 525

<210> 3

<211> 8506

<212> DNA

<213>Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 3

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaaataag 300

gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttg ttttagagct 360

agaaatagca agttaaaata aggctagtcc gtttttagcg cgtgcgccaa ttctgcagac 420

aaatggctct agaggtaccc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 480

ccaacgaccc ccgcccattg acgtcaatag taacgccaat agggactttc cattgacgtc 540

aatgggtgga gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc 600

caagtacgcc ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tgtgcccagt 660

acatgacctt atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta 720

ccatggtcga ggtgagcccc acgttctgct tcactctccc catctccccc ccctccccac 780

ccccaatttt gtatttattt attttttaat tattttgtgc agcgatgggg gcgggggggg 840

ggggggggcg cgcgccaggc ggggcggggc ggggcgaggg gcggggcggg gcgaggcgga 900

gaggtgcggc ggcagccaat cagagcggcg cgctccgaaa gtttcctttt atggcgaggc 960

ggcggcggcg gcggccctat aaaaagcgaa gcgcgcggcg ggcgggagtc gctgcgacgc 1020

tgccttcgcc ccgtgccccg ctccgccgcc gcctcgcgcc gcccgccccg gctctgactg 1080

accgcgttac tcccacaggt gagcgggcgg gacggccctt ctcctccggg ctgtaattag 1140

ctgagcaaga ggtaagggtt taagggatgg ttggttggtg gggtattaat gtttaattac 1200

ctggagcacc tgcctgaaat cacttttttt caggttggac cggtgccacc atggactata 1260

aggaccacga cggagactac aaggatcatg atattgatta caaagacgat gacgataaga 1320

tggccccaaa gaagaagcgg aaggtcggta tccacggagt cccagcagcc gacaagaagt 1380

acagcatcgg cctggacatc ggcaccaact ctgtgggctg ggccgtgatc accgacgagt 1440

acaaggtgcc cagcaagaaa ttcaaggtgc tgggcaacac cgaccggcac agcatcaaga 1500

agaacctgat cggagccctg ctgttcgaca gcggcgaaac agccgaggcc acccggctga 1560

agagaaccgc cagaagaaga tacaccagac ggaagaaccg gatctgctat ctgcaagaga 1620

tcttcagcaa cgagatggcc aaggtggacg acagcttctt ccacagactg gaagagtcct 1680

tcctggtgga agaggataag aagcacgagc ggcaccccat cttcggcaac atcgtggacg 1740

aggtggccta ccacgagaag taccccacca tctaccacct gagaaagaaa ctggtggaca 1800

gcaccgacaa ggccgacctg cggctgatct atctggccct ggcccacatg atcaagttcc 1860

ggggccactt cctgatcgag ggcgacctga accccgacaa cagcgacgtg gacaagctgt 1920

tcatccagct ggtgcagacc tacaaccagc tgttcgagga aaaccccatc aacgccagcg 1980

gcgtggacgc caaggccatc ctgtctgcca gactgagcaa gagcagacgg ctggaaaatc 2040

tgatcgccca gctgcccggc gagaagaaga atggcctgtt cggaaacctg attgccctga 2100

gcctgggcct gacccccaac ttcaagagca acttcgacct ggccgaggat gccaaactgc 2160

agctgagcaa ggacacctac gacgacgacc tggacaacct gctggcccag atcggcgacc 2220

agtacgccga cctgtttctg gccgccaaga acctgtccga cgccatcctg ctgagcgaca 2280

tcctgagagt gaacaccgag atcaccaagg cccccctgag cgcctctatg atcaagagat 2340

acgacgagca ccaccaggac ctgaccctgc tgaaagctct cgtgcggcag cagctgcctg 2400

agaagtacaa agagattttc ttcgaccaga gcaagaacgg ctacgccggc tacattgacg 2460

gcggagccag ccaggaagag ttctacaagt tcatcaagcc catcctggaa aagatggacg 2520

gcaccgagga actgctcgtg aagctgaaca gagaggacct gctgcggaag cagcggacct 2580

tcgacaacgg cagcatcccc caccagatcc acctgggaga gctgcacgcc attctgcggc 2640

ggcaggaaga tttttaccca ttcctgaagg acaaccggga aaagatcgag aagatcctga 2700

ccttccgcat cccctactac gtgggccctc tggccagggg aaacagcaga ttcgcctgga 2760

tgaccagaaa gagcgaggaa accatcaccc cctggaactt cgaggaagtg gtggacaagg 2820

gcgcttccgc ccagagcttc atcgagcgga tgaccaactt cgataagaac ctgcccaacg 2880

agaaggtgct gcccaagcac agcctgctgt acgagtactt caccgtgtat aacgagctga 2940

ccaaagtgaa atacgtgacc gagggaatga gaaagcccgc cttcctgagc ggcgagcaga 3000

aaaaggccat cgtggacctg ctgttcaaga ccaaccggaa agtgaccgtg aagcagctga 3060

aagaggacta cttcaagaaa atcgagtgct tcgactccgt ggaaatctcc ggcgtggaag 3120

atcggttcaa cgcctccctg ggcacatacc acgatctgct gaaaattatc aaggacaagg 3180

acttcctgga caatgaggaa aacgaggaca ttctggaaga tatcgtgctg accctgacac 3240

tgtttgagga cagagagatg atcgaggaac ggctgaaaac ctatgcccac ctgttcgacg 3300

acaaagtgat gaagcagctg aagcggcgga gatacaccgg ctggggcagg ctgagccgga 3360

agctgatcaa cggcatccgg gacaagcagt ccggcaagac aatcctggat ttcctgaagt 3420

ccgacggctt cgccaacaga aacttcatgc agctgatcca cgacgacagc ctgaccttta 3480

aagaggacat ccagaaagcc caggtgtccg gccagggcga tagcctgcac gagcacattg 3540

ccaatctggc cggcagcccc gccattaaga agggcatcct gcagacagtg aaggtggtgg 3600

acgagctcgt gaaagtgatg ggccggcaca agcccgagaa catcgtgatc gaaatggcca 3660

gagagaacca gaccacccag aagggacaga agaacagccg cgagagaatg aagcggatcg 3720

aagagggcat caaagagctg ggcagccaga tcctgaaaga acaccccgtg gaaaacaccc 3780

agctgcagaa cgagaagctg tacctgtact acctgcagaa tgggcgggat atgtacgtgg 3840

accaggaact ggacatcaac cggctgtccg actacgatgt ggaccatatc gtgcctcaga 3900

gctttctgaa ggacgactcc atcgacaaca aggtgctgac cagaagcgac aagaaccggg 3960

gcaagagcga caacgtgccc tccgaagagg tcgtgaagaa gatgaagaac tactggcggc 4020

agctgctgaa cgccaagctg attacccaga gaaagttcga caatctgacc aaggccgaga 4080

gaggcggcct gagcgaactg gataaggccg gcttcatcaa gagacagctg gtggaaaccc 4140

ggcagatcac aaagcacgtg gcacagatcc tggactcccg gatgaacact aagtacgacg 4200

agaatgacaa gctgatccgg gaagtgaaag tgatcaccct gaagtccaag ctggtgtccg 4260

atttccggaa ggatttccag ttttacaaag tgcgcgagat caacaactac caccacgccc 4320

acgacgccta cctgaacgcc gtcgtgggaa ccgccctgat caaaaagtac cctaagctgg 4380

aaagcgagtt cgtgtacggc gactacaagg tgtacgacgt gcggaagatg atcgccaaga 4440

gcgagcagga aatcggcaag gctaccgcca agtacttctt ctacagcaac atcatgaact 4500

ttttcaagac cgagattacc ctggccaacg gcgagatccg gaagcggcct ctgatcgaga 4560

caaacggcga aaccggggag atcgtgtggg ataagggccg ggattttgcc accgtgcgga 4620

aagtgctgag catgccccaa gtgaatatcg tgaaaaagac cgaggtgcag acaggcggct 4680

tcagcaaaga gtctatcctg cccaagagga acagcgataa gctgatcgcc agaaagaagg 4740

actgggaccc taagaagtac ggcggcttcg acagccccac cgtggcctat tctgtgctgg 4800

tggtggccaa agtggaaaag ggcaagtcca agaaactgaa gagtgtgaaa gagctgctgg 4860

ggatcaccat catggaaaga agcagcttcg agaagaatcc catcgacttt ctggaagcca 4920

agggctacaa agaagtgaaa aaggacctga tcatcaagct gcctaagtac tccctgttcg 4980

agctggaaaa cggccggaag agaatgctgg cctctgccgg cgaactgcag aagggaaacg 5040

aactggccct gccctccaaa tatgtgaact tcctgtacct ggccagccac tatgagaagc 5100

tgaagggctc ccccgaggat aatgagcaga aacagctgtt tgtggaacag cacaagcact 5160

acctggacga gatcatcgag cagatcagcg agttctccaa gagagtgatc ctggccgacg 5220

ctaatctgga caaagtgctg tccgcctaca acaagcaccg ggataagccc atcagagagc 5280

aggccgagaa tatcatccac ctgtttaccc tgaccaatct gggagcccct gccgccttca 5340

agtactttga caccaccatc gaccggaaga ggtacaccag caccaaagag gtgctggacg 5400

ccaccctgat ccaccagagc atcaccggcc tgtacgagac acggatcgac ctgtctcagc 5460

tgggaggcga caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa aagaaaaagt 5520

aagaattcct agagctcgct gatcagcctc gactgtgcct tctagttgcc agccatctgt 5580

tgtttgcccc tcccccgtgc cttccttgac cctggaaggt gccactccca ctgtcctttc 5640

ctaataaaat gaggaaattg catcgcattg tctgagtagg tgtcattcta ttctgggggg 5700

tggggtgggg caggacagca agggggagga ttgggaagag aatagcaggc atgctgggga 5760

gcggccgcag gaacccctag tgatggagtt ggccactccc tctctgcgcg ctcgctcgct 5820

cactgaggcc gggcgaccaa aggtcgcccg acgcccgggc tttgcccggg cggcctcagt 5880

gagcgagcga gcgcgcagct gcctgcaggg gcgcctgatg cggtattttc tccttacgca 5940

tctgtgcggt atttcacacc gcatacgtca aagcaaccat agtacgcgcc ctgtagcggc 6000

gcattaagcg cggcgggtgt ggtggttacg cgcagcgtga ccgctacact tgccagcgcc 6060

ctagcgcccg ctcctttcgc tttcttccct tcctttctcg ccacgttcgc cggctttccc 6120

cgtcaagctc taaatcgggg gctcccttta gggttccgat ttagtgcttt acggcacctc 6180

gaccccaaaa aacttgattt gggtgatggt tcacgtagtg ggccatcgcc ctgatagacg 6240

gtttttcgcc ctttgacgtt ggagtccacg ttctttaata gtggactctt gttccaaact 6300

ggaacaacac tcaaccctat ctcgggctat tcttttgatt tataagggat tttgccgatt 6360

tcggcctatt ggttaaaaaa tgagctgatt taacaaaaat ttaacgcgaa ttttaacaaa 6420

atattaacgt ttacaatttt atggtgcact ctcagtacaa tctgctctga tgccgcatag 6480

ttaagccagc cccgacaccc gccaacaccc gctgacgcgc cctgacgggc ttgtctgctc 6540

ccggcatccg cttacagaca agctgtgacc gtctccggga gctgcatgtg tcagaggttt 6600

tcaccgtcat caccgaaacg cgcgagacga aagggcctcg tgatacgcct atttttatag 6660

gttaatgtca tgataataat ggtttcttag acgtcaggtg gcacttttcg gggaaatgtg 6720

cgcggaaccc ctatttgttt atttttctaa atacattcaa atatgtatcc gctcatgaga 6780

caataaccct gataaatgct tcaataatat tgaaaaagga agagtatgag tattcaacat 6840

ttccgtgtcg cccttattcc cttttttgcg gcattttgcc ttcctgtttt tgctcaccca 6900

gaaacgctgg tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt gggttacatc 6960

gaactggatc tcaacagcgg taagatcctt gagagttttc gccccgaaga acgttttcca 7020

atgatgagca cttttaaagt tctgctatgt ggcgcggtat tatcccgtat tgacgccggg 7080

caagagcaac tcggtcgccg catacactat tctcagaatg acttggttga gtactcacca 7140

gtcacagaaa agcatcttac ggatggcatg acagtaagag aattatgcag tgctgccata 7200

accatgagtg ataacactgc ggccaactta cttctgacaa cgatcggagg accgaaggag 7260

ctaaccgctt ttttgcacaa catgggggat catgtaactc gccttgatcg ttgggaaccg 7320

gagctgaatg aagccatacc aaacgacgag cgtgacacca cgatgcctgt agcaatggca 7380

acaacgttgc gcaaactatt aactggcgaa ctacttactc tagcttcccg gcaacaatta 7440

atagactgga tggaggcgga taaagttgca ggaccacttc tgcgctcggc ccttccggct 7500

ggctggttta ttgctgataa atctggagcc ggtgagcgtg gaagccgcgg tatcattgca 7560

gcactggggc cagatggtaa gccctcccgt atcgtagtta tctacacgac ggggagtcag 7620

gcaactatgg atgaacgaaa tagacagatc gctgagatag gtgcctcact gattaagcat 7680

tggtaactgt cagaccaagt ttactcatat atactttaga ttgatttaaa acttcatttt 7740

taatttaaaa ggatctaggt gaagatcctt tttgataatc tcatgaccaa aatcccttaa 7800

cgtgagtttt cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga 7860

gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg 7920

gtggtttgtt tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc 7980

agagcgcaga taccaaatac tgtccttcta gtgtagccgt agttaggcca ccacttcaag 8040

aactctgtag caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc 8100

agtggcgata agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg 8160

cagcggtcgg gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac 8220

accgaactga gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga 8280

aaggcggaca ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt 8340

ccagggggaa acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag 8400

cgtcgatttt tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg 8460

gcctttttac ggttcctggc cttttgctgg ccttttgctc acatgt 8506

<210> 4

<211> 23

<212> DNA

<213>Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 4

atgcaggaga acctggcccc ctg 23

<210> 5

<211> 22

<212> DNA

<213>Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 5

caggcagctc acgctcctct cg 22

<210> 6

<211> 20

<212> DNA

<213>Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 6

aatgcccagc ccttactaca 20

<210> 7

<211> 20

<212> DNA

<213>Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 7

tgcatggaag ccatcacact 20

Claims (6)

1. a kind of sgRNA, it is used for gene editing.

2. a kind of sgRNA, its sequence such as SEQ ID NO：6 or 7 is any shown.

A kind of 3. CRISPR-CAS systems for stem cell cytogene editor, it is characterised in that：The composition bag of system Include：（1）For expressing SEQ ID NO：The plasmid of CREnhancer1.0 genes described in 1；（2) it is used to express SEQ ID NO：6 Or 7 it is any shown in sgRNA PX330 plasmid.

4. system as claimed in claim 3, it is characterised in that：（1）Plasmid can imported into advance in gene editing cell, After screening obtains positive cell, then it is transferred to（2）Plasmid.

5. purposes of the system of claim 3 in the reagent for mesenchymal stem cells MSCs gene editing is prepared.

6. purposes as claimed in claim 5, wherein mesenchymal stem cells MSCs are human marrow mesenchymal stem cell (hMSCs) PC015。