CN114774468B - Allele molecular marker and anti-blue-ear-disease pig group construction method - Google Patents

Abstract

The invention discloses a novel allele molecular marker, application thereof in pig genetic breeding and a method for establishing a porcine reproductive and respiratory syndrome resistant pig population. Through designing sgRNA targeting cysteine-rich Scavenger receptor type 1M 130 gene (M130) ligand binding pocket LBP, guiding cas9 protease to cut LBP, inducing T mutation inserted in the middle of the base position of No. 5 homologous chromosome 63323077-63323078 to form T/T inserted homozygote gene, and the mutation frequency of the gene molecular marker is as high as 59.09%. Therefore, the defects that the randomness of gene editing is high, two animals with completely consistent mutant genes cannot be obtained, and the application in animal breeding cannot be realized are overcome. The technical method of the invention successfully introduces the gene molecular marker into the male parent and the female parent of 10 families of the white pig to construct the breeding group of the white pig with the anti-porcine reproductive and respiratory syndrome, and can cultivate new varieties/strains of the pigs with the anti-porcine reproductive and respiratory syndrome and consistent genes.

Description

Allele molecular marker and anti-blue-ear-disease pig group construction method

Technical Field

The invention relates to the technical field of animal genetic breeding, in particular to a novel allele molecular marker and a method for constructing a porcine reproductive and respiratory syndrome-resistant pig population.

Background

The Porcine Reproductive and Respiratory Syndrome (PRRS) is known as Porcine Reproductive and Respiratory Syndrome, and is named due to red and purple phenomena of ears, nipples, vulvas, abdomens, tails and legs of pigs in the onset of diseases, is one of the most serious viral epidemic diseases endangering the swine industry, has great influence on the global swine industry, and has been known as 'first-grade killer of the swine industry'. The disease is caused by Porcine Reproductive and Respiratory Syndrome Virus (PRRSV), and is typically characterized by adult porcine reproductive disorders, premature labor, miscarriage and stillbirth, as well as by respiratory abnormalities in piglets. Porcine reproductive and respiratory syndrome is an immunosuppressive disease, often secondary to infection by other pathogens. The blue-ear virus can be spread by air, contact, vaccine, drug injection and other modes, and can also be spread vertically among generations, and the infectivity is extremely strong. The disease is transmitted to China in the middle of the 90 th year of the last century, and is a virulent infectious disease with the highest morbidity and the greatest harm faced by domestic large-scale pig farms at present.

The prevention and control of the blue ear disease is difficult at present, and the disease has a tendency of increasing prevalence in China. According to the monitoring result of professor yanghchun of Chinese agriculture university on 39173 serum antibodies of 472 pig farms in different scales of 24 provinces (cities) in 2017, the method comprises the following steps: the total positive rate of the sample is 81 percent, which is equivalent to the detection condition in the past year. The positive pig farm accounts for 99.4% of the detection pig farm, and the negative pig farm only has 3. The application of vaccines against porcine reproductive and respiratory syndrome has been widely controversial and has plagued swine farms and industry alike. The inactivated vaccine has poor effect; the live vaccine has a good effect, but has limited protection coverage rate on infection of different strains and has the risk of strong virulence; moreover, the blind use of the live vaccine leads to the endless emergence of new recombinant strains, which greatly aggravates the difficulty degree of the control of the blue-ear disease. Therefore, the main target cell of the effective blue-ear virus is porcine alveolar macrophage, enters the alveolar macrophage through receptor-mediated endocytosis, is massively replicated, and destroys a porcine lung immune defense system.

However, most of the studies in the prior art are realized by editing genes at different positions in the LBP region of the M130 gene, the repair of incisions generated after gene editing is usually random, and it is difficult to prepare animals with completely consistent mutant genotypes, which only meets the creation of new materials for animals. This drawback limits gene editing breeding applications, since breeding applications prefer populations with completely consistent genotypes.

Still other studies have been directed to methods for replacing a gene segment of the LBP region of the porcine M130 gene with a partial gene segment of the Ligand-binding pocket (LBP) region of the human or other animal M130 gene, which usually requires the introduction of a foreign gene and increases the biosafety risk. In addition, the method greatly increases the selective pressure of the evolution and adaptation of the blue-ear virus, and possibly brings a disaster to the gene donor organism.

Disclosure of Invention

The invention aims to provide a novel allele molecular marker, application thereof in pig genetic breeding and a method for constructing a porcine reproductive and respiratory syndrome resistant pig group so as to solve the problems.

According to the first aspect of the invention, a novel allele molecular marker is provided, the novel allele molecular marker is obtained by means of gene editing, the gene molecular marker is characterized in that a T base is inserted in the middle of the base positions of No. 5 homologous chromosomes 63323077-63323078 of an Ssicrofa 11.1 genome version of a pig to form a T/T inserted homozygote gene, and the sequence of the novel allele molecular marker is shown as SEQ ID No. 5. It is known that the repair of nicks generated after gene editing is generally random and has no regular and recyclable mutation, and the random mutation mode of bases is basically impossible to realize when people want to obtain individuals with consistent genes in different families, let alone breeding populations and strains with corresponding functions, so that the defect of gene editing determines that the repair can only be applied to the preparation of new animal materials, and limits the application of the repair in large-scale animal breeding. However, the allele molecular marker and the preparation method thereof claimed by the invention can insert T in the middle of the base positions of No. 5 homologous chromosomes 63323077-63323078 at high frequency to form new homozygote alleles inserted with T/T, and the mutation frequency of the new alleles is as high as 59.09%, thereby providing possibility for realizing the application in animal breeding.

According to a second aspect of the present invention, there is provided a use of a novel allelic molecular marker in the preparation of a swine anti-blue ear disease clone, the use of the novel allelic molecular marker comprising the steps of:

1) Connecting the sgRNA protospacer sequence shown as SEQ ID No. 1 to PX330 plasmid to construct targeting vector pCRISPR-sgLBP, wherein the gene sequence of the pCRISPR-sgLBP vector is shown as SEQ ID No. 2;

2) Transfecting a porcine fetal fibroblast cell with the pCRISPR-sgLBP vector;

3) Selecting a homozygous positive cell line containing the novel allelic molecule marker of claim 1;

4) And (3) taking the screened positive cell line as a nuclear donor cell for nuclear transplantation, and carrying out nuclear transplantation to obtain the anti-blue-ear disease cloned pig.

Therefore, the method can achieve the following beneficial effects: 1. constructing a targeting vector pCRISPR-sgLBP by adopting the sgRNA protospacer sequence in the step 1), transfecting pig fetal fibroblasts, and inserting T into the middle of base positions of No. 5 homologous chromosomes 63323077-63323078 to form a T/T inserted homozygote gene, wherein the mutation frequency of the molecular marker of the gene is up to 59.09%, thereby providing possibility for application in animal breeding; 2. the gene editing method adopts a blind screening method, so that no foreign gene is introduced, and the obtained gene editing animal is safer.

According to a third aspect of the present invention, there is provided a use of a novel allelic molecular marker in the preparation of anti-blue ear disease cloned pigs, the method comprising the steps of:

1) The sgRNA mRNA shown in SEQ ID No. 6 and the cas9 mRNA sequence or the cas9 protein shown in SEQ ID No. 7 are transfected or injected into porcine fetal fibroblasts;

2) Selecting a homozygous positive cell line containing the novel allelic molecule marker of claim 1;

3) And (3) taking the screened positive cell line as a nuclear donor cell for nuclear transplantation, and carrying out nuclear transplantation to obtain the anti-blue-ear disease cloned pig.

Therefore, by transfecting or injecting sgRNA mRNA + cas9 mRNA/cas9 protein, new exogenous genes cannot be introduced, and the new exogenous genes cannot enter nuclear donor cells, so that the obtained positive anti-blue-ear disease cloned pig is safer.

According to a fourth aspect of the present invention, there is provided a use of a novel allelic molecular marker in the preparation of anti-blue ear disease cloned pigs, the method comprising the steps of: the sgRNA mRNA shown in SEQ ID No. 6 and the cas9 mRNA sequence or the cas9 protein shown in SEQ ID No. 7 are transfected or injected into a reconstructed embryo for nuclear transplantation, the reconstructed embryo is placed into a surrogate sow uterus, and the anti-blue ear disease cloned pig is obtained after delivery. Therefore, by transfection or injection of gRNA mRNA + cas9 mRNA/cas9 protein, no new foreign gene is introduced, and no new foreign gene enters the nuclear transplantation reconstructed embryo, so that the obtained positive anti-blue-ear disease cloned pig is safer.

According to a fifth aspect of the present invention, there is provided a method for constructing a breeding population of porcine reproductive and respiratory syndrome resistant pigs containing a novel allelic molecular marker, wherein the method comprises the following steps:

1) Transfecting pig fetal fibroblasts by a pCRISPR-sgLBP vector with a gene sequence shown as SEQ ID No. 2 or co-transfecting or injecting sgRNA mRNA with an mRNA sequence shown as SEQ ID No. 6 and cas9 mRNA sequence or cas9 protein shown as SEQ ID No. 7 into the pig fetal fibroblasts, wherein the fetal fibroblasts are obtained from the pregnant embryos of boars and sows which do not have a common ancestor in 3 generations after hybridization;

2) Selecting a positive porcine fetal fibroblast cell line containing the novel allelic marker of claim 1;

3) Preparing positive porcine fetal fibroblast cell lines of different porcine families containing the novel allelic molecular marker of claim 1 according to the method of steps 1) -2);

4) Preparing a nuclear transplantation reconstructed embryo by using the positive pig fetal fibroblast lines of different pig families in the step 3);

5) Pre-mixing the female and male reconstructed embryos of different families in the step 4) according to the proportion of 2;

6) Obtaining homozygous pigs of different pedigrees containing the novel allele molecular marker of claim 1 from F0 generation of clone pigs from different pedigrees at birth in step 5);

7) Expanding propagation by taking different family line F0 generation individuals in the step 6) as male parents and female parents according to a population successive breeding method;

8) After generation-by-generation propagation breeding, a homozygous anti-blue-ear-disease pig breeding population containing the novel allelic molecular marker set forth in claim 1 is obtained.

Therefore, the adopted targeting vector pCRISPR-sgLBP contains the sgRNA protospacer sequence shown in SEQ ID No. 1, and the sequence transfects pig fetal fibroblasts, so that high-frequency insertion mutation can be obtained, namely T is inserted in the middle of the base positions of No. 5 homologous chromosomes 63323077-63323078 to form new homozygote alleles of T/T insertion, and the mutation frequency of the new allele molecular marker is as high as 59.09%. The new allele molecular marker can appear at high frequency, so that the positive fetal fibroblast lines containing the new allele mutation of different families can be prepared, the positive fetal fibroblast lines with different genetic backgrounds of different families are utilized to construct reconstructed embryos for nuclear transplantation, the female and male reconstructed embryos of different families are pre-mixed according to the proportion of 2. Compared with the traditional gene editing method, the randomness of base mutation is very difficult to obtain homozygote mutant individuals, and the individuals with completely the same gene mutation in different genetic backgrounds of different families are obtained, so the existing gene editing method cannot be applied to genetic breeding and can only be used in the fields of disease treatment, xenogeneic organ transplantation or new transgenic material obtaining. The method overcomes the low frequency and randomness of gene editing random mutation, the mutation frequency of the obtained new homozygote allele reaches 59.09%, provides possibility and technical inspiration for the application of gene editing in genetic breeding in the future, and has profound significance. At present, T is inserted into the middle of the base positions of No. 5 homologous chromosomes 63323077-63323078 through the method, homozygote new allele molecular markers formed by T/T insertion are introduced into male parents and female parents of 10 families of the white pigs, and a breeding core group of the white pigs resistant to the blue ear disease is constructed. The technical method can also be used for blue-ear disease resistant breeding groups of different strains of Changbai pigs, duroc pigs, barkholda pigs, hanpu summer, pietrain blue, local pigs in China and the like, and lays a foundation for popularization and application of blue-ear disease resistant pigs.

In some embodiments, the individuals selected in each generation are detected after the propagation of the secondary generation breeding in step 8), and the individuals with the new allele as claimed in claim 1 are reserved as the female parent or the male parent of the secondary generation breeding for propagation.

According to the sixth aspect of the invention, the method for breeding the new strain of the anti-porcine reproductive and respiratory syndrome pigs is provided, wherein the method is used for breeding the strain of the anti-porcine reproductive and respiratory syndrome pigs by constructing a breeding group of the anti-porcine reproductive and respiratory syndrome pigs, and then performing propagation expansion and cross breeding. Therefore, the porcine reproductive and respiratory syndrome resistant strains prepared by the method contain T inserted in the middle of the base positions of No. 5 homologous chromosomes 63323077-63323078 to form a T/T inserted homozygote gene molecular marker, and are convenient to screen and apply: the blue-ear disease resistant pig strain prepared by the method is equivalent to the introduction of a single nucleotide molecular marker in the strain, and the marker refers to the insertion of T in the middle of the base positions of No. 5 homologous chromosome 63323077-63323078 to form the molecular marker of the T/T inserted homozygote gene. The present invention finds that only one molecular marker is needed to be introduced without completely deleting the LBP region, namely, T/T is inserted into a homologous chromosome, and complete resistance to the blue ear virus can be generated by changing 2 amino acids at the tail end of the LBP C. Therefore, the biological safety risk can be reduced to the maximum extent, the identification degree of the porcine reproductive and respiratory syndrome resistant pig group is improved, and the molecular marker screening method can lay a foundation for subsequent rapid breeding and popularization and application of the porcine reproductive and respiratory syndrome resistant pig.

According to a seventh aspect of the present invention, there is provided a method for genetic improvement of swine, wherein the method comprises the steps of:

t is inserted in the middle of the base position of the No. 5 homologous chromosome 63323077-63323078 from the prepared porcine breeding group for resisting the blue ear disease to form a T/T inserted homozygote gene molecularly-labeled homozygote individual, the T/T inserted homozygote gene is used as a male parent or a female parent to hybridize with a homologous strain or a homologous strain wild type pig to breed F1 heterozygote offspring, then the F1 generation heterozygote is hybridized with other F0 generation homozygote family male parents or female parent pigs to obtain F2 generation, the homozygote mutant gene individual is bred in the F2 generation to establish a new breeding group, and the aim of improving the existing variety is fulfilled.

Therefore, the breeding can be rapidly carried out through the screening of molecular markers, T is inserted in the middle of the base positions of 63323077-63323078 homologous chromosomes of No. 5 in an improved pig population to form the frequency of new homozygote alleles inserted by T/T, the resistance of the pig to the blue ear disease is greatly improved, the morbidity is reduced, the great production significance is realized, and the aim of improving the existing pig variety is finally achieved.

The invention has the beneficial effects that:

1. the novel allelic molecular markers claimed in the present invention have a high frequency of occurrence: the invention can obtain high-frequency homozygote new allele with T/T inserted in the middle of the base position of No. 5 homologous chromosome 63323077-63323078, and the mutation frequency of the new allele molecular marker is as high as 59.09%. Overcomes the defect that the gene marker can not be applied in genetic breeding due to random mutation.

2. The method can rapidly prepare the porcine reproductive and respiratory syndrome resistant pig breeding population: in the prior art, 2 animals with completely consistent mutant genes are difficult to obtain by using an M130 gene LBP region gene editing method in the process of nick repair, and subsequently, only a long ancestral line establishing method can be adopted to obtain a population with completely consistent genes, however, inbreeding is difficult to avoid in the breeding process of the ancestral line establishing method, and the success rate of breeding new varieties/strains is not high. The sgRNA target edited by the LBP of the M130 gene is designed, and due to the specificity of the gene sequence of the cutting position, in the process of repairing the incision by an intracellular repair mechanism, the present invention prefers the ins/ins T (TT insertion) mutation, and the mutation frequency is as high as 59.09%, such that the present invention is more favorable for generating different line progenitors with completely consistent genes, and is favorable for rapidly obtaining the number of the line progenitors required by the breeding basic group and constructing the breeding group. The novel method for quickly constructing the breeding group of the porcine reproductive and respiratory syndrome resistant pig, which is created by the invention, can obtain the construction of the breeding group of the porcine reproductive and respiratory syndrome resistant pig with completely consistent genes only by 1-2 generations. At present, T is inserted into the middle of the base positions of No. 5 homologous chromosomes 63323077-63323078 through the method, homozygote new allele molecular markers formed by T/T insertion are introduced into male parents and female parents of 10 families of the white pigs, and a breeding core group of the white pigs resistant to the blue ear disease is constructed. The technical method can also be used for the anti-blue-ear disease breeding groups of different varieties or strains of Changbai pigs, duroc pigs, barkha pigs, hanpu Xia, petland pigs, local pigs in China and the like, and lays a foundation for the popularization and application of the anti-blue-ear disease pigs.

3. The method has high safety: the gene editing means of the invention has high editing efficiency, only needs a simple blind screening method, does not need medicine assistance, does not generate cytotoxicity, has better screened cell activity, does not have exogenous gene insertion, and is safer.

4. The new strain of the porcine with the anti-porcine reproductive and respiratory syndrome prepared by the invention contains T inserted in the middle of the base position of the No. 5 homologous chromosome 63323077-63323078 to form a new homozygote allele molecular marker inserted by T/T, and is convenient for screening and application: the porcine reproductive and respiratory syndrome resistant pig strain prepared by the method is equivalent to the introduction of a single nucleotide molecular marker in the strain, and the molecular marker refers to the molecular marker of T/T inserted homozygote genes formed by inserting T in the middle of the base positions of No. 5 homologous chromosomes 63323077-63323078. The present invention finds that only one molecular marker is needed to be introduced, namely, T/T is inserted into homologous chromosome, and complete resistance to the blue-ear virus can be generated by changing 2 amino acids at the end of LBP C. Therefore, the biological safety risk can be reduced to the maximum extent, the identification degree of the porcine reproductive and respiratory syndrome resistant pig population is improved, and the molecular marker screening method can lay a foundation for subsequent rapid breeding and popularization and application of the porcine reproductive and respiratory syndrome resistant pig.

5. The targeting sites adopted by the invention have better safety, the quality of the cells screened by adopting the somatic cell screening technology is higher, the pregnancy rate of the cloned pigs prepared by using the targeting sites almost reaches the mean level (85%) of sexual reproduction, and the targeting sites are favorable for reducing the cost of cloning and colony construction breeding.

Drawings

FIG. 1 is a graph showing the result of gene alignment of the LBP region of M130 gene from different animals;

fig. 2 is a gene editing sgRNA design and mutation introduction position;

FIG. 3 is a schematic structural view of recombinant plasmid pCRISPR-sgLBP;

FIG. 4 is a graph of PCR results of the screened mutant cell clusters using vector plasmid 7 pair primers: wherein M is 2000bp Marker,1, 2, 3, 4 and 5 are respectively 5 large white pig fetal fibroblast M130 gene LBP region gene knockout positive cells, 6 is wild type large white pig fetal fibroblast, 7 is water as negative control, and 8 is carrier plasmid as positive control;

FIG. 5 shows the sequencing results of screening of pig M130 gene LBP region gene editing cell clone groups: wherein, a T allele is inserted in the middle of 1478-1479bp position of the LBP region gene coding region (cDNA sequence) of editing pig M130 gene, namely GTTG > GTTTG mutation;

FIG. 6 is a PCR detection result chart of the gene knockout pig tissue DNA: wherein M is a Marker of 2000bp, H2O is used as a blank control, 1 is a wild type large white pig, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 and 11 are 11 LBP gene knockout large white primary clone pigs respectively, and 12 is 1 wild type large white pig;

FIG. 7 is a comparison of the sequencing results of the DNA PCR products of the partially positive cloned pig ear skin tissues: wherein YY-LBP-insT/T-1, YY-LBP-ins T/T-2, YY-LBP-ins T/T-3, YY-LBP-ins T/T-4, YY-LBP-ins T/T-5, YY-LBP-ins T/T-6, YY-LBP-ins T/T-7, YY-LBP-ins T/T-8, YY-LBP-ins T/T-9, YY-LBP-ins T/T-10, YY-LBP-ins T/T-11 are respectively 11 LBP gene knockout pigs, wherein the base T marked in red is a base inserted relative to wild type large white pigs;

FIG. 8 is a graph of the results of WB results from M130 gene LBP region gene editing in lungs, spleen, lymph nodes and bone marrow of pigs and wild type pigs: wherein WT is wild type large white pig, and LBP-KO is LBP gene knock-out pig;

FIG. 9 shows the detection results of M130 gene LBP region gene knockout pigs and wild type pig challenge type NADC30 BL strains: wherein panel a shows the concentration of PRRSV virus in the serum of two swine populations after challenge (results are expressed as standard error of the mean of the populations); panel B shows the mean serum antibody levels of both populations after challenge: the result shows that the existence of the porcine reproductive and respiratory syndrome virus can not be completely detected in the pig population with the LBP region gene knockout of the M130 gene; the graph C shows the rectal temperature detection results of 14 consecutive days after the M130 gene LBP region gene knockout pig and the wild type pig challenge type NADC30 BL strain;

FIG. 10 is a diagram of a construction mode of an Ssc r.5:63323077-63323078ins/ins T new allele molecular marker anti-porcine reproductive and respiratory syndrome pig breeding core group.

Detailed Description

The present invention will be described in further detail with reference to examples.

Example 1: selection of M130 gene LBP gene region efficient editing target point

The NCBI gene comparison shows that the LBP region of the M130 gene of human, cattle and sheep only has a difference of a seventh amino acid (the result is shown in figure 1), mutation (Q > K) occurs, and the human, cattle and sheep cannot infect the PRRSV virus, and the site mutation is presumed to be a key part for binding the PRRSV virus to a cell membrane receptor. For LBP sequence, the target site is selected according to GN19NGG rule, GN19 is the targeting site, NGG is PAM site, the binding sequence of sgRNA protospacer is designed to be TGTTGTACTTCAACACACGACC (SEQ ID No: 1), the PAM recognition sequence is TGG, and the cutting site is located right at Q amino acid code (as shown in FIG. 2).

Example 2 introduction of high-frequency Gene mutation into the LBP region Gene of the M130 Gene of porcine genome, screening and detection method for establishing a line of porcine progenitor cells resistant to blue ear disease

2.1 construction of targeting vector pCRISPR-sgLBP

The sgRNAprotospacer gene fragment is entrusted to Nanjing Kirsi to be artificially synthesized and cloned to Bbs I linearized PX330 plasmid to construct a targeting vector pCRISPR-sgLBP, the structure of which is shown in figure 3, and the nucleotide sequence of which is shown in SEQ ID No. 2.

2.2, establishing a porcine progenitor cell line for resisting blue ear diseases.

Based on the new-method line of big white pigs, the super-grade or 1-grade boar ancestor without common ancestor (the minimum guarantee that no common ancestor exists in the 2 generations) within 10 generations is screened to ensure the universality of blood sources. And selecting the sow ancestor with no common ancestor within 10 generations (minimum guarantee that no common ancestor is within 2 generations) from the first-grade sows in the core group as a mating object of the 10 boar ancestors. The 10 boars and 10 sows are selected one by one, and no common ancestor exists in 3 generations between the sows to be bred and the boars. After mating, embryos were removed from pregnant sows that were successfully pregnant, washed three times with DMEM, digested for 2-4 hours with digestion medium (DMEM containing working concentrations of 1mg/ml collagenase IV, 5% FBS and 1% streptomycin) to bulk tissue, plated with 1ml serum (containing 1% streptomycin double antibody), and next day high-sugar DMEM (GlutaMAX) containing 12% FBS and streptomycin double antibody was added ^TM Additive) culture solution for 2-3 days to obtain fetal fibroblast (PEF).

The LONZA electroporation transfection system A-033 program was used to transfect 10ug pCRISPR-sgLBP plasmid into the porcine fetal fibroblasts obtained above, diluted to 20 cells/ml by limiting dilution method, and cultured continuously for 10 days at 38.5 ℃ in DMEM containing 15% fetal calf serum with 5% carbon dioxide concentration, 10-15 single cell colonies just occupying the whole 4-fold ocular field can be picked per 10cm plate, and transferred to 48-well culture plates for expansion culture. The primers in Table 1 were used to perform PCR detection on the single cell clone clusters, and the results are shown in FIG. 4, which indicates that the selected mutant cells (single cell clone clusters) do not contain vector gene components and foreign gene insertions.

TABLE 1 summary of random 7 primer pairs on vector plasmids

The obtained mutant cell clone groups are subjected to sequencing detection, and the results are shown in Table 2, and show that the quality and efficiency of the screened cells are ensured by a drug-free cell screening method, T is inserted into the middle of the base positions of 63323077-63323078 of the homologous chromosome 5 by a blind screening method, the editing efficiency of a new homozygote allele molecular marker forming T/T insertion (the new allele molecular marker is called as 'Ssc Chr.5:63323077-63323078ins/ins T' molecular marker for short hereinafter) is up to 59.09%, the introduction efficiency of T insertion mutation containing single allele (a T is inserted into the middle of the base positions of 32633077-63323078 of one chromosome of the homologous chromosome 5 to form a T/O inserted heterozygote molecular marker) is up to 45.45%, and the total frequency of T/T and T/O mutation is up to 75%. Solves the problem of poor repeatability of editing cell mutation genotype, lays a foundation for culturing different ancestors with completely consistent genotypes, and has great breeding value.

TABLE 2 statistics of mutation results introduced into LBP region of M130 gene in pig genome

Note: editing efficiency%: the number of cell clones subjected to editing accounts for the total number of picked monoclonals; T/T, wherein T insertion mutation is introduced into the pig genome M130 gene LBP region double allele, and the percentage of the T insertion mutation is the proportion of the number of T/T mutation clones in the total number of the editing cell clones; t/o porcine genome M130 gene LBP region has introduced T insertion mutation in one allele and one other base deletion.

The single cell colonies screened were further treated with LBP-F:5-atcggctaagcccactgtag-3 (SEQ ID No: 3), LBP-R primer: 5-agcccagatcttgtccacttc-3 (SEQ ID No: 4) is subjected to PCR and sequencing, a sequence obtained by sequencing is compared with a wild-type pig LBP gene sequence by DNAstar software, the sequencing peak map result is shown in figure 5, the sequencing result shows that T is inserted in the middle of the base position of No. 5 homologous chromosome 63323077-63323078, the cell clone group of the T/T inserted homozygous gene is defined as Ssc Chr.5: 63323077-323078 ins/ins T homozygous mutant cell group, the cell clone group is Ssc Chr.5: 63303277-633078 ins/ins T homozygous mutant cell, and the mutant cell clone group is subjected to propagation culture, so that the positive anti-blue-ear pig-disease pig-line Sss Chr.5: 63323077-6330323078 ins/ins T cell line is obtained. The sequence of the new allele molecular marker of the porcine reproductive and respiratory syndrome resistant Ssccr cell line Ssccr.5: 63323077-63323078ins/ins T cell line is shown as SEQ ID No. 5:

cactgtagttccctgcacagcacgctggccgcctccagagagaagtcagaatcacagacggtgccccacgtgtctccatgtTtgtacttcaacacgaccagagcagggaatgtcccctcc

example 3 preparation and detection of anti-blue ear disease Ssccr.5: 63323077-63323078ins/ins T New allele molecular marker Swine

3.1 preparation of New allele Ssccr.5: 63323077-63323078ins/ins T Gene pigs against blue ear disease

The screened porcine line progenitor Ssccr.5: 63323077-63323078ins/ins T cell line for resisting the blue ear disease is used as a nuclear donor for nuclear transplantation, and the nuclear donor cell is injected into an enucleated oocyte to construct a reconstructed embryo containing Sscr.5: 63323077-63323078ins/ins T homozygote mutation.

The mixed embryo transplantation method is adopted to ensure that each family boar and sow are born in balance: before the clone reconstruction embryo transplantation, female and male embryos of each family are mixed in advance according to the proportion of 2. The recipient sows were followed throughout pregnancy and feed management was adjusted until the cloned pigs were born with the LBP gene editing.

The results are shown in table 3, the somatic cell nuclear transfer constructs 6139 cloned reconstructed embryos which are transferred to the uteruses of 31 generation pregnant sows after 24h in vitro culture, wherein the pregnancy rate is 23 in the uterus of 31 generation pregnant sows and is 74.2 percent, and the pregnancy rate of 9 recipient sows of the second batch is up to 88.89 percent.

In total, 11 live animals were obtained, of which 1 died after birth. The cloned pig ear tissue was used to extract genomic DNA, PCR was performed using LBP-F and LBP-R primers, and sequencing was performed. The sequence obtained by sequencing is compared with the gene sequence of the pig M130 gene LBP region in the NCBI database, and the result is shown in Table 3, which shows that the pregnancy rate of the pig receptor sow edited and cloned by the LBP gene is up to 88 percent (the average value of the cloned pig is 39 percent), the pregnancy rate of the sow is close to the pregnancy level of the sow in normal reproduction, the litter average total litter size reaches 5 litter (the average value of the cloned pig is 1.6 litter/litter), and the technical method adopted by the invention has higher safety and greatly reduces the cloning cost.

TABLE 3 cloning transplantation and birth results of anti-PRRS pigs

3.2Sscr Chr.5

The results of PCR and sequencing tests on the obtained positive cloned pigs are shown in FIG. 6 and FIG. 7, and the results show that the cloned pigs containing Ssc Chr.5:63323077-63323078ins/ins T homozygous mutation are successfully obtained.

3.3 Ssccr Chr.5

The lung, spleen lymph node and bone marrow of 1 wild type large white pig and 1M 130 gene LBP region gene knockout pig were collected, total protein was extracted, quantified and then blocked with 8% SDS-PAGE gel, membrane transfer and 5% skim milk powder, and Anti-M130 antibody (abcam, ab87099, binding site M130 aa 1050-1150) was selected as the primary antibody, and HRP goat Anti rabbit IgG (Boshide, BA 1054) and GAPDH were used as the secondary antibody. The WB results obtained after the development are shown in FIG. 8, which indicates that the gene editing of the LBP region of the M130 gene in the pig tissues does not express the C-terminal protein of the M130 gene at all, and the C-terminal of the M130 gene is terminated early.

3.4Sscr Chr.5

2 LBP gene editing pigs (containing Ssc Chr.5:63323077-63323078ins/ins T homozygote mutation) and 6 wild type control pigs were selected for challenge testing in two monomer isolation vessels, respectively. 2ml 10 was injected intramuscularly in each pig at the beginning of the experiment ⁵ And (3) carrying out virus attack on TCID50 type NADC30 BL strains, and observing and recording fever and respiratory symptoms of the pigs continuously every day after virus attack. The serum of the virus-attacked pigs is collected on the 7 th, 10 th and 14 th days of virus attack to detect the antibody titer of the PRRSV and the virus RNA level, and the result is shown in fig. 9, and the virus attack test result shows that the anti-PRRSV pigs can not generate viremia, can not generate specific antibodies aiming at the PRRSV, have normal rectal temperature, can not cause adverse reactions to PRRSV infection, can generate complete resistance to the PRRSV, and can generate severe viremia to wild pigs.

The introduction of T/T insertion mutation into the LBP region of the M130 gene of the pig genome does not change Q amino acid in LBP, but leads to the replacement of two C-terminal amino acids HG of LBP by TW (LBP: SGRVEVQHG > SGRVEVQTW), the translation of LBP is terminated early and the mutant still obtains complete resistance to the blue ear virus, which indicates that the new allele molecular marker containing Sscr Chr.5:63323077-63323078ins/ins T is successfully prepared to resist the blue ear disease pig.

Example 4 additional methods for preparing anti-blue ear disease pigs containing Sscr Chr.5:63323077-63323078ins/ins T novel allelic molecular markers.

4.1, introducing the mRNA (shown as SEQ ID No:6 and 7) sequence of sgRNA mRNA + cas9 mRNA into fetal fibroblasts by transfection or injection, carrying out monoclonal screening, screening out a positive cell clone group which has No exogenous gene insertion and is marked by new allele molecules of homozygote of the T/T insertion and is inserted into the middle of the base position of No. 5 homozygote chromosome 63323077-63323078, and further expanding the positive cell clone group to obtain the positive porcine progenitor cell line of the anti-blue ear disease porcine line. And (3) carrying out nuclear transplantation by taking the obtained positive porcine progenitor cell line with the blue-ear disease resistance as a nuclear donor for nuclear transplantation, placing the obtained reconstructed embryo into a surrogate sow uterus, and obtaining the blue-ear disease resistance pig containing Ssc Chr.5:63323077-63323078ins/ins T new allele molecular marker after delivery.

4.2 the sgRNA shown in SEQ ID No. 6 and the cas9 mRNA sequence or the cas9 protein shown in SEQ ID No. 7 are transfected or injected into nuclear transplantation reconstructed embryos, positive reconstructed embryos containing Sscr Chr.5:63323077-63323078ins/ins T new allele molecular markers are screened after detection and are placed into surrogate sows, and anti-blue ear sick pigs containing Sscr Chr.5:63323077-63323078ins/ins T new allele molecular markers are obtained after delivery.

Example 5 Ssc Chr.5:63323077-63323078ins/ins T novel allele molecular marker anti-porcine reproductive and respiratory syndrome pig breeding population construction and method for breeding anti-porcine reproductive and respiratory syndrome strain containing novel allele Ssc Chr.5:63323077-63323078ins/ins T gene.

The method of the embodiment 1-4 is used for preparing homozygous male and female parents of the F0 generation anti-blue ear disease family containing Sscr.5: 63323077-63323078ins/ins T new allele molecular marker, hybridizing with homozygous female and male parents of other families respectively (the hybridization pattern is shown in figure 10) after sexual maturity to obtain a F1 generation breeding population, carrying out RT-PCR and sequencing detection on F1 generation individuals by LBP-F and LBP-R primers, and selecting and reserving F1 individuals containing sequences shown as SEQ ID No: 5. And then expanding the breeding population of the porcine reproductive and respiratory syndrome resistant pigs of the selected F1 generation individuals according to a population subculture breeding method, screening the selected offspring individuals, reserving offspring containing a sequence shown as SEQ ID No. 5 to improve the ratio of Ssc Chr.5:63323077-63323078ins/ins T genes, finally constructing an Ssc Chr.5:63323077-63323078ins/ins T new allele molecular marker porcine reproductive and core population of the porcine reproductive and respiratory syndrome resistant pigs, expanding the core population and finally forming the breeding population of the porcine reproductive and respiratory syndrome resistant pigs containing the Ssc Chr.5: 63323077-32633078 ins/ins T new allele molecular marker.

The obtained breeding population of the porcine reproductive and respiratory syndrome resistant pigs, which contain Ssc Chr.5:63323077-63323078ins/ins T new allele molecular markers, is subjected to propagation expansion and cross breeding to breed the new porcine reproductive and respiratory syndrome resistant pig strain.

By adopting the new method for quickly constructing the porcine reproductive and respiratory syndrome resistant pig breeding population, the porcine reproductive and respiratory syndrome resistant pig breeding population construction with completely consistent genes can be obtained only by 1-2 generations. At present, T is inserted into the middle of the base positions of No. 5 homologous chromosomes 63323077-63323078 by the method, homozygote gene molecular markers forming T/T insertion are introduced into male parents and female parents of 10 families of the white pig, and the breeding population of the white pig for resisting the blue ear disease is constructed. The technical method can also be used for the anti-blue-ear disease breeding groups of different varieties or strains of Changbai pigs, duroc pigs, barkha pigs, hanpu Xia, petland pigs, local pigs in China and the like, and lays a foundation for the popularization and application of the anti-blue-ear disease pigs.

Example 6, a method for genetically improving pigs.

T is inserted into the middle of the base position of No. 5 homologous chromosome 63323077-63323078 from the prepared porcine breeding population for resisting blue ear disease to form a T/T inserted homozygote gene molecularly-labeled homozygote individual, the T/T inserted homozygote gene is used as a male parent or a female parent to cross with a wild type pig of the same strain or the same variety to breed F1 heterozygote offspring, then the F1 heterozygote is crossed with other F0 generation homozygote family male parents or female parent pigs to obtain F2 generation, the homozygote mutant gene individual is bred in the F2 generation to establish a new breeding population, and the aim of improving the existing variety is fulfilled.

Therefore, the breeding can be rapidly carried out through the screening of molecular markers, T is inserted in the middle of the base positions of the No. 5 homologous chromosome 63323077-63323078in the improved pig population to form the frequency of new homozygote alleles inserted by T/T, the resistance of the pig to the blue ear disease is greatly improved, the morbidity is reduced, the great production significance is realized, and the aim of genetic improvement of the resistance of the existing pig breed is finally achieved.

What has been described above are only some of the embodiments of the invention directed to pigs. In other embodiments, use in other animals, such as cattle and sheep, may also be attempted. Persons of ordinary skill in the art adopting the methods of the present invention to treat other animals in a similar manner are within the scope of this patent.

Sequence listing

<110> Win food group Ltd

Guangdong China core seed science and technology Co Ltd

<120> novel allele molecular marker and anti-blue-ear disease pig group construction method

<130> 20220420

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Sus scrofa

<400> 1

tgttgtactt caacacgacc 20

<210> 2

<211> 8486

<212> DNA

<213> Sus scrofa

<400> 2

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccg gtcgtgttga agtacaacag ttttagagct agaaatagca agttaaaata 300

aggctagtcc gttatcaact tgaaaaagtg gcaccgagtc ggtgcttttt tgttttagag 360

ctagaaatag caagttaaaa taaggctagt ccgtttttag cgcgtgcgcc aattctgcag 420

acaaatggct ctagaggtac ccgttacata acttacggta aatggcccgc ctggctgacc 480

gcccaacgac ccccgcccat tgacgtcaat agtaacgcca atagggactt tccattgacg 540

tcaatgggtg gagtatttac ggtaaactgc ccacttggca gtacatcaag tgtatcatat 600

gccaagtacg ccccctattg acgtcaatga cggtaaatgg cccgcctggc attgtgccca 660

gtacatgacc ttatgggact ttcctacttg gcagtacatc tacgtattag tcatcgctat 720

taccatggtc gaggtgagcc ccacgttctg cttcactctc cccatctccc ccccctcccc 780

acccccaatt ttgtatttat ttatttttta attattttgt gcagcgatgg gggcgggggg 840

gggggggggg sggggcgggg gggggggggg ggsgrggsgg rgrggkgcgg cggcagccaa 900

tcagagcggc gcgctccgaa agtttccttt tatggcgagg cggcggcggc ggcggcccta 960

taaaaagcga agcgcgcggc gggcgggagt cgctgcgcgc tgccttcgcc ccgtgccccg 1020

ctccgccgcc gcctcgcgcc gcccgccccg gctctgactg accgcgttac tcccacaggt 1080

gagcgggcgg gacggccctt ctcctccggg ctgtaattag ctgagcaaga ggtaagggtt 1140

taagggatgg ttggttggtg gggtattaat gtttaattac ctggagcacc tgcctgaaat 1200

cacttttttt caggttggac cggtgccacc atggactata aggaccacga cggagactac 1260

aaggatcatg atattgatta caaagacgat gacgataaga tggccccaaa gaagaagcgg 1320

aaggtcggta tccacggagt cccagcagcc gacaagaagt acagcatcgg cctggacatc 1380

ggcaccaact ctgtgggctg ggccgtgatc accgacgagt acaaggtgcc cagcaagaaa 1440

ttcaaggtgc tgggcaacac cgaccggcac agcatcaaga agaacctgat cggagccctg 1500

ctgttcgaca gcggcgaaac agccgaggcc acccggctga agagaaccgc cagaagaaga 1560

tacaccagac ggaagaaccg gatctgctat ctgcaagaga tcttcagcaa cgagatggcc 1620

aaggtggacg acagcttctt ccacagactg gaagagtcct tcctggtgga agaggataag 1680

aagcacgagc ggcaccccat cttcggcaac atcgtggacg aggtggccta ccacgagaag 1740

taccccacca tctaccacct gagaaagaaa ctggtggaca gcaccgacaa ggccgacctg 1800

cggctgatct atctggccct ggcccacatg atcaagttcc ggggccactt cctgatcgag 1860

ggcgacctga accccgacaa cagcgacgtg gacaagctgt tcatccagct ggtgcagacc 1920

tacaaccagc tgttcgagga aaaccccatc aacgccagcg gcgtggacgc caaggccatc 1980

ctgtctgcca gactgagcaa gagcagacgg ctggaaaatc tgatcgccca gctgcccggc 2040

gagaagaaga atggcctgtt cggaaacctg attgccctga gcctgggcct gacccccaac 2100

ttcaagagca acttcgacct ggccgaggat gccaaactgc agctgagcaa ggacacctac 2160

gacgacgacc tggacaacct gctggcccag atcggcgacc agtacgccga cctgtttctg 2220

gccgccaaga acctgtccga cgccatcctg ctgagcgaca tcctgagagt gaacaccgag 2280

atcaccaagg cccccctgag cgcctctatg atcaagagat acgacgagca ccaccaggac 2340

ctgaccctgc tgaaagctct cgtgcggcag cagctgcctg agaagtacaa agagattttc 2400

ttcgaccaga gcaagaacgg ctacgccggc tacattgacg gcggagccag ccaggaagag 2460

ttctacaagt tcatcaagcc catcctggaa aagatggacg gcaccgagga actgctcgtg 2520

aagctgaaca gagaggacct gctgcggaag cagcggacct tcgacaacgg cagcatcccc 2580

caccagatcc acctgggaga gctgcacgcc attctgcggc ggcaggaaga tttttaccca 2640

ttcctgaagg acaaccggga aaagatcgag aagatcctga ccttccgcat cccctactac 2700

gtgggccctc tggccagggg aaacagcaga ttcgcctgga tgaccagaaa gagcgaggaa 2760

accatcaccc cctggaactt cgaggaagtg gtggacaagg gcgcttccgc ccagagcttc 2820

atcgagcgga tgaccaactt cgataagaac ctgcccaacg agaaggtgct gcccaagcac 2880

agcctgctgt acgagtactt caccgtgtat aacgagctga ccaaagtgaa atacgtgacc 2940

gagggaatga gaaagcccgc cttcctgagc ggcgagcaga aaaaggccat cgtggacctg 3000

ctgttcaaga ccaaccggaa agtgaccgtg aagcagctga aagaggacta cttcaagaaa 3060

atcgagtgct tcgactccgt ggaaatctcc ggcgtggaag atcggttcaa cgcctccctg 3120

ggcacatacc acgatctgct gaaaattatc aaggacaagg acttcctgga caatgaggaa 3180

aacgaggaca ttctggaaga tatcgtgctg accctgacac tgtttgagga cagagagatg 3240

atcgaggaac ggctgaaaac ctatgcccac ctgttcgacg acaaagtgat gaagcagctg 3300

aagcggcgga gatacaccgg ctggggcagg ctgagccgga agctgatcaa cggcatccgg 3360

gacaagcagt ccggcaagac aatcctggat ttcctgaagt ccgacggctt cgccaacaga 3420

aacttcatgc agctgatcca cgacgacagc ctgaccttta aagaggacat ccagaaagcc 3480

caggtgtccg gccagggcga tagcctgcac gagcacattg ccaatctggc cggcagcccc 3540

gccattaaga agggcatcct gcagacagtg aaggtggtgg acgagctcgt gaaagtgatg 3600

ggccggcaca agcccgagaa catcgtgatc gaaatggcca gagagaacca gaccacccag 3660

aagggacaga agaacagccg cgagagaatg aagcggatcg aagagggcat caaagagctg 3720

ggcagccaga tcctgaaaga acaccccgtg gaaaacaccc agctgcagaa cgagaagctg 3780

tacctgtact acctgcagaa tgggcgggat atgtacgtgg accaggaact ggacatcaac 3840

cggctgtccg actacgatgt ggaccatatc gtgcctcaga gctttctgaa ggacgactcc 3900

atcgacaaca aggtgctgac cagaagcgac aagaaccggg gcaagagcga caacgtgccc 3960

tccgaagagg tcgtgaagaa gatgaagaac tactggcggc agctgctgaa cgccaagctg 4020

attacccaga gaaagttcga caatctgacc aaggccgaga gaggcggcct gagcgaactg 4080

gataaggccg gcttcatcaa gagacagctg gtggaaaccc ggcagatcac aaagcacgtg 4140

gcacagatcc tggactcccg gatgaacact aagtacgacg agaatgacaa gctgatccgg 4200

gaagtgaaag tgatcaccct gaagtccaag ctggtgtccg atttccggaa ggatttccag 4260

ttttacaaag tgcgcgagat caacaactac caccacgccc acgacgccta cctgaacgcc 4320

gtcgtgggaa ccgccctgat caaaaagtac cctaagctgg aaagcgagtt cgtgtacggc 4380

gactacaagg tgtacgacgt gcggaagatg atcgccaaga gcgagcagga aatcggcaag 4440

gctaccgcca agtacttctt ctacagcaac atcatgaact ttttcaagac cgagattacc 4500

ctggccaacg gcgagatccg gaagcggcct ctgatcgaga caaacggcga aaccggggag 4560

atcgtgtggg ataagggccg ggattttgcc accgtgcgga aagtgctgag catgccccaa 4620

gtgaatatcg tgaaaaagac cgaggtgcag acaggcggct tcagcaaaga gtctatcctg 4680

cccaagagga acagcgataa gctgatcgcc agaaagaagg actgggaccc taagaagtac 4740

ggcggcttcg acagccccac cgtggcctat tctgtgctgg tggtggccaa agtggaaaag 4800

ggcaagtcca agaaactgaa gagtgtgaaa gagctgctgg ggatcaccat catggaaaga 4860

agcagcttcg agaagaatcc catcgacttt ctggaagcca agggctacaa agaagtgaaa 4920

aaggacctga tcatcaagct gcctaagtac tccctgttcg agctggaaaa cggccggaag 4980

agaatgctgg cctctgccgg cgaactgcag aagggaaacg aactggccct gccctccaaa 5040

tatgtgaact tcctgtacct ggccagccac tatgagaagc tgaagggctc ccccgaggat 5100

aatgagcaga aacagctgtt tgtggaacag cacaagcact acctggacga gatcatcgag 5160

cagatcagcg agttctccaa gagagtgatc ctggccgacg ctaatctgga caaagtgctg 5220

tccgcctaca acaagcaccg ggataagccc atcagagagc aggccgagaa tatcatccac 5280

ctgtttaccc tgaccaatct gggagcccct gccgccttca agtactttga caccaccatc 5340

gaccggaaga ggtacaccag caccaaagag gtgctggacg ccaccctgat ccaccagagc 5400

atcaccggcc tgtacgagac acggatcgac ctgtctcagc tgggaggcga caaaaggccg 5460

gcggccacga aaaaggccgg ccaggcaaaa aagaaaaagt aagaattcct agagctcgct 5520

gatcagcctc gactgtgcct tctagttgcc agccatctgt tgtttgcccc tcccccgtgc 5580

cttccttgac cctggaaggt gccactccca ctgtcctttc ctaataaaat gaggaaattg 5640

catcgcattg tctgagtagg tgtcattcta ttctgggggg tggggtgggg caggacagca 5700

agggggagga ttgggaagag aatagcaggc atgctgggga gcggccgcag gaacccctag 5760

tgatggagtt ggccactccc tctctgcgcg ctcgctcgct cactgaggcc gggcgaccaa 5820

aggtcgcccg acgcccgggc tttgcccggg cggcctcagt gagcgagcga gcgcgcagct 5880

gcctgcaggg gcgcctgatg cggtattttc tccttacgca tctgtgcggt atttcacacc 5940

gcatacgtca aagcaaccat agtacgcgcc ctgtagcggc gcattaagcg cggcgggtgt 6000

ggtggttacg cgcagcgtga ccgctacact tgccagcgcc ttagcgcccg ctcctttcgc 6060

tttcttccct tcctttctcg ccacgttcgc cggctttccc cgtcaagctc taaatcgggg 6120

gctcccttta gggttccgat ttagtgcttt acggcacctc gaccccaaaa aacttgattt 6180

gggtgatggt tcacgtagtg ggccatcgcc ctgatagacg gtttttcgcc ctttgacgtt 6240

ggagtccacg ttctttaata gtggactctt gttccaaact ggaacaacac tcaactctat 6300

ctcgggctat tcttttgatt tataagggat tttgccgatt tcggtctatt ggttaaaaaa 6360

tgagctgatt taacaaaaat ttaacgcgaa ttttaacaaa atattaacgt ttacaatttt 6420

atggtgcact ctcagtacaa tctgctctga tgccgcatag ttaagccagc cccgacaccc 6480

gccaacaccc gctgacgcgc cctgacgggc ttgtctgctc ccggcatccg cttacagaca 6540

agctgtgacc gtctccggga gctgcatgtg tcagaggttt tcaccgtcat caccgaaacg 6600

cgcgagacga aagggcctcg tgatacgcct atttttatag gttaatgtca tgataataat 6660

ggtttcttag acgtcaggtg gcacttttcg gggaaatgtg cgcggaaccc ctatttgttt 6720

atttttctaa atacattcaa atatgtatcc gctcatgaga caataaccct gataaatgct 6780

tcaataatat tgaaaaagga agagtatgag tattcaacat ttccgtgtcg cccttattcc 6840

cttttttgcg gcattttgcc ttcctgtttt tgctcaccca gaaacgctgg tgaaagtaaa 6900

agatgctgaa gatcagttgg gtgcacgagt gggttacatc gaactggatc tcaacagcgg 6960

taagatcctt gagagttttc gccccgaaga acgttttcca atgatgagca cttttaaagt 7020

tctgctatgt ggcgcggtat tatcccgtat tgacgccggg caagagcaac tcggtcgccg 7080

catacactat tctcagaatg acttggttga gtactcacca gtcacagaaa agcatcttac 7140

ggatggcatg acagtaagag aattatgcag tgctgccata accatgagtg ataacactgc 7200

ggccaactta cttctgacaa cgatcggagg accgaaggag ctaaccgctt ttttgcacaa 7260

catgggggat catgtaactc gccttgatcg ttgggaaccg gagctgaatg aagccatacc 7320

aaacgacgag cgtgacacca cgatgcctgt agcaatggca acaacgttgc gcaaactatt 7380

aactggcgaa ctacttactc tagcttcccg gcaacaatta atagactgga tggaggcgga 7440

taaagttgca ggaccacttc tgcgctcggc ccttccggct ggctggttta ttgctgataa 7500

atctggagcc ggtgagcgtg gaagccgcgg tatcattgca gcactggggc cagatggtaa 7560

gccctcccgt atcgtagtta tctacacgac ggggagtcag gcaactatgg atgaacgaaa 7620

tagacagatc gctgagatag gtgcctcact gattaagcat tggtaactgt cagaccaagt 7680

ttactcatat atactttaga ttgatttaaa acttcatttt taatttaaaa ggatctaggt 7740

gaagatcctt tttgataatc tcatgaccaa aatcccttaa cgtgagtttt cgttccactg 7800

agcgtcagac cccgtagaaa agatcaaagg atcttcttga gatccttttt ttctgcgcgt 7860

aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt tgccggatca 7920

agagctacca actctttttc cgaaggtaac tggcttcagc agagcgcaga taccaaatac 7980

tgttcttcta gtgtagccgt agttaggcca ccacttcaag aactctgtag caccgcctac 8040

atacctcgct ctgctaatcc tgttaccagt ggctgctgcc agtggcgata agtcgtgtct 8100

taccgggttg gactcaagac gatagttacc ggataaggcg cagcggtcgg gctgaacggg 8160

gggttcgtgc acacagccca gcttggagcg aacgacctac accgaactga gatacctaca 8220

gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca ggtatccggt 8280

aagcggcagg gtcggaacag gagagcgcac gagggagctt ccagggggaa acgcctggta 8340

tctttatagt cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt tgtgatgctc 8400

gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg gcctttttac ggttcctggc 8460

cttttgctgg ccttttgctc acatgt 8486

<210> 3

<211> 20

<212> DNA

<213> Sus scrofa

<400> 3

atcggctaag cccactgtag 20

<210> 4

<211> 20

<212> DNA

<213> Sus scrofa

<400> 4

agcccagatc tgtccacttc 20

<210> 5

<211> 120

<212> DNA

<213> Sus scrofa

<400> 5

cactgtagtt ccctgcacag cacgctggcc gcctccagag agaagtcaga atcacagacg 60

gtgccccacg tgtctccatg tttgtacttc aacacgacca gagcagggaa tgtcccctcc 120

<210> 6

<211> 96

<212> RNA

<213> Sus scrofa

<400> 6

ggucguguug aaguacaaca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugc 96

<210> 7

<211> 4844

<212> RNA

<213> Sus scrofa

<400> 7

ccaaucagag cggcgcgcuc cgaaaguuuc cuuuuauggc gaggcggcgg cggcggcggc 60

ccuauaaaaa gcgaagcgcg cggcgggcgg gagucgcugc gcgcugccuu cgccccgugc 120

cccgcuccgc cgccgccucg cgccgcccgc cccggcucug acugaccgcg uuacucccac 180

aggugagcgg gcgggacggc ccuucuccuc cgggcuguaa uuagcugagc aagagguaag 240

gguuuaaggg augguugguu ggugggguau uaauguuuaa uuaccuggag caccugccug 300

aaaucacuuu uuuucagguu ggaccggugc caccauggac uauaaggacc acgacggaga 360

cuacaaggau caugauauug auuacaaaga cgaugacgau aagauggccc caaagaagaa 420

gcggaagguc gguauccacg gagucccagc agccgacaag aaguacagca ucggccugga 480

caucggcacc aacucugugg gcugggccgu gaucaccgac gaguacaagg ugcccagcaa 540

gaaauucaag gugcugggca acaccgaccg gcacagcauc aagaagaacc ugaucggagc 600

ccugcuguuc gacagcggcg aaacagccga ggccacccgg cugaagagaa ccgccagaag 660

aagauacacc agacggaaga accggaucug cuaucugcaa gagaucuuca gcaacgagau 720

ggccaaggug gacgacagcu ucuuccacag acuggaagag uccuuccugg uggaagagga 780

uaagaagcac gagcggcacc ccaucuucgg caacaucgug gacgaggugg ccuaccacga 840

gaaguacccc accaucuacc accugagaaa gaaacuggug gacagcaccg acaaggccga 900

ccugcggcug aucuaucugg cccuggccca caugaucaag uuccggggcc acuuccugau 960

cgagggcgac cugaaccccg acaacagcga cguggacaag cuguucaucc agcuggugca 1020

gaccuacaac cagcuguucg aggaaaaccc caucaacgcc agcggcgugg acgccaaggc 1080

cauccugucu gccagacuga gcaagagcag acggcuggaa aaucugaucg cccagcugcc 1140

cggcgagaag aagaauggcc uguucggaaa ccugauugcc cugagccugg gccugacccc 1200

caacuucaag agcaacuucg accuggccga ggaugccaaa cugcagcuga gcaaggacac 1260

cuacgacgac gaccuggaca accugcuggc ccagaucggc gaccaguacg ccgaccuguu 1320

ucuggccgcc aagaaccugu ccgacgccau ccugcugagc gacauccuga gagugaacac 1380

cgagaucacc aaggcccccc ugagcgccuc uaugaucaag agauacgacg agcaccacca 1440

ggaccugacc cugcugaaag cucucgugcg gcagcagcug ccugagaagu acaaagagau 1500

uuucuucgac cagagcaaga acggcuacgc cggcuacauu gacggcggag ccagccagga 1560

agaguucuac aaguucauca agcccauccu ggaaaagaug gacggcaccg aggaacugcu 1620

cgugaagcug aacagagagg accugcugcg gaagcagcgg accuucgaca acggcagcau 1680

cccccaccag auccaccugg gagagcugca cgccauucug cggcggcagg aagauuuuua 1740

cccauuccug aaggacaacc gggaaaagau cgagaagauc cugaccuucc gcauccccua 1800

cuacgugggc ccucuggcca ggggaaacag cagauucgcc uggaugacca gaaagagcga 1860

ggaaaccauc acccccugga acuucgagga agugguggac aagggcgcuu ccgcccagag 1920

cuucaucgag cggaugacca acuucgauaa gaaccugccc aacgagaagg ugcugcccaa 1980

gcacagccug cuguacgagu acuucaccgu guauaacgag cugaccaaag ugaaauacgu 2040

gaccgaggga augagaaagc ccgccuuccu gagcggcgag cagaaaaagg ccaucgugga 2100

ccugcuguuc aagaccaacc ggaaagugac cgugaagcag cugaaagagg acuacuucaa 2160

gaaaaucgag ugcuucgacu ccguggaaau cuccggcgug gaagaucggu ucaacgccuc 2220

ccugggcaca uaccacgauc ugcugaaaau uaucaaggac aaggacuucc uggacaauga 2280

ggaaaacgag gacauucugg aagauaucgu gcugacccug acacuguuug aggacagaga 2340

gaugaucgag gaacggcuga aaaccuaugc ccaccuguuc gacgacaaag ugaugaagca 2400

gcugaagcgg cggagauaca ccggcugggg caggcugagc cggaagcuga ucaacggcau 2460

ccgggacaag caguccggca agacaauccu ggauuuccug aaguccgacg gcuucgccaa 2520

cagaaacuuc augcagcuga uccacgacga cagccugacc uuuaaagagg acauccagaa 2580

agcccaggug uccggccagg gcgauagccu gcacgagcac auugccaauc uggccggcag 2640

ccccgccauu aagaagggca uccugcagac agugaaggug guggacgagc ucgugaaagu 2700

gaugggccgg cacaagcccg agaacaucgu gaucgaaaug gccagagaga accagaccac 2760

ccagaaggga cagaagaaca gccgcgagag aaugaagcgg aucgaagagg gcaucaaaga 2820

gcugggcagc cagauccuga aagaacaccc cguggaaaac acccagcugc agaacgagaa 2880

gcuguaccug uacuaccugc agaaugggcg ggauauguac guggaccagg aacuggacau 2940

caaccggcug uccgacuacg auguggacca uaucgugccu cagagcuuuc ugaaggacga 3000

cuccaucgac aacaaggugc ugaccagaag cgacaagaac cggggcaaga gcgacaacgu 3060

gcccuccgaa gaggucguga agaagaugaa gaacuacugg cggcagcugc ugaacgccaa 3120

gcugauuacc cagagaaagu ucgacaaucu gaccaaggcc gagagaggcg gccugagcga 3180

acuggauaag gccggcuuca ucaagagaca gcugguggaa acccggcaga ucacaaagca 3240

cguggcacag auccuggacu cccggaugaa cacuaaguac gacgagaaug acaagcugau 3300

ccgggaagug aaagugauca cccugaaguc caagcuggug uccgauuucc ggaaggauuu 3360

ccaguuuuac aaagugcgcg agaucaacaa cuaccaccac gcccacgacg ccuaccugaa 3420

cgccgucgug ggaaccgccc ugaucaaaaa guacccuaag cuggaaagcg aguucgugua 3480

cggcgacuac aagguguacg acgugcggaa gaugaucgcc aagagcgagc aggaaaucgg 3540

caaggcuacc gccaaguacu ucuucuacag caacaucaug aacuuuuuca agaccgagau 3600

uacccuggcc aacggcgaga uccggaagcg gccucugauc gagacaaacg gcgaaaccgg 3660

ggagaucgug ugggauaagg gccgggauuu ugccaccgug cggaaagugc ugagcaugcc 3720

ccaagugaau aucgugaaaa agaccgaggu gcagacaggc ggcuucagca aagagucuau 3780

ccugcccaag aggaacagcg auaagcugau cgccagaaag aaggacuggg acccuaagaa 3840

guacggcggc uucgacagcc ccaccguggc cuauucugug cugguggugg ccaaagugga 3900

aaagggcaag uccaagaaac ugaagagugu gaaagagcug cuggggauca ccaucaugga 3960

aagaagcagc uucgagaaga aucccaucga cuuucuggaa gccaagggcu acaaagaagu 4020

gaaaaaggac cugaucauca agcugccuaa guacucccug uucgagcugg aaaacggccg 4080

gaagagaaug cuggccucug ccggcgaacu gcagaaggga aacgaacugg cccugcccuc 4140

caaauaugug aacuuccugu accuggccag ccacuaugag aagcugaagg gcucccccga 4200

ggauaaugag cagaaacagc uguuugugga acagcacaag cacuaccugg acgagaucau 4260

cgagcagauc agcgaguucu ccaagagagu gauccuggcc gacgcuaauc uggacaaagu 4320

gcuguccgcc uacaacaagc accgggauaa gcccaucaga gagcaggccg agaauaucau 4380

ccaccuguuu acccugacca aucugggagc cccugccgcc uucaaguacu uugacaccac 4440

caucgaccgg aagagguaca ccagcaccaa agaggugcug gacgccaccc ugauccacca 4500

gagcaucacc ggccuguacg agacacggau cgaccugucu cagcugggag gcgacaaaag 4560

gccggcggcc acgaaaaagg ccggccaggc aaaaaagaaa aaguaagaau uccuagagcu 4620

cgcugaucag ccucgacugu gccuucuagu ugccagccau cuguuguuug ccccuccccc 4680

gugccuuccu ugacccugga aggugccacu cccacugucc uuuccuaaua aaaugaggaa 4740

auugcaucgc auugucugag uaggugucau ucuauucugg gggguggggu ggggcaggac 4800

agcaaggggg aggauuggga agagaauagc aggcaugcug ggga 4844

Claims (8)

1. An allele molecular marker, wherein the allele molecular marker is a homozygote genotype with T/T insertion formed by inserting a T base in the middle of the base position of the No. 5 homologous chromosome 63323077-63323078 of the Sstrofa 11.1 genome version of a pig, and the sequence of the allele molecular marker is shown as SEQ ID No. 5.

2. A preparation method of a cloned pig resisting blue ear disease comprises the following steps:

1) Connecting the sgRNA protospace sequence shown in SEQ ID No. 1 to PX330 plasmid to construct targeting vector pCRISPR-sgLBP, wherein the gene sequence of the pCRISPR-sgLBP vector is shown in SEQ ID No. 2;

2) Transfecting a porcine fetal fibroblast cell with the pCRISPR-sgLBP vector;

3) Selecting a homozygous positive cell line containing the allelic molecule marker of claim 1;

4) And (3) taking the screened positive cell line as a nuclear donor cell for nuclear transplantation, and carrying out nuclear transplantation to obtain the anti-blue-ear disease cloned pig.

3. A preparation method of a cloned pig resisting blue ear disease comprises the following steps:

1) Transfecting or injecting sgRNA mRNA with mRNA sequence shown as SEQ ID No. 6 and cas9 mRNA sequence or cas9 protein with mRNA sequence shown as SEQ ID No. 7 into porcine fetal fibroblasts together;

2) Selecting a homozygous positive cell line containing the allelic marker of claim 1;

3) And (3) taking the screened positive cell line as a nuclear donor cell for nuclear transplantation, carrying out nuclear transplantation to obtain a reconstructed embryo for nuclear transplantation, placing the reconstructed embryo into a surrogate sow uterus, and obtaining the anti-porcine reproductive and respiratory syndrome cloned pig after delivery.

4. A preparation method of anti-porcine reproductive and respiratory syndrome cloned pigs comprises the following steps:

the sgRNA mRNA with the mRNA sequence shown as SEQ ID No. 6 and the cas9 mRNA sequence or cas9 protein with the mRNA sequence shown as SEQ ID No. 7 are transfected or injected into reconstructed embryo for nuclear transplantation, the reconstructed embryo containing the allele molecular marker as claimed in claim 1 is screened out and put into a surrogate mother pig uterus, and the anti-blue ear disease cloned pig is obtained after delivery.

5. A method for establishing an anti-porcine reproductive and respiratory syndrome pig breeding population, wherein the method comprises the following steps:

1) Transfecting a porcine fetal fibroblast with a pCRISPR-sgLBP vector with a gene sequence shown as SEQ ID No. 2 or co-transfecting or injecting sgRNA mRNA with an mRNA sequence shown as SEQ ID No. 6 and a cas9 mRNA sequence or a cas9 protein with an mRNA sequence shown as SEQ ID No. 7 into a porcine fetal fibroblast, wherein the fetal fibroblast is obtained from a pregnant embryo after the hybridization of a boar and a sow without a common ancestor in 3 generations;

2) Selecting a positive porcine fetal fibroblast cell line containing the allelic molecular marker of claim 1;

3) Preparing positive porcine fetal fibroblast cell lines of different porcine families containing the allelic molecular marker of claim 1 according to the method of steps 1) -2);

4) Preparing a nuclear-transplanted reconstructed embryo by using the positive pig fetal fibroblast lines of different pig families in the step 3);

5) Pre-mixing the female and male reconstructed embryos of different families in the step 4) according to the proportion of 2;

6) Obtaining homozygous pigs of F0 generation containing the allelic molecular marker of claim 1 from different pedigrees when the cloned pigs from different pedigrees in step 5) are born;

7) Selecting seeds and matching according to a group successive transfer breeding method by taking different pedigree F0 generation individuals in the step 6) as male parents and female parents;

8) After generation-by-generation propagation and breeding, a homozygous anti-blue-ear-disease pig breeding population containing the allelic molecular marker set forth in claim 1 is obtained.

6. The preparation method according to claim 5, wherein the individuals remained in each generation are detected after the step 7) of the relay generation breeding expansion, and the homozygote individuals with the allele molecular marker as claimed in claim 1 are remained as the female parent and the male parent of the relay generation breeding for the expansion breeding.

7. A method for breeding a new strain of anti-porcine reproductive and respiratory syndrome pig, wherein the method comprises the steps of expanding the breeding population of the anti-porcine reproductive and respiratory syndrome pig obtained by the construction method of claim 5 or 6, and breeding the new strain of anti-porcine reproductive and respiratory syndrome pig by using a population subculture breeding method.

8. A method of genetic improvement of pigs, wherein said method comprises the steps of:

breeding homozygous individual containing the allele molecular marker in claim 1 from the breeding population of blue-ear disease resistant pigs prepared by the method in claim 5 or 6, using the bred homozygous individual as male parent or female parent to cross with wild type pigs of the same strain or variety to breed F1 heterozygote offspring, then crossing the F1 heterozygote with male parent or female parent pigs of other homozygous family containing the allele in claim 1 to obtain F2 generation, breeding homozygous mutant gene individual in F2 generation, and constructing a new breeding population, so as to achieve the purpose of introducing blue-ear disease complete resistance into the existing pig variety and realizing genetic improvement of the existing pig variety.

Images