CN107177595A

CN107177595A - Targeting sgRNA, modification carrier for pig CD163 gene editings and its preparation method and application

Info

Publication number: CN107177595A
Application number: CN201710424822.6A
Authority: CN
Inventors: 张坤; 王少华
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2017-06-07
Filing date: 2017-06-07
Publication date: 2017-09-19

Abstract

The invention provides a kind of targeting sgRNA for pig CD163 gene editings, modification carrier and its preparation method and application, it is related to gene engineering technology field, sgRNA and genetic modification carrier that the present invention is provided, high specificity, extremely efficiently can enter edlin to pig CD163 genes on a cellular level by CRISPR/Cas9n systems.The preparation method for the anti-blue otopathy pig that the present invention is provided, destroy reproductive and respiratory syndrome virus acceptor, other any foreign genes will not be introduced in addition to entering edlin to target gene CD163, also non-specific editor will not be carried out to the region of non-CD163 genes on genome, genetic background is totally clear, greatly reduces the work of later stage Transgene-safty assessment.The pig of the anti-blue otopathy obtained using the present invention, while ensure that normal survival, is resisted the infection of reproductive and respiratory syndrome virus, greatly reduces economic loss of the pig industry caused by blue otopathy.

Description

Targeting sgRNA, modification carrier for pig CD163 gene editings and preparation method thereof And application

Technical field

The present invention relates to gene engineering technology field, more particularly, to a kind of targeting for pig CD163 gene editings SgRNA, modification carrier and its preparation method and application.

Background technology

Pig blue-ear disease (porcine reproductive and respiratory syndrome, PRRS) is the first big viral infection for seriously endangering pig industry Disease, the annual loss for giving global pig industry to bring multi-million dollar.Pig blue-ear disease is by porcine reproductive and respiratory syndrome virus (PRRSV) caused by, in-pig, piglet and herd boar is mainly encroached on, causes in-pig premature labor, miscarriage and stillborn foetus, piglet Expiratory dyspnea is even dead.

External research shows, the protein domain of the 7th exons coding of pig CD163 genes be reproductive and respiratory syndrome virus by The region of body combination reproductive and respiratory syndrome virus, deletes the CD163 genes of the 7th extron completely, and the CD163 albumen that it is expressed is by chance The domain with reference to PRRSV has been lacked, and other physiological functions are unaffected, it can be seen that, CD163 genes are compiled Collect is that production can resist the important candidate's means for the pig that reproductive and respiratory syndrome virus infects.

CRISPR/Cas9 systems are a kind of gene editing technologies being widely used in recent years, can be accurately to gene Group carries out the transformations such as fixed point deletion, insertion or displacement.CRISPR/Cas9 systems are mainly made up of two important elements --- lead To RNA (sgRNA) and Cas9 endonucleases (Cas9nuclease).Many researchs show, compared with Cas9 endonucleases, Entering edlin to target gene using the Cas9 nickases (Cas9 nickase) and two sgRNA that have been mutated an active domain can To greatly reduce the effect of missing the target of CRISPR/Cas9 systems, this system is referred to as CRISPR/Cas9n systems.

Although increasing gene is employed as the biomarker and therapy target of the disease of domestic animals at present, Method for the key gene in pig blue-ear disease and its editor's modification is not yet applied in China.

In view of this, it is special to propose the present invention.

The content of the invention

First purpose of the present invention is to provide a kind of targeting sgRNA for pig CD163 gene editings；

Second object of the present invention is to provide a boar CD163 genetic modification carriers；

Third object of the present invention is the preparation method for providing a boar CD163 genetic modification carriers；

Fourth object of the present invention is to provide a boar CD163 genetic modifications carrier in anti-blue otopathy pig is prepared Using；

The 5th purpose of the present invention is to provide a kind of preparation method of anti-blue otopathy pig；

The 6th purpose of the present invention is to provide a kind of pig of anti-blue otopathy；It is directed to alleviating present in prior art The technical problem that the method for key gene and its editor's modification in pig blue-ear disease is not yet applied.

A kind of targeting sgRNA for pig CD163 gene editings that the present invention is provided, including sgRNA-C161 and sgRNA- C185；

The positive-sense strand and antisense strand of the sgRNA-C161 be respectively：

C161-Fwd：5’-AAAGTGAGCTCCCCCCAGGA-3’(SEQ ID NO.1)；

C161-Rev：5’-TCCTGGGGGGAGCTCACTTT-3’(SEQ ID NO.2)；

The positive-sense strand and antisense strand of the sgRNA-C185 be respectively：

C185-Fwd：5’-GAGAAGGAAGTGGACAGATC-3’(SEQ ID NO.3)；

C185-Rev：5’-GATCTGTCCACTTCCTTCTC-3’(SEQ ID NO.4).

Present invention also offers a boar CD163 genetic modification carriers, including two above-mentioned sgRNA, Cas9 nickases And fluorescent marker protein.

Further, the pig CD163 genetic modifications are that the gene carried out for the 7th extron of pig CD163 genes is compiled Volume.

Present invention also offers a kind of preparation method of above-mentioned pig CD163 genetic modification carriers, comprise the following steps：

Step (a)：The positive-sense strand of the sgRNA-C161 and antisense strand are subjected to complementary pairing, C161 double-stranded DNAs are formed Molecule；

Step (b)：The positive-sense strand of the sgRNA-C185 and antisense strand are subjected to complementary pairing, C185 double-stranded DNAs are formed Molecule；

Step (c)：The C161 double chain DNA molecules are connected on expression vector, construction expression sgRNA-C161 load Body；

Step (d)：The C185 double chain DNA molecules are connected on expression vector, construction expression sgRNA-C185 load Body；

Step (e)：Carrier using the expression sgRNA-C161 is template, and PCR is expanded containing described in U6 promoters SgRNA-C161 sequences, and be connected on cloning vector, then the acquisition U6-sgRNA-C161 sequences after digestion；

Step (f)：On the carrier that the U6-sgRNA-C161 sequences are connected to the expression sgRNA-C185, build Complete the expression sgRNA-C161 and sgRNA-C185 carrier.

Further, in step (c) and step (d), the expression vector is with Cas9 nickases, fluorescence labeling egg The PX461 carriers of the digestions of process Bbs I of bletilla U6 promoters.

Further, in step (e), the cloning vector is pMD18-T carriers.

Present invention also offers application of the above-mentioned pig CD163 genetic modifications carrier in anti-blue otopathy pig is prepared.

Present invention also offers a kind of preparation method of anti-blue otopathy pig, using above-mentioned pig CD163 genetic modification carriers.

Further, the pig CD163 genetic modification carriers are transferred in the body cell of pig, obtain CD163 gene editings Positive cell clone, somatic cell clone and embryo transfer are carried out by donorcells of the positive cell, obtain the anti-blue ear Sick pig.

In addition, present invention also offers a kind of pig of anti-blue otopathy, using the preparation method system of above-mentioned anti-blue otopathy pig It is standby to obtain.

Targeting sgRNA provided by the present invention for pig CD163 gene editings and cut including above-mentioned two sgRNA, Cas9 The pig CD163 genetic modification carriers of mouth enzyme and fluorescent marker protein, high specificity can extremely efficiently pass through CRISPR/ Cas9n systems enter edlin to pig CD163 genes on a cellular level.The preparation method for the anti-blue otopathy pig that the present invention is provided, The pig CD163 genetic modification carriers that the present invention is provided are applied, gene volume is carried out for the key gene CD163 in pig blue-ear disease Volume, so as to destroy reproductive and respiratory syndrome virus acceptor, also, it is any to introduce in addition to entering edlin to target gene CD163 other Foreign gene, also will not carry out non-specific editor, genetic background is totally clear to the region of non-CD163 genes on genome, Greatly reduce the work of later stage Transgene-safty assessment.The pig for the anti-blue otopathy that the present invention is provided, applies the present invention and carries The preparation method of the anti-blue otopathy pig supplied is prepared, while ensure that normal survival, resists the sense of reproductive and respiratory syndrome virus Dye, greatly reduces economic loss of the pig industry caused by blue otopathy.

Brief description of the drawings

, below will be to specific in order to illustrate more clearly of the specific embodiment of the invention or technical scheme of the prior art The accompanying drawing used required in embodiment or description of the prior art is briefly described, it should be apparent that, in describing below Accompanying drawing is some embodiments of the present invention, for those of ordinary skill in the art, before creative work is not paid Put, other accompanying drawings can also be obtained according to these accompanying drawings.

Fig. 1 is the flow chart of the preparation method for the pig CD163 genetic modification carriers that the embodiment of the present invention 1 is provided.

Embodiment

Technical scheme is clearly and completely described below in conjunction with accompanying drawing, it is clear that described implementation Example is a part of embodiment of the invention, rather than whole embodiments.Based on the embodiment in the present invention, ordinary skill The every other embodiment that personnel are obtained under the premise of creative work is not made, belongs to the scope of protection of the invention.

The invention provides a kind of targeting sgRNA for pig CD163 gene editings, including sgRNA-C161 and sgRNA- C185；

C161-Fwd：5’-AAAGTGAGCTCCCCCCAGGA-3’(SEQ ID NO.1)；

C161-Rev：5’-TCCTGGGGGGAGCTCACTTT-3’(SEQ ID NO.2)；

C185-Fwd：5’-GAGAAGGAAGTGGACAGATC-3’(SEQ ID NO.3)；

C185-Rev：5’-GATCTGTCCACTTCCTTCTC-3’(SEQ ID NO.4).

In the present invention, the targeting sgRNA for pig CD163 gene editings can play specific recognition pig CD163 bases The effect of cause.

Present invention also offers a boar CD163 genetic modification carriers, including two above-mentioned sgRNA, Cas9 nickases And fluorescent marker protein, high specificity can be extremely efficiently by CRISPR/Cas9n systems on a cellular level to pig CD163 genes enter edlin.Produce disease-resistant pig be need it is specific enter edlin to target gene, definitely can not be to gene Edlin is entered in other regions of group, high compared to effect of missing the target, and gene editing can be also carried out in the region of non-target sequence Cas9 systems, present invention selection CRISPR/Cas9n systems and unconventional CRISPR/Cas9 systems, are provided using the present invention Pig CD163 genetic modifications carrier enters edlin to CD163 genes, it is intended to special gene editing, effect are being carried out to CD163 genes While rate high specific is strong, thoroughly prevent because effect of missing the target carries out the possibility of gene editing to other sequences on genome.

Wherein, fluorescent marker protein is GFP.

In the present invention, pig CD163 genetic modifications are that the gene carried out for the 7th extron of pig CD163 genes is compiled Volume, so as to destroy reproductive and respiratory syndrome virus acceptor, reduction pig infects the risk of reproductive and respiratory syndrome virus.

Present invention also offers the preparation method of above-mentioned pig CD163 genetic modification carriers, comprise the following steps：

Step (a)：SgRNA-C161 positive-sense strand and antisense strand are subjected to complementary pairing, C161 double chain DNA molecules are formed；

Step (b)：SgRNA-C185 positive-sense strand and antisense strand are subjected to complementary pairing, C185 double chain DNA molecules are formed；

Step (c)：C161 double chain DNA molecules are connected on expression vector, construction expression sgRNA-C161 carrier；

Step (d)：C185 double chain DNA molecules are connected on expression vector, construction expression sgRNA-C185 carrier；

Step (e)：To express sgRNA-C161 carrier as template, sgRNA-C161 of the PCR amplifications containing U6 promoters Sequence, and be connected on cloning vector, then the acquisition U6-sgRNA-C161 sequences after digestion；

Step (f)：On the carrier that U6-sgRNA-C161 sequences are connected to expression sgRNA-C185, build and complete expression SgRNA-C161 and sgRNA-C185 carrier.

Wherein, in step (c) and step (d), expression vector is to be opened with Cas9 nickases, fluorescent marker protein and U6 The PX461 carriers of the digestions of process Bbs I of mover；The carrier for expressing sgRNA-C161 is PX461-C161, expresses sgRNA-C185 Carrier be PX461-C185.

In step (e), cloning vector is pMD18-T carriers, and digestion is the digestions of Kpn I.

The pMD18-T carriers for being connected with sgRNA-C161 sequences are carried out after the digestions of Kpn I, two ends is obtained and contains the enzymes of Kpn I The U6-sgRNA-C161 sequences of enzyme site.

In step (f), expression sgRNA-C185 carrier is the PX461-C185 Jing Guo the digestions of Kpn I, expresses sgRNA- C161 and sgRNA-C185 carrier is PX461-C185+C161.

The U6-sgRNA-C161 sequences that the restriction enzyme sites of Kpn I are contained at two ends are connected to the PX461-C185 after the digestions of Kpn I On, build the carrier PX461-C185+ for completing to express sgRNA-C161 and sgRNA-C185 and Cas9 nickases and GFP simultaneously C161。

In the present invention, pig CD163 genetic modification carriers are transferred to the body cell of pig, CD163 gene editings are obtained positive Cell clone, somatic cell clone and embryo transfer are carried out by donorcells of positive cell, obtain anti-blue otopathy pig.

Wherein, pig CD163 genetic modification carriers are transferred to the method for the body cell of pig for example can be, but is not limited to electricity and wears Kong Fa, microinjection, calcium phosphate precipitation or lipofection.

In one preferred embodiment, the body cell of pig is pig fibroblast, in a preferred embodiment party In formula, the body cell of pig is porcine fetus fibroblastses.

Using the body cell of the pig after CD163 gene editings as donorcells, egg mother cell passes through body as recipient cell Nuclear transfer technology obtains clone embryos；Clone embryos are moved into the entopic pregnancy of donor pig and obtain CD163 gene editings The pig of anti-blue otopathy.

The preparation method for the anti-blue otopathy pig that the present invention is provided, applies the pig CD163 genetic modifications load that the present invention is provided Body, gene editing is carried out for the key gene CD163 in pig blue-ear disease, so that reproductive and respiratory syndrome virus acceptor is destroyed, also, except Target gene CD163, which is entered, will not introduce other any foreign genes outside edlin, also will not be to non-CD163 genes on genome Region carry out non-specific editor, genetic background is totally clear, greatly reduces the work of later stage Transgene-safty assessment.

The pig for the anti-blue otopathy that the present invention is provided, the preparation method for applying the anti-blue otopathy pig that the present invention is provided is prepared into Arrive, while ensure that normal survival, resist the infection of reproductive and respiratory syndrome virus, greatly reduce pig industry because blue otopathy is made Into economic loss.

In order to contribute to it is clearer understand present disclosure, be described in detail as follows in conjunction with specific embodiment.Such as Not yet explicitly point out, the PX461 carriers used in following examples are purchased from Addgene, article No. 48140；PMD18-T carriers are purchased from TaKaRa companies；Host Strains bacillus coli DH 5 alpha is purchased from TaKaRa companies；Primer synthesis is completed by Shanghai life work；Sequencing by Shanghai Rui Di companies complete；The small extraction reagent kit of plasmid is purchased from TaKaRa companies；LA Taq enzymes are purchased from TaKaRa companies；T4DNA connects Enzyme is connect purchased from TaKaRa companies；The restriction endonucleases of Kpn I are purchased from TaKaRa companies；The restriction endonucleases of Bbs I are purchased from NEB companies；Cell culture medium DMEM, PBS, hyclone, pancreatin and fibroblast growth factor (bFGF) are purchased from Life Technologies；Liposome Lipofectamine 2000 is purchased from Invitrogen companies；Tissue Culture Plate and culture dish are purchased from Thermo Scientific.

Embodiment 1sgRNA design and the structure of carrier

According to the 7th extron, the 8th extron and part upstream and downstream intron sequences (such as SEQ ID of pig CD163 genes Shown in NO.5) and mRNA sequence (NCBI NM_213976.1, as shown in SEQ ID NO.6), it is aobvious outside the 7th of CD163 genes Two sgRNA are designed on son, is sgRNA-C161 and sgRNA-C185, adds adhesive bond sequence at its two ends respectively.Every 5 ' ends of bar sgRNA sequence F chains add joint sequence CACC, 5 ' end addition joint sequence AAAC of its reverse complementary sequence R chains, If 5 ' first base in end of sgRNA sequences are not G, then should be first in 5 ' one G of end addition of sgRNA sequence F chains, then add Top connection sequence C ACC, correspondingly, its reverse complementary sequence R chains 3 ' end be further added by a C, so as to through the digestions of Bbs I PX461 carriers cohesive end it is complementary.

Positive-sense strand and antisense strand for the sgRNA-C161 that builds pig CD163 genetic modification carriers are respectively：

C161-Fwd：5’-CACCGAAAGTGAGCTCCCCCCAGGA-3’(SEQ ID NO.7)；

C161-Rev：5’-AAACTCCTGGGGGGAGCTCACTTTC-3’(SEQ ID NO.8)；

SgRNA-C185 positive-sense strand and antisense strand be respectively：

C185-Fwd：5’-CACCGAGAAGGAAGTGGACAGATC-3’(SEQ ID NO.9)；

C185-Rev：5’-AAACGATCTGTCCACTTCCTTCTC-3’(SEQ ID NO.10).

Two sgRNA positive-sense strand and antisense strand is respectively in Shanghai life work synthesis.

SgRNA-C161 and sgRNA-C185 positive-sense strand and antisense strand are dissolved as the solution that concentration is 200 μM with water, Annealing system is as follows：

200 μM of positive-sense strands	5μL
		200 μM of antisense strands	5μL
10 × annealing buffer	2μL
		DNase/RNase-free water	8μL
Cumulative volume	20μL

Note：The composition of 10 × annealing buffer includes 100mM Tris-HCl (pH8.0), 10mM EDTA (pH8.0) and 1M NaCl。

After 94 DEG C are denatured 5min, taking out sample room temperature placement 10min makes sgRNA positive-sense strand and antisense strand carry out complementation Pairing, forms C161 double chain DNA molecules and C185 double chain DNA molecules, -20 DEG C of preservations.

As shown in figure 1, PX461 carriers are carried out after digestion recovery with restriction enzyme Bbs I, with C161 double chain DNA molecules Connected with C185 double chain DNA molecules, linked system is as follows：

16 DEG C are placed 2 hours, and connection product then is converted into bacillus coli DH 5 alpha competent cell simultaneously using conventional method Coated plate.After bacterium colony grows up to, picking single bacterium colony expands culture.Cultured bacterium solution is extracted into plasmid, sequencing identification sgRNA- Whether C161 and sgRNA-C185 is connected on carrier PX461.

Build the carrier PX461-C161 that completes to express sgRNA-C161, Cas9 nickase and GFP simultaneously and simultaneously table Up to sgRNA-C185, Cas9 nickase and GFP carrier PX461-C185.

Using PX461-C161 as template, sgRNA-Fwd and sgRNA-Rev are respectively upstream and downstream primer, and PCR amplifications contain U6 The sgRNA-C161 sequences of promoter.

Wherein, PCR primer sequence is：

sgRNA-Fwd：5’-GAGGGCCTATTTCCCATGATTCC-3’(SEQ ID NO.11)；

sgRNA-Rev：5’-GGGGTACCTCTAGAGCCATTTG-3’(SEQ ID NO.12).

PCR reaction system is：

Reagent	Volume (μ L)
		PX461-C161 templates (1ng/ μ L)	1
Sense primer sgRNA-Fwd (10 μM)	1
		Anti-sense primer sgRNA-Rev (10 μM)	1
dNTP Mix(2.5mM each)	4
		10×LA Taq Buffer	5
TaKaRa LA Taq(5U/μL)	0.25
		ddH₂O	37.75

PCR cycle condition is as follows：

After the completion of PCR reactions, the sgRNA-C161 sequences containing U6 promoters are connected on pMD18-T carriers, then Connection product is converted into bacillus coli DH 5 alpha competent cell and coated plate using conventional method.After bacterium colony grows up to, picking single bacterium Fall to expand culture.Cultured bacterium solution is extracted into plasmid, then two ends are obtained after the digestions of Kpn I and contains the restriction enzyme sites of Kpn I U6-sgRNA-C161 sequences.

The transfection of the body cell of the pig of embodiment 2 and the screening of CD163 gene editings cell clone point

Cell culture and transient transfection：

Porcine fetus fibroblastses are inoculated with 6 hole cell culture, in the DMEM culture mediums containing 15% hyclone When culture is to 50-70% degree of converging, requires, embodiment 1 is provided to specifications with the liposomes of Lipofectamine 2000 Carrier PX461-C185+C161 be transferred in cell.

The airflow classification and Colony Culture of Transfected cells：

Cell after transfection is cultivated 48 hours in 37 DEG C of incubators, after 0.1% pancreatin digestion, flow cytometer point Choosing expression GFP positive cell, according to the density inoculating cell of 50-100 cell/100mm culture dishes, is containing 15% tire ox Cultivated 9 to 12 days in the DMEM culture mediums of serum and 2.5ng/mL fibroblast growth factors (bFGF), it is obvious to growing Single cell clone point.

The identification of single cell clone point CD163 gene editing situations：

48 hole cell culture are transferred to after the good single cell clone point cell of growth conditions is digested with 0.1% pancreatin In plate, whne cell cover with need passage when, take 1/10 cell to be cell PCR after cracking for template, remaining cell is inoculated into 24 In porocyte culture plates continue cultivate to cover with and then freeze in liquid nitrogen preserve.

For identification of cell clone point CD163 gene editing situations primer be：

Primer	Primer sequence (5 ' -3 ')	SEQ ID NO.
			CD163-39F	TCCCTGCTCTGGTCGTGTTG	13
CD163-527R	CTTCCATGTCCCAGTGAGAGTT	14
			dEX7-Fb	TTGGTGAGGGCCAATTGTGTAT	15
dEX7-Rb	GGATAGAAAGGGCAACTCCACA	16
			dEX7-Fs	ACCTTGATGATTGCGCTCTT	17
dEX7-Rs	TGTCCCAGTGAGAGTTGCAG	18

Due to fewer for the cell number identified, so cell lysate first uses CD163-39F and CD163- 527R primers enter performing PCR, and the cell lysate for not amplifying specific band uses dEX7-Fb/Rb and dEX7-Fs/ respectively again Rs two does nest-type PRC to primer.

Wherein, PCR reaction system is：

Reagent	Volume (μ L)
		Cell lysate or first time PCR primer (1:100 dilutions)	5
Sense primer (10 μM)	1
		Anti-sense primer (10 μM)	1
dNTP Mix(2.5mM each)	4
		10×LA Taq Buffer	5
TaKaRa LA Taq(5U/μL)	0.25
		ddH₂O	33.75

PCR cycling condition is：

It is connected to after the PCR primer of 20 cell clone points of random picking, glue reclaim on pMD18-T carriers, sequencing analysis Find there are 18 cell clone points to there occurs the editor of CD163 genes afterwards, be positive cell.Wherein there is the cell of clone's point Delete the 7th extron of CD163 genes completely, gene editing efficiency high is up to 90%.Therefore, the table while present invention is provided Up to the pig CD163 genetic modification carriers of two sgRNA and Cas9 nickases, extremely efficiently target gene CD163 can be carried out Gene editing.It there occurs that the cell clone point CD163 genotype results of gene editing are as shown in the table.

Finally it should be noted that：Various embodiments above is merely illustrative of the technical solution of the present invention, rather than its limitations；To the greatest extent The present invention is described in detail with reference to foregoing embodiments for pipe, it will be understood by those within the art that：Its according to The technical scheme described in foregoing embodiments can so be modified, or which part or all technical characteristic are entered Row equivalent substitution；And these modifications or replacement, the essence of appropriate technical solution is departed from various embodiments of the present invention technology The scope of scheme.

SEQUENCE LISTING

<110>Zhejiang University

<120>Targeting sgRNA, modification carrier for pig CD163 gene editings and its preparation method and application

<160> 18

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> DNA

<213>Artificial sequence

<400> 1

aaagtgagct ccccccagga 20

<210> 2

<211> 20

<212> DNA

<213>Artificial sequence

<400> 2

tcctgggggg agctcacttt 20

<210> 3

<211> 20

<212> DNA

<213>Artificial sequence

<400> 3

gagaaggaag tggacagatc 20

<210> 4

<211> 20

<212> DNA

<213>Artificial sequence

<400> 4

gatctgtcca cttccttctc 20

<210> 5

<211> 1800

<212> DNA

<213> Sus scrofa（Pig）

<400> 5

ctacaaggtg cggccttaaa aggaaaaaaa aaaaaattaa atcaaggact caagagtctt 60

tcattatttg tgttgtggaa gctatatttg ttttaaagtc ttagttgtgt ttagaaagca 120

agatgttctt caactcaaat ttgggaggga acttgtttca tacattttta atggataagt 180

ggcaaaattt tcatgctgag gtgatctata gtgttgtaat gcagaatata gtcagatctt 240

gaacatttta ggaagttggt gagggccaat tgtgtatctg tgccatgctg ataagaatgt 300

caagggatca caagaattcg tgttatttga cagcagtcat ctttaaaagg catttgagaa 360

agtccaattt caaatgcatt tcctttcttt aaaagataaa ttgaagaaaa taagtcttta 420

tttcccaagt aaattgaatt gcctctcagt ctgttaaaag aaactcttac cttgatgatt 480

gcgctcttaa cctggcaaag attgtcttta aaatctgagc tccatgtctt ctgctttatt 540

tctggtgtgc ctttgactcc agattacagt aaatggagga ctgagtatag ggctaaaaag 600

tagagagaat ggatgcatat tatctgtggt ctccaatgtg atgaatgaag taggcaaata 660

ctcaaaggaa agagaaagca tgctccaaga attatgggtt ccagaaggca aagtcccaga 720

attgtctcca gggaaggaca gggaggtcta gaatcggcta agcccactgt aggcagaaaa 780

accaagaggc atgaatggct tccctttctc acttttcact ctctggctta ctcctatcat 840

gaaggaaaat attggaatca tattctccct caccgaaatg ctatttttca gcccacagga 900

aacccaggct ggttggaggg gacattccct gctctggtcg tgttgaagta caacatggag 960

acacgtgggg caccgtctgt gattctgact tctctctgga ggcggccagc gtgctgtgca 1020

gggaactaca gtgcggcact gtggtttccc tcctgggggg agctcacttt ggagaaggaa 1080

gtggacagat ctgggctgaa gaattccagt gtgaggggca cgagtcccac ctttcactct 1140

gcccagtagc accccgccct gacgggacat gtagccacag cagggacgtc ggcgtagtct 1200

gctcaagtga gacccaggga atgtgttcac tttgttccca tgccatgaag agggtagggt 1260

taggtagtca cagacatctt tttaaagccc tgtctccttc caggatacac acaaatccgc 1320

ttggtgaatg gcaagacccc atgtgaagga agagtggagc tcaacattct tgggtcctgg 1380

gggtccctct gcaactctca ctgggacatg gaagatgccc atgttttatg ccagcagctt 1440

aaatgtggag ttgccctttc tatcccggga ggagcacctt ttgggaaagg aagtgagcag 1500

gtctggaggc acatgtttca ctgcactggg actgagaagc acatgggaga ttgttccgtc 1560

actgctctgg gcgcatcact ctgttcttca gggcaagtgg cctctgtaat ctgctcaggt 1620

aagagaataa gggcagccag tgatgagcca ctcatgacgg tgccttaaga gtgggtgtac 1680

ctaggagttc ccattgtggc tcagtggtaa caaactcgac tggtatccat gagggtatgg 1740

gtttgatccc tggccttgct caatgggtta aggatccagc attgctgtga gctgtggtat 1800

<210> 6

<211> 3400

<212> RNA

<213> Sus scrofa（Pig）

<400> 6

atggtgctac ttgaagactc tggatctgca gactttagaa gatgttctgc ccatttaagt 60

tccttcactt ttgctgtagt cgctgttctc agtgcctgct tggtcactag ttctcttgga 120

ggaaaagaca aggagctgag gctaacgggt ggtgaaaaca agtgctctgg aagagtggag 180

gtgaaagtgc aggaggagtg gggaactgtg tgtaataatg gctgggacat ggatgtggtc 240

tctgttgttt gtaggcagct gggatgtcca actgctatca aagccactgg atgggctaat 300

tttagtgcag gttctggacg catttggatg gatcatgttt cttgtcgagg gaatgagtca 360

gctctctggg actgcaaaca tgatggatgg ggaaagcata actgtactca ccaacaggat 420

gctggagtaa cctgctcaga tggatctgat ttagagatga ggctggtgaa tggaggaaac 480

cggtgcttag gaagaataga agtcaaattt caagagcggt ggggaacagt gtgtgatgat 540

aacttcaaca taaatcatgc ttctgtggtt tgtaaacaac ttgaatgtgg aagtgctgtc 600

agtttctctg gttcagctaa ttttggagaa ggttctggac caatctggtt tgatgatctt 660

gtatgcaatg gaaatgagtc agctctctgg aactgcaaac atgaaggatg gggaaagcac 720

aattgcgatc atgctgagga tgctggagtg atttgcttaa atggagcaga cctgaaactg 780

agagtggtag atggactcac tgaatgttca ggaagattgg aagtgaaatt ccaaggagaa 840

tggggaacaa tctgtgatga tggctgggat agtgatgatg ccgctgtggc atgtaagcaa 900

ctgggatgtc caactgctgt cactgccatt ggtcgagtta acgccagtga gggaactgga 960

cacatttggc ttgacagtgt ttcttgccat ggacacgagt ctgctctctg gcagtgtaga 1020

caccatgaat ggggaaagca ttattgcaat cataatgaag atgctggtgt gacatgttct 1080

gatggatcag atctggaact gagacttaaa ggtggaggca gccactgtgc tgggacagtg 1140

gaggtggaaa ttcagaaact ggtaggaaaa gtgtgtgata gaagctgggg actgaaagaa 1200

gctgatgtgg tttgcaggca gctgggatgt ggatctgcac tcaaaacatc atatcaagtt 1260

tattccaaaa ccaaggcaac aaacacatgg ctgtttgtaa gcagctgtaa tggaaatgaa 1320

acttctcttt gggactgcaa gaattggcag tggggtggac ttagttgtga tcactatgac 1380

gaagccaaaa ttacctgctc agcccacagg aaacccaggc tggttggagg ggacattccc 1440

tgctctggtc gtgttgaagt acaacatgga gacacgtggg gcaccgtctg tgattctgac 1500

ttctctctgg aggcggccag cgtgctgtgc agggaactac agtgcggcac tgtggtttcc 1560

ctcctggggg gagctcactt tggagaagga agtggacaga tctgggctga agaattccag 1620

tgtgaggggc acgagtccca cctttcactc tgcccagtag caccccgccc tgacgggaca 1680

tgtagccaca gcagggacgt cggcgtagtc tgctcaagat acacacaaat ccgcttggtg 1740

aatggcaaga ccccatgtga aggaagagtg gagctcaaca ttcttgggtc ctgggggtcc 1800

ctctgcaact ctcactggga catggaagat gcccatgttt tatgccagca gcttaaatgt 1860

ggagttgccc tttctatccc gggaggagca ccttttggga aaggaagtga gcaggtctgg 1920

aggcacatgt ttcactgcac tgggactgag aagcacatgg gagattgttc cgtcactgct 1980

ctgggcgcat cactctgttc ttcagggcaa gtggcctctg taatctgctc agggaaccag 2040

agtcagacac tatccccgtg caattcatca tcctcggacc catcaagctc tattatttca 2100

gaagaaagtg gtgttgcctg catagggagt ggtcaacttc gcctggtcga tggaggtggt 2160

cgttgtgctg ggagagtaga ggtctatcct ggggcatcct ggggcaccat ctgtgatgac 2220

agctgggacc tgaatgatgc ccatgtggtg tgcaaacagc tgagctgtgg atgggccatt 2280

aatgccactg gttctgctca ttttggggaa ggaacagggc ccatttggct ggatgagata 2340

aactgtaatg gaaaagaatc tcatatttgg caatgccact cacatggttg ggggcggcac 2400

aattgcaggc ataaggagga tgcaggagtc atctgctcag agttcatgtc tctgagactg 2460

atcagtgaaa acagcagaga gacctgtgca gggcgcctgg aagtttttta caacggagct 2520

tggggcagcg ttggcaggaa tagcatgtct ccagccacag tgggggtggt atgcaggcag 2580

ctgggctgtg cagacagagg ggacatcagc cctgcatctt cagacaagac agtgtccagg 2640

cacatgtggg tggacaatgt tcagtgtcct aaaggacctg acacactatg gcagtgcccc 2700

tcatctccat ggaagaagag actggccagc ccctcagagg agacatggat cacatgtgcc 2760

aacaaaataa gacttcaaga aggaaacact aattgttctg gacgtgtgga gatctggtac 2820

ggaggttcct ggggcactgt gtgtgacgac tcctgggacc ttgaagatgc tcaggtggtg 2880

tgccgacagc tgggctgtgg ctcagctttg gaggcaggaa aagagcccgc atttggccag 2940

gggactgggc ccatatggct caatgaagtg aagtgcaagg ggaatgaacc ctccttgtgg 3000

gattgtcctg ccagatcctg gggccacagt gactgtggac acaaggagga tgctgctgtg 3060

acgtgctcag aaattgcaaa gagccgagaa tccctacatg ccacaggtcg ctcatctttt 3120

gttgcacttg caatctttgg ggtcattctg ttggcctgtc tcatcgcatt cctcatttgg 3180

actcagaagc gaagacagag gcagcggctc tcagttttct caggaggaga gaattctgtc 3240

catcaaattc aataccggga gatgaattct tgcctgaaag cagatgaaac ggatatgcta 3300

aatccctcag gagaccactc tgaagtacaa tgaaaaggaa aatgggaatt ataacctggt 3360

gagttcagcc tttaagatac cttgatgaag acctggacta 3400

<210> 7

<211> 25

<212> DNA

<213>Artificial sequence

<400> 7

caccgaaagt gagctccccc cagga 25

<210> 8

<211> 25

<212> DNA

<213>Artificial sequence

<400> 8

aaactcctgg ggggagctca ctttc 25

<210> 9

<211> 24

<212> DNA

<213>Artificial sequence

<400> 9

caccgagaag gaagtggaca gatc 24

<210> 10

<211> 24

<212> DNA

<213>Artificial sequence

<400> 10

aaacgatctg tccacttcct tctc 24

<210> 11

<211> 23

<212> DNA

<213>Artificial sequence

<400> 11

gagggcctat ttcccatgat tcc 23

<210> 12

<211> 22

<212> DNA

<213>Artificial sequence

<400> 12

ggggtacctc tagagccatt tg 22

<210> 13

<211> 20

<212> DNA

<213>Artificial sequence

<400> 13

tccctgctct ggtcgtgttg 20

<210> 14

<211> 22

<212> DNA

<213>Artificial sequence

<400> 14

cttccatgtc ccagtgagag tt 22

<210> 15

<211> 22

<212> DNA

<213>Artificial sequence

<400> 15

ttggtgaggg ccaattgtgt at 22

<210> 16

<211> 22

<212> DNA

<213>Artificial sequence

<400> 16

ggatagaaag ggcaactcca ca 22

<210> 17

<211> 20

<212> DNA

<213>Artificial sequence

<400> 17

accttgatga ttgcgctctt 20

<210> 18

<211> 20

<212> DNA

<213>Artificial sequence

<400> 18

tgtcccagtg agagttgcag 20

Claims

1. a kind of targeting sgRNA for pig CD163 gene editings, it is characterised in that the sgRNA include sgRNA-C161 and sgRNA-C185；

C161-Fwd：5’-AAAGTGAGCTCCCCCCAGGA-3’(SEQ ID NO.1)；

C161-Rev：5’-TCCTGGGGGGAGCTCACTTT-3’(SEQ ID NO.2)；

C185-Fwd：5’-GAGAAGGAAGTGGACAGATC-3’(SEQ ID NO.3)；

C185-Rev：5’-GATCTGTCCACTTCCTTCTC-3’(SEQ ID NO.4).

2. a boar CD163 genetic modification carriers, it is characterised in that cut including two sgRNA, Cas9 described in claim 1 Mouth enzyme and fluorescent marker protein.

3. pig CD163 genetic modification carriers according to claim 2, it is characterised in that the pig CD163 genetic modifications are The gene editing carried out for the 7th extron of pig CD163 genes.

4. the preparation method of pig CD163 genetic modification carriers as claimed in claim 2 or claim 3, it is characterised in that including following step Suddenly：

Step (a)：The positive-sense strand of the sgRNA-C161 and antisense strand are subjected to complementary pairing, C161 double chain DNA molecules are formed；

Step (b)：The positive-sense strand of the sgRNA-C185 and antisense strand are subjected to complementary pairing, C185 double chain DNA molecules are formed；

Step (c)：The C161 double chain DNA molecules are connected on expression vector, construction expression sgRNA-C161 carrier；

Step (d)：The C185 double chain DNA molecules are connected on expression vector, construction expression sgRNA-C185 carrier；

Step (e)：Carrier using the expression sgRNA-C161 is template, the sgRNA- of the PCR amplifications containing U6 promoters C161 sequences, and be connected on cloning vector, then the acquisition U6-sgRNA-C161 sequences after digestion；

Step (f)：On the carrier that the U6-sgRNA-C161 sequences are connected to the expression sgRNA-C185, build and complete Express the sgRNA-C161 and sgRNA-C185 carrier.

5. preparation method according to claim 4, it is characterised in that in step (c) and step (d), the expression is carried Body is the PX461 carriers of the digestions of process Bbs I with Cas9 nickases, fluorescent marker protein and U6 promoters.

6. preparation method according to claim 4, it is characterised in that in step (e), the cloning vector is pMD18- Carrier T.

7. application of the pig CD163 genetic modifications carrier as claimed in claim 2 or claim 3 in anti-blue otopathy pig is prepared.

8. a kind of preparation method of anti-blue otopathy pig, it is characterised in that the pig CD163 genes described in application Claims 2 or 3 are repaiied Adorn carrier.

9. the preparation method of anti-blue otopathy pig according to claim 8, it is characterised in that repair the pig CD163 genes Decorations carrier is transferred in the body cell of pig, CD163 gene editing positive cell clones is obtained, using the positive cell as donorcells Somatic cell clone and embryo transfer are carried out, the anti-blue otopathy pig is obtained.

10. a kind of pig of anti-blue otopathy, it is characterised in that the preparation method of the anti-blue otopathy pig described in application claim 8 or 9 Prepare.