CN108715850A - GING2 gene knockouts are carried out using CRISPR-Cas systems in epidermal stem cells - Google Patents
GING2 gene knockouts are carried out using CRISPR-Cas systems in epidermal stem cells Download PDFInfo
- Publication number
- CN108715850A CN108715850A CN201810570225.9A CN201810570225A CN108715850A CN 108715850 A CN108715850 A CN 108715850A CN 201810570225 A CN201810570225 A CN 201810570225A CN 108715850 A CN108715850 A CN 108715850A
- Authority
- CN
- China
- Prior art keywords
- stem cells
- epidermal stem
- glu
- lys
- gins2
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0625—Epidermal cells, skin cells; Cells of the oral mucosa
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
Abstract
GINS2 gene editings are carried out for epidermal stem cells using CRISPR-cas systems the present invention provides a kind of, more particularly to a kind of foundation of the epidermal stem cells cell line of structure GINS2 gene knockouts.Two special gRNA are wherein built and obtained, the gene editing efficiency that CRISPR/Cas9 in epidermal stem cells is directed to GINS2 can be significantly improved.Epidermal stem cells GINS2 provided by the invention, which knocks out plasmid, has preferable genetic stability and higher target practice efficiency.
Description
Technical field
Present invention offer is a kind of to carry out GING2 gene editings using CRISPR-cas systems for epidermal stem cells, especially
It is to be related to a kind of foundation of the epidermal stem cells cell line of structure GING2 gene knockouts.
Background technology
Epidermal stem cells (Epidermal stem cells, EpiSCS) have self duplication and multi-lineage potential
Stem cell, its normal proliferative and differentiation are to maintain skin and its appendicle (sweat gland hair, sebaceous glands) structure and function complete
The basic demand of property.In physiological conditions, epidermal stem cells are divided into a stem cell and one by Asymmetric division mode
Transit amplifying cells (transit amplifying cellsTA cells), TA cells after multiple division using being divided into silk
Postmitotic cell (Post-mitotic cells) and terminally differentiated cells (terminally-differentiated
Cells), to supplement the needs of epidermal cell continuous renewal.Research shows that epidermal stem cells can not only be trained Long Term Passages in vitro
Support, and keep its Proliferation, Differentiation potential (Dunnwald et al, Exp Dermatol, 2001,10：45-54.Papini et
Al.stem cells, 2003,21：481-494), moreover, also being shown under the conditions of certain environment similar to embryonic stem cell
Differentiation potential [Liang et al, stem cells, 2002：20：21-31].Therefore, the epidermal stem cells of purifying are obtained not
Only seed cell can be provided to be built with the artificial skin of physiological function, and can be used for gene therapy and the life of transgenic animals
Production.
Human pluripotent stem cell (Humanpluripotent stem cells, hPSCs) and genome editing technique combine
The cell model established provides a unique experiment porch for disease research.Utilize this platform system, researcher
Specific gene mutation even influence of the chromosomal structural variation to mankind's various kinds of cell type and tissue organ function can be studied
And its detailed molecular mechanism, and " personalization " disease model for carrying different genetic mutations can be established for large-scale medicine sieve
Choosing.The foundation of the model system has benefited from genome editing technique, especially CRISPR/Cas9 (Clusteredregularly
interspaced shortpalindromic repeats/CRISPR-associatedproteins9,CRISPR/Cas9)
The rapid development of technology.
GINS2 is one of DNA replication dna complex GINS family members, is located on human chromosome 16q24, mRNA length is
1196bp, the protein that coding relative molecular mass is 21000.GINS is a kind of replicative helicase, before being moved to replication fork
Open DNA double chain.Studies have shown that GINS family members play a role in the generation of cancer, as GINS family members are invading
It is overexpressed in attacking property melanoma, also there is document to show that DNA replication dna GAP-associated protein GAP plays the role of in different cells different, such as
In terms of determining that centerbody replicates quantity and the pathogenetic different phase of disease, GINS has played certain function, especially with dye
The separation of colour solid is closely related.
And it is seldom in the report of tumour related field about GINS2 at present.In CN106620703A, for people GINS2
The siRNA sequence of gene, rna interference vector and RNA interfere slow virus, further have detected the heavy of GINS2 genes
The silent influence of efficiency, GINS2-siRNA slow virus to tumor cell proliferation ability and level of apoptosis, as a result display use the side RNAi
The proliferation of tumour cell can effectively be inhibited under method after the expression of mediator GINS2 genes and growth and promote its apoptosis, show GINS2
Gene is proto-oncogene, can be used as the target spot of oncotherapy, can be used as inhibition by the expression of RNAi mode silence GINS2 genes
The effective means of tumor development.But in this study, it is interfered using SiRNA, the method has knockout not thorough
Bottom, the defect for the knockout heredity that cannot stablize.In (Integration of Genomic, Biologic, and Chemical
Approaches to Target p53Loss and Gain-of-Function in Triple Negative Breast
Cancer in), although referring to CRISPR/Cas can be used for MCM2, GINS2, C19orf43, ELOVL2, ARL4D,
DNM3OS, FGFR2, IFIT2, MPPED2, B2M, ERRFI1, GLUL CASP4, CPED1, SPTLC2, CMTM6, CFH, CARS2,
SUMF1, but an only conception, there is no implement.CRISPR modifications are carried out for different genes to be not simply easy to set
Meter, it needs to overcome numerous obstacles, has greatly experiment difficult.
Versatility based on epidermal stem cells, in order to study the epidermal stem cells for knocking out GINS2 genes in treatment of cancer side
The function in face, establishing the epidermal stem cells cell line of knockout GINS2 genes becomes particularly important.
Invention content
The object of the present invention is to provide a kind of epidermal stem cells knocking out GINS2 genes, and effectively overcoming the prior art makes
The technological deficiency of heredity cannot be stablized by carrying out interference with siRNA.
To achieve the above object, the present invention provides a kind of target of CRISPR-cas systems, according to the gene sequence of GINS2
Row, the specific sgRNA of design are as follows：
GINS2-sgRNA7：5'to 3'aatgcccagcccttactaca
GINS2-sgRNA23：5'to 3'tgcatggaagccatcacact.
To achieve the above object, a kind of raising CRISPR-cas systems of present invention offer knock out in epidermal stem cells
The method of GINS2 genes, including synergistic protein is introduced into host cell, the synergistic protein ESCS-higher is by SEQ
ID NO:Nucleotide sequence coded protein shown in 1.
Further, the synergistic protein is comprising a) or b)：
a)SEQ ID NO:The polynucleotide sequence of nucleotide sequence coded protein shown in 1；
b)SEQ ID NO:Amino acid sequence shown in 2.
Further, a kind of system carrying out gene editing using CRISPR/Cas9 in epidermal stem cells is provided,
Be characterized in that the system comprises：(1) it is used to express SEQ ID NO：The plasmid of ESCS-higher described in 1；(2) sgRNA has been
The plasmid of expression PX330 through insertion (it can express sgRNA and cas9).
Further, sgRNA the and cas9 expression vectors can also be other expression vectors commonly used in the art.
The method that the present invention provides a kind of to use CRISPR/Cas9 gene editings GINS2 in epidermal stem cells, this hair
It is bright to has the following advantages：
It being capable of specificity in epidermal stem cells the present invention provides by gRNA design and optimizations nearly 100 times, obtaining
The 2 Non-specific gRNA knocked out for GINS2 genes, there is stronger knockout effect, and the present invention is in epidermis
In stem cell, construct the cell line of GINS2 gene knockouts, screen and optimize and obtain best sgRNA, knock out it is efficient,
Passage is stablized.
Description of the drawings
Fig. 1 Western-blot detect GINS2 protein expression result figures；4 be epidermal stem cells blank control；3 be not lead
Enter the effect of the gRNA7 of synergistic protein；2 be the effect for the gRNA7 for importing synergistic protein；1 is the gRNA23 for importing synergistic protein
Effect.
Below by drawings and examples, technical scheme of the present invention will be described in further detail.
Specific implementation mode
The technical solution for the method for improving genome editorial efficiency is further illustrated the present invention below by specific embodiment.
The structure of embodiment 1, CRISPR expression vectors
The design of gRNA
According to the gene order of target gene, by applicant's early period, specifically screening obtains optimization design from tens gRNA
The form of specific sgRNA is as follows：
GINS2-sgRNA7：5'to 3'aatgcccagcccttactaca
GINS2-sgRNA23：5'to 3'tgcatggaagccatcacact.
According to above-mentioned gRNA, positive oligonucleotide sequence is obtained plus CACC at its end 5', at the ends 5' of its complementary strand
In addition AAAC obtains reverse oligonucleotide sequence, it is respectively synthesized forward and reverse oligonucleotide sequence, then by the sequence of synthesis
Denaturation, annealing, obtain the double chain DNA fragment with BbsI cohesive ends, as follows：It is positive：5'-
CACCNNNNNNNNNNNNNNNNNNNN is reversed：NNNNNNNNNNNNNNNNNNNNCAAA-5 ', denaturation, annealing system are：2μl
Positive 2 μ l reverse oligonucleotides chain (50 μM) of oligonucleotide chain (50 μM), 46 μ l l*NEB buffer press following journey in PCR instrument
Sort run：90 DEG C, 4min；72 DEG C, 10min；37 DEG C, 22min；25 DEG C, 25min.
Double chain oligonucleotide chain after annealing contains the cohesive end of BbsI, directly with by the pX330- of BbsI digestions
U6-Chimeric_BB-CBh-hSpCas9 (hereinafter referred to as PX330) carrier is attached, and can obtain PX330-gRNA-Cas9 weights
Group plasmid.
Digestion system：39.3 μ l, 10*FD buffer of water, 52 37 DEG C of water-bath 2h of μ l, PX3303.7 μ l (2 μ g) of μ l, BbsI
Plasmid after digestion is directly recycled with plastic recovery kit.
Linked system：0.5 μ l of annealed product, PX330 plasmids 2 μ 1,5*ligationbuffer2 μ l, T4DNA of linearisation
Ligase (3units/ μ 1), 1 μ l, the connection product conversion JM109 that water 4.5 μ l, 16 DEG C of water-bath 2h obtain above-mentioned steps experience
State cell is coated on the LB tablets of Amp+, and picking positive colony connects bacterium, and 37 DEG C of shaking tables shake bacterium and stay overnight, and plasmid extraction kit carries
It takes plasmid and carries out sequencing identification, obtain PX330-gRNA plasmids.
Embodiment 2 clones synergistic protein ESCS-higher and carrier construction
Synergistic protein ESCS-higher genes are cloned, by full genome synthetic method, obtain SEQ ID NO：Described in 1
Gene order using the sequence as template be respectively 5'-atgatatactttattagaat-3' according to upstream and downstream primer sequence,
5'-tcaagggatttccatttctc-3', primer and full-length genome are synthesized by Shanghai Sheng Gong Co., Ltds.PCR reaction amplifications
ESCS-higher gene target gene fragments, amplification reaction system are as follows:95 DEG C, 40s, 57 DEG C, 1min, 72 DEG C, 1min, 72
DEG C, 10min, recycle 35 times, PCR product is sequenced by Shanghai Sheng Gong Co., Ltds, by sequencing, in conjunction with SEQ ID NO：
1 exactly matches.Then, the target gene of PCR amplification is connected on empty carrier slow virus carrier pHIV-CS-CDF-CG-PRE,
Recombined lentivirus vector is identified by the methods of PCR amplification, digestion, sequencing.It is built successfully in conjunction with proof recombined lentivirus vector.
Then by the recombined lentivirus vector plasmid with helper plasmid together coinfection epidermal stem cells (ESCs) (according to CN1253558C
Middle method of claim 1 is separately cultured acquisition), the epidermal stem that can express ESCS-higher genes is packaged by recombination
Cell.By PCR screening and identifications, the stem cell of stable transfection is applied for subsequent gene editor.
Applied analyses of the embodiment 3CRISPR/Cas9 in epidermal stem cells
SgRNA expression plasmids prepared by embodiment 1, well known Cas9 expression plasmids cotransfection epidermal stem cells.Using
The transfection epidermal stem cells rotaring redyeing system and reagent that build are made Lipofectamine by lipofectionTM2000
(invitrogen companies), transfection detailed step is with reference to transfection specification.With the stem cell of the synergy gene of untransfected embodiment 2
As positive control.
Embodiment 4Western-blot detects GINS2 protein expression situations
1. total protein extraction
Cultivate cell cracking
(1) by epidermal stem cells attached cell, culture solution is removed, is washed one time with PBS, suspension cell is collected by centrifugation, PBS
It washes one time.
(2) usually every 106 cells can add 0.1ml RIPA buffer, lysate and cell to come into full contact with.
(3) it places on ice several minutes, is gently blown and beaten with pipette tips, cell is made fully to crack, then gently tilt culture dish to make to split
Solution product flow to bottle ware one side or one jiao, it is then transferred to 1.5ml centrifuge tubes, acutely oscillation 30 seconds.
DEG C centrifugation of (4) 12,000 × g, 45 minutes, takes supernatant, you can carry out subsequent electrophoresis, Western or immunoprecipitate
Operation.
Tissue block cracks
(1) tissue cuts into tiny fragment.1ml RIPA lysates are added in every 100 milligrams of tissues.Use glass homogenizer
Homogenate homogenate 20 times manually up and down.
(2) homogenate is transferred to 1.5ml centrifuge tubes.
DEG C centrifugation of (3) 12,000 × g, 45 minutes, takes supernatant, you can carry out subsequent electrophoresis, Western or immunoprecipitate
Operation.
2. determination of protein concentration (BCA surveys albumen concentration)
The preparation of working solution
(1) before measuring, according to BCA Reagent A:BCA Reagent B=100:It is configured to work after 1 ratio mixing
When making liquid, such as preparing the working solution of 30ml, the BCA Reagent B of 0.3ml are added in the BCA Reagent A of 30ml
Afterwards, the working solution fully after oscillation mixture system can preserve three days at 4 DEG C uses.
(2) computational methods of work liquid measure needed for are as follows：
Required working solution total volume (ml)=[(8 parts or 7 parts of BSA standard solution+detection sample number) × parallel samples number
(n)+1] × 1 working solution volume needed for sample
Example) Standard Operating Procedure【1ml reaction systems】Detect sample number be 12, Duplicate Samples (n=2) when：[(8+12)×
2+1] × 1ml=41ml
Example) Standard Operating Procedure【200 μ l reaction systems】, detection sample number be 20, Duplicate Samples (n=2) when：[(8+
20) × 2+1] × 0.2ml=11.4ml
Example) low concentration protein example measure operating process【1ml reaction systems】, detection sample number be 12, it is parallel
When sample (n=2)：[(7+12) × 2+1] × 0.5ml=19.5ml
3. Standard Operating Procedure (the quantification range of low concentration protein sample：0~200 μ g/ml)
【0.2ml reaction systems is measured using microwell plate】
1) preparation of BSA standard solutions.
(1) preparation of 0.2mg/ml BSA standard solutions：Take 120 μ l BSA Standard Solution (2mg/
Ml), it is sufficiently mixed after 1,080 μ l dilutions being added.
(2) according to different concentration dilution BSA standard solutions, the dilution of BSA standard solutions and detection sample can make
With deionized water, 0.9%NaCl or PBS.
2) preparation of BSA standard curves
(1) the BSA standard solutions after 100 μ l dilutions is taken to be added in microwell plate respectively, each concentration take 2 it is parallel
Sample.
(2) after 100ul working solutions being added, mixing immediately.
It reacts after sixty minutes, is cooled to room temperature in (3) 37 DEG C of water baths.
(4) absorbance value at spectrophotometric determination 562nm is used.When measurement, using 1mL cuvettes, with water school zero.
Detection finishes all samples as far as possible in 20 minutes.
(5) absorbance value of each concentration BSA standard solutions subtracts the average value of Blank values, draws BSA standard solutions
Standard curve.
3) measurement of sample is detected
When detecting sample measurement, it is proposed that be carried out at the same time measurement with BSA standard solutions.
(1) 100 μ l detection samples are taken to be added in microwell plate respectively, each sample takes 2 Duplicate Samples to be measured.
(being measured after dilution process dilution detection sample identical with BSA standard solutions if necessary, also may be selected)
(2) after 100 μ l working solutions being added, mixing immediately.
It reacts after sixty minutes, is cooled to room temperature in (3) 37 DEG C of water-baths.
(4) microplate reader wavelength is set at 562nm and is measured.With water school zero.It detects and finishes in 20 minutes as far as possible
All samples.
(5) absorbance value of each sample solution subtracts the average value of Blank values, and detection sample is calculated according to standard curve
Albumen concentration.
4.SDS-PAGE electrophoresis
(1) it is put into clamping in folder after glass plate alignment.Then vertical card prepares encapsulating on the top of the shelf.
(2) 10% separation gel is prepared, being shaken up immediately after addition TEMED can encapsulating.
(3) when having a fringence between Dang Shui and glue, illustrate that glue has coagulated.Equal 3min make glue fully solidify to fall again
It removes photoresist and upper water and is blotted water with blotting paper.
(4) 4% concentration glue is prepared, being shaken up immediately after addition TEMED can encapsulating.It is right that remaining space is filled into concentration glue
Comb is inserted into concentration glue afterwards.
(5) it is rinsed with water and concentrates glue, put it into electrophoresis tank.(small glass-board surface is inside, big glass-board surface to
Outside.If only running one piece of glue, that slot another side will pad one piece of plastic plate and have facing out on one side for word.) (6) take out loading sample with
5 × SDS sample-loading buffers press 4：1 ratio mixes, and boiling 5min in boiling water after mixing makes albuminous degeneration.
(7) it fills up after enough electrophoresis liquids by equal protein loading.
(8) electrophoresis, conversion voltage waited for that bromjophenol blue was gone to offset plate bottom and do not run just to 120V after 80V runs concentration glue
Go out.
(9) opening clip keeps black one side holding horizontal, is padding foam-rubber cushion, filter paper, glue, pvdf membrane (warp successively above
Methanol activate), filter paper, foam-rubber cushion；Change electrophoresis liquid into transfer liquid simultaneously.
(10) electric current is adjusted to constant current 200mA, shifted about 1 hour.
(11) film is taken out, and carries out positive and negative label, cleans 1 minute in TBST, is then closed with confining liquid.
(12) corresponding primary antibody is diluted to certain concentration (1 with confining liquid:500), the dilution final concentration of internal reference primary antibody
It is 1：3000, it then incubates 1.5 hours or 4 DEG C and is incubated overnight.
(13) it is cleaned 3 times, every time 5 minutes with TBST.
(14) secondary antibody is diluted to certain concentration (1 with confining liquid:3000) it, then incubates 1.5 hours.
(15) it is cleaned 4 times, every time 5 minutes with TBST.
5. chemiluminescence is developed, fixing
(1) two kinds of reagents of A and B are in vitro mixed in equal volume, is then added in the front of pvdf membrane, incubate general 2 points
Clock.
(2) enter darkroom, one layer of preservative film of pvdf membrane upper cover wipes extra luminous agent.Film is pressed on preservative film,
The different time for exposure is selected according to luminous intensity.
(3) film is put into developer solution, after there is band, is immediately placed in fixing solution, flowing water dries after developing photographic film.
(4) film is scanned, then UVP gel images processing system Labworks4.6 softwares is used to analyze purpose item
The gray value of band.
(5) GINS2 protein expressions in epidermal stem cells after transfection are detected by Western-blot, as a result such as
Shown in Fig. 1, epidermal stem cells blank control, protein expression does not influence；The gRNA1 for not importing synergistic protein can knock out purpose
Gene, protein expression have certain influence；And the gRNA7 for importing synergistic protein has the gene knockout effect albumen suppression that increases significantly
Rate processed reaches 92.1%；The protein expression inhibiting rate for importing the gRNA23 of synergistic protein reaches 91.0%, and effect is extremely notable.Tool
There are fabulous application prospect and application value.
It should be noted last that the above examples are only used to illustrate the technical scheme of the present invention and are not limiting, although ginseng
It is described the invention in detail according to preferred embodiment, it will be understood by those of ordinary skill in the art that, it can be to the present invention
Technical solution be modified or replaced equivalently, without departing from the spirit of the technical scheme of the invention and range.
Sequence table
<110>The Luoyang bio tech ltd Xuan Zhi
<120>GING2 gene knockouts are carried out using CRISPR-Cas systems in epidermal stem cells
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2280
<212> DNA
<213>Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 1
atgatatact ttattagaat aatcatgggc cagactggga agaaatctga gaagggacca 60
gtttgttggc ggaagcgtgt aaaatcagag tacatgcgac tgagacagct caagaggttc 120
agacgagctg atgaagtaaa gagtatgttt agttccaatc gtcagaaaat tttggaaaga 180
acggaaatct taaaccaaga atggaaacag cgaaggatac agcctgtgca catcctgact 240
tctgtgagct cattgcgcgg gactagggag tgttcggtga ccagtgactt ggattttcca 300
acacaagtca tcccattaaa gactctgaat gcagttgctt cagtacccat aatgtattct 360
tggtctcccc tacagcagaa ttttatggtg gaagatgaaa ctgttttaca taacattcct 420
tatatgggag atgaagtttt agatcaggat ggtactttca ttgaagaact aataaaaaat 480
tatgatggga aagtacacgg ggatagagaa tgtgggttta taaatgatga aatttttgtg 540
gagttggtga atgcccttgg tcaatataat gatgatgacg atgatgatga tggagacgat 600
cctgaagaaa gagaagaaaa gcagaaagat ctggaggatc accgagatga taaagaaagc 660
cgcccacctc ggaaatttcc ttctgataaa atttttgaag ccatttcctc aatgtttcca 720
gataagggca cagcagaaga actaaaggaa aaatataaag aactcaccga acagcagctc 780
ccaggcgcac ttcctcctga atgtaccccc aacatagatg gaccaaatgc taaatctgtt 840
cagagagagc aaagcttaca ctcctttcat acgcttttct gtaggcgatg ttttaaatat 900
gactgcttcc tacatcgtaa gtgcaattat tcttttcatg caacacccaa cacttataag 960
cggaagaaca cagaaacagc tctagacaac aaaccttgtg gaccacagtg ttaccagcat 1020
ttggagggag caaaggagtt tgctgctgct ctcaccgctg agcggataaa gaccccacca 1080
aaacgtccag gaggccgcag aagaggacgg cttcccaata acagtagcag gcccagcacc 1140
cccaccatta atgtgctgga atcaaaggat acagacagtg atagggaagc agggactgaa 1200
acggggggag agaacaatga taaagaagaa gaagagaaga aagatgaaac ttcgagctcc 1260
tctgaagcaa attctcggtg tcaaacacca ataaagatga agccaaatat tgaacctcct 1320
gagaatgtgg agtggagtgg tgctgaagcc tcaatgttta gagtcctcat tggcacttac 1380
tatgacaatt tctgtgccat tgctaggtta attgggacca aaacatgtag acaggtgtat 1440
gagtttagag tcaaagaatc tagcatcata gctccagctc ccgctgagga tgtggatact 1500
cctccaagga aaaagaagag gaaacaccgg ttgtgggctg cacactgcag aaagatacag 1560
ctgaaaaagg acggctcctc taaccatgtt tacaactatc aaccctgtga tcatccacgg 1620
cagccttgtg acagttcgtg cccttgtgtg atagcacaaa atttttgtga aaagttttgt 1680
caatgtagtt cagagtgtca aaaccgcttt ccgggatgcc gctgcaaagc acagtgcaac 1740
accaagcagt gcccgtgcta cctggctgtc cgagagtgtg accctgacct ctgtcttact 1800
tgtggagccg ctgaccattg ggacagtaaa aatgtgtcct gcaagaactg cagtattcag 1860
cggggctcca aaaagcatct attgctggca ccatctgacg tggcaggctg ggggattttt 1920
atcaaagatc ctgtgcagaa aaatgaattc atctcagaat actgtggaga gattatttct 1980
caagatgaag ctgacagaag agggaaagtg tatgataaat acatgtgcag ctttctgttc 2040
aacttgaaca atgattttgt ggtggatgca acccgcaagg gtaacaaaat tcgttttgca 2100
aatcattcgg taaatccaaa ctgctatgca aaagttatga tggttaacgg tgatcacagg 2160
ataggtattt ttgccaagag agccatccag actggcgaag agctgttttt tgattacaga 2220
tacagccagg ctgatgccct gaagtatgtc ggcatcgaaa gagaaatgga aatcccttga 2280
<210> 2
<211> 759
<212> PRT
<213>Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 2
Met Ile Tyr Phe Ile Arg Ile Ile Met Gly Gln Thr Gly Lys Lys Ser
1 5 10 15
Glu Lys Gly Pro Val Cys Trp Arg Lys Arg Val Lys Ser Glu Tyr Met
20 25 30
Arg Leu Arg Gln Leu Lys Arg Phe Arg Arg Ala Asp Glu Val Lys Ser
35 40 45
Met Phe Ser Ser Asn Arg Gln Lys Ile Leu Glu Arg Thr Glu Ile Leu
50 55 60
Asn Gln Glu Trp Lys Gln Arg Arg Ile Gln Pro Val His Ile Leu Thr
65 70 75 80
Ser Val Ser Ser Leu Arg Gly Thr Arg Glu Cys Ser Val Thr Ser Asp
85 90 95
Leu Asp Phe Pro Thr Gln Val Ile Pro Leu Lys Thr Leu Asn Ala Val
100 105 110
Ala Ser Val Pro Ile Met Tyr Ser Trp Ser Pro Leu Gln Gln Asn Phe
115 120 125
Met Val Glu Asp Glu Thr Val Leu His Asn Ile Pro Tyr Met Gly Asp
130 135 140
Glu Val Leu Asp Gln Asp Gly Thr Phe Ile Glu Glu Leu Ile Lys Asn
145 150 155 160
Tyr Asp Gly Lys Val His Gly Asp Arg Glu Cys Gly Phe Ile Asn Asp
165 170 175
Glu Ile Phe Val Glu Leu Val Asn Ala Leu Gly Gln Tyr Asn Asp Asp
180 185 190
Asp Asp Asp Asp Asp Gly Asp Asp Pro Glu Glu Arg Glu Glu Lys Gln
195 200 205
Lys Asp Leu Glu Asp His Arg Asp Asp Lys Glu Ser Arg Pro Pro Arg
210 215 220
Lys Phe Pro Ser Asp Lys Ile Phe Glu Ala Ile Ser Ser Met Phe Pro
225 230 235 240
Asp Lys Gly Thr Ala Glu Glu Leu Lys Glu Lys Tyr Lys Glu Leu Thr
245 250 255
Glu Gln Gln Leu Pro Gly Ala Leu Pro Pro Glu Cys Thr Pro Asn Ile
260 265 270
Asp Gly Pro Asn Ala Lys Ser Val Gln Arg Glu Gln Ser Leu His Ser
275 280 285
Phe His Thr Leu Phe Cys Arg Arg Cys Phe Lys Tyr Asp Cys Phe Leu
290 295 300
His Arg Lys Cys Asn Tyr Ser Phe His Ala Thr Pro Asn Thr Tyr Lys
305 310 315 320
Arg Lys Asn Thr Glu Thr Ala Leu Asp Asn Lys Pro Cys Gly Pro Gln
325 330 335
Cys Tyr Gln His Leu Glu Gly Ala Lys Glu Phe Ala Ala Ala Leu Thr
340 345 350
Ala Glu Arg Ile Lys Thr Pro Pro Lys Arg Pro Gly Gly Arg Arg Arg
355 360 365
Gly Arg Leu Pro Asn Asn Ser Ser Arg Pro Ser Thr Pro Thr Ile Asn
370 375 380
Val Leu Glu Ser Lys Asp Thr Asp Ser Asp Arg Glu Ala Gly Thr Glu
385 390 395 400
Thr Gly Gly Glu Asn Asn Asp Lys Glu Glu Glu Glu Lys Lys Asp Glu
405 410 415
Thr Ser Ser Ser Ser Glu Ala Asn Ser Arg Cys Gln Thr Pro Ile Lys
420 425 430
Met Lys Pro Asn Ile Glu Pro Pro Glu Asn Val Glu Trp Ser Gly Ala
435 440 445
Glu Ala Ser Met Phe Arg Val Leu Ile Gly Thr Tyr Tyr Asp Asn Phe
450 455 460
Cys Ala Ile Ala Arg Leu Ile Gly Thr Lys Thr Cys Arg Gln Val Tyr
465 470 475 480
Glu Phe Arg Val Lys Glu Ser Ser Ile Ile Ala Pro Ala Pro Ala Glu
485 490 495
Asp Val Asp Thr Pro Pro Arg Lys Lys Lys Arg Lys His Arg Leu Trp
500 505 510
Ala Ala His Cys Arg Lys Ile Gln Leu Lys Lys Asp Gly Ser Ser Asn
515 520 525
His Val Tyr Asn Tyr Gln Pro Cys Asp His Pro Arg Gln Pro Cys Asp
530 535 540
Ser Ser Cys Pro Cys Val Ile Ala Gln Asn Phe Cys Glu Lys Phe Cys
545 550 555 560
Gln Cys Ser Ser Glu Cys Gln Asn Arg Phe Pro Gly Cys Arg Cys Lys
565 570 575
Ala Gln Cys Asn Thr Lys Gln Cys Pro Cys Tyr Leu Ala Val Arg Glu
580 585 590
Cys Asp Pro Asp Leu Cys Leu Thr Cys Gly Ala Ala Asp His Trp Asp
595 600 605
Ser Lys Asn Val Ser Cys Lys Asn Cys Ser Ile Gln Arg Gly Ser Lys
610 615 620
Lys His Leu Leu Leu Ala Pro Ser Asp Val Ala Gly Trp Gly Ile Phe
625 630 635 640
Ile Lys Asp Pro Val Gln Lys Asn Glu Phe Ile Ser Glu Tyr Cys Gly
645 650 655
Glu Ile Ile Ser Gln Asp Glu Ala Asp Arg Arg Gly Lys Val Tyr Asp
660 665 670
Lys Tyr Met Cys Ser Phe Leu Phe Asn Leu Asn Asn Asp Phe Val Val
675 680 685
Asp Ala Thr Arg Lys Gly Asn Lys Ile Arg Phe Ala Asn His Ser Val
690 695 700
Asn Pro Asn Cys Tyr Ala Lys Val Met Met Val Asn Gly Asp His Arg
705 710 715 720
Ile Gly Ile Phe Ala Lys Arg Ala Ile Gln Thr Gly Glu Glu Leu Phe
725 730 735
Phe Asp Tyr Arg Tyr Ser Gln Ala Asp Ala Leu Lys Tyr Val Gly Ile
740 745 750
Glu Arg Glu Met Glu Ile Pro
755
<210> 3
<211> 20
<212> DNA
<213>Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 3
aatgcccagc ccttactaca 20
<210> 4
<211> 20
<212> DNA
<213>Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 4
tgcatggaag ccatcacact 20
Claims (8)
1. a kind of sgRNA, is used for gene editing.
2. a kind of sgRNA, sequence such as SEQ ID NO：3 or 4 is any shown.
3. CRISPR-cas systems method that GINS2 genes are knocked out in vitro epidermal stem cells is improved a kind of, including to place
Synergistic protein is introduced in chief cell, the synergistic protein ESCS-higher is by SEQ ID NO:Nucleotide sequence shown in 1 is compiled
The protein of code；The sgRNA, sequence such as SEQ ID NO：3 or 4 is any shown.
4. method as claimed in claim 3, further, the synergistic protein is comprising a) or b)：
a)SEQ ID NO:Nucleotide sequence coded protein shown in 1；
b)SEQ ID NO:Amino acid sequence shown in 2.
5. a kind of system carrying out gene editing using CRISPR/Cas9 in epidermal stem cells, it is characterised in that the system
Including：(1) it is used to express SEQ ID NO：The plasmid of ESCS-higher described in 1；(2) expression that sgRNA is already inserted into
The plasmid of PX330 can express sgRNA and cas9.
6. system as claimed in claim 5, it is characterised in that：(1) plasmid can in advance be imported into gene editing cell,
After screening obtains positive cell, then it is transferred to the plasmid of (2).
7. purposes of the system of claim 5 in preparing the reagent for epidermal stem cells gene editing.
8. the gRNA described in claim 2 is preparing the purposes in epidermal stem cells and in carrying out the reagent of GINS2 knockouts.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810570225.9A CN108715850B (en) | 2018-06-05 | 2018-06-05 | GING2 gene knockout in epidermal stem cells by using CRISPR-Cas system |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810570225.9A CN108715850B (en) | 2018-06-05 | 2018-06-05 | GING2 gene knockout in epidermal stem cells by using CRISPR-Cas system |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108715850A true CN108715850A (en) | 2018-10-30 |
| CN108715850B CN108715850B (en) | 2020-10-23 |
Family
ID=63911745
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810570225.9A Active CN108715850B (en) | 2018-06-05 | 2018-06-05 | GING2 gene knockout in epidermal stem cells by using CRISPR-Cas system |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108715850B (en) |
Cited By (22)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107619829A (en) * | 2017-10-14 | 2018-01-23 | 洛阳轩智生物科技有限公司 | The method for carrying out GINS2 gene knockouts to mescenchymal stem cell using CRISPR cas systems |
| CN108707604A (en) * | 2018-05-30 | 2018-10-26 | 洛阳轩智生物科技有限公司 | CNE10 gene knockouts are carried out using CRISPR-Cas systems in epidermal stem cells |
-
2018
- 2018-06-05 CN CN201810570225.9A patent/CN108715850B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107619829A (en) * | 2017-10-14 | 2018-01-23 | 洛阳轩智生物科技有限公司 | The method for carrying out GINS2 gene knockouts to mescenchymal stem cell using CRISPR cas systems |
| CN108707604A (en) * | 2018-05-30 | 2018-10-26 | 洛阳轩智生物科技有限公司 | CNE10 gene knockouts are carried out using CRISPR-Cas systems in epidermal stem cells |
Non-Patent Citations (2)
| Title |
|---|
| 无: "NCBI Reference Sequence:XM_007981541.1", 《GENBANK》 * |
| 无: "NCBI Reference Sequence:XM_017011817.2", 《GENBANK》 * |
Cited By (34)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US11920181B2 (en) | 2013-08-09 | 2024-03-05 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10954548B2 (en) | 2013-08-09 | 2021-03-23 | President And Fellows Of Harvard College | Nuclease profiling system |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US10912833B2 (en) | 2013-09-06 | 2021-02-09 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US11299755B2 (en) | 2013-09-06 | 2022-04-12 | President And Fellows Of Harvard College | Switchable CAS9 nucleases and uses thereof |
| US11124782B2 (en) | 2013-12-12 | 2021-09-21 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11053481B2 (en) | 2013-12-12 | 2021-07-06 | President And Fellows Of Harvard College | Fusions of Cas9 domains and nucleic acid-editing domains |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US11578343B2 (en) | 2014-07-30 | 2023-02-14 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108715850B (en) | 2020-10-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108715850A (en) | GING2 gene knockouts are carried out using CRISPR-Cas systems in epidermal stem cells | |
| CN108707604B (en) | CNE10 gene knockout is carried out using CRISPR-Cas system in epidermal stem cells | |
| CN108913691A (en) | Card3 gene knockout is carried out using CRISPR-Cas system in epidermal stem cells | |
| CN108610399B (en) | The method that specificity enhancing CRISPR-CAS system carries out gene editing efficiency in epidermal stem cells | |
| Tanaka et al. | Head and neck cancer organoids established by modification of the CTOS method can be used to predict in vivo drug sensitivity | |
| Mineta et al. | Predicted expansion of the claudin multigene family | |
| Briand et al. | Trisomy 7p and malignant transformation of human breast epithelial cells following epidermal growth factor withdrawal | |
| Pette | The Dynamic State of Muscle Fibers: Proceedings of the International Symposium. October 1–6, 1989, Konstanz, Federal Republic of Germany | |
| Goretzki et al. | Mutational activation of RAS and GSP oncogenes in differentiated thyroid cancer and their biological implications | |
| Chen et al. | Decreased reactive oxygen species production in cells with mitochondrial haplogroups associated with longevity | |
| CN106868008A (en) | CRISPR/Cas9 targeting knock outs people Lin28A genes and its specificity gRNA | |
| Veyrune et al. | A localisation signal in the 3′ untranslated region of c-myc mRNA targets c-myc mRNA and β-globin reporter sequences to the perinuclear cytoplasm and cytoskeletal-bound polysomes | |
| CN109682978B (en) | Prediction method for tumor mutant peptide MHC affinity and application thereof | |
| Schalken et al. | Down modulation of fibronectin messenger RNA in metastasizing rat prostatic cancer cells revealed by differential hybridization analysis | |
| Zhang et al. | A novel mutation of the PTCH1 gene activates the Shh/Gli signaling pathway in a Chinese family with nevoid basal cell carcinoma syndrome | |
| Antoszewski et al. | Tcf1 is essential for initiation of oncogenic Notch1-driven chromatin topology in T-ALL | |
| CN108893473B (en) | Rab23 gene knockout in epidermal stem cells by using CRISPR-Cas system | |
| CN109022461A (en) | A kind of application of the polypeptide of the upstream open reading frame 45aa-uORF nucleotide sequence and its coding of PTEN gene | |
| Goodwin et al. | Nucleosome structure: sites of interaction of proteins in the DNA grooves as determined by Raman scattering | |
| CN109337903A (en) | Long-chain non-coding RNA lncRNA-6585, antibody and application thereof | |
| CN105603117B (en) | MiR-3613 is used to distinguish lung squamous cancer transfer and non-diverting miRNA marker | |
| CN109423522B (en) | Identification and application of molecular breeding marker of functional mutation site of porcine CD4 gene | |
| Quaresima et al. | In vitro analysis of genomic instability triggered by BRCA1 missense mutations | |
| CN110592032B (en) | Ubiquitin ligase Smurf1 mutant, coding gene and application | |
| Jing et al. | Epidermal growth factor receptor regulates lineage plasticity driving transformation to small cell lung cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20200915 Address after: Building A10, No. 12, biogu Avenue, Torch Development Zone, Zhongshan City, Guangdong Province Applicant after: Aiyi Life Technology (Guangdong) Co., Ltd Address before: 471000 Ludu Yuefu Building 1 Unit 1-1404, South of Qianjiang Road, West of Chang Xiamen Street, Luoyang Economic and Technological Development Zone, Henan Province Applicant before: LUOYANG XUANZHI BIOLOGICAL TECHNOLOGY Co.,Ltd. |
|
| TA01 | Transfer of patent application right | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |