CN111088275A

CN111088275A - Cloning method of DNA large fragment

Info

Publication number: CN111088275A
Application number: CN201811238618.6A
Authority: CN
Inventors: 黄菁; 杨波; 卢娜
Original assignee: Individual
Current assignee: Future Mode (Beijing) Technology Co.,Ltd.
Priority date: 2018-10-23
Filing date: 2018-10-23
Publication date: 2020-05-01
Anticipated expiration: 2038-10-23
Also published as: WO2020083083A1; CN111088275B

Abstract

The application provides a method for cloning target gene fragments efficiently, quickly and simply, in particular to a method for cloning and editing DNA large fragments with the length of more than 100kb, preferably more than 300 kb. The method comprises the processes of obtaining, cloning, amplifying, enzyme digestion, transforming and the like of a target gene segment.

Description

Cloning method of DNA large fragment

Technical Field

The application relates to the technical field of genetic engineering. In particular, the method of the present application is particularly suitable for cloning and editing large DNA fragments of greater than 100kb, especially greater than 300kb, in length.

Background

Large-scale gene modification of eukaryotes and prokaryotes depends on a large-fragment genomic DNA cloning technology. However, a method for cloning very large genomic DNA (generally larger than 100kb or more, especially 300kb or more), especially eukaryotic genome with high efficiency is still lacking. The patent introduces a method and a combination technology for efficiently cloning and editing oversized gene fragments, in particular eukaryotic genome fragments.

Conventional gene library methods can be used to clone genomic DNA of a certain length, for example, bacterial artificial chromosome libraries can clone only up to 300kb of foreign DNA, Yeast Artificial Chromosome (YAC) libraries can clone 200kb to 1000kb of genes (Dausset, Ougen et al 1992). However, construction of genomic libraries and screening of positive clones requires a lot of work. In addition, the current YAC libraries are unstable and chimera and gene loss occurs with long term storage (Scott and Vos 2001).

Another approach is to selectively clone large chromosomal fragments from complex and simple genomes using yeast transformation-related recombinant cloning (TAR) techniques. However, in the prior art, the TAR cloning technology is widely used for cloning DNA of less than 300kb (Kouprina and Larionov 2006), and is difficult to be used for cloning genes of more than 300 kb. The reason is that a gene of 300kb or more can be isolated only from genomic DNA (BAC vectors are generally smaller than 300kb), and as the size of the cloned gene increases, DNA is easily broken during gene manipulation, the concentration of intact DNA is low, and the recombination efficiency is low. Also, this method relies on restriction enzymes to isolate DNA. When it is necessary to separate large DNA fragments, it is difficult to find large DNA fragments required for the complete segmentation of a specific endonuclease. In addition, when a large DNA fragment is cloned, the recombination efficiency is very low, only about 2%, due to the far TAR recombination site and DNA cleavage site. And the recombination efficiency becomes extremely low as the length of the DNA fragment increases.

Recently developed gene editing techniques (ZFNs (engineered zinc-finger nucleotides), TALENs (transcription activator-like effector nucleotides) and CRISPR-Cas9(clustered regulated expressed short palindromic repeat Cas9 nucleotides) overcome the above disadvantages and facilitate the cloning of large fragment genes, for example, CRISPR/case 9 systems, guide RNA gRNAs) can specifically recognize DNA of 20 nucleic acid sequence lengths, and gRNAs can recruit Cas9 to cleave at the recognition site.

The combination of the existing CRISPR/cas9 technology and DNA Sequence-dependent splicing technology (LIC; Sequence and ligation-independent cloning, SLIC; Gibson assembly) allows the recombination of foreign DNA into Bacterial Artificial Chromosomes (BACs) (Jiang, Zhaoet. al. 2015; Wang, Wang et. al. 2015). However, in vitro recombination technology combining CRISPR and Gibson assembly technology can only effectively clone DNA fragments of less than 100 kb.

Gene editing techniques can also be combined with bacterial Red/ET recombination techniques for cloning large fragments of DNA. For example, DNA fragments cleaved by CRISPR can also be transformed with linear vectors into bacteria expressing the lambda phage Red/ET recombination system, and the DNA fragments can be assembled into a single recombinant in vivo by sequence-dependent enzymatic reactions (Baker, Guptaet al.2016). However, it is theoretically difficult to obtain a single recombinant of 200kb or more due to the load capacity of BAC vectors and the restriction of linear large fragment DNA transformation into bacteria.

Yeast transformation-associated recombination (TAR) technology allows cloning of 20kb to 250kb of exogenous DNA in yeast cells (Kouprina and Larionov 2006). The combination of CRISPR/cas9 technology and TAR cloning technology can improve the efficiency of TAR cloning but cannot significantly improve the cloning length of cloned large-fragment DNA (Lee, Larionov et al 2015). And because the YAC vector has a low copy number in yeast, it is difficult to isolate and purify to obtain sufficient DNA for further cloning and gene editing. In eukaryotes, some loci or gene families (e.g., TCR, HLA, antibody gene, P450 gene family, etc.) are much longer than 300 kb. At present, no cloning method aiming at the oversized genes exists.

Considering that the one-step cloning method cannot obtain the cloning of the oversized gene segment, a plurality of gene segments can be assembled into a recombinant of the oversized segment in cells by utilizing a homologous recombination repair mechanism which is peculiar to certain cells. For example, in a bacteria expressing lambda Red/ET recombinase, assembly of multiple pieces of DNA within the cell can be achieved. However, most eukaryotic genes are rich in repetitive sequences, or GC-rich regions. Due to the activity of recombinant enzymes in bacteria, the large fragment gene sequences are easy to be unstable in bacteria and are easy to recombine. In addition, the low transforming ability of bacteria to large-fragment DNA also affects the recombination of these large-fragment genes in cells. Bacillus subtilis has been reported to assemble large-fragment DNA inside cells (Itaya, Tsuge et al 2005; Yonemura, Nakada et al 2007). However, Bacillus subtilis is unstable in culture and has a low DNA transforming ability. Nor suitable for the recombination of multi-segment large genes. It has been reported in the prior art that bacterial genes of over 100 million base pairs can be cloned into YAC vectors using a combination of chemical DNA synthesis, Polymerase Chain Reaction (PCR), extracellular Gibson DNA assembly and yeast cell homologous recombination-dependent multi-fragment assembly (Gibson, Glass et al 2010). However, this method has disadvantages in that the DNA sequence is synthesized almost from the beginning, the number of operation steps is large, the cycle is long, the fidelity is poor, the technique is complicated, and the success rate is low. For example, this method requires many steps (gene synthesis, PCR, in vitro ligation, etc. are used in combination) to obtain a 100kb gene. Whereas more than 10 100kb DNA fragments can be assembled into a gene of more than 1000kb in yeast cells.

In addition, genomic DNA of eukaryotes contains a large number of simple repetitive sequences. It is difficult to clone the DNA of these eukaryotes having a large number of repetitive sequences by conventional methods such as gene synthesis and PCR. These DNA sequences have important effects on regulation of gene expression, genomic stability, and the like. Therefore, the assembly method for de novo synthesis of large nucleic acids is not only technically complicated but also disadvantageous for cloning of eukaryotic genes containing simple repetitive sequences. In conclusion, the prior art lacks a method for cloning a eukaryotic gene containing a complex sequence of more than 100kb, especially more than 300kb, for large-fragment genomic DNA.

Furthermore, it has been reported in the literature that YAC vectors lacking an auto-matic replicating sequence (ARS) can efficiently clone genomic DNA containing an ARS-like sequence in yeast cells (Noskov, Koriabine et al 2001). However, this method is selective for the gene of interest. Therefore, it is necessary to establish new YAC vectors for cloning any non-selective large-fragment DNA in yeast.

Summary of The Invention

In order to solve the problem of the lack of methods for cloning large-fragment genomic DNA, particularly eukaryotic genes containing complex sequences, existing in the prior art, we have conducted intensive studies.

The application provides a method for cloning DNA fragments of more than 100kb, especially more than 300kb, efficiently, quickly and simply for the first time.

Specifically, in the present application, we utilize genome editing technology, such as Crispr/Cas9 technology, TAR cloning technology and yeast DNA homologous sequence dependent recombination assembly technology to combine, rapidly realize the editing and cloning of large-fragment (more than 100kb, especially more than 300kb) genome DNA, especially eukaryotic genome DNA.

On the other hand, a URA3 gene-dependent negative cloning negative screening strategy is designed, the enzyme-cut large gene fragment can be directly used for recombination without being recovered by glue, the yeast containing an empty vector can be killed by the drug, and false positive brought by self-cyclization of the vector is avoided. And the design of the homing endonuclease ensures the cutting integrity of large fragments. The shuttle plasmid ensures the amplification of large gene fragments in bacteria.

Although it has been reported in the literature that YAC vectors lacking an auto-matic replicating sequence (ARS) can be used for cloning of genomic DNA containing an ARS-like sequence (Noskov, Koriabine et al 2001). However, this method is selective for the gene of interest. The negative screening method using the activity of URA3 gene can be used to clone any eukaryotic gene and prokaryotic gene.

As described above, the present application can clone genomic DNA containing a simple repetitive sequence, as compared with a DNA cloning method known in the art, such as gene synthesis, PCR, etc. The present application can readily prepare a series of 100kb to 200kb, even more than 200kb, DNA fragments with terminal homologous sequences using the Crispr/TAR cloning technique, in contrast to the combination Crispr and Gibson assembly technique (DNA fragments of more than 100kb cannot be cloned), (Jiang, Zhao et al 2015)). Compared with a yeast TAR cloning technology, the method can realize that a plurality of genes with more than 100kb are assembled into genes with more than 300kb in yeast, so that the method not only can clone DNA fragments with more than 300kb, but also greatly reduces the cloning difficulty and increases the success rate.

In addition, the method of the application is faster and more efficient than the methods in the prior art in cloning prokaryotic genes. The efficiency of assembling large fragments of DNA in yeast depends on the number of DNA fragments transformed into the yeast and the number of moles of DNA fragments. The method of the present application can easily prepare a large amount of large-sized DNA (100kb or more) for homologous recombination using TAR cloning technology of yeast, greatly reducing the number of DNA fragments for assembly. Secondly, the method of the application utilizes a shuttle vector to amplify target fragments in microorganisms such as bacteria in a large quantity; completely cutting the target large fragment by using homing endonuclease; by utilizing a negative screening system of URA3, false positive caused by self cyclization of the vector is avoided; because the enzyme digestion product can be directly used for transformation, the DNA loss and the DNA fragmentation caused by the recovery of the DNA gel are avoided. The design ensures that a sufficient amount of complete large-fragment DNA is used for assembling the yeast cells, and greatly increases the efficiency of cloning the large-fragment DNA. In summary, the present application provides for the first time a method for cloning and editing DNA fragments of more than 100kb, especially more than 300kb, efficiently, rapidly and easily.

Specifically, the present invention relates to the following aspects:

in a first aspect, the present invention provides a method of cloning a gene fragment of interest, comprising the steps of:

1) obtaining a gene fragment of interest from a chromosome or a vector (preferably a BAC vector);

2) recombining the target gene segment into another vector in the microbial cell;

3) allowing the additional vector to amplify in the microorganism;

4) digesting the additional vector with a restriction enzyme to obtain a DNA fragment;

5) transforming the plurality of DNA fragments with homologous ends obtained in step 4) together with the linearized vector into a microorganism, preferably a yeast, with homologous recombination activity, thereby assembling in cells to obtain a recombinant comprising a plurality of gene fragments of interest arranged in a certain order.

In one embodiment, in the method for cloning a gene fragment of interest provided herein, the step 1) comprises cutting the chromosome or the vector using genome editing technology to obtain the gene fragment of interest.

In a preferred embodiment, the genome editing techniques are selected from one or more of the following: zinc Finger Nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) technologies include CRISPR/Cas9 and CRISPR-Cpf1, preferably CRISPR/Cas 9.

In one embodiment, in the method of cloning a gene fragment of interest provided herein, said step 2) comprises cloning said gene fragment of interest into said further vector, preferably a shuttle vector, using homologous recombination splicing technology.

In a preferred embodiment, the homologous recombination splicing technique is selected from one or more of the following: sequence-dependent in vitro assembly techniques (e.g., Gibson assembly, SLIC, LIC, etc.), yeast transformation-coupled recombination (TAR) techniques and bacterial Red/ET homologous recombination techniques, preferably yeast transformation-coupled recombination (TAR) techniques.

In a preferred embodiment, in the method for cloning a gene fragment of interest provided herein, the DNA fragment obtained in step 4) is a eukaryotic gene fragment, which is a DNA fragment of about 100kb to 300kb, and the DNA fragment has homologous ends, preferably 60-800bp, more preferably 90-200 bp.

In one embodiment, in the method of cloning a gene fragment of interest provided herein, the linearized vector is a linearized vector, preferably a linearized yeast shuttle vector, possessing homologous end sequences of the DNA fragment of interest. Preferably, the linearized vector is a YAC or TAR cloning vector.

In one embodiment, in the method of cloning a gene fragment of interest provided herein, the linearized vector is a YAC cloning vector, preferably a pTARYAC-TRP1 cloning vector.

In one embodiment, in the method of cloning a gene fragment of interest provided herein, the additional vector is selected from one or more of the following: BAC (bacterial specific chromosome), YAC (Yeast specific chromosomes), and PAC (P1 specific chromosomes), preferably BAC vectors.

In one embodiment, in the method of cloning a gene fragment of interest provided herein, the yeast is Saccharomyces cerevisiae (Saccharomyces cerevisiae).

In one embodiment, in the method for cloning a gene fragment of interest provided herein, the microorganism used for amplification is a bacterium, preferably E.coli, such as ElectroMAX^TMDH5α-E^TMCompetent cells (Invitrogen, Cata: 11319019).

In one embodiment, in the methods of cloning a gene fragment of interest provided herein, the gene fragment of interest includes prokaryotic and eukaryotic gene fragments, preferably having a length of more than 100kb, preferably more than 300kb, more preferably more than 400 kb.

In another embodiment, in the method of cloning a gene fragment of interest provided herein, the restriction enzyme is an homing endonuclease, such as I-CeuI, I-SceI, PI-PspI, PI-SceI, or the like.

In another embodiment, in the method for cloning a gene fragment of interest provided herein, the cell is a cell having DNA homologous recombination activity, preferably a yeast cell, such as saccharomyces cerevisiae (saccharomyces cerevisiae).

In yet another preferred embodiment, in the method for cloning a gene fragment of interest provided herein, the method further comprises screening the recombinants containing the gene fragment of interest obtained in step 5) using URA3 resistance screening system, the screening comprising:

1) integrating the gene fragment of interest between the ADH1 promoter and URA3 in the YAC vector;

2) yeast cells transformed with recombinants comprising the gene fragment of interest are screened on a selection medium containing 5-FOA and the corresponding auxotrophy, such as TRP1 auxotrophy.

In still another preferred embodiment, in the method for cloning a gene fragment of interest provided herein, the method further comprises the following steps between the steps 4) and 5): repeating steps 1) -4) to prepare a series of DNA fragments having homologous ends, preferably homologous ends of 60-800bp, more preferably 90-200 bp.

In still another preferred embodiment, in the method for cloning a target gene fragment provided herein, the method further comprises performing step 4) one or more times after step 5) to obtain a plurality of DNA fragments having homologous ends, preferably 100kb or more, which are further performed in step 5) to obtain recombinants of 300kb or more in a certain order.

In another aspect of the present application, the present application provides a method for screening YAC vectors recombined with foreign genes using URA3 resistance screening system, which comprises the following steps:

1) integrating the exogenous gene between the ADH1 promoter and URA3 in the YAC vector;

2) cloning the recombinant vector obtained in the step 1) into a yeast cell;

3) screening the yeast cells containing the recombinant vector obtained in step 2) on a selection medium containing 5-FOA and the corresponding auxotrophy.

Brief Description of Drawings

FIG. 1 is a schematic diagram of a high-efficiency subgenomic cloning technique showing a gene editing-dependent rapid subgenomic DNA cloning technique.

FIG. 2. BAC vector covering the human IGL locus (hg19chr22:22,385,572-23,265, 082).

FIG. 3 design and sequence of gRNA on BAC vector.

Fig. 4 is a schematic diagram of gRNA structure. In fig. 4, pairing of crRNA to tracrRNA is shown. The variable target-specific protospacer of crRNA is denoted by "N" bases.

FIG. 5 shows the in vitro cleavage result of CRISPR/Cas 9. The genomic DNA and the vector not carrying the target DNA are identified by DNA electrophoresis after the in vitro enzyme digestion of CRISPR/Cas 9. The CRISPR/Cas9 in vitro enzyme digestion and identification comprises the following steps:

step 1, mixing equimolar tracrRNA and CrRNA to form gRNA;

step 2, mixing equimolar gRNA and Cas9 to form an RNP complex;

step 3, carrying out extracellular enzyme digestion on the DNA template by the RNP complex;

and 4, electrophoretic identification.

In fig. 5, M represents a DNA marker, lane 1 is Cas 90 ug, lane 2 is Cas 90.125ug, lane 3 is cas90.25ug, lane 4 is Cas 90.5 ug.

FIG. 6 uses SnapGene^TMThe resulting yeast bacterial shuttle plasmid pTARBAC-TRP1 map.

FIG. 7A and FIG. 7B A schematic representation of PCR screening of TAR positive clones. FIG. 7A is a schematic primer design. FIG. 7B is a PCR positive clone identification chart. In FIG. 7B, M represents a 100bp molecular weight, lane 1 represents an empty plasmid PCR product, and lanes 2-4 represent recombinants positive clones.

FIG. 8.TAR and CRISPR/Cas9 combined techniques are used to clone a gene fragment of interest from a BAC vector.

FIG. 9 URA3 negative screen identifies TAR recombination positive clones.

FIG. 10. beer yeast dependent multiple DNA fragment assembly principle.

FIG. 11. Using SnapGene^TMMap of the resulting yeast bacterial shuttle plasmid pTARBAC-HIS 5.

FIG. 12 identification of multiple fragment DNA assembly primers in yeast.

FIG. 13A and FIG. 13B PCR method for the identification of multi-fragment yeast transformants. In FIG. 13A, M represents a molecular weight control; lanes 1-4,7-14 represent empty vector PCR products;

lanes

5,6,15 show the recombinant transformant PCR products. In FIG. 13B, lane 1 shows the PCR product at the junction of the vector and the foreign gene 1; lane 2 shows the PCR product of foreign gene 1; lane 3 shows the PCR product at the junction of exogenous gene 1 and exogenous gene 2; lane 4 shows the PCR product of exogenous gene 2; lane 5 shows the PCR product at the junction of foreign gene 2 and foreign gene 3; lane 6 shows the PCR product of the foreign gene 3; lane 7 shows the PCR product at the junction of the foreign gene and the vector; lane 8 represents an empty vector control; lane M represents the molecular weight control.

FIG. 14 comparison of the efficiency of assembly of different amounts of multiple large-fragment DNA in yeast.

Detailed Description

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

All patents, published patent applications, other publications, and sequences from GenBank and other databases mentioned herein are incorporated by reference in their entirety for the relevant art. The practice of the embodiments provided will employ, unless otherwise indicated, conventional techniques of molecular biology and the like, which are within the skill of the art. These techniques are explained fully in the literature. See, for example, Molecular Cloning: a Laboratory Manual, (J.Sambrook et al, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989); current protocol sin Molecular Biology (edited by F.Ausubel et al, 1987 and more recently); essential molecular biology (Brown ed., IRL Press 1991); gene Expression Technology (edited by Goeddel, Academic Press 1991); methods for Cloning and Analysis of Eukaryotic Genes (edited by Bothwell et al, Bartlett Publ.1990); gene Transfer and Expression (Kriegler, Stockton Press 1990); recombinant DNA Methodology (R.Wu et al, eds., Academic Press 1989); and (3) PCR: a practical approach (M.McPherson et al, IRL Press at Oxford university Press 1991); cell Culture for Biochemists (edited by r.adams, Elsevier science publishers 1990); gene Transfer Vectors for Malalian Cells (edited by Miller & M.Calos, 1987); mammalian Cell Biotechnology (m.butler, eds., 1991); animal Cell Culture (edited by Pollard et al, Humana Press 1990); culture of Animal Cells, 2nd Ed. (edited by Freshney et al, Alan R.Liss 1987).

As used herein, "a" or "an" means "a (one)," at least one, "or" one or more.

As used herein, "restriction enzyme site" refers to a target nucleic acid sequence that is recognized and cleaved by a restriction enzyme. Restriction enzymes are well known in the art.

As used herein, the term "target gene fragment" refers to a target DNA fragment to be cloned, and may be a genomic fragment or an artificially synthesized foreign fragment, or may be a complete gene.

The term "genome" includes naturally occurring and synthetic genomes, and includes genetically engineered genomes, such as genomes not previously found in the laboratory and nature, including modified genomes and hybrid genomes comprising nucleic acids from more than one species and/or partial genomes. The term "genome" includes organelle genomes (e.g., mitochondrial and chloroplast genomes), genomes of self-replicating organisms (cellular genomes), including prokaryotic and eukaryotic organisms, fungi, yeast, bacteria (e.g., mycoplasma), archaea, vertebrates, mammals, and other organisms, and viral genomes, as well as other genomes that depend on host proliferation. Genomes also include those of organisms and synthetic organisms that do not fall within any known Linnan classification. An exemplary genome can be a microbial genome, such as the genome of a unicellular organism, including bacteria and yeast.

As described above, the prior art lacks a method for cloning large genomic DNA fragments of 100kb or more, particularly 300kb or more, particularly eukaryotic DNA containing complex sequences.

Meanwhile, eukaryotic genes contain many simple repetitive sequences, and are difficult to synthesize by using methods of gene synthesis and PCR expansion. For genes over 100kb in length, it is also difficult to find specific restriction enzymes to isolate large fragments of genes.

In order to solve the problem, the invention establishes a method for efficiently cloning genes with more than 100kb, particularly more than 300kb, particularly eukaryotic genes. Unlike the existing methods, the method of the present application is not only highly efficient, omitting de novo synthesis or PCR-dependent gene amplification steps, but also allows cloning of eukaryotic genes containing large numbers of simple repetitive sequences.

The method of the present application allows for the rapid isolation of large subcloned gene fragments using gene editing techniques and homologous sequence dependent DNA recombination techniques. Secondly, this method can also be used to purify genomic DNA containing simple repeats. Finally, by utilizing the homologous recombination mechanism of yeast, a plurality of exogenous gene fragments of more than 100kb are assembled into a single recombinant with the length of up to 2Mb in yeast. The method can be used for cloning not only eukaryotic genomic DNA of more than 100kb, especially more than 300kb, but also prokaryotic genomes or DNA virus genomes of large fragments with the same length, can be efficiently cloned, and not only can be used for cloning continuous gene families or gene loci on chromosomes, but also can be used for editing the gene loci at different positions of the chromosomes together.

Therefore, the present application is a highly efficient genomic cloning technique for large fragment (more than 100kb, especially more than 300kb) DNA. Briefly, the technical scheme of the application mainly includes the following aspects: 1. cutting a specific DNA fragment of the chromosome or the vector by using a genome editing technology; 2. cloning the fragments into a new vector by using the principle of homologous sequence dependent DNA recombination specific to microbial cells; 3 amplifying in the microorganism by using the shuttle vector characteristic, and purifying the 100kb to 300kb DNA fragment from the vector by using restriction enzymes, particularly homing enzymes; 4. repeating the above method to prepare a series of DNA fragments with 60-800bp, preferably 90-200bp homologous ends, transforming the fragments and a linear yeast vector (YAC) into Saccharomyces cerevisiae, and obtaining recombinants with the length of more than 300kb by utilizing the homologous recombination characteristics of the yeast.

Specifically, the method for cloning the target gene fragment of the application relates to the following steps:

1) obtaining the desired Gene fragment from chromosome or vector (preferably BAC vector)

In this step, it is preferable to isolate a large fragment of the gene from the genome or vector with high specificity using a recently developed gene editing technique.

Gene editing techniques include Zinc Finger Nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR (clustered regularly interspaced short palindromic repeats)/Cas 9 techniques. Because of their long recognition sequences, longer gene fragments are more easily specifically cleaved than restriction enzymes. In the existing gene editing technology, the CRISPR/Cas9 technology is simpler and faster. In addition to the classical CRISPR/Cas9 system, the recently developed CRISPR-Cpf1 was also used to edit the genome of the AT-rich region.

The method for in vitro enzyme digestion of CRISPR/Cas9 can be referred to the prior art, and can also be divided into the following steps:

1. equimolar tracrRNA (100. mu.M) and CrRNA (100. mu.M) were mixed to form gRNAs. Denaturation at 95 ℃ for 5 min followed by room temperature renaturation for 30 min.

2. The RNP complex was formed by mixing equimolar gRNA and Cas9 at room temperature and incubated for 10 min.

The RNP complex is cleaved extracellularly with the DNA template and reacted at 37 ℃ for 2 hours.

4. Cas 910 was digested with proteinase K at 65 ℃ for min.

5. And (5) electrophoretic identification.

2) Cloning the target gene fragment into another vector

In this step, the desired gene fragment is cloned into another gene vector, preferably using homologous sequence-dependent recombination splicing techniques, to obtain a sub-recombinants.

Sequence-dependent recombinant splicing techniques include sequence-dependent in vitro assembly techniques (e.g., Gibson assembly, SLIC, LIC, etc.), yeast transformation coupled recombination (TAR) techniques and bacterial Red/ET homologous recombination techniques, and cloning into a number of genetic vectors, such as BAC (bacterial specific chromosome), YAC (Yeast specific chromosomal) and PAC (P1 specific chromosomes).

3) Amplification of sub-recombinants in microorganisms

Since vectors, especially gene vectors, such as YAC vectors, have strong homologous recombination characteristics to facilitate the recombination of large-fragment genes in cells, but the copy number of YAC in yeast cells is low, and since yeast cells grow slower than bacteria, YAC vectors and linear yeast chromosomes are difficult to separate in vitro, large-fragment DNA is easy to break, and the like, the technical difficulty in purifying vectors containing complete large-fragment DNA, such as YAC vectors, from yeast is high, and the yield of products is very low. (Noskov, Chuanget al.2011).

In this regard, the characteristics of genetic vectors, such as shuttle vectors (including pTARYAC), can be used to transform yeast vectors carrying exogenous genes into non-yeast microorganisms, preferably bacteria, such that the resulting sub-weights are obtainedThe population may be amplified in a microorganism, such as a bacterium. Vector DNA of less than 300kb can be prepared in large quantities from bacteria. It is known that the size of a DNA fragment may affect its transformation efficiency in a microorganism. For example, the efficiency of transformation of 240Kb plasmid in bacteria is 30 times lower than the efficiency of transformation of 80Kb plasmid DNA. Therefore we chose to use highly competent strains, such as ElectroMAX^TMDH5α-E^TMCompetent cells (Invitrogen, Cata:11319019) were used to transform the DNA.

4) Digesting the additional vector with a restriction enzyme to obtain a DNA fragment.

It is a DNA fragment of about 100kb to 200kb having homologous ends of 60-800bp, preferably 90-200 bp.

The additional vector is digested by restriction enzymes designed in the vector to obtain DNA fragments. The DNA fragment is a DNA fragment of about 100kb to 300kb, and the DNA fragment has a homologous end, preferably 60-800bp, more preferably 90-200 bp.

The restriction enzyme is preferably a homing enzyme.

Because the cloned genomic DNA sequence is large, it is not easy to find a proper endonuclease to completely separate a large segment of exogenous genes from the vector.

In this regard, we used an homing endonuclease in the gene cloning method of the present application. The homing endonuclease comprises I-CeuI, I-SceI, PI-PspI, PI-SceI and the like, is double-stranded DNA nuclease and can recognize a longer non-palindromic sequence (12-40 bp). Recognition sequences for homing endonucleases are very rare. For example, an 18bp recognition sequence is at every 7X10¹⁰bp corresponds to only one occurrence in the total length of 20 mammalian genomic DNAs. Therefore, any foreign gene fragment can be isolated from the vector by using the homing endonuclease.

That is, the recognition sequence of the homing endonuclease in the genome is very small. According to this feature, the objective fragment of any length can be isolated from the gene vector by using the homing endonuclease. For example, pTARYAC-TRP1 vector.

5) Transforming the plurality of DNA fragments obtained above into yeast together with a yeast vector, thereby obtaining a recombinant comprising the gene fragment of interest.

The DNA fragment, preferably having a sequence of 60-800bp, preferably 90-200bp homologous end, is transformed into yeast together with a yeast vector, preferably a linear yeast vector, and a recombinator containing the target gene fragment is obtained by utilizing the homologous recombination mechanism of yeast.

Yeast as host cells include Saccharomyces cerevisiae and other yeast species such as Schizosaccharomyces pombe (Saccharomyces pombe), which can be used to clone very long genomic DNA. Due to their unique set of genetic manipulation tools, yeast hosts are particularly suited for manipulating donor genomic material. The natural abilities of yeast cells and decades of research have led to an abundant set of tools for manipulating DNA in yeast. These advantages are well known in the art. For example, yeasts, with their abundant genetic system, can assemble and reassemble nucleotide sequences by homologous recombination, an ability that many readily available organisms do not possess. Yeast cells can be used to clone larger DNA that cannot be cloned into other organisms, e.g., whole cells, organelles, and viral genomes. Thus, one embodiment of the described method exploits the tremendous power of yeast genetics, advancing synthetic biology and synthetic genomics by using yeast as a host cell for manipulating the genomes and synthetic genomes of intractable and other organisms.

In addition, yeasts, in particular Saccharomyces cerevisiae, have great advantages as host cells for cloning DNA fragments. For example, yeast has a strong recombinase activity, and DNA fragments up to 25 overlapping fragments can be ligated to vector DNA at a time (Gibson, Benders et al 2008), thus having the ability to take up multiple DNAs. Simultaneously, the homologous recombination capability of yeast can effectively assemble the multi-fragment DNA into a single recombinant correctly.

In addition, Yeast Artificial Chromosomes (YACs) contain centromeres that support replication of at least 2Mb of eukaryotic unstable DNA (Kouprina, Leem et al 2003). Large prokaryotic DNA fragments can be cloned in yeast using the universal genetic code. Toxic gene expression is generally not an obstacle to cloning donor nucleic acids in yeast. For example, studies of bacterial and archaeal genomes indicate that proteins expressed from clonal genomes have little risk of harm to yeast hosts because eukaryotes use a different protein expression machinery than these bacteria. Transcription signals in yeast are distinct from transcription and translation in bacteria. In fact, most prokaryotic genes are likely not expressed in yeast. There are no limiting obstacles in yeast. If there is a disorder, it may be a replication disorder rather than a gene expression disorder. Genotoxicity is minimized because gene expression regulation is different in eukaryotes such as yeast than in prokaryotes. Furthermore, mycoplasma uses the codon UGA as tryptophan rather than as a translation termination signal. Thus, most mycoplasma genes, if expressed, will produce truncated proteins in yeast. This largely avoids the possibility of toxic gene products.

Thus, we introduced these DNA fragments containing the ends of the homologous sequences into yeast together with vectors, such as gene vectors, including linear YAC vectors. By utilizing the high-efficiency DNA homologous recombination mechanism peculiar to yeast, the gene segments can assemble a circular YAC vector in yeast cells.

In one aspect, the vector comprises any DNA elements (e.g., origins of replication) required to facilitate replication of the vector in one or more desired cell types and selection and/or resistance markers for use in different cell types.

Resistance markers are well known. The skilled person is able to determine suitable resistance markers for different host/donor combinations. In some cases, it is desirable to use markers that are not clinically relevant. In other cases, the selection of the resistance marker depends on the nature of the donor, host and/or recipient cell.

The yeast is preferably Saccharomyces cerevisiae.

Homologous recombination in yeast

Yeast such as Saccharomyces cerevisiae has a high-efficiency homologous recombination mechanism, and homologous recombination can be accurately and effectively carried out only by a homologous segment of more than 60bp between two DNA molecules (Noskov, Koriabine et al 2001).

In the present application, a series of large gene fragments having homologous ends can be generated by using a gene editing technique and a yeast TAR cloning technique. These gene fragments range in size from about 100kb to 300kb, and possess homologous ends with each other, and are between 60bp to 800bp in length, preferably between 90bp to 200bp in length. For example, the following primers were designed to amplify YAC shuttle vector pYACTAR-TRP1 for cloning of a portion of the human IGL locus sequence within the BAC vector (RP11-890G 10). The capital letters of the primer sequences indicate recognition sites of endonuclease I-SceI, the upstream ((60nt) indicated by lower case letters) of the recognition sites of the I-SceI is a homologous sequence of a target gene to be cloned in a BAC vector (RP11-890G10), and the downstream ((30nt) indicated by lower case letters) of the recognition sites of the I-SceI is a recognition sequence of amplified DNA of pYACTAR-TRP1 vector. After amplification of the pYACTAR-TRP1 vector by PCR, the ends of the linear vector contained the homologous sequences of the DNA fragment to be cloned.

Forward primer for amplification of YAC shuttle vector pYACTAR-TRP1 (sequence 3: SEQ ID NO:3):

gtcagtggtccaggcagggctgactcagccaccctcggtgtccaagggcttgagacagaACCCTGTTATCCCTAATTaatatttcaagctataccaagcatacaatc

reverse primer for amplification of YAC shuttle vector pYACTAR-TRP1 (sequence 4: SEQ ID NO:4):

ggcctttcatgcaaatgtgctcctcttcccctgcccaagcgtgcccctccctgggcccgtTAGGGATAACAGGGTaatatttcaagctataccaagcatacaatc

eukaryotic genomic DNA exists in many repetitive simple sequences, so designing homologous ends in repetitive simple sequence regions should be avoided. Because of the differences in the homologous end sequences of these fragments, the DNA fragments can be adapted in a certain order to a single recombinant in the yeast cell. Therefore, by utilizing the homologous recombination mechanism of yeast, multiple DNA fragments having homologous ends can be subjected to homologous recombination and connected into a single recombinant, thereby realizing splicing of multiple large-fragment DNAs in a yeast cell.

Alternatively, linear recombinants can be ligated into circular YAC recombinants using yeast TAR cloning technology via a linear YAC vector. The circular YAC vector contains centromere, and recombinants can be distributed in parent cells and daughter cells during replication. In addition, the circular structure can prevent the linear exogenous DNA from being hydrolyzed by DNase in the yeast. The principle of Saccharomyces cerevisiae-dependent multi-fragment assembly by YAC vector expression is shown in FIG. 10.

6) Comprises screening the recombinants containing the target gene segments obtained in the step 5) by using the URA3 resistance screening system

In the method of the present application, in order to improve the screening efficiency of the positive recombinants, we can also screen the recombinants containing the target gene fragment obtained in step 5) by using the URA3 resistance screening system.

Since YAC vectors, such as the linear vector pTARYAC-TRP1, are readily circularized on their own in yeast cells, producing many negative clones, this leads to many false positive results. To avoid false positive results from self-cyclization of the vector, we designed a URA3 resistance screening system in which 5-FOA was used as a negative screening drug.

The self-circularized vector can express URA3 in yeast cells. The URA3 gene encodes an enzyme that renders yeast cells incapable of growing on media containing 5-FOA. It has been reported that the ADH1 promoter loses the transcriptional activity on downstream genes when the distance between the TATA box of the ADH1 promoter and the transcription initiation point exceeds 130bp (Furter-Graves and Hall, 1990). Whereas when the foreign gene is recombined between the ADH1 promoter and URA3, the yeast cell does not express URA3, and thus 5-FOA insensitivity can be achieved on a medium containing 5-FOA. This screening method can increase the screening frequency of positive recombinants, and the statistical results are shown in FIG. 9.

Although it has been reported in the literature that YAC vectors lacking an ARS (auto-mobily replication sequence) can be used for genomic DNA containing an ARS-like sequence (Noskov, Koriabine et al 2001), this method is selective for the gene of interest. The negative screening method using URA3 gene activity can be used to clone any eukaryotic gene and prokaryotic gene without ARS-like sequence.

While the following examples are provided to assist in understanding the invention, the true scope of the invention is set forth in the appended claims. It is to be understood that modifications can be made to the presented methods without departing from the spirit of the invention.

Example cloning of the human Lamda light chain locus (IGL) Using a BAC vector as template.

1. Selection of BAC vectors comprising the human Lambda light chain locus (IGL) and purification thereof.

The human IGL locus is located in the 1 st and 2nd sub-bands of the long arm 1 region of human chromosome 22. Depending on the human haplotype, this locus comprises 70 to 71 IGLV variable region genes, 7 to 11 IGLJ junction genes and 7 to 11 IGLC conserved region genes, followed by conserved region genes for each junction gene. According to the genomic version GRCh37/hg19, the start and stop position of the human IGL locus on chromosome is between 22,385,572 and 23,265,082 for a total of 879,511 bases. According to the display of a UCSC genome browser (https:// genome. UCSC. edu /), some BAC vectors are found to cover the above region. The information and start-stop positions of the BAC vector are shown in FIG. 2. These BACs were purchased from BACPAC Resources Center (BPRC) and ranged in length from 160kb to 200 kb. There is at least an overlapping region of several tens kb between each adjacent BAC vector. BAC vector DNA was purified by a BAC extraction kit such as NucleoBond Xtra BAC (Cata #: 740436.25) from Takara, and stored in a refrigerator at 4 ℃.

The advantage of isolating genomic DNA from BAC libraries is that genomic target fragments (100kb to 200kb) can be amplified in bacteria and the sequence information is well defined. In addition, when the CRISPR/Cas9 system is used for enzyme digestion, the non-specific recognition sites of gRNAs on the BAC vector are less than that of the whole genome, the cleavage specificity is guaranteed, and the off-target effect is reduced.

2. The target sequence of the gRNA was designed in the BAC overlap region.

The overlapping region of adjacent BAC vectors in BAC genome library is usually tens or tens of kb, in order to generate a series of DNA large fragments with certain homologous regions (60bp to 800bp), gRNA is designed in the overlapping region of adjacent BAC plasmids on the genome, and the target DNA is separated from the BAC plasmid by Cas9 enzyme cutting. Simple inverted repeat regions should be avoided in the selection of guide RNA recognition sites, the spacing of the gRNA target sequences in the overlap region not exceeding 1kb to favor this regionPrimers were designed internally for TAR cloning. The target sequences of grnas were designed using online software embedded in the UCSC genome browser, such as CRISPOR. The searched characteristic sequence is [ 5' -G19nt-NGG]. Software is also required for selection of gRNAs, e.g. Blatsearch ((R))http://genome.ucsc.edu/cgi-bin/hgBlat) To analyze potential off-target sequences in the genome, and in particular to avoid off-target sequences present in BAC vectors. The design results are shown in FIG. 3.

3. The BAC vector is subjected to in vitro enzyme digestion by using CRISPR/Cas 9.

The gRNA consists of CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA), and a part of the sequence of the crRNA can be paired with the tracrRNA to form a double-stranded RNA structure; a portion of the sequence complementary to the target region, thereby recognizing the target sequence. tracr RNA not only stabilizes crRNA, but also participates in binding and cleavage of Cas9 protein to DNA.

The crRNA and tracrRNA can be obtained not only by reverse transcription using a template DNA containing the T7 promoter, but also by direct chemical synthesis. For example, Alt-R CRISPR crRNA and Alt-R CRISPR-Cas9tracrRNA (IDTdna, Cata #1072533) are chemically synthesized from IDTdna. The sequence and structure are shown in figure 4.

The in vitro enzyme cutting method of CRISPR/Cas9 is as follows:

1) mix 10 μ l 10 μ M CRISPR-Cas9 crRNA and 10 μ l 10 μ M tracrRNA. Preheated at 95 ℃ for 5 minutes and then cooled to room temperature.

2) Preparing a Cas9 ribonucleoprotein complex (RNP) mixture: a mixture of crRNA and tracrRNA was mixed equimolar with Cas9 enzyme (from NEB, # M0386) and dissolved in PBS buffer to a final volume of 100. mu.l. The RNP mixture was reacted at room temperature for 10 minutes.

3) Preparing an in vitro enzyme digestion reaction: 1 μ l Cas9 RNP complex, 10xCas9 nucleic reaction buffer, 100nM BAC DNA, 7 μ l H₂And O. The reaction was carried out at 37 ℃ for 60 minutes. Finally, Cas9 was digested with 1. mu.L of protease K (20mg/mL) at 56 ℃ for 10 min and BAC DNA was isolated from Cas 9. And (5) carrying out electrophoresis and identifying the cutting efficiency.

FIG. 5 shows the digestion of BAC plasmid DNA (RP11-890G10) by gRNA/Cas 9. grnas consist of CrRNA and tracrRNA. The sequences of crrnas are:

IGL2A (rGrCrUrArCrUrGrGrrGrrGrrGrrGrrUrrUrrUrrUrrUrrUrrArGrArGrrUrrUrrUrrUrrGrrUrrGrrUrrGrrGrrUrrGrrGrrGrrGrrUrrGrrGrrGrrU); IGL2B (rUrrUrrCrUrrUrrArCrArArrArrGrUrrUrrU rAGrArGrArrArrCrArrUrrU rAGrArGrrUrrU GrrGrrUrrU). tracrRNA from IDTdna

(# 1072533). FIG. 5 shows the results of digestion of BAC (RP11-890G10) with different amounts of CRISPR/Cas9 complexes by 1kb plusDNA ladder (NEB Cat #: N0552S and under different Cas9 enzyme equivalents, respectively, from left to right.

Cloning target gene cut by CRISPR/Cas9 by TAR method

When the desired region on the BAC plasmid is cleaved by CRISPR/Cas9 in vitro, the isolated gene fragment of interest can be transformed into yeast cells together with a linear yeast bacterial shuttle plasmid (pTARYAC-TRP 1). In yeast cells, the gene fragment of interest and the linear pTARYAC-TRP1 were assembled into a circular YAC vector by homologous sequences at the respective ends.

Shuttle plasmid pTARYAC-TRP1 (shown in FIG. 6) was modified from pBACe3.6 (purchased from BACPAC Resources Center, Cata #: pBACe3.6). A portion of the DNA is from plasmid pbace3.6 and contains bacterial replication sequences and selectable markers, such as including the repE gene, the sopA gene, the sopB gene, the oriT1 replicon, and the selectable resistance gene Chloramphenicol (CMR); another part of the DNA is obtained by genetic chemical synthesis and comprises yeast-related replication sequences and selective resistance genes, such as an replication origin sequence ARS4, a centromere domain CEN5, resistance genes TRP1, URA3 and the like. The synthetic gene sequence is shown in SEQ ID NO 1, SEQ ID NO 1. Yeast strains AB1380 available from American model culture Bank (USA)

20843). The gene phenotype is MATa ade2-1 lys2-1 can1-100 trp1 ura3his 5.

Preparation of linearized pTARYAC-TRP1 vector.

An I-SceI site was introduced between the ADH1 promoter of pTARYAC-TRP1 and the transcription start site of URA3 gene. pTARYAC-TRP1 was linearized using the restriction enzyme I-SceI. Primers were designed to amplify the linearized pTARYAC-TRP1 vector, thereby cloning the partial human IGL locus sequence within the BAC vector (RP11-890G 10). The primer sequence is that the forward primer (sequence 3: SEQ ID NO:3) for amplifying YAC shuttle vector pYACTAR-TRP1 is gtcagtggtccaggcagggctgactcagccaccctcggtgtccaagggcttgagacagaACCCTGTTATCCCTAATTaatatttcaagctataccaagcatacaatc;

ggcctttcatgcaaatgtgctcctcttcccctgcccaagcgtgcccctccctgggcccgtTAGGGATAACAGGGTaatatttcaagctataccaagcatacaatc reverse primer (sequence 4: SEQ ID NO:4) for amplification of YAC shuttle vector pYACTAR-TRP 1.

The 3' end of the primer (shown in lower case letters), about 30bp, is identical to the end of the linearized vector. The 5' -end (shown in lower case letters) of the primer has 60 or more bases, and is identical to the terminal sequence of the gene fragment to be cloned in the BAC vector. Between the 5 'and 3' ends of the primers (shown in uppercase letters) is an endonuclease I-SceI recognition site.

Using highly efficient high fidelity amplification enzymes, e.g. TaKaRa LA

DNA Polymerase (TaKaRaRR002A) amplified the I-SceI linearized pTARYAC-TRP1 vector. After amplification, the ends of the PCR product will possess the homologous sequences for recombination of the fragment of interest.

The method used in conjunction with TAR and CRISPR/Cas9 technology for cloning target genes from BAC vectors is shown in FIG. 8. 100ng of CRISPR/Cas9 linearized gene of interest and 100ng of PCR linearized vector were co-transformed into competent yeast AB 1380. After culturing in liquid YPAD medium (Katara, Cata #: 630306) for 24hr, yeast cells were smeared on solid synthetic medium (Katara, Cata #: 630309) containing 5-Fluoroorotic acid hydrate, 5-FOA, Sigma F5013) and TRP-selective and cultured.

A yeast transformation method.

AB1380 yeast (ATCC Cata #201447) was inoculated and cultured overnight at 30 ℃ in 5ml of YPAD medium with shaking. The overnight culture cell density was counted to a final 5X 10⁶The cells were inoculated in 50ml YPAD medium at a cell density of one ml. Shaking and culturing at 30 deg.C and 200r/min to 2 × 10⁷Individual cells/ml.The cells were harvested by centrifugation at 3000g (2500r/min) for 5 minutes in a 50ml sterile centrifuge tube. Discard the culture medium, suspend the cells in 25ml of sterile water, centrifuge as above, and discard the water. The cells were suspended in 1ml of 100mmol/L lithium acetate and transferred to a sterile 1.5ml centrifuge tube. The cells were pelleted by high speed centrifugation for 5 seconds and lithium acetate was aspirated off with a micropipette. The cells were suspended to a final volume of 500. mu.l containing approximately 400. mu.l of 100mmol/L lithium acetate. The cell suspension was shaken, 50. mu.l of yeast cells were taken into a labeled centrifuge tube, the cells were pelleted by centrifugation, and lithium acetate was removed with a microsampler. The basic "transformation mix" (Sigma Cata # YEAST1-1KT) consisted of 240. mu.l PEG (50% w/v), 36. mu.l 1.0mol/L lithium acetate. After mixing 25. mu.l of linear vector DNA (2.0mg/ml) and 50. mu.l of the DNA linearized by Cas9 (0.1-10. mu.g), each reaction tube was shaken vigorously until the cells were completely mixed, which usually took about 1 minute. Preserving the heat for 30 minutes at 30 ℃, and then placing the mixture into a water bath at 42 ℃ for heat shock for 20-25 minutes. Centrifuging at 6000-8000 r/min for 15 s, and removing the converted mixed solution by using a micropipette. 01.0ml of YPD liquid medium (Sigma Cata # Y1375) was pipetted into each reaction tube, and the precipitated cells were gently suspended by a pipette and incubated overnight at 30 ℃. The next day, an aliquot of 200. mu.l of the transformation mixture was spread evenly on TRP-deleted synthetic medium containing 0.5mg/mL 5-FOA (TAKARA, 630309). After 48 hours, positive clones were picked and amplified, using kit (C)

Yeast DNA Kit, D3370-01) and PCR detection was used to identify positive clones. Two primers are designed in the opposite direction of the tail end of the linear vector for amplifying the empty vector, and the third primer is designed in the upstream of the tail end homologous recombination sequence of the target gene for amplifying the inserted positive clone. Primer design is shown in FIG. 7A. The primer sequences are as follows: primer 1 (sequence 5: SEQ ID NO:5) for amplification of empty vector: CATCAGCTCTGGAACAACGA, respectively; primer 2 (sequence 6: SEQ ID NO:6) for amplification of empty vector: GGCAACCAAACCCATACATC, respectively; primer 3 (SEQ ID NO:7) for amplification of the inserted positive clone: AAAGGCTCAACAGGTTGGTG are provided. The PCR identification result is shown in FIG. 7B. Lane 1 is the PCR product of the empty vector. Strip 23, 4 are PCR products of positive clones.

Since the linear vector pTARYAC-TRP1 readily cyclizes itself in yeast cells, many negative clones were produced, which resulted in many false positive results. To avoid false positive results from self-cyclization of the vector, we designed a URA3 resistance screening system in which 5-FOA was used as a negative screening drug. The self-circularized vector can express URA3 in yeast cells. The URA3 gene encodes an enzyme that renders yeast cells incapable of growing on media containing 5-FOA. When the distance between the TATA box of the ADH1 promoter and the transcription start point exceeds 130bp, the ADH1 promoter loses the transcription activity on downstream genes (Furter-Graves and Hall 1990). Whereas when the foreign gene is recombined between the ADH1 promoter and URA3, the yeast cell does not express URA3, and thus 5-FOA insensitivity can be achieved on a medium containing 5-FOA. The design and screening schematic is shown in figure 8. The statistical results of TAR recombination positive clones identified by URA3 negative screening are shown in FIG. 9.

As is evident from fig. 9, the negative screening method for URA3 gene activity can significantly increase the screening frequency of positive recombinants, screening out 77% of false positive results. The negative screening method using the activity of URA3 gene can be used to clone any eukaryotic and prokaryotic genes.

5. The foreign gene cloned in shuttle vector pTARYAC-TRP1 was purified from bacteria.

The recombinant pTARYAC-TRP1 vector can be amplified in bacteria. Because the homing endonuclease, such as an I-SceI site, is designed in the middle of the PCR primer, and the recognition sequence of the homing endonuclease in a genome is extremely low. Therefore, the homing endonuclease can completely enrich and separate target fragments with any length from the pTARYAC-TRP1 vector.

The method for amplifying a target gene from a bacterium is as follows:

using a commercial kit (

Yeast DNA Kit, Omega Bio-tek, D3370-01). Using the electrotransformation method, 100ng of DNA was added to 50. mu. competent bacterium, ElectroMAX^TMDH5α-E^TMCompetent cells (Invitrogen, Cata # 11319019). The electrotransformation conditions were 1350V and 5ms pulse. Immediately after the electrotransformation, 1ml of SOC medium (Invitrogen, Cata #15544034) was added and incubated at 37 ℃ for one hour. 100 μ l of the culture was inoculated into LB plates containing chloramphenicol (15ug/ml) and cultured overnight at 37 ℃. The next day, bacterial clones were picked and amplified in LB containing resistance fluid ((15ug/ml chloramphenicol). Using QIAGEN Large-construction Kit (Cat number/ID: 12462), approximately 100. mu.g of recombinant pTARYAC vector DNA could be purified from 1 liter of medium.

The size of the circular YAC vector extracted directly from yeast is not more than 500kbp due to the low copy number of YAC vector in yeast, the slower growth of yeast than bacteria, the difficulty of in vitro separation of YAC vector and linear yeast chromosome, the easy breakage of large fragment DNA and the like. Therefore, the characteristics of the shuttle vector pTARYAC can be used to transform the gene cloned in yeast into bacteria and amplify the target fragment in bacteria.

However, for large fragments of DNA, the bacterial transformation efficiency is reduced. For example, the efficiency of transformation of 240Kb plasmid in bacteria is 30 times lower than the efficiency of transformation of 80Kb plasmid DNA. Since the transformation efficiency of the electrotransformation method is at least 10 times higher than that of the conventional method, the electrotransformation method is selected to transform the DNA with large molecular weight. Electromax (Electromax)^TMDH5α-E^TMThe transformation efficiency of the component cells was>1 x 10¹⁰Clone/. mu.g. Since the recA1 mutation-containing bacteria can increase the stability of foreign DNA, it is considered that other highly competent bacteria containing recA1mutation are suitable for amplifying plasmids containing large fragments of DNA.

Because the sequence of the cloned genomic DNA is large, it is difficult to find a proper endonuclease to completely separate a large segment of the exogenous gene from the vector. In contrast, homing endonucleases, including I-CeuI, I-SceI, PI-PspI, PI-SceI, etc., are double-stranded DNA nucleases that recognize longer non-palindromic sequences (12-40 bp). Furthermore, the recognition sequence of homing endonucleases is very rare. For example, an 18bp recognition sequence is at every 7X10¹⁰bp corresponds to 20 mammalian genomesThe total length of the DNA is only once, so that the homing endonuclease designed in the vector can completely separate any exogenous gene segment from the vector.

6. A multi-fragment DNA was assembled in Saccharomyces cerevisiae (Saccharomyces cerevisiae).

Saccharomyces cerevisiae has an efficient homologous recombination mechanism, and homologous recombination can be accurately and effectively carried out only by homologous segments of more than 60bp between two DNA molecules (Noskov, Koriabine et al 2001).

Using gene editing techniques and yeast TAR cloning techniques, a series of large gene fragments can be generated that possess homologous fragment ends. These gene fragments may range in size from 30kb to 300kb, and possess homologous ends between each other, and may range in length from 90bp to 200 bp. Eukaryotic genomic DNA exists in many repetitive simple sequences, so designing homologous ends in these regions should be avoided. Because of the differences in the homologous end sequences of these fragments, they can be adapted in a certain order to a single recombinant in yeast cells. As shown in FIG. 10, three large fragment DNAs were assembled in yeast into a total of 340kbp recombinants comprising a portion of the human IGL locus. The DNA fragment 1 was cloned from BAC vector RP11-685C18, cut by I-SceI and about 38kbp (GRCh37/hg19Chr22: 22377208-. DNA fragment 2(155kb) was cloned from BAC vector RP11-890G10 at about 155kb (GRCh37/hg19Chr22: 22415353-22571119). DNA fragment 3 was cloned from RP11-373H24 and was approximately 147kb (GRCh37/hg19Chr22: 22570833-.

In addition, the recombinants assembled by multiple fragments and the linear YAC vector can be linked into a circular YAC recombinants by utilizing the homologous recombination mechanism of yeast. The circular YAC vector contains centromere, and recombinants can be distributed in parent cells and daughter cells during replication. In addition, the circular structure can prevent the linear exogenous DNA from being hydrolyzed by DNase in the yeast.

Competent yeast (ABI1380) was prepared by the above method. Competent yeast equivalent to 5ml of the original yeast culture was incubated with 50ng of the linearized vector pTARYAC-HIS5 (FIG. 11) and 500ng of the foreign gene fragment isolated from the above recombinant vector in a volume of 200. mu.l at 30 ℃ for 30 minutes, followed by heat shock in a 42 ℃ water bath for 20 to 25 minutes. To be provided withCentrifuging at 6000-8000 r/min for 15 s, and removing the converted mixed solution by using a micropipette. Suction 01.0ml YPD liquid medium (SigmaCata # Y1375) was added to each reaction tube, and the precipitated cells were gently suspended by a pipette and cultured overnight at 30 ℃. The next day, an aliquot of 200. mu.l of the transformation mixture was spread evenly over the HIS-deleted synthetic solid medium containing 0.5mg/mL 5-FOA (TAKARA, 630313). After 48 hours, positive clones were picked and amplified, grown in liquid medium SD/-His ((TAKARA, 630312.) with kit (see paper biosystems, supra.))

Yeast DNA Kit, D3370-01) and PCR detection was used to identify positive clones.

pTARYAC-HIS5 was obtained by engineering the vector pTARYAC-TRP1, in which the TRP1 gene was replaced in situ by the HIS5 gene. The HIS5 gene sequence is shown in SEQ ID NO. 2, SEQ ID NO.

The selection of recombinants requires two rounds of PCR selection. The first round of screening was used to identify recombinant positive clones. Primers (V-3F, V-5R) are designed at both ends of the recombination site of the vector and are used for amplifying the self-circular vector. In addition, a third primer (D3-3F) is designed at the edge of the recombined exogenous fragment for amplifying the recombinants. The primer sequences are shown in FIG. 12 (shown below).

As shown in FIG. 13A, electrophoresis bands 1-4 and 7-14 are negative controls, and the amplification product is a self-circularized plasmid. And the

electrophoretic bands

5,6 and 15 are recombinant PCR products. Because the vector is inserted with a large segment of exogenous gene, the PCR product of the empty vector is negative, and a third primer on the exogenous segment and another primer at the tail end of the vector can amplify another PCR band. The second round of screening was used to identify whether the recombinants carried all of the exogenous fragments. Primers were designed at the junctions of the gene fragments and inside the DNA fragments, respectively, to identify positive clones. The PCR primer sequence is shown in the attached FIG. 12, and FIG. 13B shows the PCR identification result of the polygene fragment recombinants. After assembly in yeast cells, the recombinants reach 340kb in size.

The efficiency of recombinant transformation is not only inversely proportional to the number of fragments, but also proportional to the number of molecular copies of the foreign gene (Gibson, Benders et al 2008). Since the larger the DNA fragment, the lower the number of mols. In order to increase the transformation efficiency of large molecular weight DNA, it is necessary to increase the template amount of the objective fragment. However, conventional DNA gel purification methods tend to result in the loss and fragmentation of large fragments of DNA, and thus the amount of template used for transformation is small. For 100ug of 150kb DNA, large fragment DNA was easily fragmented and recovery rate was very low by gel recovery. The recovery efficiency after each purification was less than 30 ng. FIG. 14 shows that the efficiency of assembly of three large-fragment DNAs in yeast can be increased compared with the efficiency of assembly of a plurality of large-fragment DNAs in yeast by increasing the amount of DNA template.

Using yeast bacterial shuttle plasmids, we can amplify and purify large amounts of foreign genes from bacteria for transformation. In addition, to avoid the loss of the gel after digestion, when the multi-fragment assembly was carried out in yeast, we designed yeast plasmids (pTARYAC-HIS5) with different selectable markers for recombination, as shown in FIG. 11. After the enzyme digestion, the linear vector fragment (pTARYAC-TRP1) is transferred into the yeast cell, but is easily degraded by the DNA enzyme of the yeast cell, or after the self-cyclization, the linear vector fragment is killed by the 5-FOA drug due to the activity of the URA3 gene.

The sequence referred to in this application is as follows:

1. sequence 1: SEQ ID NO 1

Synthetic sequence of vector pYACTAR-TRP 1:

TTACGCAGTTACGCGCTTCCTCGCTCACTGACTTTAATTAACTGCGGCGAGGGCGGCGGTATCAGCGCGGCCGCCGCTGCGCTCGGTCGTTCGGGTTCTATTTAGTTTTGCTGGCCGCATCTTCTCAAATATGCTTCCCAGCCTGCTTTTCTGTAACGTTCACCCTCTACCTTAGCATCCCTTCCCTTTGCAAATAGTCCTCTTCCAACAATAATAATGTCAGATCCTGTAGAGACCACATCATCCACGGTTCTATACTGTTGACCCAATGCGTCTCCCTTGTCATCTAAACCCACACCGGGTGTCATAATCAACCAATCGTAACCTTCATCTCTTCCACCCATGTCTCTTTGAGCAATAAAGCCGATAACAAAATCTTTGTCGCTCTTCGCAATGTCAACAGTACCCTTAGTATATTCTCCAGTAGATAGGGAGCCCTTGCATGACAATTCTGCTAACATCAAAAGGCCTCTAGGTTCCTTTGTTACTTCTTCTGCCGCCTGCTTCAAACCGCTAACAATACCTGGGCCCACCACACCGTGTGCATTCGTAATGTCTGCCCATTCTGCTATTCTGTATACACCCGCAGAGTACTGCAATTTGACTGTATTACCAATGTCAGCAAATTTTCTGTCTTCGAAGAGTAAAAAATTGTACTTGGCGGATAATGCCTTTAGCGGCTTAACTGTGCCCTCCATGGAAAAATCAGTCAAGATATCCACATGTGTTTTTAGTAAACAAATTTTGGGACCTAATGCTTCAACTAACTCCAGTAATTCCTTGGTGGTACGAACATCCAATGAAGCACACAAGTTTGTTTGCTTTTCGTGCATGATATTAAATAGCTTGGCAGCAACAGGACTAGGATGAGTAGCAGCACGTTCCTTATATGTAGCTTTCGACATGGTGGCAGTTGATTGTATGCTTGGTATAGCTTGAAATATTaccctgttatccctaATTAATAATTGCAGGTCTATTTATACTTGATAGCAAGACAGCAAACTTTTTTTTATTTCAAATTCAAGTAACTGGAAGGAAGGCCGTATACCGTTGCTCATTAGAGAGTAGTGTGCGTGAATGAAGGAAGGAAAAAGTTTCGTGTGCTTCGAGATACCCCTCATCAGCTCTGGAACAACGACATCTGTTGGTGCTGTCTTTGTCGTTAATTTTTTCCTTTAGTGTCTTCCATCATTTTTTTGTCATTGCGGATATGGTGAGACAACAACGGGGGAGAGAGAAAAGAAAAAAAAAGAAAAGAAGTTGCATGCGCCTATTATTACTTCAATAGATGGCAAATGGAAAAAGGGTAGTGAAACTTCGATATGATGATGGCTATCAAGTCTAGGGCTACAGTATTAGTTCGTTATGTACCACCATCAATGAGGCAGTGTAATTGGTGTAGTCTTGTTTAGCCCATTATGTCTTGTCTGGTATCTGTTCTATTGTATATCTCCCCTCCGCCACCTACATGTTAGGGAGACCAACGAAGGTATTATAGGAATCCCGATGTATGGGTTTGGTTGCCAGAAAAGAGGAAGTCCATATTGTACACCCGGAAACAACAAAAGGATATATAACGGTCCTAAGGTAGCGAATGCAGTTATGACGCCAGATGGCAGTAGTGGAAGATATTCTTTATTGAAAAATAGCTTGTCACCTTACGTACAATCTTGATCCGGAGCTTTTCTTTTTTTGCCGATTAAGAATTAATTCGGTCGAAAAAAGAAAAGGAGAGGGCCAAGAGGGAGGGCATTGGTGACTATTGAGCACGTGAGTATACGTGATTAAGCACACAAAGGCAGCTTGGAGTATGTCTGTTATTAATTTCACAGGTAGTTCTGGTCCATTGGTGAAAGTTTGCGGCTTGCAGAGCACAGAGGCCGCAGAATGTGCTCTAGATTCCGATGCTGACTTGCTGGGTATTATATGTGTGCCCAATAGAAAGAGAACAATTGACCCGGTTATTGCAAGGAAAATTTCAAGTCTTGTAAAAGCATATAAAAATAGTTCAGGCACTCCGAAATACTTGGTTGGCGTGTTTCGTAATCAACTTAAGGAGGATGTTTTGGCTCTGGTCAATGATTACGGCATTGATATCGTCCAACTGCATGGAGATGAGTCGTGGCAAGAATACCAAGAGTTCCTCGGTTTGCCAGTTATTAAAAGACTCGTATTTCCAAAAGACTGCAACATACTACTCAGTGCAGCTTCACAGAAACCTCATTCGTTTATTCCCTTGTTTGATTCAGAAGCAGGTGGGACAGGTGAACTTTTGGATTGGAACTCGATTTCTGACTGGGTTGGAAGGCAAGAGAGCCCCGAAAGCTTACATTTTATGTTAGCTGGTGGACTGACGCCAGAAAATGTTGGTGATGCGCTTAGATTAAATGGCGTTATTGGTGTTGATGTAAGCGGAGGTGTGGAGACAAATGGTGTAAAAGACTCTAACAAAATAGCAAATTTCGTCAAAAATGCTAAGAAATAGGTTATTACTGAGTAGTATTTATTTAAGTATTGTTTGTGCACTTGCCGATCTATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGAAAGTACACATATATTACGATGCTGTTCTATTAAATGCTTCCTATATTATATATATAGTAATGTCGTGATCTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGGATCGCTTGCCTGTAACTTACACGCGCCTCGTATCTTTTAATGATGGAATAATTTGGGAATTTACTCTGTGTTTATTTATTTTTATGTTTTGTATTTGGATTTTAGAAAGTAAATAAAGAAGGTAGAAGAGTTACGGAATGAAGAAAAAAAAATAAACAAAGGTTTAAAAAATTTCAACAAAAAGCGTACTTTACATATATATTTATTAGACAAGAAAAGCAGATTAAATAGATATACATTCGATTAACGATAAGTAAAATGTAAAATCACAGGATTTTCGTGTGTGGTCTTCTACACAGACAAGGTGAAACAATTCGGCATTAATACCTGAGAGCAGGAAGAGCAAGATAAAAGGTAGTATTTGTTGGCGATCCCCCTAGAGTCTTTTACATCTTCGGAAAACAAAAACTATTTTTTCTT

2. sequence 2: SEQ ID NO 2

HIS5 Gene sequence

ATGGGTAGGAGGGCTTTTGTAGAAAGAAATACGAACGAAACGAAAATCAGCGTTGCCATCGCTTTGGACAAAGCTCCCTTACCTGAAGAGTCGAATTTTATTGATGAACTTATAACTTCCAAGCATGCAAACCAAAAGGGAGAACAAGTAATCCAAGTAGACACGGGAATTGGATTCTTGGATCACATGTATCATGCACTGGCTAAACATGCAGGCTGGAGCTTACGACTTTACTCAAGAGGTGATTTAATCATCGATGATCATCACACTGCAGAAGATACTGCTATTGCACTTGGTATTGCATTCAAGCAGGCTATGGGTAACTTTGCCGGCGTTAAAAGATTTGGACATGCTTATTGTCCACTTGACGAAGCTCTTTCTAGAAGCGTAGTTGACTTGTCGGGACGGCCCTATGCTGTTATCGATTTGGGATTAAAGCGTGAAAAGGTTGGGGAATTGTCCTGTGAAATGATCCCTCACTTACTATATTCCTTTTCGGTAGCAGCTGGAATTACTTTGCATGTTACCTGCTTATATGGTAGTAATGACCATCATCGTGCTGAAAGCGCTTTTAAATCTCTGGCTGTTGCCATGCGCGCGGCTACTAGTCTTACTGGAAGTTCTGAAGTCCCAAGCACGAAGGGAGTGTTGTAA

3. And (3) sequence: SEQ ID NO 3

Forward primer for amplification of YAC shuttle vector pYACTAR-TRP1

4. And (3) sequence 4: SEQ ID NO 4

Reverse primer for amplification of YAC shuttle vector pYACTAR-TRP1

5. And (5) sequence: SEQ ID NO 5

Primer 1 for amplifying empty vector

CATCAGCTCTGGAACAACGA

6. And (3) sequence 6: SEQ ID NO 6

Primer 2 for amplifying empty vector

GGCAACCAAACCCATACATC

7. And (3) sequence 7: SEQ ID NO 7

Primer 3 for amplification of inserted positive clones

AAAGGCTCAACAGGTTGGTG

8. And (2) sequence 8: SEQ ID NO 8

Primers for recombinants screening V-3F:

TAGCAGCACGTTCCTTATATGT

9. sequence 9: SEQ ID NO 9

Primer D1-5R for recombinants screening:

CTCACTGCCACACCCTCATAGA

10. sequence 10: SEQ ID NO 10

D1F:

GGTGGTCAGATTGCTTGGTT

11. Sequence 11: 11 SEQ ID NO

D1R:AAAGGGCATCCAGCATAGTG

12. Sequence 12: SEQ ID NO 12

D1-3F:

GTCTGTGGGGCTCTTAGCTG

13. Sequence 13: 13 of SEQ ID NO

D2-5R:

AAGCAGAACAGGGAAGGACA

14. Sequence 14: 14 of SEQ ID NO

D2F:

CCACCCTCCCAAACTCCTAT

15. Sequence 15: SEQ ID NO 15

D2R:

TCTGTGAGGCCTGTTCAGTG

16. Sequence 16: 16 SEQ ID NO

D2-3F:

CCCATTGCGTTGCTTTAGAT

17. Sequence 17: SEQ ID NO 17

D3-5R:CTTCAGGATGGAGCTTCTGG

18. Sequence 18: 18 of SEQ ID NO

D3F:

CTGGTCCATGCCTCTGTTTT

19. Sequence 19: SEQ ID NO 19

D3R:TGTGTCTTCCAGGGGAAAAG

20. Sequence 20: 20 of SEQ ID NO

D3-3F:

CATTGCACACCCTTTCCTTT

21. Sequence 21: 21 SEQ ID NO

V-5R:

AACTATCGTTCTGTCGTTTGA

22. Sequence 22: SEQ ID NO 22

V-3F:

TAGCAGCACGTTCCTTATATGT

23. Sequence 23: SEQ ID NO 23

V-5R:

AGTTTGCTGTCTTGCTATCAAG

Sequence listing

<110> cyanine

<120> method for cloning large DNA fragment

<130>C18P2643

<160>23

<170>PatentIn version 3.5

<210>1

<211>3336

<212>DNA

<213> Artificial sequence

<220>

<223> synthetic sequence of vector pYACTAR-TRP1

<400>1

ttacgcagtt acgcgcttcc tcgctcactg actttaatta actgcggcga gggcggcggt 60

atcagcgcgg ccgccgctgc gctcggtcgt tcgggttcta tttagttttg ctggccgcat 120

cttctcaaat atgcttccca gcctgctttt ctgtaacgtt caccctctac cttagcatcc 180

cttccctttg caaatagtcc tcttccaaca ataataatgt cagatcctgt agagaccaca 240

tcatccacgg ttctatactg ttgacccaat gcgtctccct tgtcatctaa acccacaccg 300

ggtgtcataa tcaaccaatc gtaaccttca tctcttccac ccatgtctct ttgagcaata 360

aagccgataa caaaatcttt gtcgctcttc gcaatgtcaa cagtaccctt agtatattct 420

ccagtagata gggagccctt gcatgacaat tctgctaaca tcaaaaggcc tctaggttcc 480

tttgttactt cttctgccgc ctgcttcaaa ccgctaacaa tacctgggcc caccacaccg 540

tgtgcattcg taatgtctgc ccattctgct attctgtata cacccgcaga gtactgcaat 600

ttgactgtat taccaatgtc agcaaatttt ctgtcttcga agagtaaaaa attgtacttg 660

gcggataatg cctttagcgg cttaactgtg ccctccatgg aaaaatcagt caagatatcc 720

acatgtgttt ttagtaaaca aattttggga cctaatgctt caactaactc cagtaattcc 780

ttggtggtac gaacatccaa tgaagcacac aagtttgttt gcttttcgtg catgatatta 840

aatagcttgg cagcaacagg actaggatga gtagcagcac gttccttata tgtagctttc 900

gacatggtgg cagttgattg tatgcttggt atagcttgaa atattaccct gttatcccta 960

attaataatt gcaggtctat ttatacttga tagcaagaca gcaaactttt ttttatttca 1020

aattcaagta actggaagga aggccgtata ccgttgctca ttagagagta gtgtgcgtga 1080

atgaaggaag gaaaaagttt cgtgtgcttc gagatacccc tcatcagctc tggaacaacg 1140

acatctgttg gtgctgtctt tgtcgttaat tttttccttt agtgtcttcc atcatttttt 1200

tgtcattgcg gatatggtga gacaacaacg ggggagagag aaaagaaaaa aaaagaaaag 1260

aagttgcatg cgcctattat tacttcaata gatggcaaat ggaaaaaggg tagtgaaact 1320

tcgatatgat gatggctatc aagtctaggg ctacagtatt agttcgttat gtaccaccat 1380

caatgaggca gtgtaattgg tgtagtcttg tttagcccat tatgtcttgt ctggtatctg 1440

ttctattgta tatctcccct ccgccaccta catgttaggg agaccaacga aggtattata 1500

ggaatcccga tgtatgggtt tggttgccag aaaagaggaa gtccatattg tacacccgga 1560

aacaacaaaa ggatatataa cggtcctaag gtagcgaatg cagttatgac gccagatggc 1620

agtagtggaa gatattcttt attgaaaaat agcttgtcac cttacgtaca atcttgatcc 1680

ggagcttttc tttttttgcc gattaagaat taattcggtc gaaaaaagaa aaggagaggg 1740

ccaagaggga gggcattggt gactattgag cacgtgagta tacgtgatta agcacacaaa 1800

ggcagcttgg agtatgtctg ttattaattt cacaggtagt tctggtccat tggtgaaagt 1860

ttgcggcttg cagagcacag aggccgcaga atgtgctcta gattccgatg ctgacttgct 1920

gggtattata tgtgtgccca atagaaagag aacaattgac ccggttattg caaggaaaat 1980

ttcaagtctt gtaaaagcat ataaaaatag ttcaggcact ccgaaatact tggttggcgt 2040

gtttcgtaat caacttaagg aggatgtttt ggctctggtc aatgattacg gcattgatat 2100

cgtccaactg catggagatg agtcgtggca agaataccaa gagttcctcg gtttgccagt 2160

tattaaaaga ctcgtatttc caaaagactg caacatacta ctcagtgcag cttcacagaa 2220

acctcattcg tttattccct tgtttgattc agaagcaggt gggacaggtg aacttttgga 2280

ttggaactcg atttctgact gggttggaag gcaagagagc cccgaaagct tacattttat 2340

gttagctggt ggactgacgc cagaaaatgt tggtgatgcg cttagattaa atggcgttat 2400

tggtgttgat gtaagcggag gtgtggagac aaatggtgta aaagactcta acaaaatagc 2460

aaatttcgtc aaaaatgcta agaaataggt tattactgag tagtatttat ttaagtattg 2520

tttgtgcact tgccgatcta tgcggtgtga aataccgcac agatgcgtaa ggagaaaata 2580

ccgcatcagg aaagtacaca tatattacga tgctgttcta ttaaatgctt cctatattat 2640

atatatagta atgtcgtgat ctatggtgca ctctcagtac aatctgctct gatgccgcat 2700

agttaagcca gccccgacac ccgccaacac ccgctgacgc gccctgacgg gcttgtctgc 2760

tcccggcatc cgcttacaga caagctgtga ccgtctccgg gagctgcatg tgtcagaggt 2820

tttcaccgtc atcaccgaaa cgcgcgagac gaaagggcct cgtgatacgc ctatttttat 2880

aggttaatgt catgataata atggtttctt agacggatcg cttgcctgta acttacacgc 2940

gcctcgtatc ttttaatgat ggaataattt gggaatttac tctgtgttta tttattttta 3000

tgttttgtat ttggatttta gaaagtaaat aaagaaggta gaagagttac ggaatgaaga 3060

aaaaaaaata aacaaaggtt taaaaaattt caacaaaaag cgtactttac atatatattt 3120

attagacaag aaaagcagat taaatagata tacattcgat taacgataag taaaatgtaa 3180

aatcacagga ttttcgtgtg tggtcttcta cacagacaag gtgaaacaat tcggcattaa 3240

tacctgagag caggaagagc aagataaaag gtagtatttg ttggcgatcc ccctagagtc 3300

ttttacatct tcggaaaaca aaaactattt tttctt 3336

<210>2

<211>654

<212>DNA

<213> Artificial sequence

<220>

<223> HIS5 Gene sequence

<400>2

atgggtagga gggcttttgt agaaagaaat acgaacgaaa cgaaaatcag cgttgccatc 60

gctttggaca aagctccctt acctgaagag tcgaatttta ttgatgaact tataacttcc 120

aagcatgcaa accaaaaggg agaacaagta atccaagtag acacgggaat tggattcttg 180

gatcacatgt atcatgcact ggctaaacat gcaggctgga gcttacgact ttactcaaga 240

ggtgatttaa tcatcgatga tcatcacact gcagaagata ctgctattgc acttggtatt 300

gcattcaagc aggctatggg taactttgcc ggcgttaaaa gatttggaca tgcttattgt 360

ccacttgacg aagctctttc tagaagcgta gttgacttgt cgggacggcc ctatgctgtt 420

atcgatttgg gattaaagcg tgaaaaggtt ggggaattgt cctgtgaaat gatccctcac 480

ttactatatt ccttttcggt agcagctgga attactttgc atgttacctg cttatatggt 540

agtaatgacc atcatcgtgc tgaaagcgct tttaaatctc tggctgttgc catgcgcgcg 600

gctactagtc ttactggaag ttctgaagtc ccaagcacga agggagtgtt gtaa 654

<210>3

<211>107

<212>DNA

<213> Artificial sequence

<220>

<223> Forward primer for amplification of YAC shuttle vector pYACTAR-TRP1

<400>3

gtcagtggtc caggcagggc tgactcagcc accctcggtg tccaagggct tgagacagaa 60

ccctgttatc cctaattaat atttcaagct ataccaagca tacaatc 107

<210>4

<211>105

<212>DNA

<213> Artificial sequence

<220>

<223> reverse primer for amplification of YAC shuttle vector pYACTAR-TRP1

<400>4

ggcctttcat gcaaatgtgc tcctcttccc ctgcccaagc gtgcccctcc ctgggcccgt 60

tagggataac agggtaatat ttcaagctat accaagcata caatc 105

<210>5

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> primer 1 for amplifying empty vector

<400>5

catcagctct ggaacaacga 20

<210>6

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> primer 2 for amplifying empty vector

<400>6

ggcaaccaaa cccatacatc 20

<210>7

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> primer 3 for amplifying inserted positive clone

<400>7

aaaggctcaa caggttggtg 20

<210>8

<211>22

<212>DNA

<213> Artificial sequence

<220>

<223> primer V-3F for screening recombinants

<400>8

tagcagcacg ttccttatat gt 22

<210>9

<211>22

<212>DNA

<213> Artificial sequence

<220>

<223> primer D1-5R for screening recombinants

<400>9

ctcactgcca caccctcata ga 22

<210>10

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223>D1F

<400>10

ggtggtcaga ttgcttggtt 20

<210>11

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223>D1R

<400>11

aaagggcatc cagcatagtg 20

<210>12

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223>D1-3F

<400>12

gtctgtgggg ctcttagctg 20

<210>13

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223>D2-5R

<400>13

aagcagaaca gggaaggaca 20

<210>14

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223>D2F

<400>14

ccaccctccc aaactcctat 20

<210>15

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223>D2R

<400>15

tctgtgaggc ctgttcagtg 20

<210>16

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223>D2-3F

<400>16

cccattgcgt tgctttagat 20

<210>17

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223>D3-5R

<400>17

cttcaggatg gagcttctgg 20

<210>18

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223>D3F

<400>18

ctggtccatg cctctgtttt 20

<210>19

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223>D3R

<400>19

tgtgtcttcc aggggaaaag 20

<210>20

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223>D3-3F

<400>20

cattgcacac cctttccttt 20

<210>21

<211>21

<212>DNA

<213> Artificial sequence

<220>

<223>V-5R

<400>21

aactatcgtt ctgtcgtttg a 21

<210>22

<211>22

<212>DNA

<213> Artificial sequence

<220>

<223>V-3F

<400>22

tagcagcacg ttccttatat gt 22

<210>23

<211>22

<212>DNA

<213> Artificial sequence

<220>

<223>V-5R

<400>23

agtttgctgt cttgctatca ag 22

Claims

1. A method of cloning a gene fragment of interest comprising the steps of:

3) allowing the additional vector to amplify in the microorganism;

2. The method according to claim 1, wherein said step 1) comprises cleaving said chromosome or vector to obtain said gene fragment of interest using genome editing techniques.

3. The method according to claim 1 or 2, wherein said step 2) comprises cloning said gene fragment of interest into said further vector, preferably a shuttle vector, using homologous recombination splicing techniques.

4. The method according to any of the preceding claims, wherein the DNA fragment obtained in step 4) is a DNA fragment of about 100kb to 300kb and has homologous ends, preferably 60-800bp, more preferably 90-200 bp.

5. The method according to any one of the preceding claims, wherein the linearized vector is a linearized vector, preferably a linearized yeast shuttle vector, possessing the homologous end sequences of the DNA fragment of interest.

6. The method according to any one of claims 2-5, wherein the genome editing techniques are selected from one or more of the following: zinc Finger Nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) technologies, including CRISPR/Cas9 and CRISPR-Cpf1, preferably CRISPR/Cas 9.

7. Method according to any one of claims 3 to 6, wherein the homologous recombination splicing technique is selected from one or more of the following: sequence-dependent in vitro assembly techniques (e.g., Gibson assembly, SLIC, LIC, etc.), yeast transformation-coupled recombination (TAR) techniques and bacterial Red/ET homologous recombination techniques, preferably yeast transformation-coupled recombination (TAR) techniques.

8. A method according to any one of the preceding claims, wherein the additional carrier is selected from one or more of the following: BAC (bacterial specific chromosome), YAC (Yeast specific chromosomes), and PAC (P1 specific chromosomes).

9. The method according to any of the preceding claims, wherein the yeast is Saccharomyces cerevisiae.

10. Method according to any one of the preceding claims, wherein the microorganism used for amplification is a bacterium, preferably E.coli, such as ElectroMAX^TMDH5α-E^TMA component cell.

11. The method according to claim 5, wherein the linearization vector is a YAC or TAR cloning vector.

12. The method according to claim 11, wherein the linearization vector is a YAC cloning vector, preferably a pTARYAC-TRP1 cloning vector.

13. The method according to any of the preceding claims, wherein the gene fragment of interest, including prokaryotic and eukaryotic gene fragments, preferably eukaryotic gene fragments, is preferably more than 100kb, preferably more than 300kb, more preferably more than 400kb in length.

14. Method according to any of the preceding claims, wherein the restriction endonuclease is an homing endonuclease, such as I-CeuI, I-SceI, PI-PspI, PI-SceI.

15. The method according to any of the preceding claims, further comprising screening the recombinants comprising the gene fragment of interest obtained in step 5) using the URA3 resistance screening system, said screening comprising:

16. The method according to any of the preceding claims, wherein between said steps 4) and 5) further comprising the steps of: repeating steps 1) -4) to prepare a series of DNA fragments having homologous ends, preferably homologous ends of 60-800bp, more preferably 90-200 bp.

17. Method according to any of the preceding claims, wherein the cell is a cell with DNA homologous recombination activity, preferably a yeast cell, such as saccharomyces cerevisiae (saccharomyces cerevisiae).

18. The method according to any of the preceding claims, further comprising performing step 5) followed one or more further steps 4) to obtain a plurality of DNA fragments with homologous ends, preferably more than 100kb, which are further subjected to step 5) to obtain recombinants of more than 300kb arranged in a certain order.

19. A method for screening YAC vector recombined with exogenous gene by using URA3 resistance screening system, which comprises the following steps:

2) cloning the recombinant vector obtained in the step 1) into a yeast cell;