CN116064666A - Method for integrating target gene fragment - Google Patents

Abstract

The present application provides a method of integrating a gene fragment of interest comprising the steps of: 1) Obtaining a gene fragment of interest, said gene fragment of interest having a length exceeding 100kb; 2) Cloning the target gene fragment into a circular YAC vector; 3) Transforming a vector containing said gene fragment of interest into a yeast cell; 4) Introducing the vector comprising the gene fragment of interest into a recipient cell, wherein the recipient cell is a eukaryotic cell; 5) Inducing the activity of a recombinase of CreERT2 by adding Tamoxifen, wherein the Cre recombinase mediates the site-directed integration of the target gene fragment into the genome of the receptor cell, and simultaneously the expression cassette 1 and the expression cassette 2 form a resistance expression cassette for expressing the complete resistance gene neomycin; 6) Screening the receptor cells in which the target gene fragment is integrated at a fixed point in the genome.

Description

Method for integrating target gene fragment

The present application is a divisional application of Chinese patent application with the application number of 201910951144.8 and the name of 'method for site-directed integration of large-fragment exogenous DNA'.

Technical Field

The application relates to the technical field of genetic engineering. In particular, the present application relates to a method for integrating a target gene fragment, which is suitable for efficiently site-directed integration of a target gene fragment, particularly a large fragment of 300kb or more, of exogenous DNA into the genome of a cell.

Background

The large-scale DNA modification of the genome of cells, especially the site-directed integration of very long gene fragments in the genome, especially large exogenous gene fragments with a length of more than 300kb, has been a difficult problem in biotechnology.

Mammalian artificial chromosomes (mammalian artificial chromosome, MAC) are cloning vectors isolated from mammalian cells and constructed from replication initiation regions, telomeres, and centromeres. The vector may be used to load exogenous DNA fragments greater than 1000 kb. The large fragment exogenous gene carried by MAC can be introduced into eukaryotic cells using minicell-mediated chromosome transfer (microcell mediatedchromosome transfer, MMCT) (Martella, polarod et al 2016). Since MAC exists episomally, the foreign gene cannot be stably integrated into the chromosome of the cell, and stable inheritance is obtained.

Yeast artificial chromosomes (Yeast artificial chromosomes, YACs) are vectors in which the largest DNA fragment can be cloned, into which a 100-2000kb exogenous DNA fragment can be inserted. YAC vectors assembled with large fragments of exogenous DNA can be inserted into recipient cell chromosomes using yeast protoplast fusion (yeast spheroplast cell fusion) technology (Mendez, green et al 1997). However, this approach suffers from a number of problems: the copy number of the exogenous gene is uncontrollable, the integration position of the genome is random, the YAC vector regulatory sequence causes the receptor cells to be polluted by the gene, and large fragment genes are easy to break in the processes of cell fusion and integration, and the like. Meanwhile, when the method is used for establishing the transgenic mice, a large amount of genotype identification is required for ES cell clones edited by genes, and the phenotypes of different transgenic mouse lines are also required to be identified.

Bacterial artificial chromosome (Bacterial artificial chromosome, BAC) is a bacterial chromosome cloning vector constructed based on F plasmid (F-plasmid), and is commonly used for cloning DNA fragments of 150kb to 200kb in size. Because BAC vectors have the advantages of large capacity, genetic stability, easy operation and the like, the BAC vectors are often used for genetic modification. The exogenous gene of 100kb to 200kb can be site-directed integrated into a specific position of the genome of the cell by using conventional homologous recombination techniques or recombinase systems ((Valenzuela, murphy et al 2003; wallace, marques-Kranc et al 2007). The strategy is undoubtedly long-lived and technically difficult if larger-scale modifications, such as site-directed insertion or in situ replacement, of the genome are desired, and complex multiple genetic modifications of the cell are required (Macdonald, karow et al 2014; murphy, macdonald et al 2014).

Thus, there is an urgent need in the art for methods for site-directed integration of large fragments of exogenous DNA, particularly large fragments of 300kb or more, in the genome.

Summary of The Invention

The modification of large-scale DNA of cell genome, especially the site-directed integration of large-fragment exogenous DNA into genome, has been a current biotechnology problem. The main technical difficulties of fixed point integration include the following aspects: 1) It is difficult to clone large fragments of exogenous DNA into a gene vector; 2) It is difficult to completely introduce a vector containing a large fragment of exogenous DNA into eukaryotic cells; 3) It is difficult to efficiently integrate large fragments of exogenous DNA site-directed into the genome of recipient cells; 4) It is difficult to efficiently screen and detect site-directed integration recombinant cell clones.

The patent solves the technical problems through a series of technical innovations, and provides a method for efficiently and stably site-directed integration of large-fragment exogenous DNA in genome, especially large-fragment exogenous DNA with a length of more than 300kb for the first time.

In particular, in one aspect the present application utilizes the modified recombinase system Cre/Loxp, i.e., the Loxp71/66 mutant, to stably, irreversibly site-integrate exogenous DNA into the genome of a recipient cell.

Cre-Lox recombination is a site-specific recombinase technique for deletion, insertion, transposition and inversion operations at specific sites of cellular DNA. The Loxp locus consists of a 34bp special locus sequence, wherein the middle 8bpDNA base is an asymmetric sequence, the direction of the Loxp sequence is determined, two sections of 13bp reverse symmetric sequences are arranged on two sides of the asymmetric sequence, and the combination efficiency with Cre is determined.

Although the conventional Cre-Lox recombination method can catalyze site-directed integration of exogenous genes. However, in the initial experiments, wild-type Loxp was unable to stably site-directed integrate macromolecular DNA into the cell chromosome. This is probably because, by analysis, cre-catalyzed Loxp sequence-dependent recombination reactions are reversible, i.e. reverse recombination or deletion between Loxp sites is possible, so that the wild-type Loxp site is not effective in mediating stable site-directed integration of macromolecular DNA into the cell chromosome.

When a mutation occurs at one end of the symmetric sequence, such as Loxp71 (mutation exists in the 5 '-terminal symmetric sequence) and Loxp66 (mutation exists in the 3' -terminal symmetric sequence), cre can still catalyze recombination reaction between the mutations Loxp (such as Loxp71 and Loxp 66). After the recombination reaction of Loxp71 and Loxp66, wild-type Loxp and double mutant Loxp (Loxp 71/66) were generated. Because the symmetrical sequences at both ends of Loxp71/66 are mutated, the binding capacity of the Loxp71/66 with Cre is greatly reduced, so that the reverse recombination reaction between wild type Loxp and Loxp71/66 is avoided, and the exogenous DNA is stably and irreversibly integrated into cell chromosomes, thereby enhancing the stability of the knocked-in gene. The present application has found for the first time that such mutant Loxp, but not wild-type Loxp, facilitates site-directed integration of large fragment DNA into the cell genome. The principle is as shown in figure 2 of the drawings of the specification.

The application finds that Loxp double mutation Loxp66/71 is the most preferable scheme for mediating stable site-directed integration of macromolecular DNA into cell chromosomes. The Loxp66/71 has the best effect and highest transformation efficiency compared with the wild-type Loxp, or Loxp containing 1 mutation, such as Loxp/Loxp66 or Loxp/Loxp71, or Loxp double mutation containing other mutation positions, can stably and fixedly integrate macromolecular DNA into cell chromosomes most effectively and most stably, and is most suitable for the fixed-point integration and cloning of large-fragment DNA.

In addition, in order to efficiently screen recombinants site-specifically integrated into chromosomes, the present application also designed expression cassettes for the functionally complementary and truncated resistance gene neomycin (NeoR) after the Loxp sites of DNA and chromosomes, respectively. Only recombinants inserted with exogenous genes at fixed positions can express the resistance of G418 drugs, and randomly integrated DNA fragments cannot generate drug resistance. The schematic diagram is shown in figure 3 of the drawings in the specification.

Meanwhile, the present application uses the FLP/FRT system to excise unnecessary vector sequences and the G418 resistant expression cassette. The gene modification element and the recombination principle are shown in figure 3 in the attached drawings.

In addition, YAC is used as a vector for loading exogenous genes because YAC vectors can accommodate 2000kb exogenous DNA fragments at most. Traditional YAC vectors are linear structures, are unstable in cells, and are prone to breakage and homologous recombination. In this regard, the present application utilizes YAC vectors to load large fragment DNA into circular YAC vectors, thereby increasing the efficiency of site-directed insertion of intact genes into cell chromosomes.

The difficulty of targeting large fragment DNA into recipient cells is that the transformation efficiency is low, the exogenous DNA is easy to break, and the purification efficiency of large fragment DNA from yeast cells is low, so the application selects the yeast spheroplast fusion technology (yeastprotoplast fusion). The large fragment exogenous gene in yeast is introduced into recipient cells. The method has no limitation on the size of the exogenous gene body, and can avoid the exogenous gene from breaking in the purification process (Brown, chan et al 2017).

The application overcomes various problems existing in the process of integrating the chromosomal DNA at fixed points of the macromolecular DNA through a series of technical designs, such as poor transfection efficiency of the macromolecular DNA, easy breakage of exogenous genes, poor fixed point integration efficiency and the like. Thus, the method of the present application can efficiently and stably integrate exogenous DNA, especially large-fragment exogenous DNA, more particularly large-fragment exogenous DNA of 300kb or more, into genome at one time and site.

Specifically, 1. A method for integrating a gene fragment of interest, comprising the steps of:

1) Obtaining a gene fragment of interest, said gene fragment of interest having a length exceeding 100kb;

2) Cloning a target gene fragment into a circular YAC vector, inserting a truncated neomycin (G418) resistance expression cassette 1 into the obtained vector comprising the target gene fragment, the expression cassette 1 comprising a mutant Loxp1, i.e. Loxp66 sequence, a part of HPRT intron and a part of the resistance gene a, i.e. the 3' end part of the neomycin resistance gene Neo gene in the 5' to 3' direction;

3) Transforming a vector containing said gene fragment of interest into a yeast cell;

4) Introducing the vector comprising the gene fragment of interest within the yeast into a recipient cell, wherein the recipient cell is a eukaryotic cell, wherein a truncated neomycin (G418) resistance expression cassette 2 has been site-directed into the genome of the recipient cell, said expression cassette 2 comprising in the 5' to 3' direction a partial HPRT intron, a mutant Loxp 2, i.e. Loxp71 sequence, a resistance gene b portion, i.e. the 5' end portion of the Neo gene, a fusion protein CreERT2 comprising a ligand binding domain mutant (ERT 2) of an estrogen receptor (estrogen receptor, ER) and a Cre recombinase, and an IRES-PuroR structure;

5) Inducing the activity of a recombinase of CreERT2 by adding Tamoxifen, wherein the Cre recombinase mediates the site-directed integration of the target gene fragment into the genome of the receptor cell, and simultaneously the expression cassette 1 and the expression cassette 2 form a resistance expression cassette for expressing the complete resistance gene neomycin;

6) Screening said recipient cells in which said gene fragment of interest has been site-directed integrated in the genome,

wherein the mutant Loxp 1 in the resistance expression cassette 1 truncated neomycin (G418) resistance expression cassette 1 in said step 2) and/or the mutant Loxp 2 in the resistance expression cassette 2 truncated neomycin (G418) resistance expression cassette 2 in said step 4) is used for site-directed introduction of said expression cassettes into the genome of said recipient cell,

wherein the 3 'end portion of the neomycin resistance gene Neo of the resistance gene part a contained in said resistance expression cassette 1 in step 2) and the 5' end portion of the Neo gene of the resistance gene part b in said resistance expression cassette 2 in step 4) are functionally complementary,

wherein the HPRT intron contained in the truncated neomycin (G418) resistant expression cassette 1 of the resistant expression cassette 1 in the step 2), the 3 '-end portion of the Neo gene of the a part of the resistant gene, and the truncated neomycin (G418) resistant expression cassette 2 of the resistant expression cassette 2 in the step 4), the 5' -end portion of the Neo gene of the b part of the resistant gene, and the neomycin (G418) resistant expression cassette of Neo expressing the complete resistant gene formed in the step 5) are used for screening cell recombinants after site-directed integration of the gene fragment of interest.

2. The method according to item 1, wherein the 5 '-end portion of the Neo gene and the 3' -end portion of the Neo gene are truncated at position 92,

and said step 6) selecting said recipient cells having said gene fragment of interest site-directed in their genome by adding a reagent antibiotic G418 specific for said resistance gene.

3. The method according to item 2, wherein the 92 th amino acid of neomycin is encoded by the terminal nucleotide of the 5 'end portion of the Neo gene and the starting nucleotide of the 3' end portion of the Neo gene together.

4. According to the method of item 2, amino acid 92 of neomycin is encoded by the end 2 nucleotides of the 5 'end portion of the Neo gene together with the first nucleotide at the beginning of the 3' end portion of the Neo gene.

5. The method according to any one of the preceding claims, wherein in the obtained vector comprising the gene fragment of interest in step 1), an FRT sequence is present upstream of the gene fragment of interest, while in the expression cassette in step 4) an FRT sequence is present downstream of the IRES-PuroR structure,

and further comprising step 7) after said step 6): transferring a plasmid comprising FLP into said recipient cell to remove said expression cassette.

6. The method according to any one of the preceding claims, wherein the gene segments of interest in step 1) comprise prokaryotic and eukaryotic gene segments.

7. The method according to item 1, wherein the circular vector is obtained by a homologous recombination splicing technique, or a combination of a homologous recombination splicing technique and a genome editing technique.

8. The method according to item 7, wherein the circular vector is obtained by a yeast transformation coupled recombination (TAR) technique or a combination of a yeast transformation coupled recombination (TAR) technique and a genome editing technique.

9. The method according to item 7 or 8, wherein the homologous recombination splicing technique is selected from one or more of the following: sequence dependent in vitro assembly techniques, yeast transformation coupled recombination (TAR) techniques and bacterial Red/ET homologous recombination techniques.

10. The method according to any of the preceding claims, wherein the gene fragment of interest in step 1) is obtained from a chromosome or from a further vector.

11. The method according to any one of the preceding claims, wherein the gene fragment of interest in step 1) is obtained by cleavage of the chromosome or vector using genome editing techniques.

12. The method according to any one of the preceding claims, wherein in said step 4) said expression cassette and its downstream large fragment DNA are stably introduced site-directed into the genome of said recipient cell by means of genome editing techniques.

13. The method according to any one of items 7, 8, 11 and 12, wherein the genome editing technique is selected from one or more of the following: zinc finger nuclease technology (zinc finger nucleases, ZFNs), transcription activator-like effector nuclease technology (transcription activator-like effector nucleases, TALENs) and clustered regularly interspaced short palindromic repeat (Clustered Regularly Interspaced Short Palindromic Repeat, CRISPR) technology, including CRISPR/Cas9 and CRISPR-Cpf1.

14. The method according to any one of the preceding claims, wherein the yeast is saccharomyces cerevisiae.

15. The method according to any one of the preceding claims, wherein in said step 4) the vector comprising the gene fragment of interest within the microorganism is introduced into a recipient cell using yeast spheroplast fusion (yeast protoplast fusion) technique.

16. The method according to any one of the preceding claims, wherein the recipient cells in step 4) are animal embryonic stem cells.

17. The method according to any of the preceding claims, wherein the gene fragment of interest is more than 300kb in length.

18. The method according to any of the preceding claims, wherein the gene fragment of interest is more than 400kb in length.

In particular, the invention relates to the following aspects:

1. a method of integrating a gene fragment of interest comprising the steps of:

1) Obtaining a target gene fragment;

2) Cloning the gene fragment of interest into a vector, inserting a resistance expression cassette 1, preferably a truncated neomycin (G418) resistance expression cassette 1, into the obtained vector comprising the gene fragment of interest, said expression cassette 1 comprising in the 5' to 3' direction a mutant Loxp 1, preferably a Loxp66 sequence, a part of the HPRT intron and a part of the resistance gene a, preferably the 3' part of the neomycin resistance gene Neo gene;

3) Transforming a vector containing said gene fragment of interest into a microbial cell, preferably a yeast, in particular a Saccharomyces cerevisiae cell;

4) Introducing the vector comprising the gene fragment of interest in the microorganism into a recipient cell, wherein a resistance expression cassette 2, preferably a truncated neomycin (G418) resistance expression cassette 2, has been introduced at a fixed point into the genome of the recipient cell, said expression cassette 2 comprising in the 5' to 3' direction a part of the HPRT intron, a mutant Loxp 2, preferably a Loxp71 sequence, a part of the resistance gene b, preferably a 5' part of the Neo gene, a fusion protein CreERT2 comprising a ligand binding region mutant (ERT 2) of the estrogen receptor (estrogen receptor, ER) and a Cre recombinase, and an IRES-PuroR structure

Wherein the mutations in the mutant Loxp 1 and the mutant Loxp 2 are located in the 3 'symmetrical sequence and the 5' symmetrical sequence of the wild-type Loxp site, or the 5 'symmetrical sequence and the 3' symmetrical sequence of the wild-type Loxp site, respectively, and the mutant Loxp 1 and the mutant Loxp 2 can both bind to Cre, and a Loxp sequence having mutations at both ends, such as Loxp66/71, is formed after the step 4);

preferably, the single-ended mutant Loxp sequences, mutant Loxp 1 and mutant Loxp 2, e.g., loxp71 and Loxp66, do not affect the binding efficiency to Cre, but upon recombination form two Loxp sequences, one of which is the wild-type Loxp sequence and the other of which contains a mutant Loxp sequence at both ends, e.g., loxp66/71, which reduces the binding efficiency to Cre compared to the wild-type Loxp sequence; similar to the Loxp66 sequence, it is known in the art that it is possible to recombine with Loxp71 to form double-ended mutant Loxp structures including loxJTZ17, loxKR1, loxKR2, loxKR3, loxKR4, etc. These similar Loxp structures mediate recombination in different cells and are slightly more efficient at integrating into the chromosome to form stable recombinants. Furthermore, the efficiency of integration into the chromosome to form stable recombinants is affected by a number of factors, such as the cell line being integrated. The Loxp66/71 structure of the present application is most efficient in forming stable recombinants in the chromosome of cells relative to these similar Loxp mutants, and thus the cloning efficiency of large DNA fragments is highest;

5) Inducing the recombinase activity of CreERT2, preferably by adding Tamoxifen, which mediates the site-directed integration of the gene fragment of interest into the genome of the recipient cell, while the expression cassette 1 and expression cassette 2 form a resistance expression cassette expressing the complete resistance gene, preferably neomycin;

6) Screening the receptor cells in which the target gene fragment is integrated at a fixed point in the genome.

2. The method according to item 1, wherein the part of resistance gene a comprised in the resistance expression cassette 1 in said step 2), preferably the 3 'part of the neomycin resistance gene Neo, and the part of resistance gene b in the resistance expression cassette 2 in said step 4), preferably the 5' part of the Neo gene, are functionally complementary, neither of the resistance expression cassettes 1 or 2 alone is capable of conferring resistance to a cell, e.g. the truncated neomycin (G418) resistance expression cassette 1 or 2 is incapable of conferring neomycin resistance to a cell, preferably only the part of resistance gene b and the part a comprised therein, e.g. the 5 'part and the 3' part of the Neo gene are recombined in a certain order before the neomycin resistance protein is expressed.

Preferably, the 5 'end portion of the Neo gene and the 3' end portion of the Neo are truncated at position 92, more preferably, amino acid 92 of neomycin is encoded by the last nucleotide of the 5 'end portion of the Neo gene and the start nucleotide of the 3' end portion of the Neo gene together, more preferably, amino acid 92 of neomycin is encoded by the last 2 nucleotides of the 5 'end portion of the Neo gene and the first nucleotide of the 3' end portion of the Neo gene together. That is, the 5 '-end portion of the Neo gene expresses amino acids from position 1 to 91 of neomycin, the 3' -end portion of the Neo gene expresses amino acids from position 93 to 267 of neomycin, while the last 2 nucleotides of the 5 '-end portion and the first nucleotide at the beginning of the 3' -end portion of the Neo gene together encode amino acid 92 of neomycin,

And said step 6) selecting said recipient cells in the genome into which said gene fragment of interest has been site-directed integrated by adding a reagent specific for said resistance gene, preferably the antibiotic G418.

3. The method according to item 1 or 2, wherein in the obtained vector comprising the gene fragment of interest in said step 1), an FRT sequence is present upstream of said gene fragment of interest, while in the expression cassette in said step 4), an FRT sequence is present downstream of said IRES-Puror structure,

and further comprising step 7) after said step 6): transferring a plasmid comprising FLP into said recipient cell to remove said expression cassette.

4. The method according to one of the preceding claims, wherein the gene fragment of interest in step 1) comprises prokaryotic and eukaryotic gene fragments, preferably eukaryotic gene fragments, which are preferably more than 100kb in length, preferably more than 300kb, more preferably more than 400kb.

5. The method according to one of the preceding claims, wherein the vector comprising the gene fragment of interest obtained in step 2) is a circular BAC vector or genomic DNA.

6. The method according to one of the preceding claims, wherein said vector in step 2) is a linearized vector, preferably a linearized vector having homologous end sequences of the cloned DNA fragment of interest, more preferably a linearized yeast shuttle vector.

7. The method according to item 6, wherein the linearization vector is a YAC or TAR cloning vector.

8. The method according to item 7, wherein the linearization vector is a YAC cloning vector, preferably a pTARYAC cloning vector.

9. The method according to one of items 1 to 5, wherein the vector comprising the gene fragment of interest in the step 2) is BAC (bacterial artificial chromosome) or PAC (P1 artificial chromosomes).

10. The method according to item 5, wherein the circular vector is obtained by a homologous recombination splicing technique (preferably a yeast transformation coupled recombination (TAR) technique) or a combination of a homologous recombination splicing technique (preferably a yeast transformation coupled recombination (TAR) technique) and a genome editing technique.

11. The method according to item 10, wherein the homologous recombination splicing technique is selected from one or more of the following: sequence dependent in vitro assembly techniques (e.g., gibson assembling, SLIC, LIC, etc.), yeast transformation coupled recombination (TAR) techniques and bacterial Red/ET homologous recombination techniques, preferably yeast transformation coupled recombination (TAR) techniques.

12. The method according to one of the preceding claims, wherein the gene fragment of interest in step 1) is obtained from a chromosome or from a further vector, preferably a BAC vector.

13. The method according to one of the preceding items, wherein the gene fragment of interest in step 1) is obtained by cleaving the chromosome or vector using a genome editing technique.

14. The method according to one of the preceding items, wherein in said step 4) said expression cassette and its downstream large fragment DNA are site-directed and stably introduced into the genome of said recipient cell by means of genome editing techniques.

15. The method of clauses 10, 13 or 14, wherein the genome editing technique is selected from one or more of the following: zinc finger nuclease technology (zinc finger nucleases, ZFNs), transcription activator-like effector nuclease technology (transcription activator-like effector nucleases, TALENs) and clustered regularly interspaced short palindromic repeat (Clustered Regularly Interspaced Short Palindromic Repeat, CRISPR) technology, including CRISPR/Cas9 and CRISPR-Cpf1, preferably CRISPR/Cas9.

16. The method according to one of the preceding items, wherein the yeast is Saccharomyces cerevisiae.

17. The method according to one of the preceding items, wherein in said step 4) the vector comprising the gene fragment of interest within the microorganism is introduced into a recipient cell using yeast spheroplast fusion (yeast protoplast fusion) technique.

18. The method according to one of the preceding items, wherein the resistance expression cassette 1 in step 2), preferably the mutant Loxp 1 in the truncated neomycin (G418) resistance expression cassette 1 and/or the resistance expression cassette 2 in step 4), preferably the mutant Loxp 2 in the truncated neomycin (G418) resistance expression cassette 2, is used for site-directed introduction of the expression cassette into the genome of the recipient cell.

19. The method according to one of the preceding items, wherein the resistance expression cassette 1 in step 2), preferably the truncated neomycin (G418) resistance expression cassette 1, the HPRT intron comprised in the resistance gene a part, preferably the Neo gene 3 'part, and the resistance expression cassette 2 in step 4), preferably the truncated neomycin (G418) resistance expression cassette 2, the resistance gene b part, preferably the Neo gene 5' part, and the resistance expression cassette formed in step 5) expressing the complete resistance gene, preferably the neomycin (G418) resistance expression cassette of neomycin Neo, are used for screening cell recombinants after site-directed integration of the gene fragment of interest.

20. The method according to one of the preceding claims, wherein the recipient cell in step 4) is a eukaryotic cell, preferably an animal embryonic stem cell.

In addition, in addition to using the resistance of the complementarily truncated G418 gene to screen recombinants with a foreign gene inserted at a site-specific position, other resistance screening mechanisms known in the art may be used in the present application. These commonly used resistance screening mechanisms or resistance genes may be, for example, puromycin (Puromycin), hygromycin (Hygromycin), HPRT and the like.

Brief Description of Drawings

FIG. 1 shows the general strategy for site-directed integration of large fragments of exogenous genes into the genome of a cell.

FIG. 2 Loxp71/66 mutant promotes targeted integration of large circular DNA.

FIG. 3 is a schematic diagram of site-directed integration of exogenous circular DNA into a chromosome of a cell.

FIG. 4 shows a TAR-YAC-HygR- ΔNeoGFP-Loxp66 FRT plasmid map.

FIG. 5 PCR identification of vector TAR-IGL-Loxp 66.

In the context of the illustration of figure 5,

m represents a 100bp DNA ladder,

lane 1 is the PCR product 1 of the junction of the vector TAR-Loxp66 end and IGL1,

lane 2 is IGL1 internal PCR product 2,

lane 3 is the junction PCR product 3 of IGL1 and IGL2,

lane 4 is IGL2 internal PCR product 4,

lane 5 is the PCR product 5 at the junction of IGL2 and IGL3,

lane 6 is IGL3 internal PCR product 6, and

lane 7 is PCR product 7 at the end junction of IGL3 and vector TAR-Loxp 66.

FIG. 6 primer sequences for identification of TAR-IGL-Loxp 66.

Figure 7 crispr/Cas9 technology mediated gene knock-in.

FIG. 8 identification of genetically modified recipient cells.

FIG. 9 identifies site-directed insertion of large fragment IGL.

FIG. 10A schematic diagram of the nucleotide sequence and the amino acid sequence of the 5 '-end portion of Neo gene in the truncated neomycin (G418) resistance expression cassette 2 and the 3' -end portion of Neo gene contained in the truncated neomycin (G418) resistance expression cassette 1. In the figure, the 5 'end part of the Neo gene and the 3' end part of the Neo gene are truncated at 92 positions, the 5 'end part of the Neo gene expresses amino acids from 1 st to 91 st of neomycin, the 3' end part of the Neo gene expresses amino acids from 93 rd to 267 th of neomycin, and the last 2 nucleotides of the 5 'end part and the first nucleotide at the beginning of the 3' end part of the Neo gene jointly encode amino acid R at 92 th of neomycin. In FIG. 10, the upper unshaded part shows nucleotide sequences extremely corresponding to the amino acid sequences from positions 1 to 91 of neomycin expressed in the 5 'end portion of the Neo gene, and the lower gray shaded part shows nucleotide sequences extremely corresponding to the amino acid sequences from positions 93 to 267 of neomycin expressed in the 3' end portion of the Neo gene. Meanwhile, the amino acid R at position 92 is shown in black and is encoded by the last 2 nucleotides AG of the 5 'end portion and the first nucleotide G of the 3' end portion of the Neo gene.

Detailed Description

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

All patents, published patent applications, other publications, and sequences from GenBank and other databases mentioned herein are incorporated by reference in their entirety for the relevant art. The practice of the provided embodiments will employ, unless otherwise indicated, conventional techniques of molecular biology and the like, which are within the skill of the art. These techniques are well explained in the literature. See, for example, molecular Cloning: a Laboratory Mannual, (j. Sambrook et al Cold Spring Harbor Laboratory, cold Spring Harbor, n.y., 1989); currentProtocols in Molecular Biology (F. Ausubel et al, 1987 and recent); essentialMolecular Biology (Brown ed., IRL Press 1991); gene Expression Technology (Goeddel, eds., academic Press 1991); methods for Cloning and Analysis ofEukaryotic Genes (Bothwell et al, bartlett public 1990); gene Transfer andExpression (Kriegler, stockton Press 1990); recombinant DNA Methodology (R.Wu et al, academic Press 1989); and (2) PCR: a PracticalApproach (M.McPherson et al IRL Press atOxford University Press 1991); cell Culture for Biochemists (r.adams edit Elsevier Science Publishers 1990); gene Transfer Vectors for Mamalian Cells (Miller & M.Calos. Edit, 1987); mammalian Cell Biotechnology (m.butler edit, 1991); animal Cell Culture (Polard et al, humana Press 1990); culture of Animal Cells,2nd Ed. (Freshney et al, alan R.Lists 1987).

As used herein, "a" or "an" means "one", "at least one" or "one or more".

As used herein, a "restriction endonuclease site" refers to a target nucleic acid sequence that is recognized and cleaved by a restriction enzyme. Restriction enzymes are well known in the art.

As used herein, the term "gene fragment of interest" refers to a target DNA fragment to be cloned, either a genomic fragment or an artificially synthesized foreign fragment, or a complete gene.

The term "genome" includes naturally occurring and synthetic genomes, and includes genetically engineered genomes, such as genomes previously not found in the laboratory and nature, that include modified genomes and hybrid genomes comprising nucleic acids and/or parts of genomes from more than one species. The term "genome" includes organelle genomes (e.g., mitochondrial and chloroplast genomes), genomes of self-replicating organisms (cell genomes), including prokaryotic and eukaryotic organisms, fungi, yeast, bacteria (e.g., mycoplasma), archaebacteria, vertebrates, mammals, and other organisms, and viral genomes, as well as other genomes that proliferate by virtue of the host. Genomes also include those of organisms and synthetic organisms that do not fall within any of the known Linnean (Linnean) classifications. An exemplary genome may be a microbial genome, such as the genome of single-cell organisms including bacteria and yeast.

As described above, the prior art lacks a method for site-directed integration of genomic DNA for large fragments of 300kb or more in the genome.

In order to solve the problem, the invention establishes a method for efficiently and stably site-directed integration of genes with more than 300kb, particularly eukaryotic genes, into a genome. Compared with the prior art, the method not only can stably integrate large exogenous DNA fragments, such as more than 300kb, into the genome, but also improves the efficiency of site-directed integration.

As described above, the modification of the genome of a cell with large-scale DNA, in particular, the site-directed integration of large fragments of exogenous DNA into the genome has been a current biotechnological challenge. The main technical difficulties of fixed point integration include the following aspects: 1. how to clone large fragments of exogenous DNA into a gene vector; 2. how to completely introduce a vector containing exogenous DNA into eukaryotic cells; 3. how to efficiently integrate large fragments of exogenous DNA into the genome of recipient cells at a fixed point; 4. how to efficiently screen and detect site-directed integration recombinant cell clones.

The present application was designed to efficiently and stably integrate exogenous DNA into the genome at a fixed point for the 4 technical difficulties described above. The method comprises the following steps:

For 1): how to clone large fragments of exogenous DNA into a gene vector

Since vectors, especially gene vectors, such as YAC vectors, have very strong homologous recombination properties, large fragments of exogenous DNA can be recombined in cells. Meanwhile, YAC is selected as a vector for loading exogenous genes in the present application in consideration that YAC vectors can accommodate 2000kb exogenous DNA fragments at most. Traditional YAC vectors are linear structures, are unstable in cells, and are prone to breakage and random recombination. In this regard, the present application utilizes YAC vectors to load large fragment DNA into circular YAC vectors, thereby increasing the efficiency of site-directed insertion of intact genes into cell chromosomes.

In one embodiment, circular YAC vectors containing the gene fragment of interest are obtained using homologous recombination splicing techniques, or a combination of homologous recombination splicing techniques and genome editing techniques. In a preferred embodiment, linear YAC vectors are circularized into circular closed YAC vectors using homologous recombination splicing techniques, such as yeast Transformation-coupled recombination (TAR) techniques. In another preferred embodiment, gene fragments in a plurality of BAC vectors are edited into a plurality of linear DNA segments with homologous ends using a combination of homologous recombination splicing techniques and genome editing techniques, such as the Crispr/Cas9 method and TAR technique, and are spliced into circular YAC vectors in their cells using the homologous recombination properties of saccharomyces cerevisiae. Specific methods can be found in chinese patent application No. 201811238618.6.

Sequence-dependent recombination splicing techniques include sequence-dependent in vitro assembly techniques (e.g., gibson assembling, SLIC, LIC, etc.), yeast transformation-coupled recombination (TAR) techniques and bacterial Red/ET homologous recombination techniques, cloned into a number of gene vectors, such as BAC (bacterial artificial chromosome), YAC (Yeast artificialchromosomes) and PAC (P1 artificial chromosomes).

Yeast as host cells include Saccharomyces cerevisiae and other yeast species such as Schizosaccharomyces pombe (Saccharomyces pombe), which can be used to clone very long genomic DNA. Yeast hosts are particularly suitable for manipulating donor genomic material due to their unique set of genetic manipulation tools. The natural ability of yeast cells and decades of research have produced a rich set of tools for manipulating DNA in yeast. These advantages are well known in the art. For example, yeasts, with their abundant genetic systems, can assemble and reassemble nucleotide sequences by homologous recombination, an ability not possessed by many readily available organisms. Yeast, such as Saccharomyces cerevisiae, has a highly efficient homologous recombination mechanism, and homologous recombination can be performed accurately and efficiently by only having a homologous region of 60bp or more between two DNA molecules (Noskov, koriadine et al 2001). Yeast cells can be used to clone larger DNA that cannot be cloned into other organisms, e.g., whole cells, organelles, and viral genomes. Thus, one embodiment of the described method exploits the great ability of yeast to inherit, advancing synthetic biology and synthetic genomics by using yeast as host cells for manipulating the genome and synthetic genome of difficult and other organisms.

In addition, yeasts, particularly Saccharomyces cerevisiae (Saccharomyces cerevisiae), are of great advantage as host cells for cloning DNA fragments. For example, yeast has a strong recombinase activity, and DNA fragments of up to 25 overlapping fragments can be ligated to vector DNA at a time (Gibson, benders et al 2008), thus having the ability to ingest multiple DNA fragments. Meanwhile, the homologous recombination capability of the yeast can effectively and correctly assemble the multi-segment DNA into a single recombinant.

In addition, yeast artificial chromosomes (Yeast artificial chromosome, YAC) contain centromeres that support replication of at least 2Mb of eukaryotic unstable DNA (Kouprina, leem et al 2003). Large prokaryotic DNA fragments may be cloned in yeast using the common genetic code. Toxic gene expression is generally not a barrier to cloning of donor nucleic acids in yeast. For example, studies of bacterial and archaeal genomes indicate that proteins expressed from cloned genomes present little risk of damage to yeast hosts because eukaryotes use different protein expression machinery than these bacteria. The transcription signal in yeast is different from transcription and translation in bacteria. Indeed, most prokaryotic genes are likely not expressed in yeast. There are no restriction barriers in yeast. If there is a disorder, it may be a replication disorder, not a gene expression disorder. Genotoxicity is minimized because gene expression regulation in eukaryotes such as yeast is different than in prokaryotes. Furthermore, mycoplasma uses the codon UGA as tryptophan instead of as a translation termination signal. Thus, most mycoplasma genes, if expressed, will produce truncated proteins in yeast. This largely avoids the possibility of toxic gene products.

Therefore, the present application uses YAC vector to load large fragment DNA into circular YAC vector in yeast cell based on yeast specific high efficiency DNA homologous recombination mechanism, thereby improving efficiency of complete gene site-directed insertion into cell chromosome.

For 2): how to completely introduce a vector containing a large fragment of exogenous gene into eukaryotic cells

The difficulty of targeting large fragment DNA into recipient cells is that the transformation efficiency is low, the foreign DNA is easily broken, the efficiency of purifying large fragment DNA from yeast cells in vitro is low, and the size of the DNA is limited by the common DNA transfection method.

In this regard, as an improvement, the present application adopts a method of yeast spheroplast fusion (yeast protoplast fusion) to introduce a large fragment of exogenous gene in yeast into recipient cells. Under the mediation of PEG, yeast spheroplasts can be fused with cells, and large fragment DNA is introduced into recipient cells. The method has no limitation on the size of the exogenous gene body, and can avoid the exogenous gene from breaking during the purification process (Brown, chan et al 2017).

The transformation of large fragments of exogenous genes and site-directed integration into the cell genome is described in FIG. 1 of the drawings.

How efficiently to site-integrate large fragments of exogenous genomic DNA into the genome of a recipient cell for 3);

The present application utilizes the modified recombinase system Cre/Loxp, i.e., loxp71/66 mutant, to stably and irreversibly site-integrate exogenous DNA into the genome of a recipient cell.

Circular vectors can be site-directed inserted into cell chromosomes using conventional recombinase systems such as Cre/Loxp, FLP/FRT and phiC31-att, etc. (Ohtsuka, miura et al 2012). However, there has been no report that the above-mentioned recombinase can integrate an exogenous circular gene of more than 300kb into the genome of a cell at one time at a fixed point. Because Cre/Loxp, the FLP/FRT system mediates reversible enzymatic reactions, when macromolecular circular DNA recombines into a chromosome, the recombinase-mediated DNA cleavage reaction is much greater than the site-directed integration reaction. This results in a lower efficiency of the stable recombinants obtained the larger the exogenous molecule. Although the phiC31-att recombination system may mediate irreversible recombination reactions between DNA fragments, phiC31 activity is lower than Cre recombinase activity and is therefore not a preferred scheme for mediating large molecule DNA recombination. Among the above-described recombinase systems, the Cre/Loxp system is most efficient in catalysis and most commonly used, and thus the present application contemplates the use of the Cre/Loxp system to mediate recombination of large fragments of DNA.

Cre-Lox recombination is a site-specific recombinase technique for deletion, insertion, transposition and inversion operations at specific sites of cellular DNA. The Loxp locus consists of a special sequence of 34bp, wherein the middle 8bpDNA base is an asymmetric sequence, the direction of the Loxp sequence is determined, two sections of 13bp reverse symmetric sequences are arranged on two sides of the asymmetric sequence, and the combination efficiency with Cre is determined.

Although conventional Cre-Lox recombination can catalyze site-directed integration of exogenous genes. However, it was found in the initial experiments that the wild-type Loxp sequence did not stably site-directed integrate macromolecular DNA into the cell chromosome. This is probably because Cre-catalyzed Loxp sequence-dependent recombination reactions are reversible, i.e. reverse recombination or deletion may occur between Loxp sites, so recombination between wild-type Loxp sites is not effective in mediating stable site-directed integration of macromolecular DNA into the cell chromosome.

Although the introduction of heterologous Loxp sequences (e.g., loxp and Loxp 2272) at sites flanking the DNA fragment may mediate recombination between homologous Loxp sites (Loxp and Loxp, loxp2722 and Loxp 2722) and thus mediate targeted insertion of the foreign DNA into the chromosome. But the efficiency of Cre-lox recombination decreases greatly with increasing insertion length. This approach may also be used for site-directed insertion of certain macromolecular DNA, but is not preferred.

In this regard, in one embodiment, the present application utilizes tamoxifen to induce the expression of Cre recombinase by recipient cells, such as ES cells. When a mutation occurs at one end of the symmetrical sequence in the Loxp sequence, i.e., mutant Loxp 1, preferably Loxp71 (mutation exists in the 5 '-terminal symmetrical sequence) and mutant Loxp 2, preferably Loxp66 (mutation exists in the 3' -terminal symmetrical sequence).

Meanwhile, mutations in the mutant Loxp 1 and the mutant Loxp 2 are respectively positioned in a 3 'symmetrical sequence and a 5' symmetrical sequence of a wild type Loxp site, or a 5 'symmetrical sequence and a 3' symmetrical sequence of a wild type Loxp site, wherein the mutant Loxp 1 and the mutant Loxp 2 can be combined with Cre, and a Loxp sequence with mutations at both ends is formed after the step 4), such as Loxp66/71;

preferably, the single-ended mutant Loxp sequences, mutant Loxp 1 and mutant Loxp 2, e.g., loxp71 and Loxp66, do not affect the binding efficiency to Cre, but upon recombination form two Loxp sequences, one of which is the wild-type Loxp sequence and the other of which contains a mutant Loxp sequence at both ends, e.g., loxp66/71, which reduces the binding efficiency to Cre compared to the wild-type Loxp sequence;

similar to the Loxp66 sequence, it is known in the art that it is possible to recombine with Loxp71 to form double-ended mutant Loxp structures including loxJTZ17, loxKR1, loxKR2, loxKR3, loxKR4, etc. These similar Loxp structures mediate recombination in different cells with slightly different efficiencies in forming stable recombinants that integrate stably into the chromosome. Furthermore, the efficiency of integration into the chromosome to form stable recombinants is affected by a number of factors, such as the cell line being integrated. The Loxp66/71 structure of the present application is most efficient in forming stable recombinants in the chromosome of cells, and thus the cloning efficiency of large fragments of DNA is highest, relative to these similar Loxp mutants.

In a preferred embodiment, the single-ended mutant Loxp sequence, mutant Loxp 1 and mutant Loxp 2, preferably Loxp71 and Loxp66, do not affect the binding efficiency to Cre, whereas two Loxp sequences are formed after recombination, one of which is a wild-type Loxp sequence and the other of which contains a mutant Loxp sequence at both ends, preferably Loxp66/71, which reduces the binding to Cre compared to the wild-type Loxp sequence.

The recombined circular DNA can be inserted into the chromosome at a fixed point and wild-type Loxp sites and Loxp 1/2 mutants, such as Loxp71/66 mutants, can be generated on both sides of the insert. Because Loxp 1/2 type mutants, preferably Loxp71/66 mutants, have a mutation in the symmetrical sequences at both ends, and their binding capacity to Cre is greatly reduced, cre is not able to effectively catalyze the reverse recombination of Loxp 1/2 type mutants, preferably Loxp71/66 mutants, resulting in stable and irreversible integration of large fragments of circular DNA into the cell chromosome. That is, the Loxp 1/2 type mutant, preferably the Loxp71/66 mutant, prevents the occurrence of a reverse recombination reaction between the wild type Loxp and the Loxp 1/2 type mutant, preferably the Loxp71/66 mutant, resulting in stable irreversible integration of the foreign DNA into the chromosome of the cell, thereby enhancing the stability of the inserted gene.

As shown in the examples of the present application, the wild-type Loxp site is not effective for stable site-directed integration into the chromosome by Cre-mediated large circular DNA. The working principle of the Loxp71/66 mutant for promoting the directional integration of macromolecular circular DNA is shown in figure 2 in the attached drawing of the specification.

Thus, for the first time, the present application has found that mutant Loxp, such as Loxp71/66 mutant, rather than wild-type Loxp, facilitates the site-directed integration of large fragment DNA into the cell genome with high efficiency and stability.

Meanwhile, the application finds that Loxp double mutation Loxp66/71 is the most preferable scheme for mediating the stable site-directed integration of macromolecular DNA into cell chromosomes through experiments. The Loxp66/71 has the best effect and highest transformation efficiency compared with the wild-type Loxp, or Loxp containing 1 mutation, such as Loxp/Loxp66 or Loxp/Loxp71, or Loxp double mutation containing other mutation positions, can stably and fixedly integrate macromolecular DNA into cell chromosomes most effectively and most stably, and is most suitable for the fixed-point integration and cloning of large-fragment DNA.

For 4) how efficiently site-directed integration recombinant cell clones are screened and tested.

Once the desired gene fragment is site-directed integrated into the genome of the recipient cell, the recipient cell also needs to be screened. In this regard, the vector typically comprises any DNA elements (e.g., origins of replication) required to facilitate replication of the vector in one or more desired cell types and selection and/or resistance markers for use in different cell types.

Resistance markers are well known. The skilled person is able to determine suitable resistance markers for different host/donor combinations. In some cases, it is desirable to use a non-clinically relevant marker. In other cases, the selection of the resistance marker depends on the nature of the donor, host and/or recipient cell.

For the present application, in order to efficiently screen recombinants site-specifically integrated into chromosomes, the present application also designed expression cassettes for the functionally complementary and truncated resistance gene neomycin (NeoR) after the Loxp site of DNA and chromosome, respectively. Only recombinants inserted with exogenous genes at fixed positions can express the resistance of G418 drugs, and randomly integrated DNA fragments cannot generate drug resistance. Thus, this expression cassette can be used to identify site-directed insertion of a foreign gene. None of the truncated neomycin (G418) resistance expression cassettes alone is capable of conferring neomycin resistance on cells, preferably only after recombination of the 5 'and 3' parts of the Neo gene contained therein in a certain order.

In a preferred embodiment, the 5 'end portion of the Neo gene and the 3' end portion of the Neo are truncated at position 92. More preferably, amino acid 92 of neomycin is encoded by both the last nucleotide of the 5 'end portion of the Neo gene and the starting nucleotide of the 3' end portion of the Neo gene. In a specific embodiment, amino acid 92 of neomycin is encoded by the last 2 nucleotides of the 5 'end portion of the Neo gene together with the first nucleotide at the beginning of the 3' end portion of the Neo gene. That is, the 5 'end portion of the Neo gene expresses amino acids 1 to 91 of neomycin, the 3' end portion of the Neo gene expresses amino acids 93 to 267 of neomycin, and the last 2 nucleotides of the 5 'end portion and the first nucleotide at the beginning of the 3' end portion of the Neo gene together encode amino acid 92 of neomycin.

Meanwhile, a CreERT2-IRES-PuroR structure is designed at the upstream of the NeoR expression cassette. CreERT2 is a fusion protein of a ligand binding region mutant (ERT 2) containing an estrogen receptor (estrogen receptor, ER) and a Cre recombinase. In the absence of Tamoxifen induction, cre-ERT2 is in an inactive state within the cytoplasm. When Tamoxifen is induced, the metabolite 4-OHT (estrogen analog) of Tamoxifen binds to ERT, allowing Cre-ERT2 to enter the nucleus and exert Cre recombinase activity. IRES-PuroR constructs were used to screen positive clones for gene knockins.

In addition, the present application uses the FLP/FRT system to excise the vector sequence and the G418 resistant expression cassette. With the insertion of foreign genes into the chromosomal genome, the cell will express some unwanted selective genes such as HygR, neoR, puroR, etc. The present application uses FLP/FRT recombination to delete these selectable genes. After integration of the foreign gene into the Loxp71 site of the recipient cell chromosome, the NeoR-CreERT2-IRES-PuroR sequence can be deleted by FRT sequence-dependent FLP recombinase.

In addition, in addition to using the resistance of the complementarily truncated G418 gene to screen recombinants with a foreign gene inserted at a site-specific position, other resistance screening mechanisms known in the art may be used in the present application. These commonly used resistance screening mechanisms are, for example, puromycin (Puromycin), hygromycin (Hygromycin), HPRT and the like.

While the present application provides the following examples to assist in understanding the invention, the true scope of the invention is set forth in the appended claims. It will be appreciated that modifications may be made to the methods presented without departing from the spirit of the invention.

Example site-directed integration of the partially human Lamda light chain locus (IGL) into embryonic stem cells (ES cells)

1. Preparation of YAC vector containing large fragment exogenous DNA

According to the previously reported DNA macromolecule cloning method (China patent application No. 201811238618.6), 340kb part of human IGL locus (GRCh 37/hg19 chr22:22,377,297-22,717,584) was cloned into the linear TAR cloning shuttle vector TAR-YAC-HygR-. DELTA.NeoGFP-Loxp 66FRT (i.e. TAR-Loxp 66, see FIG. 4 of the drawings of the specification) and TAR-YAC-HygR-. DELTA.NeoGFP-WT Loxp FRT (i.e. TAR-WT Loxp), respectively. The vectors TAR-Loxp 66 and TAR-WT Loxp were obtained by DNA synthesis. The TAR-Loxp 66 sequence (all referred to as TAR-YAC-HygR- ΔNeoGFP-Loxp 66FRT sequence) is SEQ ID NO. 25, see sequence Listing. The vector TAR-WT Loxp differs from TAR-Loxp 66 in that the Loxp 66 sequence of the TAR-Loxp 66 vector (ATAACTTCGTATA ATGTATGC TATACGAACGGTA) is replaced with a WT Loxp sequence (ATAACTTCGTATA ATGTATGC TATACGAAGTTAT).

The 340kb partial human IGL locus template sequences are derived from BAC vectors RP11-685C18, RP11-890G10 and RP11-373H24. According to the patent method (Chinese patent application No. 201811238618.6), the BAC vector is digested in vitro by using the Crispr/Cas9 method, and the linearized DNA fragment is cloned into pTARYAC vector by using TAR cloning technology. The recombinant pTARYAC vector can be amplified and purified in bacteria. The vector purified in large quantities was digested with I-SceI to give 3 DNA fragments, DNA fragment IGL1, 38kbp (GRCh 37/hg19 Chr22: 22377208-22415482), respectively; DNA fragment IGL2, about 155kb (GRCh 37/hg19 Chr22: 22415353-22571119) and DNA fragment IGL3, 147kb (GRCh 37/hg19 Chr22: 22570833-22718740). The homologous recombination sequences of about 100bp exist between the digested DNA products.

Linearized TAR-WT Loxp and TAR-Loxp 66 were prepared using ApaI and PAC I cleavage and DNA gel purification. The ends of linearized TAR-WT Loxp and TAR-Loxp 66 contain the terminal homologous sequences of DNA fragment IGL1 and DNA fragment IGL3, respectively. The digested DNA fragments IGL1, IGL2, IGL3 and linearized TAR-WT Loxp or TAR-Loxp 66 were transformed into Saccharomyces cerevisiae using TAR cloning to give circular vectors containing 340kb of human IGL locus useful for gene integration.

The specific test procedure is as follows:

referring to the procedure set forth in the patent application (China patent application No. 201811238618.6), 100ng of DNA fragment IGL1 ((GRCh 37/hg19Chr22: 22377208-22415482), 100ng of DNA fragment IGL2 (GRCh 37/hg19Chr22: 22415353-22571119), 100ng of DNA fragment IGL3 (GRCh 37/hg19Chr22: 22570833-22718740) were mixed with 100ng of linearized vector TAR-WT Loxp and TAR-Loxp 66, respectively, and the DNA fragment was transformed into competent yeast cell AB 1380 (ATCC, cata: 20843) using the yeast protoplasm fusion procedure (Kouprina and Larionov 2008).

The yeast protoplast fusion method is briefly described as follows:

yeast cell cultures were harvested overnight and then washed with 1M sorbitol. Cells were transformed into spheroplasts by treatment with zymolyaseTM and beta-mercaptoethanol in the presence of 1M sorbitol. The spheroplasts were washed with sorbitol and resuspended in buffer containing sorbitol and CaCl 2. 200 μl of competent yeast equivalent to 5ml of the original yeast culture was mixed with 100ng of linearized vector, 100ng of RP11-890G10 cleavage product. Incubation is carried out for 30 minutes at 30 ℃, and then heat shock is carried out for 20-25 minutes in a water bath at 42 ℃. Centrifuging at 6000-8000 r/min for 15 seconds, and removing the transformation mixed solution by a micropipette. 1.0ml of YPD liquid medium (Sigma Cata#Y1375) was added to each reaction tube, and the pelleted cells were gently suspended with a micropipette, and incubated overnight at 30 ℃.

The next day, an aliquot of 200. Mu.l of the transformation mix was spread evenly over YPD solid medium containing 0.2mg/mL Hygromycin B for cultivation. After 48 hours, positive clones were picked and amplified, and grown in YPD liquid medium containing Hygromycin B. Yeast DNA was extracted using a Kit (Yeast DNA Kit, D3370-01) and positive clones were identified by PCR detection. The complete recombinants were identified using different PCR primers. Two recombinants were finally obtained, TAR-IGL-HygR-. DELTA.NeoGFP-Loxp 66 (i.e., TAR-IGL-Loxp 66) and TAR-IGL-HygR-. DELTA.NeoGFP-WTLoxp (i.e., TAR-IGL-WTLoxp), respectively. The result of the electrophoretic identification of the ligation product, i.e., the vector TAR-IGL-Loxp66PCR, is shown in FIG. 5 of the drawings of the specification. The primer sequences are shown in FIG. 6 of the drawings.

2. Genetic modification of recipient cells

In order to site-directed integration of a foreign gene into a host cell chromosome at a specific location, it is necessary to genetically modify the chromosome of the host cell.

Considering the advantages of short cycle and high efficiency of CRISPR/Cas9 technology, the application utilizes the technology to insert an expression cassette containing CreERT2 and 5' NeoR at a specific site Chr16:19046551-19048556 (NCBI 37/mm 9) of an embryonic stem cell (ES cell). The working principle is shown in figure 7 in the attached drawings.

Specifically, a guide RNA (Guide RNA) is designed near the insertion site (Chr16: 19046551-19048556 (NCBI 37/mm 9)). The recognition target sequence is TTGGCTACAATAGCCAATGC/CGG, wherein the CGG at the 3' end is PAM sequence. ES cells (EDJ #22) were purchased from ATCC (ATCC, cat: SCRC-1021) as 129S 5/SvEvTac-derived ES cell line.

The inserted gene has the structure of Loxp71-hprt intron-5' neo-PGK promoter-rBGpA-EF1 apromiter-Create 2-IRES-puro-FRT, and the sequence is shown in the sequence table. Wherein the Loxp71 sequence is used to mediate site-directed integration of a foreign gene. Upstream of the Loxp71 site is a truncated NeoR resistance expression cassette. When the foreign gene is inserted into the Loxp71 site, a complete NeoR expression cassette can be formed. This newly formed resistance expression cassette can be used to identify site-directed insertion of a foreign gene.

The CreERT2-IRES-PuroR construct was also designed upstream of the NeoR expression cassette. CreERT2 is a fusion protein of a ligand binding region mutant (ERT 2) containing an estrogen receptor (estrogen receptor, ER) and a Cre recombinase. In the absence of Tamoxifen induction, cre-ERT2 is in an inactive state within the cytoplasm. When Tamoxifen is induced, the metabolite 4-OHT (estrogen analog) of Tamoxifen binds to ERT, allowing Cre-ERT2 to enter the nucleus and exert Cre recombinase activity. IRES-PuroR constructs were used to screen positive clones for gene insertion. After integration of the foreign gene into the Loxp71 site of the chromosome', the NeoR-CreERT2-IRES-PuroR sequence can be deleted by FLP recombinase upon which the FRT sequence depends.

In this example, the 5 'end portion of the Neo gene and the 3' end portion of the Neo gene are truncated at position 92, the 5 'end portion of the Neo gene expresses amino acids from positions 1 to 91 of neomycin, the 3' end portion of the Neo gene expresses amino acids from positions 93 to 267 of neomycin, and amino acid R at position 92 is encoded by the last 2 nucleotides AG of the 5 'end portion and the first nucleotide G at the beginning of the 3' end portion of the Neo gene.

To insert the above gene structure site-specifically into the genome of a host cell, a 1014bp 5 '-terminal recombination arm was cloned upstream of the insertion sequence (Loxp 71-5' -NeoR-CreERT 2-IRES-Puror-FRT) and its sequence was located in chr16:19046411-19047425 (NCBI 37/mm 9). A1087 bp 3' -terminal recombinant arm was cloned downstream thereof and its sequence was located at NCBI37/mm9 chr16:19047426-19048512 (NCBI 37/mm 9).

The specific test method is as follows:

A. preparation of Cas9 ribonucleoproteins complex (RNP): crRNA (IDTdna Co.) of the template sequence (ttggctacaatagccaatgc/cgg) was synthesized from the sequence using a chemical synthesis method. Crrnas contain 16nt of complementary sequences for fusion of tracrRNA in addition to the 20nt of specific sequence of the target site. mu.M CrRNA and 10. Mu.M TracrRNA (IDTdnacata: 1072534) were denatured at 95℃for 5min. And then cooled to room temperature. Equimolar Cas9 nucleic V3 (IDTdnacata: 1081058) was added, PBS was used as buffer, the reaction solution was 20ul in volume, and incubated at 25℃for 20min to form RNP.

B. Mu.l of RNP and 100ng of linear template DNA (Loxp 71-5' NeoR-CreERT 2-IRES-PuroR-FRT) were mixed in an ice bath for 10min.

C.3x105ES cells and 20ul RNP were mixed with DNA template and electrotransfected in electrotumblers (BioRad, cata: 1652081). Electrotransfection conditions: 1200 volts, 30 milliseconds apart. Following electrotransfection, ES cells diluted with culture broth were cultured in 10 cm dishes in the presence of feeder cells (sigmaaldrich Cata: PMEF-CFX). The culture medium and culture conditions for ES cells are described with reference to ATCC for this cell line.

D. After the cells ES were continuously cultured for 48 hours, 1ug/ml Puromycin (ThermofisherCata: A1113802) was added to the medium. The culture was continued for 7 days.

E. Monoclonal ES cells were picked and transferred to 48 well plates for continued growth. After 3 days, ES cells were scattered with a pipette tip, one half of the cells were used for extracting genomic DNA, and the other half were frozen in a 48-well cell culture plate for use.

F. Primers were designed at the junctions of the 5 'and 3' ends of the insert and the insertion site, respectively, and genomic DNA having the expression cassette integrated at the site was selected by PCR. The primer sequence is as follows, insert 5F: GCAGTCTGCACTCTCTGTGG; insert 5R: tcgaggggacttaCCGTTC; inert 3F: cgtgacatgagacaaagg; insert 3R: GGAACCTTTCCCCCATAAAA. The primer design principle and the screening result are shown in figure 8 in the attached drawings of the specification. By PCR, 15 of the 28 clones were PCR negative, 9 clones were positive for both the 5 'and 3' ends of the insert, and a few were PCR positive only at one end. The results show that the ratio of site-directed insertion of exogenous DNA into receptor cells reaches 30% using CRISPR/Cas9 technology. The genetically modified ES clone was designated ES 5' neo-Loxp 71.

Using the same strategy, another ES clone was prepared, and the inserted gene structure was WT-Loxp-hprt intron-5' neo-PGKremoter-rBGpA-EF 1 a-CreeERT 2-IRES-puro-FRT. This modified ES clone was named ES 5' neo-WTLoxp.

3. Yeast spheroplast mediated cell fusion technique

The difficulty with the targeted insertion of large fragment DNA into recipient cells is that the transformation efficiency is low, the exogenous DNA in the form of linear large fragments is easily broken, and the efficiency of purifying large fragment DNA from yeast cells is very low using conventional methods such as liposome transfection, electrotransformation, etc. In this regard, yeast spheroplast fusion techniques were chosen for use in the present application. Under the mediation of PEG, yeast spheroplasts can be fused with cells, so that large fragment DNA is introduced into recipient cells. Although yeast spheroplast-mediated cell fusion has been reported in the prior art to be useful for mediating the introduction of YACs containing large fragments of DNA into recipient cells, such introduction is mostly due to chromosomal random insertion, rather than site-directed insertion. Meanwhile, linear YAC vectors are easily degraded or broken down in cells. In this regard, the present application has improved that YAC vectors are spliced into circular YAC vectors, and simultaneously, large fragment DNA is loaded into circular YAC vectors, thereby improving the efficiency of site-directed insertion of complete genes into cell chromosomes. In addition, in order to maintain the versatility of ES cells after protoplast fusion, we also selected embryonic stem cells (ES cells) with 129S5/Sv as a genetic background. The ES cells of this genetic background are less likely to differentiate when cultured in vitro than the ES cells of other genetic backgrounds.

The specific method comprises the following steps:

A. preparation of yeast protoplast cells:

yeast solution loaded with large fragment IGL (carrying TAR-IGL-Loxp 66 gene) was added to YPD (Sigma, cata: Y1375) medium containing 0.2mg/mLHygromycin and shaken overnight at 30 ℃. The next day, the bacteria were diluted 10-fold with YPD medium and shaking was continued for 3-4 hours until OD600 was 2.0-3.0. Yeast was then collected by centrifugation at 2500g for 15 min. Yeast cell pellet was suspended with 20ml of 1M sorbitol and allowed to stand at 4℃for 2 hours. Yeast cells were collected by centrifugation, cell pellet was homogenized with SPEM buffer (1M sorbitol, 0.1M sodium phosphate buffer mixture pH7.4, and 10mM EDTA, pH 8.0), and further wall-removed by adding 75UL of 14mM 2-ME and 100UL Zymolase, and digested at 30℃for 30 minutes. The digested cells were washed with 1M sorbitol. The cells were then suspended in 2ml of STC solution (1M sorbitol,10mM Tris-HCl, pH 7.5,10mM CACl2 and 2.5mM MgCl2) for use.

PEG-mediated cell fusion:

at the same time, the above-described genetically modified ES cells (e.g., ES 5' neo-Loxp 71) were collected. ES 5' neo-Loxp 71 cells were combined with TAR-IGL-Loxp 66 yeast cells at a ratio of 1:100 in PBS solution. The cells were centrifuged at room temperature and the cell mixture was suspended in PEG1500 solution (Roche Applied Science, cata: 10783641001) containing 10% DMSO. After two minutes, the fused ES cells were suspended in the culture solution, and centrifuged at 200g for 5 minutes. The cell mixture was suspended, 2X106ES cells were diluted with ES cell medium, and cultured on 5 10cm dishes. After 50% ES cell attachment, the ES cells were induced to express Cre recombinase by the addition of Tamoxifen (1. Mu.g/ml) (Sigma, cata: T5648-1G). After 16 hours, tamoxifen was washed away, G418 was added and resistant clones were screened.

As a control, ES 5' neo-WTLoxp cells were fused with TAR-IGL-WTLoxp yeast cells by PEG, followed by G418 screening, but G418 resistant clone generation was not observed, indicating that WT Loxp was not able to mediate site-directed insertion of large fragment circular DNA, or that the insertion efficiency was very low.

Thus, the present application also attempted a conventional Cre-Lox recombination method, i.e., using a wild-type Loxp sequence, but failed to stably site-directed integrate macromolecular DNA into the cell chromosome. This is probably because Cre-catalyzed Loxp sequence-dependent recombination reactions are reversible, i.e. reverse recombination or deletion may occur between Loxp sites, so recombination between wild-type Loxp sites is not effective in mediating stable site-directed integration of macromolecular DNA into the cell chromosome.

C. Detection of positive gene insertion into cells:

after one week of continuous culture in the presence of G418, G418-resistant monoclonal ES cells expressing GFP (ES 5' neo-WTLOXP) were picked and transferred to 48-well plates for continued growth. After 3 days, ES cells were scattered with a pipette tip, one half of which was used for extracting genomic DNA, and the other half was frozen in a 48-well cell culture plate for use. Considering that clones with G418 resistance recombine between the Loxp 66 site and the chromosomal Loxp 71 site of the foreign fragment, thereby generating WTLOxp site and Loxp 71/66 site at both ends of the insert, primers were designed at both ends of the insert WTLOxp and Loxp 71/66, and the site-specific insert ES clone was identified by PCR method.

The primer sequences were as follows:

WT Loxp F:GGAGATCCTCAGGTCATTGC；

WT Loxp R:GGCAGAGCTTTGCTTTTGTT；

Loxp 66/71 F:CCTTGACCCAGAAATTCCAC；

loxp 66/71 R:TGGAGGCCATAAACAAGAAGA. The primer design and the PCR identification result are shown in figure 9 in the attached drawings.

After G418 selection, all cell clones were positive for the Loxp 71/66PCR result, with 75% of the cell clones being double positive for Loxp 71/66 and WT Loxp, and 25% of the cell clones were single positive for Loxp 71/66PCR and negative for WT LoxpPCR, indicating that a second gene recombination event at the WT Loxp site could result in multiple copy insertion or gene fragmentation. This can be excluded by PCR, to further select for double positive clones and to identify the integrity of the inserted gene IGL. The PCR primers used are shown in FIG. 6 of the drawings. The identification showed that all PCR results were positive, indicating that the inserted gene was complete.

D. Deletion of the selectable marker:

with the insertion of the exogenous gene IGL into the chromosome, the cell will express some unnecessary selective genes such as HygR, neoR, creERT2 and PuroR, etc. These selectable genes can be deleted using FLP/FRT recombination. As shown in figure 3 of the drawings of the specification. FLP plasmid (pCAG-Flpe) sequence (Addgene, cata: 13787) was synthesized. The pCAG-Flpe plasmid was transferred into ES clones inserted with IGL gene by conventional liposome transformation method, and GFP negative, G418 sensitive and Puromycin sensitive ES clones were selected for use.

Cre-Lox recombination is a site-specific recombinase technique for deletion, insertion, transposition and inversion operations at specific sites of cellular DNA. The loxP site consists of 34bp special site sequence, the middle 8bp DNA base is asymmetric sequence to determine the direction of the loxP site, and two 13bp opposite symmetric sequences are arranged on two sides of the asymmetric sequence to determine the combination efficiency with Cre. When a mutation occurs at one end of the symmetric sequence, such as Loxp71 (mutation exists in the 5 '-terminal symmetric sequence) and Loxp66 (mutation exists in the 3' -terminal symmetric sequence), cre can still catalyze recombination reaction between the mutations Loxp (such as Loxp71 and Loxp 66). However, after the recombination reaction of Loxp71 and Loxp66, wild-type Loxp and double mutant Loxp (Loxp 71/66) were produced. Because of the mutation of the symmetrical sequences of Loxp71/66 at both ends, the binding capacity with Cre is greatly reduced, so that the reverse recombination reaction between WT Loxp and Loxp71/66 is avoided, and the stability of the inserted gene is enhanced. Comparison of the above experiments shows that mutant Loxp, but not wild-type Loxp, facilitates the site-directed insertion of large fragment DNA.

The application finds that Loxp double mutation Loxp66/71 is the most preferable scheme for mediating stable site-directed integration of macromolecular DNA into cell chromosomes. The Loxp66/71 has the best effect and highest transformation efficiency compared with the wild-type Loxp, or Loxp containing 1 mutation, such as Loxp/Loxp66 or Loxp/Loxp71, or Loxp double mutation containing other mutation positions, can stably and fixedly integrate macromolecular DNA into cell chromosomes most effectively and most stably, and is most suitable for the fixed-point integration and cloning of large-fragment DNA.

The sequences referred to in this application are as follows:

1. sequence 1SEQ ID NO:1

loxp66 sequence:

ATAACTTCGTATA ATGTATGC TATACGAACGGTA

2. sequence 2SEQ ID NO:2

WT loxp sequence

ATAACTTCGTATA ATGTATGC TATACGAAGTTAT

3. Sequence 3 EQ ID NO:3

Forward primer for PCR product 1 at junction of TAR-loxp66 end of vector and IGL1

GGGTTCTCACCTCTGATTAG

4. SEQ ID NO. 4 sequence

Reverse primer for PCR product 1 at junction of vector TAR-loxp66 end and IGL1

AGGTCCCTCGACCTGCAGCCC

5. Sequence 5SEQ ID NO:5

Forward primer for IGL1 internal PCR product 2

AAACCAAGACGGTGAGGAAAG

6. Sequence 6SEQ ID NO:6

Reverse primer for IGL1 internal PCR product 2

GTAAATGAATAAAGGAATGG

7. SEQ ID NO:7

Forward primer for PCR product 3 at the junction of IGL1 and IGL2

TGGTGCAGACTCCCCGGATCT

8. Sequence 8SEQ ID NO 8

Reverse primer for IGL1 and IGL2 junction PCR product 3

GGAAATGATACCTGGCCCTGGCC

9. SEQ ID NO. 9 sequence 9

Forward primer for IGL2 internal PCR product 4

AGGGAGGCAGATGCAGAGGT

10. Sequence 10SEQ ID NO 10

Reverse primer for IGL2 internal PCR product 4

TTGACCCCACTCCTCCTCCTCA

11. SEQ ID NO. 11 sequence

Forward primer for PCR product 5 at junction of IGL2 and IGL3

TCCAGTAATGGTCAGGGAGGC

12. Sequence 12SEQ ID NO:12

Reverse primer for IGL2 and IGL3 junction PCR product 5

CCCACCTCTGCTCCAGCTTC

13. SEQ ID NO. 13 sequence 13

Forward primer for IGL3 internal PCR product 6

CTCGGTGACTTGATCCCAG

14. SEQ ID NO. 14 sequence 14

Reverse primer for IGL3 internal PCR product 6

AATGTGTGTAGGGAACATCAT

15. Sequence 15SEQ ID NO 15

Forward primer for PCR product 7 at end junction of IGL3 and vector TAR-loxp66

AGTTCTGCTCAAGCTTGGC

16. Sequence 16SEQ ID NO:16

Reverse primer for PCR product 7 at the end junction of IGL3 and vector TAR-loxp66

CACAGCTACCCTCAAGAAAG

17. 17SEQ ID NO:17

Primer Insert 5F for screening PCR of genomic DNA integrated with the expression cassette:

GCAGTCTGCACTCTCTGTGG

18. sequence 18SEQ ID NO:18

Primer Insert 5R for screening PCR of genomic DNA integrated with the expression cassette:

tcgagggacctaTACCGTTC

19. sequence 19SEQ ID NO 19

Primers Insert 3F cgtgacatgaaagg for PCR screening genomic DNA integrated with expression cassette

20. Sequence 20SEQ ID NO:20

Primer Insert 3R for PCR screening of genomic DNA integrated with expression cassette

GGAACCTTTCCCCCATAAAA

21. Sequence 21SEQ ID NO:21

Primer WT loxp F for identifying WT loxp positivity:

GGAGATCCTCAGGTCATTGC

22. sequence 22SEQ ID NO:22

Primer WT loxp R for identifying WT loxp positive:

GGCAGAGCTTTGCTTTTGTT

23. sequence 23SEQ ID NO:23

Primers Loxp66/71F for identifying Loxp66/71 positives:

CCTTGACCCAGAAATTCCAC

24. sequence 24SEQ ID NO:24

Primers Loxp66/71R for identifying Loxp66/71 positivity:

TGGAGGCCATAAACAAGAAGA

25. sequence 25SEQ ID NO:25

TAR-loxp66 sequence

GGCGCGCCACTAGTGGATCTCGAGCCCCAGCTGGTTCTTTCCGCCTCAGAAGGAATTTCGAGGTCGCTAGTGCTAGAGCTTGGGCTGCAGGTCGAGGGACCTAATAACTTCGTATAATGTATGCTATACGAACGGTAATTAAGGGTTCCGGATCAATTCTAGAGCTATCTAATATATTTTAAAGGTTGCATAGCATTCTGTCTTATGGAGATACCATAACTGATTTAACCAGTCCACTATTGATAGACACTATTTTGTTCTTACCGACTGTACTAGAAGAAACATTCTTTTACATGTTTGGTACTTGTTCAGCTTTATTCAAGTGGAATTTCTGGGTCAAGGGGAAAGAGTTTATTGAATATTTTGGTATTGCCAAATTTTCCTCTAAGAAGTTGAATCATTTTATACTCCTGATGTTATATGAGAGTACCTTTCTCTTCACAATTTGTCTCTTTTTTTTTTTTTTTTGAGACAAGGTCTCTGTTGCCCAGGCTGGGGTGCAGTGCAGCAGAATGATCACAGTTCACTGCAGTCTCAACCTCCTGGGTTCAAGCGATCCTTCCACCTCAGCCTCCTGAGTAGCTGGGACTATAGGTGTGCGCCACCACTCCCAGCTAATATTTTTATTTTGTAGAAACAGGGTTCGCCATGTTACCCAGCCTCCCAAAGTGCTGGGATTACAGGCATGAGCCACTGGCCCAGTTTCTACAGTCTCTCTTAATATTGTATATTATCCAAGAAATTTCATTTAATCAGAACCTGCCAGTCTGATAGGTGAAAATGGTATCTTGTTTTTATTTGCATTTAAAAAAAATTATGATAGTGGTATGCTTGGTTTTTTTGAAGGTATCAAATTTTTTACCTTATGAAACATGAGGGCAAAGGATGTGTTACGTGGAAGATTTAAAAAAAATTTTTAATGCATTTTTTTGAGACAAGGTCTTGCTCTATTGTCCAGGCTGGAGTGCAGTGGCACAATCACAGTTCACTCCAGCCTCAACATCCTGCACTAAAGTGATTTTCCCACCTCACCTCTCAAGTAGCTGGGACTACAGGTACATGCTACCATGCCTGGCTAATTTTTTTTTTTTTGCAGGCATGGGGTCTCACTATATTGCCCAGGTTGGTGTGGAAGTTTAATGACTAAGAGGTGTTTGTTATAAAGTTTAATGTATGAAACTTTCTATTAAATTCCTGATTTTATTTCTGTAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGATGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCGGCAGTGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGCCCAGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAAGAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGAGAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGCTTCTGAGGCGGAAAGAACCAGCTGGGGCTCGATCCTCTAGTTGGGTACCTTCTGAGAATTCGCCCTCGCCGCAGGGCCTCGGTGGCCGGCCGCAGCTTGCAAATTAAAGCCTTCGAGCGTCCCAAAACCTTCTCAAGCAAGGTTTTCAGTATAATGTTACATGCGTACACGCGTCTGTACAGAAAAAAAAGAAAAATTTGAAATATAAATAACGTTCTTAATACTAACATAACTATAAAAAAATAAATAGGGACCTAGACTTCAGGTTGTCTAACTCCTTCCTTTTCGGTTAGAGCGGATGTGGGGGGAGGGCGTGAATGTAAGCGTGACATAACTAATTACATGATGCGGCCCTCTAGATGCATGCTCGAGCGGCCGCTACCACTTTGTACAAGAAAGCTGGGTTTATTCCTTTGCCCTCGGACGAGTGCTGGGGCGTCGGTTTCCACTATCGGCGAGTACTTCTACACAGCCATCGGTCCAGACGGCCGCGCTTCTGCGGGCGATTTGTGTACGCCCGACAGTCCCGGCTCCGGATCGGACGATTGCGTCGCATCGACCCTGCGCCCAAGCTGCATCATCGAAATTGCCGTCAACCAAGCTCTGATAGAGTTGGTCAAGACCAATGCGGAGCATATACGCCCGGAGCCGCGGCGATCCTGCAAGCTCCGGATGCCTCCGCTCGAAGTAGCGCGTCTGCTGCTCCATACAAGCCAACCACGGCCTCCAGAAGAAGATGTTGGCGACCTCGTATTGGGAATCCCCGAACATCGCCTCGCTCCAGTCAATGACCGCTGTTATGCGGCCATTGTCCGTCAGGACATTGTTGGAGCCGAAATCCGCGTGCACGAGGTGCCGGACTTCGGGGCAGTCCTCGGCCCAAAGCATCAGCTCATCGAGAGCCTGCGCGACGGACGCACTGACGGTGTCGTCCATCACAGTTTGCCAGTGATACACATGGGGATCAGCAATCGCGCATATGAAATCACGCCATGTAGTGTATTGACCGATTCCTTGCGGTCCGAATGGGCCGAACCCGCTCGTCTGGCTAAGATCGGCCGCAGCGATGGCATCCATGGCCTCCGCGACCGGCTGCAGAACAGCGGGCAGTTCGGTTTCAGGCAGGTCTTGCAACGTGACACCCTGTGCACGGCGGGAGATGCAATAGGTCAGGCTCTCGCTAAATTCCCCAATGTCAAGCACTTCCGGAATCGGGAGCGCGGCCGATGCAAAGTGCCGATAAACATAACGATCTTTGTAGAAACCATCGGCGCAGCTATTTACCCGCAGGACATATCCACGCCCTCCTACATCGAAGCTGAAAGCACGAGATTCTTCGCCCTCCGAGAGCTGCATCAGGTCGGAGACGCTGTCGAACTTTTCGATCAGAAACTTCTCGACAGACGTCGCGGTGAGTTCAGGCTTTTTACCCATGGTGGCAGCCTGCTTTTTTGTACAAACTTGCTTAGATTAGATTGCTATGCTTTCTTTCTAATGAGCAAGAAGTAAAAAAAGTTGTAATAGAACAAGAAAAATGAAACTGAAACTTGAGAAATTGAAGACCATTTATTAACTTAAATATCAATGGGAGGTCATCGAAAGAGAAAAAAATCAAAAAAAAAAATTTTCAAGAAAAAGAAACGTGATAAAAATTTTTATTGCCTTTTTCGACGAAGAAAAAGAAACGAGGCGGTCTCTTTTTTCTTTTCCAAACCTTTAGTACGGGTAATTAACGACACCCTAGAGGAAGAAAGAGGGGGAATTTAGTATGCTGTGCTTGGGTGTTTTGAAGTGGTACGGCGATGCGCGGAGTCCGAGAAAATCTGGAAGAGTAAAAAAGGAGTAGAAACATTTTGAAGCTATGGTGTGTGGGGGATCCAACTTTTCTATACAAAGTTGACTAGTGGATCGATCCCCTTTACATCTTCGGAAAACAAAAACTATTTTTTCTTTAATTTCTTTTTTTACTTTCTATTTTTAATTTATATATTTATATTAAAAAATTTAAATTATAATTATTTTTATAGCACGTGATCAGCCTGCTGTCGTGAATACGGCGCGCCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCTTATGAGGTCCCTCATCCAGAACTCTGGCTGCAGCAACCCCAGCAGAGGTCCTGAGTCTGCAGACTTGAAGAATAATACAAAGAAGAATTAGGGAAGTGAGTAGGCACTATTAATTAAAGTTCTGCTCAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCACGGGCCCTTGCCACCCGCTCTCACTGCCACACCCTCATAGAAATCCTTCCCCATATGGATCTTGTGTTCTTCTCTCTCTCTTCCCTCTCAGCTCCTGCTCAGTGGCTGAAGCAGATTTGGAGCCACGAACACGAGTCTGGCAGAGCTTTGCTTTTGTTTTTAACTGGGAGTCGACTGCAGAGGCCTGCATG

26. Sequence 26SEQ ID NO 26

loxp71-hprt intron-5' neo-PGK pro-rBGpA-EF 1a-CreERT2-IRES-puro-FRT sequence

CGATTTAAGAAACAGAGGAAAATTGCAAGATTTTCTTGATTCTCTGTCTTAAACAAAACAGACAAAGATGATGGGCTCTTTGACTTTCTTGTGTCACTTTAATTTTCCTTGTCTTTCTAAGGAAAGTTGCCTGAGATAGCATAATGAGGGTTGAACATGACTGACACTGATAGAAACCCTGGTGAGGAGGTAGACATGTAAATAACAAGCAGAGCATTTGACCAGCACTGTTTGGTGTCACTAAATCAGTGGGTGCTATAAGTGGTGATGATGTTACCTGTATTCTTGAATGTTTCAATTTATATTTACCTGGAAAACTGGTTCATTTTGTTAAGGATTCTATGTTGCATTCCCTAAGTGTTGTGAGGTAAATGATGAAAGTTCTTTCAGGTCTGAATGAGGAAGATGTCTTGATGTCTTTTCAAGGCAAGCTCTATAGTGCAGGAGAGATGAGAGTTGTATATTCTCCAACACTATCCTCCATGTTCAGAAACAGCTATCACTTCAAGCCTGGGGTATGGAATTATATGACAGAAGGCCTCTGAAATAATTTCCCTGCTCTACCTTGCAAATTAACCCCATCTCTCTTATCTGTCACTCAATACCTGTATTCCTATCAATTCGTAACAAAACCAAACTGTTGTGTCTGATTTAAATAATATCTATGAAGTTGATATGAGCATGGCATGGCTTCTCTGTCTACTAGGGTATGAAGAAAAATCACCTTTCAAACAGAGAAAAAATACACCGAGTAGCAGCTGTCTGACTCTGGCATTAACTGGTAAATATTTGCAGCATATACTATGGAGCTGTTCAGATTTGATGAGTATGTTATTTGTTGACTCACTCATTCACTGAACAAATCTTCAGTGAGCACAGGTGTAGGCATGGGTTAGGAGCAAAGAGATGAGGCCTACCTACTCTGGAGAAACTTAGGAGTTAGAGATAAATACAATGTAGAATGAATCATTATTCTTATCCAGGAGATCCTCAGGTCATTGCTTGTCTCCGGCAGGATCCGATGATCCGGAACCCTTAATATAACTTCGTATAATGTATGCTATACGAACGGTATAGGTCCCTCGACCTGCAGCCCAAGCTCTAGACACACTAATATTAAAAGTGTCCAATAACATTTAAAACTATACTCATACGTTAAAATATAAATGTATATATGTACTTTTGCATATAGTATACATGCATAGCCAGTGCTTGAGAAGAAATGTGTACAGAAGGCTGAAAGGAGAGAACTTTAGTCTTCTTGTTTATGGCCTCCATAGTTAGAATATTTTATAACACAAATATTTTGATATTATAATTTTAAAATAAAAACACAGAATAGCCAGACATACAATGCAAGCATTCAATACCAGGTAAGGTTTTTCACTGTAATTGACTTAACAGAAAATTTTCAAGCTAGATGTGCATAATAATAAAAATCTGACCTTGCCTTCATGTGATTCAGCCCCAGTCCATTACCCTGTTTAGGACTGAGAAATGCAAGACTCTGGCTAGAGTTCCTTCTTCCATCTCCCTTCAATGTTTACTTTGTTCTGGTCCCTACAGAGTCCCACTATACCACAACTGATACTAAGTAATTAGTAAGGCCCTCCTCTTTTATTTTTAATAAAGAAGATTTTAGAAAGCATCAGTTATTTAATAAGTTGGCCTAGTTTATGTTCAAATAGCAAGTACTCAGAACAGCTGCTGATGTTTGAAATTAACACAAGAAAAAGTAAAAAACCTCATTTTAAGATCTTACTTACCTTCCCGCTTCAGTGACAACGTCGAGCACAGCTGCGCAAGGAACGCCCGTCGTGGCCAGCCACGATAGCCGCGCTGCCTCGTCCTGCAGTTCATTCAGGGCACCGGACAGGTCGGTCTTGACAAAAAGAACCGGGCGCCCCTGCGCTGACAGCCGGAACACGGCGGCATCAGAGCAGCCGATTGTCTGTTGTGCCCAGTCATAGCCGAATAGCCTCTCCACCCAAGCGGCCGGAGAACCTGCGTGCAATCCATCTTGTTCAATGGCCGATCCCATAACGGAGCCGGCCGGCGCGCGGGCTGACTGCTCAGGAGGAGGAAGCCGGTGGCGGAGCAGAGGAGGAGGCGGAGGCGCAGCAAGACCCCCCCCCCCCCCTGCAGGTCGAAAGGCCCGGAGATGAGGAAGAGGAGAACAGCGCGGCAGACGTGCGCTTTTGAAGCGTGCAGAATGCCGGGCCTCCGGAGGACCTTCGGGCGCCCGCCCCGCCCCTGAGCCCGCCCCTGAGCCCGCCCCCGGACCCACCCCTTCCCAGCCTCTGAGCCCAGAAAGCGAAGGAGCAAAGCTGCTATTGGCCGCTGCCCCAAAGGCCTACCCGCTTCCATTGCTCAGCGGTGCTGTCCATCTGCACGAGACTAGTGAGACGTGCTACTTCCATTTGTCACGTCCTGCACGACGCGAGCTGCGGGGCGGGGGGGAACTTCCTGACTAGGGGAGGAGTAGAAGGTGGCGCGAAGGGGCCACCAAAGAACGGAGCCGGTTGGCGCCTACCGGTGGATGTGGAATGTGTGCGAGGCCAGAGGCCACTTGTGTAGCGCCAAGTGCCCAGCGGGGCTGCTAAAGCGCATGCTCCAGACTGCCTTGGGAAAAGCGCCTCCCCTACCCGGTAGAATTCCTGGCGCGGATCTCCATAAGAGAAGAGGGACAGCTATGACTGGGAGTAGTCAGGAGAGGAGGAAAAATCTGGCTAGTAAAACATGTAAGGAAAATTTTAGGGATGTTAAAGAAAAAAATAACACAAAACAAAATATAAAAAAAATCTAACCTCAAGTCAAGGCTTTTCTATGGAATAAGGAATGGACAGCAGGGGGCTGTTTCATATACTGATGACCTCTTTATAGCCAACCTTTGTTCATGGCAGCCAGCATATGGGCATATGTTGCCAAACTCTAAACCAAATACTCATTCTGATGTTTTAAATGATTTGCCCTCCCATATGTCCTTCCGAGTGAGAGACACAAAAAATTCCAACACACTATTGCAATGAAAATAAATTTCCTTTATTAGCCAGAAGTCAGATGCTCAAGGGGCTTCATGATGTCCCCATAATTTTTGGCAGAGGGAAAAAGATCTCAGTGGTATTTGTGAGCCAGGGCATTGGCCACACCAGCCACCACCTTCTGATAGGCAGCCTGCACCTGAGGATCACCACTTTGTACAAGAAAGCTGGGTGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCG

CAACGGGTTTGCCGCCAGAACACAGGTAAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTTGCGTGCCTTGAATTACTTCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAGCTTCGGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCCCTTCGCCTCGTGCTTGAGTTGAGGCCTGGCCTGGGCGCTGGGGCCGCCGCGTGCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAGCCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGTCTTGTAAATGCGGGCCAAGATCTGCACACTGGTATTTCGGTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATGTTCGGCGAGGCGGGGCCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCGGCCTGCTCTGGTGCCTGGTCTCGCGCCGCCGTGTATCGCCCCGCCCTGGGCGGCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGGCCGCTTCCCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGCGGGCGGGTGAGTCACCCACACAAAGGAAAAGGGCCTTTCCGTCCTCAGCCGTCGCTTCATGTGACTCCACGGAGTACCGGGCGCCGTCCAGGCACCTCGATTAGTTCTCGAGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGCGATGGAGTTTCCCCACACTGAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGGCACTTGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTCATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGAAGCTTGGTACCGCCACCATGGGCTCCAATTTACTGACCGTACACCAAAATTTGCCTGCATTACCGGTCGATGCAACGAGTGATGAGGTTCGCAAGAACCTGATGGACATGTTCAGGGATCGCCAGGCGTTTTCTGAGCATACCTGGAAAATGCTTCTGTCCGTTTGCCGGTCGTGGGCGGCATGGTGCAAGTTGAATAACCGGAAATGGTTTCCCGCAGAACCTGAAGATGTTCGCGATTATCTTCTATATCTTCAGGCGCGCGGTCTGGCAGTAAAAACTATCCAGCAACATTTGGGCCAGCTAAACATGCTTCATCGTCGGTCCGGGCTGCCACGACCAAGTGACAGCAATGCTGTTTCACTGGTTATGCGGCGGATCCGAAAAGAAAACGTTGATGCCGGTGAACGTGCAAAACAGGCTCTAGCGTTCGAACGCACTGATTTCGACCAGGTTCGTTCACTCATGGAAAATAGCGATCGCTGCCAGGATATACGTAATCTGGCATTTCTGGGGATTGCTTATAACACCCTGTTACGTATAGCCGAAATTGCCAGGATCAGGGTTAAAGATATCTCACGTACTGACGGTGGGAGAATGTTAATCCATATTGGCAGAACGAAAACGCTGGTTAGCACCGCAGGTGTAGAGAAGGCACTTAGCCTGGGGGTAACTAAACTGGTCGAGCGATGGATTTCCGTCTCTGGTGTAGCTGATGATCCGAATAACTACCTGTTTTGCCGGGTCAGAAAAAATGGTGTTGCCGCGCCATCTGCCACCAGCCAGCTATCAACTCGCGCCCTGGAAGGGATTTTTGAAGCAACTCATCGATTGATTTACGGCGCTAAGGATGACTCTGGTCAGAGATACCTGGCCTGGTCTGGACACAGTGCCCGTGTCGGAGCCGCGCGAGATATGGCCCGCGCTGGAGTTTCAATACCGGAGATCATGCAAGCTGGTGGCTGGACCAATGTAAATATTGTCATGAACTATATCCGTAACCTGGATAGTGAAACAGGGGCAATGGTGCGCCTGCTGGAAGATGGCGATCTCGAGCCATCTGCTGGAGACATGAGAGCTGCCAACCTTTGGCCAAGCCCGCTCATGATCAAACGCTCTAAGAAGAACAGCCTGGCCTTGTCCCTGACGGCCGACCAGATGGTCAGTGCCTTGTTGGATGCTGAGCCCCCCATACTCTATTCCGAGTATGATCCTACCAGACCCTTCAGTGAAGCTTCGATGATGGGCTTACTGACCAACCTGGCAGACAGGGAGCTGGTTCACATGATCAACTGGGCGAAGAGGGTGCCAGGCTTTGTGGATTTGACCCTCCATGATCAGGTCCACCTTCTAGAATGTGCCTGGCTAGAGATCCTGATGATTGGTCTCGTCTGGCGCTCCATGGAGCACCCAGTGAAGCTACTGTTTGCTCCTAACTTGCTCTTGGACAGGAACCAGGGAAAATGTGTAGAGGGCATGGTGGAGATCTTCGACATGCTGCTGGCTACATCATCTCGGTTCCGCATGATGAATCTGCAGGGAGAGGAGTTTGTGTGCCTCAAATCTATTATTTTGCTTAATTCTGGAGTGTACACATTTCTGTCCAGCACCCTGAAGTCTCTGGAAGAGAAGGACCATATCCACCGAGTCCTGGACAAGATCACAGACACTTTGATCCACCTGATGGCCAAGGCAGGCCTGACCCTGCAGCAGCAGCACCAGCGGCTGGCCCAGCTCCTCCTCATCCTCTCCCACATCAGGCACATGAGTAACAAAGGCATGGAGCATCTGTACAGCATGAAGTGCAAGAACGTGGTGCCCCTCTATGACCTGCTGCTGGAGGCGGCGGACGCCCACCGCCTACATGCGCCCACTAGCCGTGGAGGGGCATCCGTGGAGGAGACGGACCAAAGCCACTTGGCCACTGCGGGCTCTACTTCATCGCATTCCTTGCAAAAGTATTACATCACGGGGGAGGCAGAGGGTTTCCCTGCCACAGCTTGATGAGCCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATATGGCCACAACCCACAAGGAGACGACCTTCCATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAAACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTACTTAAGAGGGGGAGACCAAAGGGCGAGACGTTAAGGCCTCACGTGACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCTAAAAGTGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCTTGGCTATTGTAGCCAAAAATCTCATCAAAAGCCCAGAATGGATCTGAACAACAGAAAATTCCATGAGATGATCTGACTGTATGACCAGAGCCATTGTGGACACAGCACAGTACATTGCTGATTTCTTTTCAACTCTGAGGTATCAGGATTGCTAATGTCCATCATTTATGGGGTATCTACCATTAGATGTACAAAGGACTGACCCTGTTCCACTTATCATATATGACCAATTTATGTCTAGAGAATGAAAGTCAGAAAAAAATTAAACAATACATAAACACAAACCCAACCACAAAACTTGTGATCTACAGACTGTTCTCAATGCAAAATATGCTAGGGCAATGGGGGCACAAATCTTAGAGAAATAATTAAACAACATTTGATTTGACTTAAATCTCATTCCATGACATGGAACTCATGAACACTGTTTGGCAGACCAAGATCTAGAGACTAAATAGACCAATGACCTATGATAAACCAAATACTACTGGCTTAAAACAAAAGTATCACTAACATGACTCCTGATGATATTCTGCTATCTCATAGATTGTGCTTTATTTAGCCATCATCAGGTAGGCTTCCTCATACATCACGGTTAGGGTTAGGCTTAGGGGTTAGGGTTAGCATTAGAGTTAGGTCCCAGAAATATTTGGAGATCTGCAGTCTTTTAAAATATCTTTCATGACAAAAAGGAGCAATCTCTGCCCCAAAGGGAAGGTTTGACTTTCCTGTTGCATGAGTTAACTGGAATATTTGCATCATAAATTTAGTTTGAAACTGTAATATATCTTGTAACATATAAAAATTTCAAGACTACATATGATGGCTTAAAGGCTGGCACTATGGCTTAGCCAGTAAAAGTACTTGGCACAAATTGTGATGACCTGAATTTGATCCCAGAACTTACATCTGACTATTTAACTTGCCTTCTGACAATGTTTCTCCCCCCTCTCTCTGCCATTATGTAACTCTCTCCATCTCTCAATAAATAACATTATTTTAAAATTATTTTTATTTTTAAACTTGAAGTTTAAGAATGAATAACATAATTAAGTCAAACAATGATCCTCAAATGGATAAGATCAA

Claims (19)

1. A method of integrating a gene fragment of interest comprising the steps of:

1) Obtaining a gene fragment of interest, said gene fragment of interest having a length exceeding 100kb, wherein said gene fragment of interest in step 1) is obtained from a BAC vector;

2) Cloning a target gene fragment into a circular YAC vector, inserting a truncated neomycin (G418) resistance expression cassette 1 into the obtained vector comprising the target gene fragment, the expression cassette 1 comprising a mutant Loxp1, i.e. Loxp66 sequence, a part of HPRT intron and a part of the resistance gene a, i.e. the 3' end part of the neomycin resistance gene Neo gene in the 5' to 3' direction;

3) Transforming a vector containing said gene fragment of interest into a yeast cell;

4) Introducing the vector comprising the gene fragment of interest within the yeast into a recipient cell, wherein the recipient cell is a eukaryotic cell, wherein a truncated neomycin (G418) resistance expression cassette 2 has been site-directed into the genome of the recipient cell, said expression cassette 2 comprising in the 5' to 3' direction a partial HPRT intron, a mutant Loxp 2, i.e. Loxp71 sequence, a resistance gene b portion, i.e. the 5' end portion of the Neo gene, a fusion protein CreERT2 comprising a ligand binding domain mutant (ERT 2) of an estrogen receptor (estrogen receptor, ER) and a Cre recombinase, and an IRES-PuroR structure;

5) Inducing the activity of a recombinase of CreERT2 by adding Tamoxifen, wherein the Cre recombinase mediates the site-directed integration of the target gene fragment into the genome of the receptor cell, and simultaneously the expression cassette 1 and the expression cassette 2 form a resistance expression cassette for expressing the complete resistance gene neomycin;

6) Screening said recipient cells in which said gene fragment of interest has been site-directed integrated in the genome,

wherein the mutant Loxp 1 in the resistance expression cassette 1 truncated neomycin (G418) resistance expression cassette 1 in said step 2) and/or the mutant Loxp 2 in the resistance expression cassette 2 truncated neomycin (G418) resistance expression cassette 2 in said step 4) is used for site-directed introduction of said expression cassettes into the genome of said recipient cell,

wherein the 3 'end portion of the neomycin resistance gene Neo of the resistance gene part a contained in said resistance expression cassette 1 in step 2) and the 5' end portion of the Neo gene of the resistance gene part b in said resistance expression cassette 2 in step 4) are functionally complementary,

wherein the HPRT intron contained in the truncated neomycin (G418) resistant expression cassette 1 of the resistant expression cassette 1 in the step 2), the 3 '-end portion of the Neo gene of the a part of the resistant gene, and the truncated neomycin (G418) resistant expression cassette 2 of the resistant expression cassette 2 in the step 4), the 5' -end portion of the Neo gene of the b part of the resistant gene, and the neomycin (G418) resistant expression cassette of Neo expressing the complete resistant gene formed in the step 5) are used for screening cell recombinants after site-directed integration of the gene fragment of interest.

2. The method according to claim 1, wherein the 5 '-end portion of the Neo gene and the 3' -end portion of Neo are truncated at position 92,

and said step 6) selecting said recipient cells having said gene fragment of interest site-directed in their genome by adding a reagent antibiotic G418 specific for said resistance gene.

3. The method according to claim 2, wherein amino acid 92 of neomycin is encoded by the last nucleotide of the 5 'end portion of the Neo gene together with the starting nucleotide of the 3' end portion of the Neo gene.

4. The method according to claim 2, wherein the 92 th amino acid of neomycin is encoded by the end 2 nucleotides of the 5 'end portion of the Neo gene together with the first nucleotide at the beginning of the 3' end portion of the Neo gene.

5. The method according to any one of the preceding claims, wherein in the vector comprising the gene fragment of interest obtained in step 1), an FRT sequence is present upstream of the gene fragment of interest, while in the expression cassette in step 4) an FRT sequence is present downstream of the IRES-PuroR structure,

and further comprising step 7) after said step 6): transferring a plasmid comprising FLP into said recipient cell to remove said expression cassette.

6. The method according to any one of claims 1 to 4, wherein the gene fragment of interest in step 1) comprises prokaryotic and eukaryotic gene fragments.

7. The method according to claim 1, wherein the circular vector is obtained by homologous recombination splicing techniques, or a combination of homologous recombination splicing techniques and genome editing techniques.

8. The method according to claim 7, wherein the circular vector is obtained by a yeast transformation coupled recombination (TAR) technique or a combination of a yeast transformation coupled recombination (TAR) technique and a genome editing technique.

9. The method according to claim 7 or 8, wherein the homologous recombination splicing technique is selected from one or more of the following: sequence dependent in vitro assembly techniques, yeast transformation coupled recombination (TAR) techniques and bacterial Red/ET homologous recombination techniques.

10. The method according to any one of claims 1 to 4, wherein the gene fragment of interest in step 1) is obtained from a chromosome or from another vector.

11. The method according to claim 1, wherein the gene fragment of interest in step 1) is obtained by cleaving the chromosome or vector using a genome editing technique.

12. The method according to claim 1, wherein in said step 4) said expression cassette and its downstream large fragment DNA are site-directed and stably introduced into the genome of said recipient cell by means of genome editing techniques.

13. The method according to any one of claims 7, 8, 11 and 12, wherein the genome editing technique is selected from one or more of the following: zinc finger nuclease technology (zinc finger nucleases, ZFNs), transcription activator-like effector nuclease technology (transcription activator-like effector nucleases, TALENs) and clustered regularly interspaced short palindromic repeats (Clustered Regularly Interspaced Short Palindromic Repeat, CRISPR) technology.

14. The method of claim 13, wherein the CRISPR technique comprises CRISPR/Cas9 and CRISPR-Cpf1.

15. The method according to any one of claims 1 to 4, wherein the yeast is Saccharomyces cerevisiae.

16. The method according to any one of claims 1 to 4, wherein in said step 4) the vector comprising the gene fragment of interest within the microorganism is introduced into a recipient cell using yeast spheroplast fusion (yeast protoplast fusion) technique.

17. The method according to any one of claims 1 to 4, wherein the recipient cells in step 4) are animal embryonic stem cells.

18. The method according to any one of claims 1 to 4, wherein the length of the gene fragment of interest exceeds 300kb.

19. The method according to any of the preceding claims 1-4, wherein the gene fragment of interest is more than 400kb in length.

Images