CN101684476B - Transgenosis construct and application thereof in preparing space-time adjustable liver damage model - Google Patents
Transgenosis construct and application thereof in preparing space-time adjustable liver damage model Download PDFInfo
- Publication number
- CN101684476B CN101684476B CN2008102002078A CN200810200207A CN101684476B CN 101684476 B CN101684476 B CN 101684476B CN 2008102002078 A CN2008102002078 A CN 2008102002078A CN 200810200207 A CN200810200207 A CN 200810200207A CN 101684476 B CN101684476 B CN 101684476B
- Authority
- CN
- China
- Prior art keywords
- construction
- gene
- sequence
- tbid
- bax
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a transgenosis construct and an application thereof in preparing a space-time adjustable liver damage model and discloses a construct combination used for preparing the space-time adjustable liver damage model. The construct combination comprises a construct expressing space-time adjustable liver damage induction induced gene and a construct expressing Cre recombinant enzyme. The invention also discloses cells containing the construct and a method for preparing the space-time adjustable liver damage model. The obtained animal model can efficiently induce the liver damage at any time, and provides an effective way for the research of hepatic cell transplantation and liver replantation.
Description
Technical field
The invention belongs to biological technical field, be specifically related to the application in transgenosis construct and the empty in the preparation adjustable liver damage model thereof.
Background technology
The liver organ transplantation be present clinical treatment acute hepatic failure, whole latter stage hepatopathy and the main means of metabolic hepatopathy.Yet because the shortage of donor livers, the clinical application of liver organ transplantation has received serious restriction.The U.S. has 14000 people to wait for liver transplantation every year approximately, wherein 50% waits for above 1 year, and annual about 1300 people are owing to wait dead less than liver transplantation.China requires the wait list of row organ transplantation also to be on the increase.Therefore, the urgent clinical needs additive method improves liver function, and the survival time that prolongs the patient is waited for liver transplantation, or replaces liver transplantation.
Liver cell has stronger multiplication capacity.Bumgardner in 1988 etc. have taken the lead in proposing the notion of hepatocyte transplantation, carry out first routine human hepatocyte's implantation technique in the world by Mito etc. in 1993, and what carry out at that time was from body homology hepatocyte transplantation.The hepatocyte transplantation technology develops rapidly subsequently, and becomes one of hot fields of biomedical research.Preclinical phase test through laboratory animal shows; Hepatocyte transplantation is behind liver, spleen and some other position; Still can keep its normal light microscopic and Electronic Speculum structure; And can express multiple hepatocyte function, like serum albumin secretion, glycogen storage and glycolysis, UCB combination, ammonia metabolism and cytochrome P 450 enzymes genetic expression etc.Be expected to disease through hepatocyte transplantation treatment and comprise that the disease of liver itself and liver are diseases related, like acute and chronic liver failure, chronic viral hepatitis and liver cirrhosis etc.
The first hepatocyte transplantation of China was succeedd in 2004.At present hepatocyte transplantation has accumulated abundant clinical experience, and can partly or entirely replace liver transplantation and be applied to clinical.But the core of hepatocyte transplantation research remains the hepatocellular source problem that comes.Clinical study shows that from the most suitable clinical transplantation of liver cell of body maturation, but this itself is exactly a contradiction, and for this reason, people are eager to seek other source.
As if the ES cell become the effective means that address this problem to hepatocellular directed differentiation to hepatocellular directed differentiation behind the reprogramming of somatic cells.Yet whether " liver cell " function that directed differentiation produces is normal, and the liver injury model that needs detects, and this model preferably space-time is adjustable, can be momentarily and induce the formation liver injury efficiently.
Summary of the invention
The object of the present invention is to provide a kind of transgenosis construct that can be used for preparing space-time adjustable liver damage model.
Another object of the present invention is to provide a kind of space-time adjustable liver damage model and preparation method thereof.
In first aspect of the present invention, a kind of construction combination that is used to prepare space-time adjustable liver damage model is provided, it comprises:
(1) construction 1, and from 5 ' to 3 ' comprises the element that following operability links to each other successively:
Promotor, LoxP sequence, reporter gene sequence, terminator 1, LoxP sequence, tBid gene order, Bax gene order, terminator 2; With
(2) construction 2, and from 5 ' to 3 ' comprises the element that following operability links to each other successively:
Promotor, mutant estrogen receptor ligands binding domains gene order, Cre recombinase gene sequence, and terminator; Wherein said mutant estrogen receptor ligands binding domains can be activated and then activation Cre recombinase active by estrogen like compound, is not activated by the animal body inner estrogen.
In another preference, described estrogen like compound is selected from: Tamoxifen (Tamoxifen), or 4-hydroxyl Tamoxifen (4-OH Tamoxifen, 4-OHT).
In another preference, described mutant estrogen receptor ligands binding domains derives from the mouse ERs; Preferably mouse ERs aminoacid sequence is (referring to the GenBank accession number: NM_007956) 281-599 position, and wherein the 525th glycocoll (G) sports l-arginine (R).
In another preference, described mutant estrogen receptor ligands binding domains derives from human estrogen acceptor; Preferably people's ERs aminoacid sequence is (referring to the GenBank accession number: NM_000125) 282-594 position; And wherein the 400th glycocoll (G) sports that Xie Ansuan (V), the 543rd methionine(Met) (M) sport L-Ala (A), the 544th leucine (L) becomes L-Ala (A).
In another preference, in the construction 1, described reporter gene is a beta-galactosidase gene.
In another preference, described reporter gene 3 ' end also is connected with the resistant gene sequence; Preferable, described resistant gene is Xin Meisu (Neomycin, Neo) resistant gene.
In another preference, in the construction 1, described promotor is CAG (cytomegalovirus enhanser, a chicken β Actin muscle and rabbit beta Globulin combined launch) promotor; Or in the construction 2, described promotor is BSA (Alb) promotor.
In another preference, in the construction 1, described terminator 1 is 3 * poly A (3 PA is in series), or described terminator 2 is rabbit beta Globulin poly A.
In another preference, in the construction 2, described terminator is SV40 poly A.
In another preference, in the construction 2, between described Cre recombinase gene and terminator, also contain a mutant estrogen receptor ligands binding domains gene order.
In another preference, in the construction 1, between described tBid gene and the Bax gene, also contain internal ribosome and insert site (IRES) sequence.
In second aspect of the present invention, a kind of cell (non-sexual cell) is provided, be integrated with described construction 1 and construction 2 in the genome of described cell.
In another preference, described cell is a liver cell.
In another preference, under the normal circumstances, described cell expressing reporter gene encoded protein; After handling with estrogen like compound, described cell expressing tBid albumen and Bax albumen.
In the third aspect of the invention, a kind of method for preparing transgenic nonhuman mammal zygote is provided, described zygote being used to prepares space-time adjustable liver damage model, and said method comprises:
With the zygote that described construction 1 is introduced non-human mammal, obtain to have changed over to the zygote of said construction 1; Or
With the zygote that described construction 2 is introduced non-human mammal, obtain to have changed over to the zygote of said construction 2.
In another preference, described non-human mammal is a mouse.
In fourth aspect of the present invention, a kind of method for preparing space-time adjustable liver damage model is provided, said method comprises:
The zygote of (1) described construction 1 being introduced non-human mammal; The zygote that has changed said construction over to is moved in the uterine tube of false pregnancy non-human mammal; Make it to continue to grow, generate the non-human mammal that is integrated with described construction 1 in the genome;
The zygote of (2) described construction 2 being introduced non-human mammal; The zygote that has changed said construction over to is moved in the uterine tube of false pregnancy non-human mammal; Make it to continue to grow, generate the non-human mammal that is integrated with described construction 2 in the genome; With
The non-human mammal that (1) and (2) is obtained carries out mating, obtains to be integrated with in the genome non-human mammal of described construction 1 and construction 2.
Others of the present invention are because the disclosure of this paper is conspicuous to those skilled in the art.
Description of drawings
Fig. 1. utilize facs analysis Caspase8, Bax, the ability of tBid gene or their combination inducing hepatocyte apoptosis.
Fig. 2. make up the structural representation of the transgenic plasmid pCALL2-tIB that obtains.
Fig. 3. the plasmid that will carry Bax-IRES-tBid (tIB), Bax-IRES-tBid (BIt), tBid-IRES-EGFP (tIE), Bax-IRES-EGFP (BIE), IRES-EGFP (IE) or negative control is gone among the LEPC with the pAlbCreSVPA corotation respectively, floats on the apoptosis situation of cell detection cell dead in the nutrient solution through observation.
Fig. 4 .PCR identifies that male F1 is for mouse.
They come from 7 the head person of building mouse, M39:141-149 respectively; M40:151; F41:159-162; F42:163-168,248-250; F43:230-235; F44:237-245; F46:179-183.M is molecular weight marker D2000 (a day root company), the negative contrast of NC.
Fig. 5 .9 mouse species liver organization RT-PCR result.
Wt is the wild-type negative control; Rosa26 is the positive control of Rosa26-β gal mouse.29,149,161,168,183,234,238 is respectively the F1 generation of 7 the head person of building mouse.No. 161 of the head person of building F41 and No. 168 offsprings of the first person of building F42 demonstrate genetically modified expression.GAPDH is confidential reference items, positive control.
Fig. 6. No. 250 transgenics of the offspring of the head person of building F42 are the expression in liver, kidney and small intestine respectively.Visible transgenic β geo has expression through X-gal dyeing.
Fig. 7 .pAlbMerCreMerSVPA and pCAG-loxP-mRFP-loxP-EGFP corotation are gone among the Hepal-6, induce with 4-OHT after 24 hours.Green fluorescence is expressed, and explains that MerCreMer has brought into play activity, and the plasmid loxP intermediary mRFP that corotation is gone into cuts away, and the EGFP in downstream is expressed.
Fig. 8 .pAlbCreERSVPA and pCAG-loxP-mRFP-loxP-EGFP corotation are gone among the Hepal-6, induce with 4-OHT after 24 hours.Green fluorescence is expressed, and explains that CreER has brought into play activity, and the plasmid loxP intermediary mRFP that corotation is gone into cuts away, and the EGFP in downstream is expressed.
Fig. 9 .PCR identifies that male F0 is for mouse.
In the mouse that 61 are come through the procaryotic injection growth, through the primer amplification to Alb promotor and Cre enzyme, having identified 6 mouse genome conformities has the target practice sequence, is respectively 2,3,6,8,31,37.
Embodiment
The inventor has found the gene that is particularly suitable for the efficient induction hepatocellular apoptosis through extensive studies, has made up the construction of alternative expression apoptogene, thereby has set up a kind of hepar damnification non-human animal model of space-time adjustable.Described non-human animal model is not having not express apoptogene under the inductive situation, and under the inductive situation, can express apoptogene unusually efficiently, thereby can induce efficiently, in real time liver injury (like liver failure) takes place.
TBid gene and Bax gene
Bid albumen is BH3interacting domain death agonist, is one of member in the Bcl-2 family, contains a BH3 structural domain, and its molecular mass (Mr) is 22000Da.
TBid albumen is the Bid albumen of brachymemma, is that Bid albumen cuts that its N holds about 60 amino acid and the Bid protein fragments that forms.TBid is the relevant albumen of a kind of apoptosis, for example can induce some cell generation apoptosis such as Hela cell.
The present invention can use full-length proteins or its bioactive fragment of tBid.The proteic bioactive fragment of any tBid can be applied among the present invention.Here, the implication of the proteic bioactive fragment of tBid is meant as a kind of protein fragments, the proteic all or part of function of its tBid that still can be kept perfectly (activity as at least 80%, better at least 90% activity).The aminoacid sequence of the tBid that passes through replacement, disappearance or the interpolation of one or more amino-acid residues and form is also included among the present invention.Replacement, disappearance or the interpolation of the one or more amino-acid residues of described process and the tBid albumen that forms also has the collaborative function that promotes hepatocellular apoptosis with Bax.The present invention also can adopt through the tBid albumen of modifying or improveing, such as, can adopt in order to prolong its transformation period, to improve its stability and the tBid albumen of improvement.
The not special restriction in the source of tBid can be people, mouse, rat, pig or other mammiferous tBid.As a kind of optimal way of the present invention, the aminoacid sequence of described tBid can be that the sequence 319-729 position shown in the NM_007544 is substantially the same with the GenBank accession number.Preferably, can adopt the tBid albumen of reorganization.After obtaining proteic sequence, those skilled in the art are easy to learn the proteic dna sequence dna of the said tBid of coding.
The Bax gene extensively is present in mammiferous multiple tissue and the cell, belongs to the member of Bcl-2 family, and it participates in the apoptosis-promoting effect of some tumour cells.
The present invention can use full-length proteins or its bioactive fragment of Bax.The proteic bioactive fragment of any Bax can be applied among the present invention.Here, the implication of the proteic bioactive fragment of Bax is meant as a kind of protein fragments, the proteic all or part of function of its Bax that still can be kept perfectly (activity as at least 80%, better at least 90% activity).The aminoacid sequence of the Bax that passes through replacement, disappearance or the interpolation of one or more amino-acid residues and form is also included among the present invention.Replacement, disappearance or the interpolation of the one or more amino-acid residues of described process and the Bax albumen that forms also has the collaborative function that promotes hepatocellular apoptosis with tBid.The present invention also can adopt through the Bax albumen of modifying or improveing, such as, can adopt in order to prolong its transformation period, to improve its stability and the Bax albumen of improvement.
The not special restriction in the source of Bax can be people, mouse, rat, pig or other mammiferous Bax.As a kind of optimal way of the present invention, the aminoacid sequence of described Bax can be that the sequence 124-702 position shown in the NM_007527 is substantially the same with the GenBank accession number.Preferably, can adopt the Bax albumen of reorganization.After obtaining proteic sequence, those skilled in the art are easy to learn the proteic dna sequence dna of the said Bax of coding.
Transgenosis construct
A good animal liver damage model must possess the characteristic of following 4 aspects: the space-time inducibility, simple to operate, liver injury induces efficient high, easy storing and expansion.In order to satisfy these requirements, finally obtain suitable transgenosis construct, the inventor has made up a pair of construction.Described construction 1 from 5 ' to 3 ' comprises the element that following operability links to each other successively: promotor, LoxP sequence, reporter gene, terminator 1, LoxP sequence, tBid gene, Bax gene, terminator 2; Described construction 2 comprises the element that following operability links to each other: promotor, mutant estrogen receptor ligands binding domains gene order, Cre recombinase gene sequence, and terminator; Wherein said mutant estrogen receptor ligands binding domains can be activated and then activation Cre recombinase active by estrogen like compound, and is not activated by the animal body inner estrogen.
When two kinds of constructions are in the cell system simultaneously, under specific inductive condition, can activate the Cre recombinase, recombinate thereby further induce between the LoxP site, make tBid and Bax genetic expression, inducing cell generation apoptosis.
The realization of space-time adjustable is based on the Cre/loxP system.The inventor has used a kind of double-tagging to express framework, and the two ends of this framework respectively comprise a LoxP sequence in the same way, are reporter gene and/or the resistance screening marker gene that can independently express between two LoxP sites.After having the Cre recombinase in the system, the Cre recombinase can be discerned the LoxP site and site-specific reorganization takes place, with the excision of the sequence between two LoxP sites, thus downstream tBid gene and Bax genetic expression.
And the activity of Cre recombinase is to regulate and control through the ligand binding domains of mutant ERs in the cell.After the ligand binding domains and Cre fusion with the mutant ERs, the activity of Cre receives the adjusting of the ligand binding domains of mutant ERs.Because this structural domain is transformed through sudden change; It does not respond inducing of mouse self hormone; And it is comparatively responsive to Tamoxifen materials such as (Tamoxifen) (referring to Logie and Stewart; 1995, Ligand-regulated site-speific recombination.Proc.Natl.Acad.Sci.USA.92:5940-5944).Like this, the ligand binding domains of mutant ERs and Cre fusion rotein just receive the adjusting of Tamoxifen etc.
But the ligand binding domains of induced mutation type ERs and then the active estrogen like compound of adjusting Cre comprise: 4-OHT, Tamoxifen.
The ligand binding domains of described mutant ERs can be derive from multiple mammiferous.As a kind of optimal way, described mutant estrogen receptor ligands binding domains derives from the mouse ERs; Preferably mouse ERs aminoacid sequence is (referring to the GenBank accession number: NM_007956) 281-599 position, and wherein the 525th glycocoll (G) sports l-arginine (R).
As another kind of optimal way, described mutant estrogen receptor ligands binding domains derives from human estrogen acceptor; Preferably people's ERs aminoacid sequence is (referring to the GenBank accession number: NM_000125) 282-594 position; And wherein the 400th glycocoll (G) sports that Xie Ansuan (V), the 543rd methionine(Met) (M) sport L-Ala (A), the 544th leucine (Leu) becomes L-Ala (A).
Can be used for the not special restriction of promotor of the present invention, representational example comprises (but being not limited to): MMTV LTR promotor, CMV promotor, salivin gene promoter etc.As optimal way of the present invention; Adopt CAG (cytomegalovirus enhanser; Chicken β Actin muscle and rabbit beta Globulin combined launch) promotor is as the promotor of construction 1; This promotor is a kind of strong promoter of general expression, can drive its downstream gene wide expression, and empirical tests has the effect of good regulate gene expression.As optimal way of the present invention, use the Alb promotor to instruct the expression of the ligand binding domains and the Cre fusion gene of mutant ERs, help like this making that this fusion gene is specific expressed in liver.When said fusion gene is expressed, the performance of Cre recombinase is active, thereby the expression of apoptosis-induced gene tBid and Bax causes tissue injury.
As optimal way of the present invention, when amalgamation and expression, hold at the 5 ' end and 3 ' of Cre recombinase gene to be connected with the ligand binding domains gene of a mutant ERs respectively, promptly constitute the structure of MER-Cre-MER.Find relatively that through the inventor's experiment the fusion gene of MER-Cre-MER type has following characteristics: in that not have under the inductive situation activity close tighter, induce efficient higher having under the inductive situation.
Can be used for the not special restriction of terminator of the present invention, but any suitable terminator with terminator expressive function all is available.As a kind of mode of the present invention, in the construction 1, described terminator 1 is 3 * poly A, and described terminator 2 is rabbit beta Globulin poly A; In the construction 2, described terminator is SV40 poly A.
Be that operability links to each other between each element of the present invention; Described " operability links to each other " or " operationally being connected in " refer to a kind of like this situation, and promptly the activity of same other part of linear DNA sequence can regulated or control to some part of linear DNA sequence.For example, if the transcribing of promotor control sequence, it is exactly operationally to be connected in encoding sequence so.
Can have the proper spacing sequence between described each element, for example have 0-1000bp, the intervening sequence of preferable 0-500bp.
As used herein, described " containing ", " having " or " comprising " comprised " comprising ", " mainly by ... constitute ", " basically by ... constitute " and " by ... constitute "; " mainly by ... constitute ", " basically by ... constitute " belong to the subordinate concept of " containing ", " having " or " comprising " with " by ... formation ".
The preparation of animal model
After having obtained described transgenosis construct, available ordinary method changes linearizing construction in the zygote over to.Treat the filial generation animal birth available several different methods known in the art in back (including but not limited to methods such as PCR detection, Southern blotting) identifies whether transgenosis construct is integrated into its genome, thereby obtain genetically modified animal.
Therefore; The present invention also provides a kind of method for preparing space-time adjustable liver damage model; Said method comprises: the zygote that non-human mammal is introduced with the described construction 1 of claim 1 in (1); The zygote that has changed said construction over to is moved in the uterine tube of false pregnancy non-human mammal, make it to continue to grow, generate the non-human mammal that is integrated with the described construction 1 of claim 1 in the genome; The zygote of (2) the described construction 2 of claim 1 being introduced non-human mammal; The zygote that has changed said construction over to is moved in the uterine tube of false pregnancy non-human mammal; Make it to continue to grow, generate the non-human mammal that is integrated with the described construction 2 of claim 1 in the genome; The non-human mammal that (1) and (2) is obtained carries out mating, obtains to be integrated with in the genome non-human mammal of described construction 1 of claim 1 and construction 2.
In order to obtain the offspring of inheritance stability; As optimal way of the present invention; Described method also comprises: (4) obtain to be integrated with in the genome offspring's non-human mammal of described construction with (3) transgenic nonhuman mammal that obtains and the non-human mammal mating that (3) obtain.
Non-human mammal of the present invention can be mouse, sheep, ox, pig, rabbit etc.Mouse preferably comprises the mouse of mouse, rat or other type.
The main application of space-time adjustable liver damage model of the present invention includes but not limited to: the Prevention Research of liver injury, the effect analysis of hepatocyte transplantation, the effect analysis that liver is grown again etc.
A kind of method of utilizing space-time adjustable liver damage model of the present invention to analyze hepatocyte transplantation effect to be measured is: (1) gives estrogen like compound (like Tamoxifen or 4-OHT) to be integrated with in the genome of aforementioned acquisition the non-human mammal of described construction 1 of claim 1 and construction 2; Activate the Cre recombinase; The Cre recombinase is further induced between the LoxP site of construction 1 and is recombinated; Make the sequence between the loxP be cut off; Cause tBid and Bax genetic expression, inducing cell generation apoptosis, thus form the animal liver damage model; (2) with the liver of hepatocyte transplantation to be measured, observe the situation of transplanting the back liver, thereby learn hepatocyte transplantation effect to be measured to animal.
Analyzing hepatocyte transplantation effect to be measured or liver, to grow the method for effect again be technology known in the art, for example can be through immunohistochemical method.
Major advantage of the present invention is:
(1) inventor has found the assortment of genes that is particularly suitable for the inducing hepatocyte apoptosis, and it can bring into play inducing hepatocyte apoptotic effect efficiently.
(2) inventor has made up the space-time controllability construction of alternative expression apoptogene, thereby has set up the hepar damnification non-human animal model of space-time adjustable.Said animal model can be induced liver injury momentarily, efficiently, and the research of growing again for hepatocyte transplantation, liver provides valid approach.Therefore, the inventor has set up a kind of new method and has come induced tissue damage.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in the restriction scope of the present invention.The experimental technique of unreceipted actual conditions in the following example; Usually according to people such as normal condition such as Sambrook; Molecular cloning: lab guide (New York:Cold Spring Harbor Laboratory Press; 1989) condition described in, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.
I. material
1. plasmid and bacterial strain
Transgene carrier pCALL2 is available from Canadian Samuel Lunenfeld institute;
PIRES2-EGFP plasmid and pEGFP-N2 are available from Clontech company;
The pMD18T-simple plasmid is available from Takara company;
The pET28a plasmid is available from Novagen;
PcDNA3 and pcDNA3.1/Hygro (-) are available from Invitrogen company.
2. toolenzyme and reagent
Restriction enzyme, T4DNA ligase enzyme are available from NEB company;
DNTP, Hifi Taq Platinum, Trizol, RT-PCR kit are available from Invitrogen;
Taq archaeal dna polymerase, Proteinase K, X-gal are available from sky root company;
The in a small amount quick extraction agent box of DNA is available from vast Imtech;
Glue reclaims test kit available from JaRa company;
QIAprep Maxprep Kit is available from Qiagen company.
Annexin V-FITC Apoptosis Detection Kit I is available from BD Biosciences company.
Transfection reagent Effectene is available from Qiagen company.
II. embodiment
But known have a several genes cell death inducing, at first selects to be suitable for most the gene of inducing hepatocyte apoptosis in the present embodiment.
With the method for conventional FACS, to three gene C aspase8, Bax, tBid inducing hepatocyte apoptosis capacity compares, and confirms optimal gene.With Caspase8, Bax and tBid are cloned into respectively among the carrier pcDNA3.1 (available from Invitrogen).As template, primer sequence is respectively (upstream primer is provided with Eco RI site, and downstream primer is provided with the XhoI site) with mouse liver cDNA:
Caspase8F(SEQ?ID?NO：2)：
CTCT
GAATTCCCATGGATTTCCAGAGTTGTCTTTATGC；
Caspase8R(SEQ?ID?NO：3)：
GCAC
CTCGAGTTAGGGAGGGAAGAAGAGCTTCTT；
Bax?F(SEQ?ID?NO：4)：
GCA
GGAATTCCCATGGACGGGTCCGGGGAG；
Bax?R(SEQ?ID?NO：5)：
GTGG
CTCGAGTCAGCCCATCTTCTTCCAGATGG；
tBid?F(SEQ?ID?NO：6)：
ATAT
GAATTCGCATGGGCAGCCAGGCCAGCC；
tBid?R(SEQ?ID?NO：7)：
GCGC
CTCGAGTCAGTCCATCTCGTTTCTAACCAAG；
To carry Caspase8, the carrier of Bax or tBid is transfected into LEPC cell (mouse adult dual intensity liver stem cells separately; From the Shanghai The 2nd Army Medical College; Can be referring to Li WL etc.; 2006; Isolation andcharacterization of bipotent liver progenitor cells from adult mouse.Stem Cells.24:322-332) in, perhaps will carry the carrier and the carrier that carries tBid of Bax.The FACS detected result is seen Fig. 1, and is visible by the result, and in the transfection, the ability of the short apoptosis of tBid is the strongest separately, and Bax takes second place, Caspase a little less than.And when corotation Bax and tBid, the ability of short apoptosis is the strongest.
It is thus clear that for liver cell, the apoptosis-promoting effect of Bax and tBid co expression is the strongest.
With the method for PCR from mouse liver cDNA, increase tBid and Bax gene, and they are connected in the pMD18T-simple carrier.
Primer sequence is following:
tBid?F(SEQ?ID?NO：8)：
5’-ATATAGATCTACCATGGGCAGCCAGGCCA-3’；
tBid?R(SEQ?ID?NO：7)：
5’-GCGCCTCGAGTCAGTCCATCTCGTTTCTAACCAAG-3’；
Bax?F(SEQ?ID?NO：9)：
5’-ATATAGATCTACCATGGACGGGTCCGGG-3’；
Bax?R(SEQ?ID?NO：5)：
5’-GTGGCTCGAGTCAGCCCATCTTCTTCCAGATGG-3’。
The pcr amplification condition is distinguished as follows:
TBid: at first 94 ℃, 5min; 94 ℃ then, 30s; 56 ℃, 30s; 72 ℃, 30s; 30 circulations; Last 72 ℃, 10min.
Bax: at first 94 ℃, 5min; 94 ℃ then, 30s; 58 ℃, 30s; 72 ℃, 30s; 30 circulations; Last 72 ℃, 10min.
With BglII and NcoI the IRES sequence is scaled off from pIRES2-EGFP, be connected to corresponding site among the pET28a, obtain pET28a-IRES; Follow method with PCR; From liver cDNA, amplifying Bax and tBid also inserts respectively in the pMD18T-simple carrier; Obtain pMD18T-Bax and pMD18T-tBid, after sequencing result is correct, Bax is scaled off from pMD18T-Bax with NcoI and XhoI; Be connected to the corresponding site of pET28a-IRES, obtain pET28a-IRES-Bax; With BglII and XhoI tBid is scaled off from pMD18T-tBid again, be connected between the BglII and SalI of pET28a-IRES-Bax, obtain pET28a-tBid-IRES-Bax, be called for short pET28a-tIB.Next with BglII and XhoI tIB is scaled off, be connected to corresponding site among the pCALL2, obtain plasmid pCALL2-tIB.The PCR product reclaims, dna fragmentation reclaims, plasmid extraction is operated by vast Tyke specification sheets, and enzyme is cut with the operation instructions that is connected by the NEB enzyme and carried out.
After transgenic plasmid pCALL2-tIB made up and accomplishes, it comprised 7 key components altogether: can drive the strong promoter CAG of gene wide expression, the loxP sequence; The encoder block of β geo gene, 3 * polyA (terminator) is with previous loxP loxP sequence in the same way; Gene tIB; Rabbit beta Globulin polyA is total to 9.5kb, and its structure is as shown in Figure 2.Order-checking shows entirely true.The full length sequence of pCALL2-tIB plasmid is shown in SEQ IDNO:1.
Based on aforementioned similar method, the inventor has also made up the pCALL2-BIt plasmid that carries Bax-IRES-tBid (BIt), the series system of Bax and tBid is different from the pCALL2-tIB plasmid in this plasmid.
The inventor also makes up the plasmid that contains IRES-EGFP (IE) simultaneously, and makes up the plasmid that contains Bax-IRES-EGFP (BIE) and tBid-IRES-EGFP (tIE) respectively based on independent apoptogene.Concrete construction process is following:
For pCALL2-BIt, with NcoI and XhoI tBid is scaled off from pMD18T-tBid, be connected to the corresponding site of pET28a-IRES, obtain pET28a-IRES-tBid; With Bgl II and Xho I Bax is scaled off from pMD18T-Bax again, be connected between the Bgl II and Sal I of pET28a-IRES-tBid, obtain pET28a-Bax-IRES-tBid, be called for short pET28a-BIt.Next with Bgl II and Xho I BIt is scaled off, be connected to corresponding site among the pCALL2, obtain plasmid pCALL2-BIt.
For pCALL2-tIE; With Bgl II and Xho I tBid is scaled off from pMD18T-tBid, be connected in the pIRES2-EGFP carrier between the Bgl II and Sal I, obtain ptBid-IRES-EGFP; Be called for short ptIE; With Bgl II and Not I tIE is scaled off then, be connected to the corresponding site of pCALL2, promptly obtain pCALL2-tIE.
For pCALL2-BIE; With Bgl II and Xho I Bax is scaled off from pMD18T-Bax, be connected in the pIRES2-EGFP carrier between the Bgl II and Sal I, obtain pBax-IRES-EGFP; Be called for short pBIE; With Bgl II and Not I BIE is scaled off then, be connected to the corresponding site of pCALL2, promptly obtain pCALL2-BIE.
For pCALL2-IE, then directly IRES-EGFP is scaled off from pIRES2-EGFP with Bgl II and Not I, be connected to the corresponding site of pCALL2, obtain pCALL2-IE.
These plasmids are gone among the LEPC with the pAlbCreSVPA corotation respectively, through observing the apoptosis situation that dead cell suspends and detects cell.The result finds that the ability of the short apoptosis of pCALL2-tIB is significantly strong than pCALL2-BIt; The short apoptosis capacity that the ratio of expressing two apoptogenes is simultaneously expressed a gene is strong; The short apoptosis capacity that the ratio of expression apoptogene is not expressed apoptogene is strong, as shown in Figure 3.The complete sequence of pCALL2-tIB plasmid is total to 11323bp shown in SEQ ID NO:1.
Therefore, the inventor has selected the pCALL2-tIB plasmid for use, with its linearizing, is expelled in the mouse fertilized egg, has prepared the tIB transgenic mice, is used for condition induced tissue apoptosis.
With ScaI and SfiI the plasmid pCALL2-tIB of aforementioned structure is cut, reclaim the band of the 9.5kb that comprises above-mentioned 7 elements, remove irrelevant fragment, at last this fragment is diluted to 2-5ng/ μ L, carry out the zygote microinjection by routine.The zygote transplation that to accept DNA then makes it to continue to grow in the female mouse uterine tube of acceptor false pregnancy, and childbirth at last obtains generation mice.
Method through PCR is made genotype identification to the offspring who is born; Take out the about 30 days mouse 0.5-1cm tail point in living back and place the 1.5mL centrifuge tube, add 260 μ L and organize lysate [50 μ L10%SDS, 10 μ L20mg/mL Proteinase Ks; 200 μ L NLB (10mM Tris-HCl, pH8.2; 400mM NaCl; 1mM EDTA, pH8.0)] in 55 ℃ of cracking of spending the night.Add the saturated NaCl of 50 μ L in the sample completely to cracking, put upside down mixing, 8000rpm is in 4 ℃ of centrifugal 15min.Supernatant mixes with 200 μ L Virahols, the centrifugal 15min of room temperature 13200rpm, and deposition is with 70% washing with alcohol once, and is air-dry, and the TE with 100 μ L dissolves at last.
The primer of genotype identification is following:
βgal-F(SEQ?ID?NO：10)：
5’-GTGACGTCTCGTTGCTGCATAAAC-3’；
βgal-F(SEQ?ID?NO：11)：
5’-CACGGCGTTAAAGTTGTTCTGCT-3’；
Bax-F(SEQ?ID?NO：12)：
5’-GAGGTTAAAAAAACGTCTAGGCCC-3’；
Bax-R(SEQ?ID?NO：13)：
5’-TTTGGCAGAGGGAAAAAGATCG-3’；
CD34enh-F(SEQ?ID?NO：14)：
5’-ACGCGTGAGTGGTCTGGATCCAAACTGAGTG-3’；
CD34enh-R(SEQ?ID?NO：15)：
5’-AAGCTTAGCTATAATGCAACCAGAATATAAAGCAT-3’。
The pcr amplification condition is distinguished as follows:
β gal: at first 94 ℃, 2min; 94 ℃ then, 30s; 58 ℃, 30s; 72 ℃, 30s; Carry out 28 circulations; Last 72 ℃, 10min.
Bax: at first 94 ℃, 2min; 94 ℃ then, 30s; 57 ℃, 30s; 72 ℃, 35s; Carry out 28 circulations; Last 72 ℃, 10min.
CD34enhancer: at first 94 ℃, 2min; 94 ℃ then, 30s; 58 ℃, 30s; 72 ℃, 50s; Carry out 28 circulations; Last 72 ℃, 10min.
As a result, obtain 11 transgenic founders (F0 generation) altogether, the positive mouse of integration is arranged on their genome of preliminary evaluation.With these head person of building mouse respectively with the wild-type mice mating, Offspring F1 carries transgenic (Fig. 4).
11 the head person of building mouse are built with the wild-type mice mating respectively and are.Carry genetically modified F1 for mouse on the method identified gene group of continuation through PCR.
Choose wherein 7 the head person of building offsprings; Negative control and the Rosa26-β gal positive control that adds wild-type be totally 9 mouse, gets its liver, liquid nitrogen flash freezer mouse fresh liver; Grind into powder; Use the extraction of Trizol lysing cell RNA immediately, the extraction of RNA, the RT-PCR process is carried out according to the corresponding specification sheets of Invitrogen.Get its tail point simultaneously and be used to take out genomic dna.The amplification of β gal with before identical.
9 mouse species liver organization RT-PCR results are as shown in Figure 5, and RT-PCR result shows that wherein two the head person of building offsprings have genetically modified expression, are respectively No. 161 and No. 168 offsprings of the first person of building F42 of the head person of building F41.
Embodiment 5.X-gal detects and organizes transgene expression
The RT-PCR that learnt from else's experience shows that transgenic has the head person of the building offspring (offspring of F42 No. 250) of expression, and its liver, kidney and small intestine are carried out X-gal dyeing.Place stationary liquid (0.02%NP-40 is in PBS for 1% formaldehyde, 0.2% LUTARALDEHYDE) to fix 4 hours for 4 ℃ in organ; Use the PBS room temperature washing then 2 times, each 20 minutes, follow organ as for (5mM yellow prussiate of potash in the staining fluid; The 5mM Tripotassium iron hexacyanide, 0.01% peroxide Sodium cholic acid, 0.02%NP-40; The 2mM magnesium chloride, 1mg/mL X-gal is in PBS), room temperature dyeing is spent the night.
The X-gal coloration result is seen Fig. 6, can see that these organs all have genetically modified expression, therefore can confirm that this transgenic mice has genetically modified normal expression, and the inventor is called the tIB mouse with this mouse, can be used in subsequent experimental.
The structure of the induced Cre enzyme mouse of embodiment 6. liver specifically expressings
Structure for the induced Cre enzyme mouse of specifically expressing in the liver the inside; With Xho I and Afl II pIRES2-EGFP (Clontech) and pcDNA3.1/Hygro (-) (Invitrogen) are cut; And the fragment that about 1.6kb among the former contains polyA inserted among the latter, obtain pcDNA3.1-SVPA/Hygro (-).Then; With Mlu I and Xho I with the Alb promotor from pGEMAlbSVPA (referring to Goshi Shiota etc.; 1990, Hepatocyte growth factor inhibits growth of hepatocellular carcinoma cells scales off in Proc.Natl.Acad.Sci.USA.92:5940-5944.89:373-377); Insert corresponding site among the pcDNA3.1-SVPA/Hygro (-), obtain pAlb (Old)-SVPA/Hygro (-).For the ATG with Alb promotor back removes; With the method for conventional PCR, the last 0.5kb segment of amplification promotor is after the PCR product is cut with Bam HI and Xho I enzyme; Replace corresponding segment among pAlb (Old)-SVPA/Hygro (-), obtain pAlbSVPA/Hygro (-).Then, with the method for conventional PCR from pANMerCreMer (Zhang etc., 1996; Inducible site-directed recombination in mouse embryonic stemcells.Nucleic Acids Research.24:543-548) sequence amplification with Cre in come out (with Cre F1 and Cre R as primer); Be connected among the pMD-18T simple vector; After order-checking is correct; With XhoI and NotI Cre is connected to corresponding site among the pAlb-SVPA/Hygro (-), obtains pAlbCreSVPA.With Asc I and Sac I CreER is scaled off from pBS-CreLBD (available from model animal center, Chinese Academy of Sciences Shanghai), replace the Cre among the pAlbCreSVPA, obtain pAlbCreERSVPA in identical site.
In addition, the inventor has also made up pAlbMerCreMerSVPA, with the method for PCR Cre is increased from pANMerCreMer (with Cre F2 and Cre R as primer), is connected to pMD-18T simplevector, obtains T-Cre.Next, pANMerCreMer is cut with the SacI enzyme, reclaim the fragment of 4.4kb, then the fragment of this 4.4kb is cut with the partially digested method enzyme of NcoI, reclaim the fragment of about 3kb, and be inserted into the corresponding site of T-Cre, obtain T-MerCreMer.With AscI and SacI MerCreMer is scaled off from T-MerCreMer, replace the Cre among the pAlbCreSVPA, obtain pAlbMerCreMerSVPA at same loci.
Because all contain derivable Cre among pAlbCreERSVPA and the pAlbMerCreMerSVPA, the inventor has compared CreER and MerCreMer, see which is not having under the inductive condition background activity low, and it is higher to stand inductive efficient.
The inventor goes into pAlbCreERSVPA and pAlbMerCreMerSVPA among the SMMC-7721 Hepal-6 (available from biochemical cell institute of Chinese Academy of Sciences cell bank) with the pCAG-loxP-mRFP-loxP-EGFP corotation respectively; After the transfection 24 hours, the 4-OHT with 1 μ M induces respectively.Express from green fluorescence, do not having under the inductive situation, it is tighter that the MerCreMer activity is closed, and after inducing with 4-OHT, MerCreMer induces efficient higher, sees Fig. 7 and Fig. 8.Therefore the inventor has selected the pAlbMerCreMerSVPA plasmid to remove to prepare transgenic mice.
Primer sequence:
Cre?F1(SEQ?ID?NO：16)：
TATACTCGAGGCGCGCCACCATGCCCAAGAAGAAGAGG
Cre?F2(SEQ?ID?NO：17)：
TATACTCGAGGCGCGCCACCATGGCCAAGAAGAAGAGG
Cre?R(SEQ?ID?NO：18)：
ATATGCGGCCGCGAGCTCTAATCGCCATCTTCCAGCAGG
Alb?pro?F(SEQ?ID?NO：19)：
ATATGGATCCATGGGGTTGATTTGGATGTAG
Alb?pro?R(SEQ?ID?NO：20)：
CAGTCTCGAGGGAAAGGTGATCTGTGTGCA
The pcr amplification condition is distinguished as follows:
Cre: at first, 94 ℃, 2min; Then, 94 ℃, 30s; 55 ℃, 30s; 72 ℃, 1min; 20 circulations; At last, 72 ℃, 10min.
The Alb promotor: at first, 94 ℃, 2min, then, and 94 ℃, 30s; 55 ℃, 30s; 72 ℃, 30s; 20 circulations; At last, 72 ℃, 10min.
The construction process of pCAG-loxP-mRFP-loxP-EGFP is following:
With the method for conventional PCR from pDB587 (referring to M.Fischer et al.; 2004; A brilliantmonomeric red fluorescent protein to visualize cytoskeleton dynamics inDictyostelium.FEBS Letters.577:227-232) in mRFP is increased out; The PCR product is cut with ClaI and BclI enzyme, and replaces the Cla I of pCALL2 and the sequence between the Bcl I, obtains pCAG-loxP-mRFP-loxP.With Bam HI and Not I the EGFP sequence among the pEGFP-N2 is scaled off then, and insert among the pCAG-loxP-mRFP-loxP between the Bgl II and Not I, obtain pCAG-loxP-mRFP-loxP-EGFP.
Primer sequence:
mRFP?F(SEQ?ID?NO：21)：
ATCGATACCATGGCCAGCTCCGAG
mRFP?R(SEQ?ID?NO：22)：
TGATCATTAGCTTCCAGCGCCTGTGC
The pcr amplification condition is following:
At first, 94 ℃, 2min; Then, 94 ℃, 30s; 55 ℃, 30s; 72 ℃, 45s; 20 circulations; At last, 72 ℃, 10min.
The inventor cuts pAlbMerCreMerSVPA with Mlu I and Pme I, reclaim and contain the Alb promotor, and the fragment of the 6.1kb of MerCreMer gene and SV40polyA is used for zygote is carried out procaryotic injection.With the intrauterine of the zygote transplation after the injection, to accomplish fetal development to the female mouse of false pregnancy.F0 was born back one month for mouse, took out mouse tail DNA and carried out the genome evaluation, selected to have integrated segmental positive mouse on the genome.
Identify that used primer sequence is following:
Alb?Enh/Pro?GT-F(SEQ?ID?NO：23)：
GCTGATGCAGAGTGAAGAGTGTGTGA；
Alb?Enh/Pro?GT-R(SEQ?ID?NO：24)：
GGCATGGAAGCATGCCACATT；
Cre?GT-F(SEQ?ID?NO：25)：
GAGCATACCTGGAAAATGCTTCTGT；
Cre?GT-R(SEQ?ID?NO：26)：
CCCAGGCTAAGTGCCTTCTCTACA；
CD34enh-F(SEQ?ID?NO：14)：
5’-ACGCGTGAGTGGTCTGGATCCAAACTGAGTG-3’；
CD34enh-R(SEQ?ID?NO：15)：
5’-AAGCTTAGCTATAATGCAACCAGAATATAAAGCAT-3’。
The pcr amplification condition is following:
Alb Enh/Pro, 94 ℃, 2min; 94 ℃, 30s; 59 ℃, 30s; 72 ℃, 30s; 35 circulations; 72 ℃, 10min.Cre, 94 ℃, 2min; 94 ℃, 30s; 58 ℃, 30s; 72 ℃, 30s; 28 circulations; 72 ℃, 10min.
CD34enhancer, 94 ℃, 2min; 94 ℃, 30s; 58 ℃, 30s; 72 ℃, 50s; 28 circulations; 72 ℃, 10min.
Result such as Fig. 9, result obtain 7 positive head altogether and build and be (F0 generation).
Next, it is to hybridize with the C57 wild-type mice respectively that 7 head are built, and has obtained F1 for mouse.F1 for mouse in, be integrated into the male filial generation through taking out mouse tail DNA identified gene group.
Select the male generation mice, through the method for Western blot and RT-PCR, the higher head of selection expression level builds and is; Cultivate the MerCreMer transgenic mice that isozygotys; Be called the MCM mouse, with the tIB mouse of the isozygotying hybridization of aforementioned preparation, to obtain double transgenic mouse MCM/tIB.
The MCM/tIB mouse of 6-8 about week 1mg/ days, injected 5 days through belly injection 4-OHT continuously.Get 5 days hepatic tissues since the 6th day continuously, detect the situation of liver generation apoptosis through TUNEL.Confirm that space-time induces the liver cell apoptosis adjustablely, caused liver injury effectively.
The inventor extracts liver cell from the liver of resulting mouse, contain MerCreMer construction and tIB construction in the hepatocellular genome of this kind, but this cell vitro culture and breeding.
All documents in that the present invention mentions are all quoted as a reference in this application, are just quoted such as a reference separately as each piece document.Should be understood that in addition after having read above-mentioned teachings of the present invention, those skilled in the art can do various changes or modification to the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
< 110>Shanghai Inst. of Life Science, CAS
< 120>application in transgenosis construct and the empty in the preparation adjustable liver damage model thereof
<130>085115
<160>26
<170>PatentIn?version3.3
<210>1
<211>11323
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>recombinant vectors
<400>1
<210>2
<211>38
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>primer
<400>2
<210>3
<211>34
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>primer
<400>3
<210>4
<211>30
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>primer
<400>4
<210>5
<211>33
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>primer
<400>5
<210>6
<211>31
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>primer
<400>6
<210>7
<211>35
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>primer
<400>7
<210>8
<211>29
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>primer
<400>8
<210>9
<211>28
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>primer
<400>9
<210>10
<211>24
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>primer
<400>10
<210>11
<211>23
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>primer
<400>11
<210>12
<211>24
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>primer
<400>12
<210>13
<211>22
<212>DNA
< 213>artificial sequence
<221>mi?sc_feature
< 223>primer
<400>13
<210>14
<211>31
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>primer
<400>14
<210>15
<211>35
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>primer
<400>15
<210>16
<211>38
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>primer
<400>16
<210>17
<211>38
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>primer
<400>17
<210>18
<211>39
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>primer
<400>18
<210>19
<211>31
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>primer
<400>19
<210>20
<211>30
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>primer
<400>20
<210>21
<211>24
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>primer
<400>21
<210>22
<211>26
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>primer
<400>22
<210>23
<211>26
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>primer
<400>23
<210>24
<211>21
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>primer
<400>24
<210>25
<211>25
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>primer
<400>25
<210>26
<211>24
<212>DNA
< 213>artificial sequence
<221>misc_feature
< 223>primer
<400>26
Claims (8)
1. construction combination that is used to prepare space-time adjustable liver damage model is characterized in that it comprises:
(1) construction 1, and from 5 to 3 comprise the element that following operability links to each other successively:
Promotor, LoxP sequence, reporter gene sequence, terminator 1, LoxP sequence, tBid gene order, Bax gene order, terminator 2; With
(2) construction 2, and from 5 to 3 comprise the element that following operability links to each other successively:
Promotor, mutant estrogen receptor ligands binding domains gene order, Cre recombinase gene sequence, and terminator; Wherein said mutant estrogen receptor ligands binding domains can be activated and then activation Cre recombinase active by estrogen like compound, is not activated by the animal body inner estrogen.
2. construction as claimed in claim 1 is characterized in that, in the construction 1, described reporter gene is a beta-galactosidase gene.
3. construction as claimed in claim 1 is characterized in that, in the construction 1, described promotor is the CAG promotor; Or
In the construction 2, described promotor is an albumin promoter.
4. construction as claimed in claim 1 is characterized in that, in the construction 2, between described Cre recombinase gene and terminator, also contains a mutant estrogen receptor ligands binding domains gene order.
5. construction as claimed in claim 1 is characterized in that, in the construction 1, between described tBid gene and the Bax gene, also contains internal ribosome and inserts site sequence.
6. a cell is characterized in that, is integrated with the arbitrary described construction combination of claim 1-5 in the genome of described cell, and described cell is a liver cell.
7. method for preparing transgenic nonhuman mammal zygote, described zygote being used to prepares space-time adjustable liver damage model, it is characterized in that, and said method comprises:
With the zygote that the described construction 1 of claim 1 is introduced non-human mammal, obtain to have changed over to the zygote of said construction 1; Or
With the zygote that the described construction 2 of claim 1 is introduced non-human mammal, obtain to have changed over to the zygote of said construction 2.
8. method as claimed in claim 7 is characterized in that described non-human mammal is a mouse.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008102002078A CN101684476B (en) | 2008-09-22 | 2008-09-22 | Transgenosis construct and application thereof in preparing space-time adjustable liver damage model |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008102002078A CN101684476B (en) | 2008-09-22 | 2008-09-22 | Transgenosis construct and application thereof in preparing space-time adjustable liver damage model |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101684476A CN101684476A (en) | 2010-03-31 |
| CN101684476B true CN101684476B (en) | 2012-05-02 |
Family
ID=42047850
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2008102002078A Expired - Fee Related CN101684476B (en) | 2008-09-22 | 2008-09-22 | Transgenosis construct and application thereof in preparing space-time adjustable liver damage model |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101684476B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103947606B (en) * | 2014-04-11 | 2015-09-30 | 中国科学院广州生物医药与健康研究院 | Knock in the non-human mammal model of uncoupling proteins 1-luciferase gene and construction method thereof and application |
| CN106676135A (en) * | 2017-01-23 | 2017-05-17 | 中国人民解放军第三军医大学第附属医院 | Alb-uPA-teton lentiviral vector and preparation method and application thereof |
| CN116064666A (en) * | 2019-10-08 | 2023-05-05 | 黄菁 | Method for integrating target gene fragment |
| CN112868603B (en) * | 2021-02-25 | 2022-09-13 | 成都药康生物科技有限公司 | Construction method and application of conditional cell death animal model |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004113531A1 (en) * | 2003-06-20 | 2004-12-29 | Tokyo Metropolitan Organization For Medical Research | Conditioned autophagy-deficient animal and disease model animal |
| CN1898561A (en) * | 2003-09-12 | 2007-01-17 | 威特克斯医药股份有限公司 | Animal model for protease activity and liver damage |
-
2008
- 2008-09-22 CN CN2008102002078A patent/CN101684476B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004113531A1 (en) * | 2003-06-20 | 2004-12-29 | Tokyo Metropolitan Organization For Medical Research | Conditioned autophagy-deficient animal and disease model animal |
| CN1898561A (en) * | 2003-09-12 | 2007-01-17 | 威特克斯医药股份有限公司 | Animal model for protease activity and liver damage |
Non-Patent Citations (4)
| Title |
|---|
| Gross a.等.Caspase cleaved BID targets mitochondria and is required for cytochrome c release |
| Gross,a.等.Caspase cleaved BID targets mitochondria and is required for cytochrome c release, while BCL-XL prevents this release but not tumor necrosis factor-R1/Fas death.《J.Biol.Chem.》.1999,第274卷(第2期),1156-1163. * |
| Knudson,C.M.等.Bax-deficient mice with lymphoid hyperplasia and male germ cell death.《Science》.1995,第270卷(第5233期),96-99. * |
| 宋正己.实验性肝损伤模型的建立和研究进展.《医学综述》.2004,第10卷(第5期),278-280. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101684476A (en) | 2010-03-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Dai et al. | The ovo gene required for cuticle formation and oogenesis in flies is involved in hair formation and spermatogenesis in mice | |
| Monvoisin et al. | VE‐cadherin‐CreERT2 transgenic mouse: a model for inducible recombination in the endothelium | |
| AU754993B2 (en) | Transgenic fish with tissue-specific expression | |
| Jonkers et al. | Synergistic tumor suppressor activity of BRCA2 and p53 in a conditional mouse model for breast cancer | |
| US9043995B2 (en) | Transgenic fish and uses thereof | |
| Kile et al. | Functional analysis of Asb-1 using genetic modification in mice | |
| EP1855524B1 (en) | Transgenic animal as a model for fibrotic diseases | |
| CN101684476B (en) | Transgenosis construct and application thereof in preparing space-time adjustable liver damage model | |
| Metzger et al. | Targeted somatic mutagenesis in the mouse epidermis | |
| US7238797B2 (en) | Nucleic acid encoding a pig heat shock protein 70 | |
| WO2001033957A1 (en) | Transgenic non-human mammals for monitoring change in calcium ion concentration in cells | |
| Birbach et al. | A Probasin‐MerCreMer BAC allows inducible recombination in the mouse prostate | |
| US8980627B2 (en) | Method for enabling stable expression of transgene | |
| AU751811B2 (en) | Vectors | |
| US20030208785A1 (en) | Transgenic pig containing heat shock protein 70 transgene | |
| Riedlinger III et al. | Tsg101 Is Essential for Cell Growth | |
| Lampard | Expression of foreign gene sequences mediated by chicken lysozyme gene regulatory sequences | |
| Xin et al. | FINAL ACCEPTED VERSION | |
| Losos | Modification of the complete chicken lysozyme gene domain by poxvirus medicated gene targeting | |
| JPH11285333A (en) | Non-human animal embryo stem cell having variant smooth muscle myosin heavy chain gene and non-human animal | |
| Bernardi et al. | Characterization of the Regulatory Region of the Zebrafish Prep1. 1 | |
| JP2002191365A (en) | Method for mutation induction to double chromosome using recombination system | |
| JP2003116407A (en) | Radixin knock-out animal | |
| WO2001000860A2 (en) | Prolactin-inducible mammary specific promoter |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120502 Termination date: 20170922 |