CN101684476A - Transgenosis construct and application thereof in preparing space-time adjustable liver damage model - Google Patents

Abstract

The invention relates to a transgenosis construct and an application thereof in preparing a space-time adjustable liver damage model and discloses a construct combination used for preparing the space-time adjustable liver damage model. The construct combination comprises a construct expressing space-time adjustable liver damage induction induced gene and a construct expressing Cre recombinant enzyme. The invention also discloses cells containing the construct and a method for preparing the space-time adjustable liver damage model. The obtained animal model can efficiently induce the liver damage at any time, and provides an effective way for the research of hepatic cell transplantation and liver replantation.

Description

Application in transgenosis construct and the empty in the preparation adjustable liver damage model thereof

Technical field

The invention belongs to biological technical field, be specifically related to the application in transgenosis construct and the empty in the preparation adjustable liver damage model thereof.

Background technology

The liver organ transplantation be present clinical treatment acute hepatic failure, whole latter stage hepatopathy and the main means of metabolic hepatopathy.Yet because the shortage of donor livers, the clinical application of liver organ transplantation has been subjected to serious restriction.The U.S. has 14000 people to wait for liver transplantation every year approximately, wherein 50% waits for above 1 year, and annual about 1300 people are owing to wait dead less than liver transplantation.China requires the wait list of row organ transplantation also to be on the increase.Therefore, the urgent clinical needs additive method improves liver function, and the survival time that prolongs the patient is waited for liver transplantation, or replaces liver transplantation.

Liver cell has stronger multiplication capacity.Bumgardner in 1988 etc. have taken the lead in proposing the notion of hepatocyte transplantation, carry out first routine human hepatocyte's implantation technique in the world by Mito etc. in 1993, and what carry out at that time was from body homology hepatocyte transplantation.The hepatocyte transplantation technology develops rapidly subsequently, and becomes one of hot fields of biomedical research.The preclinical phase of animal test shows by experiment, hepatocyte transplantation is behind liver, spleen and some other position, still can keep its normal light microscopic and Electronic Speculum structure, and can express multiple hepatocyte function, as serum albumin secretion, glycogen storage and glycolysis, bilirubin combination, ammonia metabolism and cytochrome P 450 enzymes genetic expression etc.Be expected to disease by hepatocyte transplantation treatment and comprise that the disease of liver itself and liver are diseases related, as acute and chronic liver failure, chronic viral hepatitis and liver cirrhosis etc.

The first hepatocyte transplantation of China was succeedd in 2004.At present hepatocyte transplantation has accumulated abundant clinical experience, and can partly or entirely replace liver transplantation and be applied to clinical.But the core of hepatocyte transplantation research remains the hepatocellular source problem that comes.Clinical study shows that from the most suitable clinical transplantation of liver cell of body maturation, but this itself is exactly a contradiction, and for this reason, people are eager to seek other source.

As if the ES cell become the effective means that address this problem to hepatocellular directed differentiation to hepatocellular directed differentiation behind the reprogramming of somatic cells.Yet whether " liver cell " function that directed differentiation produces is normal, and the liver injury model that needs detects, and this model preferably space-time is adjustable, can be momentarily and induce the formation liver injury efficiently.

Summary of the invention

The object of the present invention is to provide a kind of transgenosis construct that can be used for preparing space-time adjustable liver damage model.

Another object of the present invention is to provide a kind of space-time adjustable liver damage model and preparation method thereof.

In a first aspect of the present invention, a kind of construction combination that is used to prepare space-time adjustable liver damage model is provided, it comprises:

(1) construction 1, and from 5 ' to 3 ' comprises the element that following operability links to each other successively:

Promotor, LoxP sequence, reporter gene sequence, terminator 1, LoxP sequence, tBid gene order, Bax gene order, terminator 2; With

(2) construction 2, and from 5 ' to 3 ' comprises the element that following operability links to each other successively:

Promotor, mutant estrogen receptor ligands binding domains gene order, Cre recombinase gene sequence, and terminator; Wherein said mutant estrogen receptor ligands binding domains can be activated and then activate the Cre recombinase active by estrogen analogue, do not activated by the animal body inner estrogen.

In another preference, described estrogen analogue is selected from: Tamoxifen (Tamoxifen), or 4-hydroxyl Tamoxifen (4-OH Tamoxifen, 4-OHT).

In another preference, described mutant estrogen receptor ligands binding domains derives from the mouse estrogen receptor; Preferably mouse estrogen receptor aminoacid sequence is (referring to the GenBank accession number: NM_007956) 281-599 position, and wherein the 525th glycine (G) sports arginine (R).

In another preference, described mutant estrogen receptor ligands binding domains derives from human estrogen acceptor; Preferably people's estrogen receptor aminoacid sequence is (referring to the GenBank accession number: NM_000125) 282-594 position, and wherein the 400th glycine (G) sports that Xie Ansuan (V), the 543rd methionine(Met) (M) sport L-Ala (A), the 544th leucine (L) becomes L-Ala (A).

In another preference, in the construction 1, described reporter gene is a beta-galactosidase gene.

In another preference, described reporter gene 3 ' end also is connected with the resistant gene sequence; Preferable, described resistant gene is Xin Meisu (Neomycin, Neo) resistant gene.

In another preference, in the construction 1, described promotor is CAG (cytomegalovirus enhanser, a chicken β Actin muscle and rabbit beta Globulin combined launch) promotor; Or in the construction 2, described promotor is albumin (Alb) promotor.

In another preference, in the construction 1, described terminator 1 is 3 * poly A (3 PA is in series), or described terminator 2 is rabbit beta Globulin poly A.

In another preference, in the construction 2, described terminator is SV40 poly A.

In another preference, in the construction 2, between described Cre recombinase gene and terminator, also contain a mutant estrogen receptor ligands binding domains gene order.

In another preference, in the construction 1, between described tBid gene and the Bax gene, also contain internal ribosome and insert site (IRES) sequence.

In a second aspect of the present invention, a kind of cell (non-sexual cell) is provided, be integrated with described construction 1 and construction 2 in the genome of described cell.

In another preference, described cell is a liver cell.

In another preference, under the normal circumstances, described cell expressing reporter gene encoded protein; After handling with estrogen analogue, described cell expressing tBid albumen and Bax albumen.

In a third aspect of the present invention, a kind of method for preparing transgenic nonhuman mammal zygote is provided, described zygote being used to prepares space-time adjustable liver damage model, and described method comprises:

With the zygote that described construction 1 is introduced non-human mammal, obtain to have changed over to the zygote of described construction 1; Or

With the zygote that described construction 2 is introduced non-human mammal, obtain to have changed over to the zygote of described construction 2.

In another preference, described non-human mammal is a mouse.

In a fourth aspect of the present invention, a kind of method for preparing space-time adjustable liver damage model is provided, described method comprises:

(1) zygote that described construction 1 is introduced non-human mammal, the zygote that has changed described construction over to is moved in the uterine tube of false pregnancy non-human mammal, make it to continue to grow, generate the non-human mammal that is integrated with described construction 1 in the genome;

(2) zygote that described construction 2 is introduced non-human mammal, the zygote that has changed described construction over to is moved in the uterine tube of false pregnancy non-human mammal, make it to continue to grow, generate the non-human mammal that is integrated with described construction 2 in the genome; With

The non-human mammal that (1) and (2) is obtained carries out mating, obtains to be integrated with in the genome non-human mammal of described construction 1 and construction 2.

Others of the present invention are because the disclosure of this paper is conspicuous to those skilled in the art.

Description of drawings

Fig. 1. utilize facs analysis Caspase 8, Bax, the ability of tBid gene or their combination inducing hepatocyte apoptosis.

Fig. 2. make up the structural representation of the transgenosis plasmid pCALL2-tIB that obtains.

Fig. 3. the plasmid that will carry Bax-IRES-tBid (tIB), Bax-IRES-tBid (BIt), tBid-IRES-EGFP (tIE), Bax-IRES-EGFP (BIE), IRES-EGFP (IE) or negative control is gone among the LEPC with the pAlbCreSVPA corotation respectively, floats on the apoptosis situation of cell detection cell dead in the nutrient solution by observation.

Fig. 4 .PCR identifies that male F1 is for mouse.

They come from 7 the head person of building mouse, M39:141-149 respectively; M40:151; F41:159-162; F42:163-168,248-250; F43:230-235; F44:237-245; F46:179-183.M is molecular weight marker D2000 (a day root company), the negative contrast of NC.

Fig. 5 .9 mouse species liver organization RT-PCR result.

Wt is the wild-type negative control; Rosa26 is the positive control of Rosa26-β gal mouse.29,149,161,168,183,234,238 is respectively the F1 generation of 7 the head person of building mouse.No. 161 of the head person of building F41 and No. 168 offsprings of the first person of building F42 demonstrate genetically modified expression.GAPDH is confidential reference items, positive control.

Fig. 6. No. 250 transgenosiss of the offspring of the head person of building F42 are the expression in liver, kidney and small intestine respectively.By the X-gal visible transgenosis β geo that dyes expression is arranged.

Fig. 7 .pAlbMerCreMerSVPA and pCAG-loxP-mRFP-loxP-EGFP corotation are gone among the Hepa1-6, induce with 4-OHT after 24 hours.Green fluorescence is expressed, and illustrates that MerCreMer has brought into play activity, and the plasmid loxP intermediary mRFP that corotation is gone into cuts away, and the EGFP in downstream is expressed.

Fig. 8 .pAlbCreERSVPA and pCAG-loxP-mRFP-loxP-EGFP corotation are gone among the Hepa1-6, induce with 4-OHT after 24 hours.Green fluorescence is expressed, and illustrates that CreER has brought into play activity, and the plasmid loxP intermediary mRFP that corotation is gone into cuts away, and the EGFP in downstream is expressed.

Fig. 9 .PCR identifies that male F0 is for mouse.

In the mouse that 61 are come through the procaryotic injection growth, by the primer amplification at Alb promotor and Cre enzyme, having identified 6 mouse genome conformities has the target practice sequence, is respectively 2,3,6,8,31,37.

Embodiment

The inventor has found the gene that is particularly suitable for efficient inducing hepatocyte apoptosis through extensive studies, has made up the construction of alternative expression apoptogene, thereby has set up a kind of hepar damnification non-human animal model of space-time adjustable.Described non-human animal model is not having not express apoptogene under the inductive situation, and can express apoptogene under the inductive situation unusually efficiently, thereby can induce efficiently, in real time liver injury (as liver failure) takes place.

TBid gene and Bax gene

Bid albumen is BH3 interacting domain death agonist, is one of member in the Bcl-2 family, contains a BH3 structural domain, and its molecular mass (Mr) is 22000Da.

TBid albumen is the Bid albumen of brachymemma, is that Bid albumen cuts that its N holds about 60 amino acid and the Bid protein fragments that forms.TBid is the relevant albumen of a kind of apoptosis, for example can induce some cell generation apoptosis such as Hela cell.

The present invention can use full-length proteins or its bioactive fragment of tBid.The proteic bioactive fragment of any tBid can be applied among the present invention.Here, the implication of the proteic bioactive fragment of tBid is meant as a kind of protein fragments, the proteic all or part of function of its tBid that still can be kept perfectly (activity as at least 80%, better at least 90% activity).The aminoacid sequence of the tBid that passes through replacement, disappearance or the interpolation of one or more amino-acid residues and form is also included among the present invention.Replacement, disappearance or the interpolation of the one or more amino-acid residues of described process and the tBid albumen that forms also has the collaborative function that promotes hepatocellular apoptosis with Bax.The present invention also can adopt tBid albumen modified or improvement, such as, can adopt in order to prolong its transformation period, to improve its stability and the tBid albumen of improvement.

The source of tBid is not particularly limited, and can be people, mouse, rat, pig or other mammiferous tBid.As a kind of optimal way of the present invention, the aminoacid sequence of described tBid can be that the sequence 319-729 position shown in the NM_007544 is substantially the same with the GenBank accession number.Preferably, can adopt the tBid albumen of reorganization.After obtaining proteic sequence, those skilled in the art are easy to learn the proteic dna sequence dna of the described tBid of coding.

The Bax gene extensively is present in mammiferous multiple tissue and the cell, belongs to the member of Bcl-2 family, and it participates in the apoptosis-promoting effect of some tumour cells.

The present invention can use full-length proteins or its bioactive fragment of Bax.The proteic bioactive fragment of any Bax can be applied among the present invention.Here, the implication of the proteic bioactive fragment of Bax is meant as a kind of protein fragments, the proteic all or part of function of its Bax that still can be kept perfectly (activity as at least 80%, better at least 90% activity).The aminoacid sequence of the Bax that passes through replacement, disappearance or the interpolation of one or more amino-acid residues and form is also included among the present invention.Replacement, disappearance or the interpolation of the one or more amino-acid residues of described process and the Bax albumen that forms also has the collaborative function that promotes hepatocellular apoptosis with tBid.The present invention also can adopt Bax albumen modified or improvement, such as, can adopt in order to prolong its transformation period, to improve its stability and the Bax albumen of improvement.

The source of Bax is not particularly limited, and can be people, mouse, rat, pig or other mammiferous Bax.As a kind of optimal way of the present invention, the aminoacid sequence of described Bax can be that the sequence 124-702 position shown in the NM_007527 is substantially the same with the GenBank accession number.Preferably, can adopt the Bax albumen of reorganization.After obtaining proteic sequence, those skilled in the art are easy to learn the proteic dna sequence dna of the described Bax of coding.

Transgenosis construct

A good animal liver damage model must possess the characteristic of following 4 aspects: the space-time inducibility, simple to operate, the efficient height is induced in liver injury, preserves easily and expands.In order to satisfy these requirements, finally obtain suitable transgenosis construct, the inventor has made up a pair of construction.Described construction 1 from 5 ' to 3 ' comprises the element that following operability links to each other successively: promotor, LoxP sequence, reporter gene, terminator 1, LoxP sequence, tBid gene, Bax gene, terminator 2; Described construction 2 comprises the element that following operability links to each other: promotor, mutant estrogen receptor ligands binding domains gene order, Cre recombinase gene sequence, and terminator; Wherein said mutant estrogen receptor ligands binding domains can be activated and then activate the Cre recombinase active by estrogen analogue, and is not activated by the animal body inner estrogen.

When two kinds of constructions are in the cell system simultaneously, under specific inductive condition, can activate the Cre recombinase, recombinate thereby further induce between the LoxP site, make tBid and Bax genetic expression, inducing cell generation apoptosis.

The realization of space-time adjustable is based on the Cre/loxP system.The inventor has used a kind of double-tagging to express framework, and the two ends of this framework respectively comprise a LoxP sequence in the same way, are reporter gene and/or the resistance screening marker gene that can independently express between two LoxP sites.After having the Cre recombinase in the system, the Cre recombinase can be discerned the LoxP site and site-specific reorganization takes place, with the excision of the sequence between two LoxP sites, thus downstream tBid gene and Bax genetic expression.

And the activity of Cre recombinase is to regulate and control by the ligand binding domains of mutant estrogen receptor in the cell.After the ligand binding domains and Cre fusion with the mutant estrogen receptor, the activity of Cre is subjected to the adjusting of the ligand binding domains of mutant estrogen receptor.Because this structural domain is transformed through sudden change, it does not respond inducing of mouse self hormone, and it is comparatively responsive to Tamoxifen materials such as (Tamoxifen) (referring to Logie and Stewart, 1995, Ligand-regulated site-speific recombination.Proc.Natl.Acad.Sci.USA.92:5940-5944).Like this, the ligand binding domains of mutant estrogen receptor and Cre fusion rotein just are subjected to the adjusting of Tamoxifen etc.

But the ligand binding domains of induced mutation type estrogen receptor and then the active estrogen analogue of adjusting Cre comprise: 4-OHT, Tamoxifen.

The ligand binding domains of described mutant estrogen receptor can be derive from multiple mammiferous.As a kind of optimal way, described mutant estrogen receptor ligands binding domains derives from the mouse estrogen receptor; Preferably mouse estrogen receptor aminoacid sequence is (referring to the GenBank accession number: NM_007956) 281-599 position, and wherein the 525th glycine (G) sports arginine (R).

As another kind of optimal way, described mutant estrogen receptor ligands binding domains derives from human estrogen acceptor; Preferably people's estrogen receptor aminoacid sequence is (referring to the GenBank accession number: NM_000125) 282-594 position, and wherein the 400th glycine (G) sports that Xie Ansuan (V), the 543rd methionine(Met) (M) sport L-Ala (A), the 544th leucine (Leu) becomes L-Ala (A).

Can be used for promotor of the present invention and be not particularly limited, representational example comprises (but being not limited to): MMTV LTR promotor, CMV promotor, salivin gene promoter etc.As optimal way of the present invention, adopt CAG (cytomegalovirus enhanser, chicken β Actin muscle and rabbit beta Globulin combined launch) promotor is as the promotor of construction 1, this promotor is a kind of strong promoter of general expression, can drive its downstream gene wide expression, empirical tests has the effect of good regulate gene expression.As optimal way of the present invention, use the Alb promotor to instruct the expression of the ligand binding domains and the Cre fusion gene of mutant estrogen receptor, help like this making that this fusion gene is specific expressed in liver.When described fusion gene is expressed, the performance of Cre recombinase is active, thereby the expression of apoptosis-induced gene tBid and Bax causes tissue injury.

As optimal way of the present invention, when amalgamation and expression, hold at the 5 ' end and 3 ' of Cre recombinase gene to be connected with the ligand binding domains gene of a mutant estrogen receptor respectively, promptly constitute the structure of MER-Cre-MER.Find relatively that through the inventor's experiment the fusion gene of MER-Cre-MER type has following characteristics: in that not have under the inductive situation activity close tighter, induce efficient higher having under the inductive situation.

Can be used for terminator of the present invention and be not particularly limited, but any suitable terminator with terminator expressive function all is available.As a kind of mode of the present invention, in the construction 1, described terminator 1 is 3 * poly A, and described terminator 2 is rabbit beta Globulin poly A; In the construction 2, described terminator is SV40 poly A.

Be that operability links to each other between each element of the present invention, described " operability links to each other " or " operationally being connected in " refer to a kind of like this situation, and promptly the activity of same linear DNA sequence other parts can be regulated or control to some part of linear DNA sequence.For example, if the transcribing of promotor control sequence, it is exactly operationally to be connected in encoding sequence so.

Can have the proper spacing sequence between described each element, for example have 0-1000bp, the intervening sequence of preferable 0-500bp.

As used herein, described " containing ", " having " or " comprising " comprised " comprising ", " mainly by ... constitute ", " basically by ... constitute " and " by ... constitute "; " mainly by ... constitute ", " basically by ... constitute " and " by ... formation " belong to the subordinate concept of " containing ", " having " or " comprising ".

The preparation of animal model

After having obtained described transgenosis construct, available ordinary method changes linearizing construction in the zygote over to.Treat the filial generation animal birth available several different methods known in the art in back (including but not limited to methods such as PCR detection, Southern blotting) identifies whether transgenosis construct is integrated into its genome, thereby obtain genetically modified animal.

Therefore, the present invention also provides a kind of method for preparing space-time adjustable liver damage model, described method comprises: the zygote that (1) introduces non-human mammal with the described construction 1 of claim 1, the zygote that has changed described construction over to is moved in the uterine tube of false pregnancy non-human mammal, make it to continue to grow, generate the non-human mammal that is integrated with the described construction 1 of claim 1 in the genome; (2) zygote that the described construction 2 of claim 1 is introduced non-human mammal, the zygote that has changed described construction over to is moved in the uterine tube of false pregnancy non-human mammal, make it to continue to grow, generate the non-human mammal that is integrated with the described construction 2 of claim 1 in the genome; The non-human mammal that (1) and (2) is obtained carries out mating, obtains to be integrated with in the genome non-human mammal of described construction 1 of claim 1 and construction 2.

In order to obtain the offspring of inheritance stability, as optimal way of the present invention, described method also comprises: (4) obtain to be integrated with in the genome offspring's non-human mammal of described construction with (3) transgenic nonhuman mammal that obtains and the non-human mammal mating that (3) obtain.

Non-human mammal of the present invention can be mouse, sheep, ox, pig, rabbit etc.Mouse preferably comprises the mouse of mouse, rat or other type.

The main application of space-time adjustable liver damage model of the present invention includes but not limited to: the Prevention Research of liver injury, the effect analysis of hepatocyte transplantation, the effect analysis that liver is grown again etc.

A kind of method of utilizing space-time adjustable liver damage model of the present invention to analyze hepatocyte transplantation effect to be measured is: (1) gives estrogen analogue (as Tamoxifen or 4-OHT) to be integrated with in the genome of aforementioned acquisition the non-human mammal of described construction 1 of claim 1 and construction 2, activate the Cre recombinase, the Cre recombinase is further induced between the LoxP site of construction 1 and is recombinated, make the sequence between the loxP be cut off, cause tBid and Bax genetic expression, inducing cell generation apoptosis, thus the animal liver damage model formed; (2) with the liver of hepatocyte transplantation to be measured, observe the situation of transplanting the back liver, thereby learn hepatocyte transplantation effect to be measured to animal.

Analyzing hepatocyte transplantation effect to be measured or liver, to grow the method for effect again be technology known in the art, for example can be by immunohistochemical method.

Major advantage of the present invention is:

(1) inventor has found the assortment of genes that is particularly suitable for the inducing hepatocyte apoptosis, and it can bring into play inducing hepatocyte apoptotic effect efficiently.

(2) inventor has made up the space-time controllability construction of alternative expression apoptogene, thereby has set up the hepar damnification non-human animal model of space-time adjustable.Described animal model can be induced liver injury momentarily, efficiently, and the research of growing again for hepatocyte transplantation, liver provides valid approach.Therefore, the inventor has set up a kind of new method and has come induced tissue damage.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: lab guide (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.

I. material

1. plasmid and bacterial strain

Transgene carrier pCALL2 is available from Canadian Samuel Lunenfeld institute;

PIRES2-EGFP plasmid and pEGFP-N2 are available from Clontech company;

The pMD18T-simple plasmid is available from Takara company;

The pET28a plasmid is available from Novagen;

PcDNA3 and pcDNA3.1/Hygro (-) are available from Invitrogen company.

2. toolenzyme and reagent

Restriction enzyme, T4DNA ligase enzyme are available from NEB company;

DNTP, Hifi Taq Platinum, Trizol, RT-PCR kit are available from Invitrogen;

Taq archaeal dna polymerase, Proteinase K, X-gal are available from sky root company;

The in a small amount quick extraction agent box of DNA is available from vast Imtech;

Glue reclaims test kit available from JaRa company;

QIAprep Maxprep Kit is available from Qiagen company.

Annexin V-FITC Apoptosis Detection Kit I is available from BD Biosciences company.

Transfection reagent Effectene is available from Qiagen company.

II. embodiment

Embodiment 1. determines to be suitable for most the gene of inducing hepatocyte apoptosis

But known have a several genes cell death inducing, at first selects to be suitable for most the gene of inducing hepatocyte apoptosis in the present embodiment.

With the method for the FACS of routine, to three gene C aspase 8, Bax, tBid inducing hepatocyte apoptosis capacity compares, and determines optimal gene.With Caspase 8, Bax and tBid are cloned into respectively among the carrier pcDNA3.1 (available from Invitrogen).As template, primer sequence is respectively (upstream primer is provided with Eco RI site, and downstream primer is provided with the XhoI site) with mouse liver cDNA:

Caspase?8F(SEQ?ID?NO：2)：

CTCT GAATTCCCATGGATTTCCAGAGTTGTCTTTATGC；

Caspase?8R(SEQ?ID?NO：3)：

GCAC CTCGAGTTAGGGAGGGAAGAAGAGCTTCTT；

Bax?F(SEQ?ID?NO：4)：

GCAG GAATTCCCATGGACGGGTCCGGGGAG；

Bax?R(SEQ?ID?NO：5)：

GTGG CTCGAGTCAGCCCATCTTCTTCCAGATGG；

tBid?F(SEQ?ID?NO：6)：

ATAT GAATTCGCATGGGCAGCCAGGCCAGCC；

tBid?R(SEQ?ID?NO：7)：

GCGC CTCGAGTCAGTCCATCTCGTTTCTAACCAAG；

To carry Caspase 8, the carrier of Bax or tBid is transfected into LEPC cell (mouse adult dual intensity liver stem cells separately; From the Shanghai The 2nd Army Medical College; Can be referring to Li WL etc., 2006, Isolation andcharacterization of bipotent liver progenitor cells from adult mouse.Stem Cells.24:322-332) in, perhaps will carry the carrier and the carrier that carries tBid of Bax.The FACS detected result is seen Fig. 1, and by the result as seen, in the transfection, the ability of the short apoptosis of tBid is the strongest separately, and Bax takes second place, and Caspase is the most weak.And when corotation Bax and tBid, the ability of short apoptosis is the strongest.

As seen, for liver cell, the apoptosis-promoting effect of Bax and tBid co expression is the strongest.

Embodiment 2. transgene carriers make up

With the method for PCR from mouse liver cDNA, increase tBid and Bax gene, and they are connected in the pMD18T-simple carrier.

Primer sequence is as follows:

tBid?F(SEQ?ID?NO：8)：

5’-ATATAGATCTACCATGGGCAGCCAGGCCA-3’；

tBid?R(SEQ?ID?NO：7)：

5’-GCGCCTCGAGTCAGTCCATCTCGTTTCTAACCAAG-3’；

Bax?F(SEQ?ID?NO：9)：

5’-ATATAGATCTACCATGGACGGGTCCGGG-3’；

Bax?R(SEQ?ID?NO：5)：

5’-GTGGCTCGAGTCAGCCCATCTTCTTCCAGATGG-3’。

The pcr amplification condition is as follows respectively:

TBid: at first 94 ℃, 5min; 94 ℃ then, 30s; 56 ℃, 30s; 72 ℃, 30s; 30 circulations; Last 72 ℃, 10min.

Bax: at first 94 ℃, 5min; 94 ℃ then, 30s; 58 ℃, 30s; 72 ℃, 30s; 30 circulations; Last 72 ℃, 10min.

With BglII and NcoI the IRES sequence is scaled off from pIRES2-EGFP, be connected to corresponding site among the pET28a, obtain pET28a-IRES; Then use the method for PCR, amplifying Bax and tBid from liver cDNA also inserts respectively in the pMD18T-simple carrier, obtain pMD18T-Bax and pMD18T-tBid, after sequencing result is correct, with NcoI and XhoI Bax is scaled off from pMD18T-Bax, be connected to the corresponding site of pET28a-IRES, obtain pET28a-IRES-Bax; With BglII and XhoI tBid is scaled off from pMD18T-tBid again, be connected between the BglII and SalI of pET28a-IRES-Bax, obtain pET28a-tBid-IRES-Bax, be called for short pET28a-tIB.Next with BglII and XhoI tIB is scaled off, be connected to corresponding site among the pCALL2, obtain plasmid pCALL2-tIB.The PCR product reclaims, dna fragmentation reclaims, plasmid extraction is operated by vast Tyke specification sheets, and enzyme is cut with the operation instructions that is connected by the NEB enzyme and carried out.

After transgenosis plasmid pCALL2-tIB makes up and finishes, it comprises 7 key components altogether: the strong promoter CAG that can drive the gene wide expression, the loxP sequence, the encoder block of β geo gene, 3 * polyA (terminator) is with previous loxP loxP sequence in the same way, gene tIB, rabbit beta Globulin polyA is total to 9.5kb, and its structure as shown in Figure 2.Order-checking shows entirely true.The full length sequence of pCALL2-tIB plasmid is shown in SEQ IDNO:1.

Based on aforementioned similar method, the inventor has also made up the pCALL2-BIt plasmid that carries Bax-IRES-tBid (BIt), the series system of Bax and tBid is different from the pCALL2-tIB plasmid in this plasmid.

The inventor also makes up the plasmid that contains IRES-EGFP (IE) simultaneously, and makes up the plasmid that contains Bax-IRES-EGFP (BIE) and tBid-IRES-EGFP (tIE) respectively based on independent apoptogene.Concrete construction process is as follows:

For pCALL2-BIt, with NcoI and XhoI tBid is scaled off from pMD18T-tBid, be connected to the corresponding site of pET28a-IRES, obtain pET28a-IRES-tBid; With BglII and XhoI Bax is scaled off from pMD18T-Bax again, be connected between the BglII and SalI of pET28a-IRES-tBid, obtain pET28a-Bax-IRES-tBid, be called for short pET28a-BIt.Next with BglII and XhoI BIt is scaled off, be connected to corresponding site among the pCALL2, obtain plasmid pCALL2-BIt.

For pCALL2-tIE, with BglII and XhoI tBid is scaled off from pMD18T-tBid, be connected in the pIRES2-EGFP carrier between the BglII and SalI, obtain ptBid-IRES-EGFP, be called for short ptIE, with BglII and NotI tIE is scaled off then, be connected to the corresponding site of pCALL2, promptly obtain pCALL2-tIE.

For pCALL2-BIE, with BglII and XhoI Bax is scaled off from pMD18T-Bax, be connected in the pIRES2-EGFP carrier between the BglII and SalI, obtain pBax-IRES-EGFP, be called for short pBIE, with BglII and NotI BIE is scaled off then, be connected to the corresponding site of pCALL2, promptly obtain pCALL2-BIE.

For pCALL2-IE, then directly IRES-EGFP is scaled off from pIRES2-EGFP with BglII and NotI, be connected to the corresponding site of pCALL2, obtain pCALL2-IE.

These plasmids are gone among the LEPC with the pAlbCreSVPA corotation respectively, by observing the apoptosis situation that dead cell suspends and detects cell.Found that the ability of the short apoptosis of pCALL2-tIB is significantly strong than pCALL2-BIt; The short apoptosis capacity that the ratio of expressing two apoptogenes is simultaneously expressed a gene is strong; The short apoptosis capacity that the ratio of expression apoptogene is not expressed apoptogene is strong, as shown in Figure 3.The complete sequence of pCALL2-tIB plasmid is total to 11323bp shown in SEQ ID NO:1.

Therefore, the inventor has selected the pCALL2-tIB plasmid for use, with its linearizing, is expelled in the mouse fertilized egg, has prepared the tIB transgenic mice, is used for condition induced tissue apoptosis.

Embodiment 3. zygote microinjections and transgenic mice are identified

With ScaI and SfiI the plasmid pCALL2-tIB of aforementioned structure is cut, reclaim the band of the 9.5kb that comprises above-mentioned 7 elements, remove irrelevant fragment, at last this fragment is diluted to 2-5ng/ μ L, carry out the zygote microinjection routinely.The zygote transplation that to accept DNA then makes it to continue to grow in the female mouse uterine tube of acceptor false pregnancy, and childbirth at last obtains generation mice.

Method by PCR is made genotype identification to the offspring who is born, take out the about 30 days mouse 0.5-1cm tail point in living back and place the 1.5mL centrifuge tube, add 260 μ L and organize lysate [50 μ L, 10% SDS, 10 μ L 20mg/mL Proteinase Ks, 200 μ L NLB (10mM Tris-HCl, pH8.2; 400mM NaCl; 1mM EDTA, pH8.0)] in 55 ℃ of cracking of spending the night.Add the saturated NaCl of 50 μ L in the sample completely to cracking, put upside down mixing, 8000rpm is in 4 ℃ of centrifugal 15min.Supernatant mixes with 200 μ L Virahols, the centrifugal 15min of room temperature 13200rpm, and precipitation is with 70% washing with alcohol once, and is air-dry, and the TE with 100 μ L dissolves at last.

The primer of genotype identification is as follows:

βgal-F(SEQ?ID?NO：10)：

5’-GTGACGTCTCGTTGCTGCATAAAC-3’；

βgal-F(SEQ?ID?NO：11)：

5’-CACGGCGTTAAAGTTGTTCTGCT-3’；

Bax-F(SEQ?ID?NO：12)：

5’-GAGGTTAAAAAAACGTCTAGGCCC-3’；

Bax-R(SEQ?ID?NO：13)：

5’-TTTGGCAGAGGGAAAAAGATCG-3’；

CD34?enh-F(SEQ?ID?NO：14)：

5’-ACGCGTGAGTGGTCTGGATCCAAACTGAGTG-3’；

CD34?enh-R(SEQ?ID?NO：15)：

5’-AAGCTTAGCTATAATGCAACCAGAATATAAAGCAT-3’。

The pcr amplification condition is as follows respectively:

β gal: at first 94 ℃, 2min; 94 ℃ then, 30s; 58 ℃, 30s; 72 ℃, 30s; Carry out 28 circulations; Last 72 ℃, 10min.

Bax: at first 94 ℃, 2min; 94 ℃ then, 30s; 57 ℃, 30s; 72 ℃, 35s; Carry out 28 circulations; Last 72 ℃, 10min.

CD34 enhancer: at first 94 ℃, 2min; 94 ℃ then, 30s; 58 ℃, 30s; 72 ℃, 50s; Carry out 28 circulations; Last 72 ℃, 10min.

As a result, obtain 11 transgenic founders (F0 generation) altogether, the positive mouse of integration is arranged on their genome of preliminary evaluation.With these head person of building mouse respectively with the wild-type mice mating, Offspring F1 carries transgenosis (Fig. 4).

Embodiment 4. transgenic mice liver expression RT-PCR detect

11 the head person of building mouse are built with the wild-type mice mating respectively and are.Carry genetically modified F1 for mouse on the method identified gene group of continuation by PCR.

Choose wherein 7 the head person of building offsprings, add the negative control of wild-type and Rosa26-β gal positive control totally 9 mouse, get its liver, liquid nitrogen flash freezer mouse fresh liver, grind into powder, use the extraction of Trizol lysing cell RNA immediately, the extraction of RNA, the RT-PCR process is carried out according to the corresponding specification sheets of Invitrogen.Get its tail point simultaneously and be used to take out genomic dna.The amplification of β gal is with preceding identical.

9 mouse species liver organization RT-PCR results as shown in Figure 5, RT-PCR result shows that wherein two the head person of building offsprings have genetically modified expression, is respectively No. 161 and No. 168 offsprings of the first person of building F42 of the head person of building F41.

Embodiment 5.X-gal detects and organizes transgene expression

The RT-PCR that learnt from else's experience shows that transgenosis has the head person of the building offspring (offspring of F42 No. 250) of expression, and its liver, kidney and small intestine are carried out X-gal dyeing.Organ is placed stationary liquid (1% formaldehyde, 0.2% glutaraldehyde, 0.02%NP-40 is in PBS) 4 ℃ fix 4 hours, use the PBS room temperature washing then 2 times, each 20 minutes, follow organ as for (5mM yellow prussiate of potash, the 5mM Tripotassium iron hexacyanide, 0.01% peroxide Sodium cholic acid in the staining fluid, 0.02%NP-40, the 2mM magnesium chloride, 1mg/mL X-gal is in PBS), room temperature dyeing is spent the night.

The X-gal coloration result is seen Fig. 6, can see that these organs all have genetically modified expression, therefore can determine that this transgenic mice has genetically modified normal expression, and the inventor is called the tIB mouse with this mouse, can be used in subsequent experimental.

The structure of the induced Cre enzyme mouse of embodiment 6. liver specifically expressings

Structure for the induced Cre enzyme mouse of specifically expressing inside liver, with XhoI and AflII pIRES2-EGFP (Clontech) and pcDNA3.1/Hygro (-) (Invitrogen) are cut, and about 1.6kb among the former is contained among the fragment insertion latter of polyA, obtain pcDNA3.1-SVPA/Hygro (-).Then, with MluI and XhoI with the Alb promotor from pGEMAlbSVPA (referring to Goshi Shiota etc., 1990, Hepatocyte growth factor inhibits growth of hepatocellular carcinoma cells, Proc.Natl.Acad.Sci.USA.92:5940-5944.89:373-377) scale off in, insert corresponding site among the pcDNA3.1-SVPA/Hygro (-), obtain pAlb (Old)-SVPA/Hygro (-).For the ATG with Alb promotor back removes, with the method for conventional PCR, the last 0.5kb segment of amplification promotor is after the PCR product is cut with BamHI and XhoI enzyme, replace corresponding segment among pAlb (Old)-SVPA/Hygro (-), obtain pAlbSVPA/Hygro (-).Then, with the method for conventional PCR from pANMerCreMer (Zhang etc., 1996; Inducible site-directed recombination in mouse embryonic stemcells.Nucleic Acids Research.24:543-548) sequence amplification with Cre in come out (with Cre F1 and Cre R as primer), be connected among the pMD-18T simple vector, after order-checking is correct, with XhoI and NotI Cre is connected to corresponding site among the pAlb-SVPA/Hygro (-), obtains pAlbCreSVPA.With AscI and SacI CreER is scaled off from pBS-CreLBD (available from model animal center, Chinese Academy of Sciences Shanghai), the Cre among the pAlbCreSVPA is replaced, obtain pAlbCreERSVPA in identical site.

In addition, the inventor has also made up pAlbMerCreMerSVPA, with the method for PCR Cre is increased from pANMerCreMer (with Cre F2 and Cre R as primer), is connected to pMD-18T simplevector, obtains T-Cre.Next, pANMerCreMer is cut with the SacI enzyme, reclaim the fragment of 4.4kb, then the fragment of this 4.4kb is cut with the partially digested method enzyme of NcoI, reclaim the fragment of about 3kb, and be inserted into the corresponding site of T-Cre, obtain T-MerCreMer.With AscI and SacI MerCreMer is scaled off from T-MerCreMer, replace Cre among the pAlbCreSVPA, obtain pAlbMerCreMerSVPA at same loci.

Because all contain derivable Cre among pAlbCreERSVPA and the pAlbMerCreMerSVPA, the inventor has compared CreER and MerCreMer, see which is not having under the inductive condition background activity low, and it is higher to stand inductive efficient.

The inventor goes into pAlbCreERSVPA and pAlbMerCreMerSVPA among the hepatoma cell line Hepa1-6 (available from biochemical cell institute of Chinese Academy of Sciences cell bank) with the pCAG-loxP-mRFP-loxP-EGFP corotation respectively, after the transfection 24 hours, the 4-OHT with 1 μ M induces respectively.Express from green fluorescence, do not having under the inductive situation, it is tighter that the MerCreMer activity is closed, and after inducing with 4-OHT, MerCreMer induces efficient higher, sees Fig. 7 and Fig. 8.Therefore the inventor has selected the pAlbMerCreMerSVPA plasmid to remove to prepare transgenic mice.

Primer sequence:

Cre?F1(SEQ?ID?NO：16)：

TATACTCGAGGCGCGCCACCATGCCCAAGAAGAAGAGG

Cre?F2(SEQ?ID?NO：17)：

TATACTCGAGGCGCGCCACCATGGCCAAGAAGAAGAGG

Cre?R(SEQ?ID?NO：18)：

ATATGCGGCCGCGAGCTCTAATCGCCATCTTCCAGCAGG

Alb?pro?F(SEQ?ID?NO：19)：

ATATGGATCCATGGGGTTGATTTGGATGTAG

Alb?pro?R(SEQ?ID?NO：20)：

CAGTCTCGAGGGAAAGGTGATCTGTGTGCA

The pcr amplification condition is as follows respectively:

Cre: at first, 94 ℃, 2min; Then, 94 ℃, 30s; 55 ℃, 30s; 72 ℃, 1min; 20 circulations; At last, 72 ℃, 10min.

The Alb promotor: at first, 94 ℃, 2min, then, and 94 ℃, 30s; 55 ℃, 30s; 72 ℃, 30s; 20 circulations; At last, 72 ℃, 10min.

The construction process of pCAG-loxP-mRFP-loxP-EGFP is as follows:

With the method for conventional PCR from pDB587 (referring to M.Fischer et al., 2004, A brilliantmonomeric red fluorescent protein to visualize cytoskeleton dynamics inDictyostelium.FEBS Letters.577:227-232) in mRFP is increased out, the PCR product is cut with ClaI and BclI enzyme, and replace the ClaI of pCALL2 and the sequence between the BclI, obtain pCAG-loxP-mRFP-loxP.With Bam HI and NotI the EGFP sequence among the pEGFP-N2 is scaled off then, and insert among the pCAG-loxP-mRFP-loxP between the BglII and NotI, obtain pCAG-loxP-mRFP-loxP-EGFP.

Primer sequence:

mRFP?F(SEQ?ID?NO：21)：

ATCGATACCATGGCCAGCTCCGAG

mRFP?R(SEQ?ID?NO：22)：

TGATCATTAGCTTCCAGCGCCTGTGC

The pcr amplification condition is as follows:

At first, 94 ℃, 2min; Then, 94 ℃, 30s; 55 ℃, 30s; 72 ℃, 45s; 20 circulations; At last, 72 ℃, 10min.

The inventor cuts pAlbMerCreMerSVPA with MluI and PmeI, reclaim and contain the Alb promotor, and the fragment of the 6.1kb of MerCreMer gene and SV40polyA is used for zygote is carried out procaryotic injection.With the intrauterine of the zygote transplation after the injection, to finish fetal development to the female mouse of false pregnancy.F0 was born back one month for mouse, took out mouse tail DNA and carried out the genome evaluation, selected to have integrated segmental positive mouse on the genome.

Identify that used primer sequence is as follows:

Alb?Enh/Pro?GT-F(SEQ?ID?NO：23)：

GCTGATGCAGAGTGAAGAGTGTGTGA；

Alb?Enh/Pro?GT-R(SEQ?ID?NO：24)：

GGCATGGAAGCATGCCACATT；

Cre?GT-F(SEQ?ID?NO：25)：

GAGCATACCTGGAAAATGCTTCTGT；

Cre?GT-R(SEQ?ID?NO：26)：

CCCAGGCTAAGTGCCTTCTCTACA；

CD34?enh-F(SEQ?ID?NO：14)：

5’-ACGCGTGAGTGGTCTGGATCCAAACTGAGTG-3’；

CD34?enh-R(SEQ?ID?NO：15)：

5’-AAGCTTAGCTATAATGCAACCAGAATATAAAGCAT-3’。

The pcr amplification condition is as follows:

Alb Enh/Pro, 94 ℃, 2min; 94 ℃, 30s; 59 ℃, 30s; 72 ℃, 30s; 35 circulations; 72 ℃, 10min.Cre, 94 ℃, 2min; 94 ℃, 30s; 58 ℃, 30s; 72 ℃, 30s; 28 circulations; 72 ℃, 10min.

CD34 enhancer, 94 ℃, 2min; 94 ℃, 30s; 58 ℃, 30s; 72 ℃, 50s; 28 circulations; 72 ℃, 10min.

Result such as Fig. 9, result obtain 7 positive head altogether and build and be (F0 generation).

Next, it is to hybridize with the C57 wild-type mice respectively that 7 head are built, and has obtained F1 for mouse.F1 for mouse in, be integrated into the male filial generation by taking out mouse tail DNA identified gene group.

Select the male generation mice, by the method for Western blot and RT-PCR, the higher head of selection expression level builds and is, cultivate the MerCreMer transgenic mice that isozygotys, be called the MCM mouse, with the tIB mouse of the isozygotying hybridization of aforementioned preparation, to obtain double transgenic mouse MCM/tIB.

The MCM/tIB mouse of 6-8 about week injected 4-OHT by belly, 1mg/ days, injects continuously 5 days.Get 5 days hepatic tissues since the 6th day continuously, detect the situation of liver generation apoptosis by TUNEL.Determine that space-time induces the liver cell apoptosis adjustablely, caused liver injury effectively.

The inventor extracts liver cell from the liver of resulting mouse, contain MerCreMer construction and tIB construction in the hepatocellular genome of this kind, but this cell vitro culture and breeding.

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Sequence table

＜110〉Shanghai Inst. of Life Science, CAS

＜120〉application in transgenosis construct and the empty in the preparation adjustable liver damage model thereof

<130>085115

<160>26

<170>PatentIn?version?3.3

<210>1

<211>11323

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉recombinant vectors

<400>1

gtcgacattg?attattgact?agttattaat?agtaatcaat?tacggggtca?ttagttcata 60

gcccatatat?ggagttccgc?gttacataac?ttacggtaaa?tggcccgcct?ggctgaccgc 120

ccaacgaccc?ccgcccattg?acgtcaataa?tgacgtatgt?tcccatagta?acgccaatag 180

ggactttcca?ttgacgtcaa?tgggtggact?atttacggta?aactgcccac?ttggcagtac 240

atcaagtgta?tcatatgcca?agtacgcccc?ctattgacgt?caatgacggt?aaatggcccg 300

cctggcatta?tgcccagtac?atgaccttat?gggactttcc?tacttggcag?tacatctacg 360

tattagtcat?cgctattacc?atgggtcgag?gtgagcccca?cgttctgctt?cactctcccc 420

atctcccccc?cctccccacc?cccaattttg?tatttattta?ttttttaatt?attttgtgca 480

gcgatggggg?cggggggggg?gggggcgcgc?gccaggcggg?gcggggcggg?gcgaggggcg 540

gggcggggcg?aggcggagag?gtgcggcggc?agccaatcag?agcggcgcgc?tccgaaagtt 600

tccttttatg?gcgaggcggc?ggcggcggcg?gccctataaa?aagcgaagcg?cgcggcgggc 660

gggagtcgct?gcgttgcctt?cgccccgtgc?cccgctccgc?gccgcctcgc?gccgcccgcc 720

ccggctctga?ctgaccgcgt?tactcccaca?ggtgagcggg?cgggacggcc?cttctcctcc 780

gggctgtaat?tagcgcttgg?tttaatgacg?gctcgtttct?tttctgtggc?tgcgtgaaag 840

ccttaaaggg?ctccgggagg?gccctttgtg?cgggggggag?cggctcgggg?ggtgcgtgcg 900

tgtgtgtgtg?cgtggggagc?gccgcgtgcg?gcccgcgctg?cccggcggct?gtgagcgctg 960

cgggcgcggc?gcggggcttt?gtgcgctccg?cgtgtgcgcg?aggggagcgc?ggccgggggc 1020

ggtgccccgc?ggtgcggggg?ggctgcgagg?ggaacaaagg?ctgcgtgcgg?ggtgtgtgcg 1080

tgggggggtg?agcagggggt?gtgggcgcgg?cggtcgggct?gtaacccccc?cctgcacccc 1140

cctccccgag?ttgctgagca?cggcccggct?tcgggtgcgg?ggctccgtgc?ggggcgtggc 1200

gcggggctcg?ccgtgccggg?cggggggtgg?cggcaggtgg?gggtgccggg?cggggcgggg 1260

ccgcctcggg?ccggggaggg?ctcgggggag?gggcgcggcg?gccccggagc?gccggcggct 1320

gtcgaggcgc?ggcgagccgc?agccattgcc?ttttatggta?atcgtgcgag?agggcgcagg 1380

gacttccttt?gtcccaaatc?tggcggagcc?gaaatctggg?aggcgccgcc?gcaccccctc 1440

tagcgggcgc?gggcgaagcg?gtgcggcgcc?ggcaggaagg?aaatgggcgg?ggagggcctt 1500

cgtgcgtcgc?cgcgccgccg?tccccttctc?catctccagc?ctcggggctg?ccgcaggggg 1560

acggctgcct?tcggggggga?cggggcaggg?cggggttcgg?cttctggcgt?gtgaccggcg 1620

gctctagagc?ctctgctaac?catgttcatg?ccttcttctt?tttcctacag?ctcctgggca 1680

acgtgctggt?tattgtgctg?tctcatcatt?ttggcaaaga?attcctcgat?cgagggacct 1740

aataacttcg?tatagcatac?attatacgaa?gttatattaa?gggttccgca?agcttcctag 1800

actagtcgac?ggtatcgata?agcagcttga?tgatctgtga?catggcggat?cccgtcgttt 1860

tacaacgtcg?tgactgggaa?aaccctggcg?ttacccaact?taatcgcctt?gcagcacatc 1920

cccctttcgc?cagctggcgt?aatagcgaag?aggcccgcac?cgatcgccct?tcccaacagt 1980

tgcgcagcct?gaatggcgaa?tggcgctttg?cctggtttcc?ggcaccagaa?gcggtgccgg 2040

aaagctggct?ggagtgcgat?cttcctgagg?ccgatactgt?cgtcgtcccc?tcaaactggc 2100

agatgcacgg?ttacgatgcg?cccatctaca?ccaacgtaac?ctatcccatt?acggtcaatc 2160

cgccgtttgt?tcccacggag?aatccgacgg?gttgttactc?gctcacattt?aatgttgatg 2220

aaagctggct?acaggaaggc?cagacgcgaa?ttatttttga?tggcgttaac?tcggcgtttc 2280

atctgtggtg?caacgggcgc?tgggtcggtt?acggccagga?cagtcgtttg?ccgtctgaat 2340

ttgacctgag?cgcattttta?cgcgccggag?aaaaccgcct?cgcggtgatg?gtgctgcgtt 2400

ggagtgacgg?cagttatctg?gaagatcagg?atatgtggcg?gatgagcggc?attttccgtg 2460

acgtctcgtt?gctgcataaa?ccgactacac?aaatcagcga?tttccatgtt?gccactcgct 2520

ttaatgatga?tttcagccgc?gctgtactgg?aggctgaagt?tcagatgtgc?ggcgagttgc 2580

gtgactacct?acgggtaaca?gtttctttat?ggcagggtga?aacgcaggtc?gccagcggca 2640

ccgcgccttt?cggcggtgaa?attatcgatg?agcgtggtgg?ttatgccgat?cgcgtcacac 2700

tacgtctgaa?cgtcgaaaac?ccgaaactgt?ggagcgccga?aatcccgaat?ctctatcgtg 2760

cggtggttga?actgcacacc?gccgacggca?cgctgattga?agcagaagcc?tgcgatgtcg 2820

gtttccgcga?ggtgcggatt?gaaaatggtc?tgctgctgct?gaacggcaag?ccgttgctga 2880

ttcgaggcgt?taaccgtcac?gagcatcatc?ctctgcatgg?tcaggtcatg?gatgagcaga 2940

cgatggtgca?ggatatcctg?ctgatgaagc?agaacaactt?taacgccgtg?cgctgttcgc 3000

attatccgaa?ccatccgctg?tggtacacgc?tgtgcgaccg?ctacggcctg?tatgtggtgg 3060

atgaagccaa?tattgaaacc?cacggcatgg?tgccaatgaa?tcgtctgacc?gatgatccgc 3120

gctggctacc?ggcgatgagc?gaacgcgtaa?cgcgaatggt?gcagcgcgat?cgtaatcacc 3180

cgagtgtgat?catctggtcg?ctggggaatg?aatcaggcca?cggcgctaat?cacgacgcgc 3240

tgtatcgctg?gatcaaatct?gtcgatcctt?cccgcccggt?gcagtatgaa?ggcggcggag 3300

ccgacaccac?ggccaccgat?attatttgcc?cgatgtacgc?gcgcgtggat?gaagaccagc 3360

ccttcccggc?tgtgccgaaa?tggtccatca?aaaaatggct?ttcgctacct?ggagagacgc 3420

gcccgctgat?cctttgcgaa?tacgcccacg?cgatgggtaa?cagtcttggc?ggtttcgcta 3480

aatactggca?ggcgtttcgt?cagtatcccc?gtttacaggg?cggcttcgtc?tgggactggg 3540

tggatcagtc?gctgattaaa?tatgatgaaa?acggcaaccc?gtggtcggct?tacggcggtg 3600

attttggcga?tacgccgaac?gatcgccagt?tctgtatgaa?cggtctggtc?tttgccgacc 3660

gcacgccgca?tccagcgctg?acggaagcaa?aacaccagca?gcagtttttc?cagttccgtt 3720

tatccgggca?aaccatcgaa?gtgaccagcg?aatacctgtt?ccgtcatagc?gataacgagc 3780

tcctgcactg?gatggtggcg?ctggatggta?agccgctggc?aagcggtgaa?gtgcctctgg 3840

atgtcgctcc?acaaggtaaa?cagttgattg?aactgcctga?actaccgcag?ccggagagcg 3900

ccgggcaact?ctggctcaca?gtacgcgtag?tgcaaccgaa?cgcgaccgca?tggtcagaag 3960

ccgggcacat?cagcgcctgg?cagcagtggc?gtctggcgga?aaacctcagt?gtgacgctcc 4020

ccgccgcgtc?ccacgccatc?ccgcatctga?ccaccagcga?aatggatttt?tgcatcgagc 4080

tgggtaataa?gcgttggcaa?tttaaccgcc?agtcaggctt?tctttcacag?atgtggattg 4140

gcgataaaaa?acaactgctg?acgccgctgc?gcgatcagtt?cacccgtgca?ccgctggata 4200

acgacattgg?cgtaagtgaa?gcgacccgca?ttgaccctaa?cgcctgggtc?gaacgctgga 4260

aggcggcggg?ccattaccag?gccgaagcag?cgttgttgca?gtgcacggca?gatacacttg 4320

ctgatgcggt?gctgattacg?accgctcacg?cgtggcagca?tcaggggaaa?accttattta 4380

tcagccggaa?aacctaccgg?attgatggta?gtggtcaaat?ggcgattacc?gttgatgttg 4440

aagtggcgag?cgatacaccg?catccggcgc?ggattggcct?gaactgccag?ctggcgcagg 4500

tagcagagcg?ggtaaactgg?ctcggattag?ggccgcaaga?aaactatccc?gaccgcctta 4560

ctgccgcctg?ttttgaccgc?tgggatctgc?cattgtcaga?catgtatacc?ccgtacgtct 4620

tcccgagcga?aaacggtctg?cgctgcggga?cgcgcgaatt?gaattatggc?ccacaccagt 4680

ggcgcggcga?cttccagttc?aacatcagcc?gctacagtca?acagcaactg?atggaaacca 4740

gccatcgcca?tctgctgcac?gcggaagaag?gcacatggct?gaatatcgac?ggtttccata 4800

tggggattgg?tggcgacgac?tcctggagcc?cgtcagtatc?ggcggaattc?cagctgagcg 4860

ccggtcgcta?ccattaccag?ttggtctggt?gtcaggggat?cccccgggct?gcagccaata 4920

tgattgaaca?agatggattg?cacgcaggtt?ctccggccgc?ttgggtggag?aggctattcg 4980

gctatgactg?ggcacaacag?acaatcggct?gctctgatgc?cgccgtgttc?cggctgtcag 5040

cgcaggggcg?cccggttctt?tttgtcaaga?ccgacctgtc?cggtgccctg?aatgaactgc 5100

aggacgaggc?agcgcggcta?tcgtggctgg?ccacgacggg?cgttccttgc?gcagctgtgc 5160

tcgacgttgt?cactgaagcg?ggaagggact?ggctgctatt?gggcgaagtg?ccggggcagg 5220

atctcctgtc?atctcacctt?gctcctgccg?agaaagtatc?catcatggct?gatgcaatgc 5280

ggcggctgca?tacgcttgat?ccggctacct?gcccattcga?ccaccaagcg?aaacatcgca 5340

tcgagcgagc?acgtactcgg?atggaagccg?gtcttgtcga?tcaggatgat?ctggacgaag 5400

agcatcaggg?gctcgcgcca?gccgaactgt?tcgccaggct?caaggcgcgc?atgcccgacg 5460

gcgaggatct?cgtcgtgacc?catggcgatg?cctgcttgcc?gaatatcatg?gtggaaaatg 5520

gccgcttttc?tggattcatc?gactgtggcc?ggctgggtgt?ggcggaccgc?tatcaggaca 5580

tagcgttggc?tacccgtgat?attgctgaag?agcttggcgg?cgaatgggct?gaccgcttcc 5640

tcgtgcttta?cggtatcgcc?gctcccgatt?cgcagcgcat?cgccttctat?cgccttcttg 5700

acgagttctt?ctgaggggat?caattctcta?ggcttgggat?ctttgtgaag?gaaccttact 5760

tctgtggtgt?gacataattg?gacaaactac?ctacagagat?ttaaagctct?aaggtaaata 5820

taaaattttt?aagtgtataa?tgtgttaaac?tactgattct?aattgtttgt?gtattttaga 5880

ttcacagtcc?caaggctcat?ttcaggcccc?tcagtcctca?cagtctgttc?atgatcataa 5940

tcagccatac?cacatttgta?gaggttttac?ttgctttaaa?aaacctccca?cacctccccc 6000

tgaacctgaa?acataaaatg?aatgcaattg?ttgttgttaa?cttgtttatt?gcagcttata 6060

atggttacaa?ataaagcaat?agcatcacaa?atttcacaaa?taaagcattt?ttttcactgc 6120

attctagttg?tgtttgtcca?aactcatcaa?tgtatcttat?catgtctgga?tcataatcag 6180

ccataccaca?tttgtagagg?ttttacttgc?tttaaaaaac?cttccccaca?cctccccctg 6240

aactgaaaca?taaaatgaat?gcaattgttg?ttgttaactt?gtttattgca?gcttataatg 6300

gttacaaata?aagcaatagc?atcacaaatt?tcacaaataa?agcatttttt?tcactgcatt 6360

ctagttgtgg?tttgtccaaa?ctcatcaatg?tatcttatca?tgtctggatc?ataatcagcc 6420

ataccacatt?tgtagaggtt?ttacttgctt?taaaaaacct?cccacacctc?cccctgaacc 6480

tgaaacataa?aatgaatgca?attgttgttg?ttaacttgtt?tattgcagct?tataatggtt 6540

acaaataaag?caatagcatc?acaaatttca?caaataaagc?atttttttca?ctgcattcta 6600

gttgtggttt?gtccaaactc?atcaatgtat?cttatcatgt?ctggatccac?tagttctagc 6660

tagtctaggt?cgatgcagga?taacttcgta?tagcatacat?tatacgaagt?tatagatcta 6720

ccatgggcag?ccaggccagc?cgctccttca?accaaggaag?aatagagcca?gattctgaaa 6780

gtcaggaaga?aatcatccac?aacattgcca?gacatctcgc?ccaaataggc?gatgagatgg 6840

accacaacat?ccagcccaca?ctggtgagac?agctagccgc?acagttcatg?aatggcagcc 6900

tgtcggagga?agacaaaagg?aactgcctgg?ccaaagccct?tgatgaggtg?aagacagcct 6960

tccccagaga?catggagaac?gacaaggcca?tgctgataat?gaccatgctg?ttggccaaaa 7020

aagtggccag?tcacgcacca?tctttgctcc?gtgatgtctt?ccacacgact?gtcaacttta 7080

ttaaccagaa?cctattctcc?tatgtgagga?acttggttag?aaacgagatg?gactgactcg 7140

acggtaccgc?gggcccggga?tccgcccctc?tccctccccc?ccccctaacg?ttactggccg 7200

aagccgcttg?gaataaggcc?ggtgtgcgtt?tgtctatatg?ttattttcca?ccatattgcc 7260

gtcttttggc?aatgtgaggg?cccggaaacc?tggccctgtc?ttcttgacga?gcattcctag 7320

gggtctttcc?cctctcgcca?aaggaatgca?aggtctgttg?aatgtcgtga?aggaagcagt 7380

tcctctggaa?gcttcttgaa?gacaaacaac?gtctgtagcg?accctttgca?ggcagcggaa 7440

ccccccacct?ggcgacaggt?gcctctgcgg?ccaaaagcca?cgtgtataag?atacacctgc 7500

aaaggcggca?caaccccagt?gccacgttgt?gagttggata?gttgtggaaa?gagtcaaatg 7560

gctctcctca?agcgtattca?acaaggggct?gaaggatgcc?cagaaggtac?cccattgtat 7620

gggatctgat?ctggggcctc?ggtgcacatg?ctttacatgt?gtttagtcga?ggttaaaaaa 7680

acgtctaggc?cccccgaacc?acggggacgt?ggttttcctt?tgaaaaacac?gatgataata 7740

tggccacaac?catggacggg?tccggggagc?agcttgggag?cggcgggccc?accagctctg 7800

aacagatcat?gaagacaggg?gcctttttgc?tacagggttt?catccaggat?cgagcaggga 7860

ggatggctgg?ggagacacct?gagctgacct?tggagcagcc?gccccaggat?gcgtccacca 7920

agaagctgag?cgagtgtctc?cggcgaattg?gagatgaact?ggacagcaat?atggagctgc 7980

agaggatgat?tgctgacgtg?gacacggact?ccccccgaga?ggtcttcttc?cgggtggcag 8040

ctgacatgtt?tgctgatggc?aacttcaact?ggggccgcgt?ggttgccctc?ttctactttg 8100

ctagcaaact?ggtgctcaag?gccctgtgca?ctaaagtgcc?cgagctgatc?agaaccatca 8160

tgggctggac?actggacttc?ctccgtgagc?ggctgcttgt?ctggatccaa?gaccagggtg 8220

gctgggaagg?cctcctctcc?tacttcggga?cccccacatg?gcagacagtg?accatctttg 8280

tggctggagt?cctcaccgcc?tcgctcacca?tctggaagaa?gatgggctga?ctcgaggcgg 8340

ccgcgatctt?tttccctctg?ccaaaaatta?tggggacatc?atgaagcccc?ttgagcatct 8400

gacttctggc?taataaagga?aatttatttt?cattgcaata?gtgtgttgga?attttttgtg 8460

tctctcactc?ggaaggacat?atgggagggc?aaatcattta?aaacatcaga?atgagtattt 8520

ggtttagagt?ttggcaacat?atgccatatg?ctggctgcca?tgaacaaagg?tggctataaa 8580

gaggtcatca?gtatatgaaa?cagccccctg?ctgtccattc?cttattccat?agaaaagcct 8640

tgacttgagg?ttagattttt?tttatatttt?gttttgtgtt?atttttttct?ttaacatccc 8700

taaaattttc?cttacatgtt?ttactagcca?gatttttcct?cctctcctga?ctactcccag 8760

tcatagctgt?ccctcttctc?ttatgaagat?ccctcgacct?gcagcccaag?cttggcgtaa 8820

tcatggtcat?agctgtttcc?tgtgtgaaat?tgttatccgc?tcacaattcc?acacaacata 8880

cgagccggaa?gcataaagtg?taaagcctgg?ggtgcctaat?gagtgagcta?actcacatta 8940

attgcgttgc?gctcactgcc?cgctttccag?tcgggaaacc?tgtcgtgcca?gcggatccgc 9000

atctcaatta?gtcagcaacc?atagtcccgc?ccctaactcc?gcccatcccg?cccctaactc 9060

cgcccagttc?cgcccattct?ccgccccatg?gctgactaat?tttttttatt?tatgcagagg 9120

ccgaggccgc?ctcggcctct?gagctattcc?agaagtagtg?aggaggcttt?tttggaggcc 9180

taggcttttg?caaaaagcta?acttgtttat?tgcagcttat?aatggttaca?aataaagcaa 9240

tagcatcaca?aatttcacaa?ataaagcatt?tttttcactg?cattctagtt?gtggtttgtc 9300

caaactcatc?aatgtatctt?atcatgtctg?gatccgctgc?attaatgaat?cggccaacgc 9360

gcggggagag?gcggtttgcg?tattgggcgc?tcttccgctt?cctcgctcac?tgactcgctg 9420

cgctcggtcg?ttcggctgcg?gcgagcggta?tcagctcact?caaaggcggt?aatacggtta 9480

tccacagaat?caggggataa?cgcaggaaag?aacatgtgag?caaaaggcca?gcaaaaggcc 9540

aggaaccgta?aaaaggccgc?gttgctggcg?tttttccata?ggctccgccc?ccctgacgag 9600

catcacaaaa?atcgacgctc?aagtcagagg?tggcgaaacc?cgacaggact?ataaagatac 9660

caggcgtttc?cccctggaag?ctccctcgtg?cgctctcctg?ttccgaccct?gccgcttacc 9720

ggatacctgt?ccgcctttct?cccttcggga?agcgtggcgc?tttctcaatg?ctcacgctgt 9780

aggtatctca?gttcggtgta?ggtcgttcgc?tccaagctgg?gctgtgtgca?cgaacccccc 9840

gttcagcccg?accgctgcgc?cttatccggt?aactatcgtc?ttgagtccaa?cccggtaaga 9900

cacgacttat?cgccactggc?agcagccact?ggtaacagga?ttagcagagc?gaggtatgta 9960

ggcggtgcta?cagagttctt?gaagtggtgg?cctaactacg?gctacactag?aaggacagta 10020

tttggtatct?gcgctctgct?gaagccagtt?accttcggaa?aaagagttgg?tagctcttga 10080

tccggcaaac?aaaccaccgc?tggtagcggt?ggtttttttg?tttgcaagca?gcagattacg 10140

cgcagaaaaa?aaggatctca?agaagatcct?ttgatctttt?ctacggggtc?tgacgctcag 10200

tggaacgaaa?actcacgtta?agggattttg?gtcatgagat?tatcaaaaag?gatcttcacc 10260

tagatccttt?taaattaaaa?atgaagtttt?aaatcaatct?aaagtatata?tgagtaaact 10320

tggtctgaca?gttaccaatg?cttaatcagt?gaggcaccta?tctcagcgat?ctgtctattt 10380

cgttcatcca?tagttgcctg?actccccgtc?gtgtagataa?ctacgatacg?ggagggctta 10440

ccatctggcc?ccagtgctgc?aatgataccg?cgagacccac?gctcaccggc?tccagattta 10500

tcagcaataa?accagccagc?cggaagggcc?gagcgcagaa?gtggtcctgc?aactttatcc 10560

gcctccatcc?agtctattaa?ttgttgccgg?gaagctagag?taagtagttc?gccagttaat 10620

agtttgcgca?acgttgttgc?cattgctaca?ggcatcgtgg?tgtcacgctc?gtcgtttggt 10680

atggcttcat?tcagctccgg?ttcccaacga?tcaaggcgag?ttacatgatc?ccccatgttg 10740

tgcaaaaaag?cggttagctc?cttcggtcct?ccgatcgttg?tcagaagtaa?gttggccgca 10800

gtgttatcac?tcatggttat?ggcagcactg?cataattctc?ttactgtcat?gccatccgta 10860

agatgctttt?ctgtgactgg?tgagtactca?accaagtcat?tctgagaata?gtgtatgcgg 10920

cgaccgagtt?gctcttgccc?ggcgtcaata?cgggataata?ccgcgccaca?tagcagaact 10980

ttaaaagtgc?tcatcattgg?aaaacgttct?tcggggcgaa?aactctcaag?gatcttaccg 11040

ctgttgagat?ccagttcgat?gtaacccact?cgtgcaccca?actgatcttc?agcatctttt 11100

actttcacca?gcgtttctgg?gtgagcaaaa?acaggaaggc?aaaatgccgc?aaaaaaggga 11160

ataagggcga?cacggaaatg?ttgaatactc?atactcttcc?tttttcaata?ttattgaagc 11220

atttatcagg?gttattgtct?catgagcgga?tacatatttg?aatgtattta?gaaaaataaa 11280

caaatagggg?ttccgcgcac?atttccccga?aaagtgccac?ctg 11323

<210>2

<211>38

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉primer

<400>2

ctctgaattc?ccatggattt?ccagagttgt?ctttatgc 38

<210>3

<211>34

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉primer

<400>3

gcacctcgag?ttagggaggg?aagaagagct?tctt 34

<210>4

<211>30

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉primer

<400>4

gcaggaattc?ccatggacgg?gtccggggag 30

<210>5

<211>33

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉primer

<400>5

gtggctcgag?tcagcccatc?ttcttccaga?tgg 33

<210>6

<211>31

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉primer

<400>6

atatgaattc?gcatgggcag?ccaggccagc?c 31

<210>7

<211>35

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉primer

<400>7

gcgcctcgag?tcagtccatc?tcgtttctaa?ccaag 35

<210>8

<211>29

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉primer

<400>8

atatagatct?accatgggca?gccaggcca 29

<210>9

<211>28

<212>DNA

＜213〉artificial sequence

<221>misc?feature

＜223〉primer

<400>9

atatagatct?accatggacg?ggtccggg 28

<210>10

<211>24

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉primer

<400>10

gtgacgtctc?gttgctgcat?aaac 24

<210>11

<211>23

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉primer

<400>11

cacggcgtta?aagttgttct?gct 23

<210>12

<211>24

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉primer

<400>12

gaggttaaaa?aaacgtctag?gccc 24

<210>13

<211>22

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉primer

<400>13

tttggcagag?ggaaaaagat?cg 22

<210>14

<211>31

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉primer

<400>14

acgcgtgagt?ggtctggatc?caaactgagt?g 31

<210>15

<211>35

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉primer

<400>15

aagcttagct?ataatgcaac?cagaatataa?agcat 35

<210>16

<211>38

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉primer

<400>16

tatactcgag?gcgcgccacc?atgcccaaga?agaagagg 38

<210>17

<211>38

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉primer

<400>17

tatactcgag?gcgcgccacc?atggccaaga?agaagagg 38

<210>18

<211>39

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉primer

<400>18

atatgcggcc?gcgagctcta?atcgccatct?tccagcagg 39

<210>19

<211>31

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉primer

<400>19

atatggatcc?atggggttga?tttggatgta?g 31

<210>20

<211>30

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉primer

<400>20

cagtctcgag?ggaaaggtga?tctgtgtgca 30

<210>21

<211>24

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉primer

<400>21

atcgatacca?tggccagctc?cgag 24

<210>22

<211>26

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉primer

<400>22

tgatcattag?cttccagcgc?ctgtgc 26

<210>23

<211>26

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉primer

<400>23

gctgatgcag?agtgaagagt?gtgtga 26

<210>24

<211>21

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉primer

<400>24

ggcatggaag?catgccacat?t 21

<210>25

<211>25

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉primer

<400>25

gagcatacct?ggaaaatgct?tctgt 25

<210>26

<211>24

<212>DNA

＜213〉artificial sequence

<221>misc_feature

＜223〉primer

<400>26

cccaggctaa?gtgccttctc?taca 24

Claims (10)

1. construction combination that is used to prepare space-time adjustable liver damage model is characterized in that it comprises:

(1) construction 1, and from 5 ' to 3 ' comprises the element that following operability links to each other successively:

Promotor, LoxP sequence, reporter gene sequence, terminator 1, LoxP sequence, tBid gene order, Bax gene order, terminator 2; With

(2) construction 2, and from 5 ' to 3 ' comprises the element that following operability links to each other successively:

Promotor, mutant estrogen receptor ligands binding domains gene order, Cre recombinase gene sequence, and terminator; Wherein said mutant estrogen receptor ligands binding domains can be activated and then activate the Cre recombinase active by estrogen analogue, do not activated by the animal body inner estrogen.

2. construction as claimed in claim 1 is characterized in that, in the construction 1, described reporter gene is a beta-galactosidase gene.

3. construction as claimed in claim 1 is characterized in that, in the construction 1, described promotor is the CAG promotor; Or

In the construction 2, described promotor is an albumin promoter.

4. construction as claimed in claim 1 is characterized in that, in the construction 2, between described Cre recombinase gene and terminator, also contains a mutant estrogen receptor ligands binding domains gene order.

5. construction as claimed in claim 1 is characterized in that, in the construction 1, between described tBid gene and the Bax gene, also contains internal ribosome and inserts site sequence.

6. a cell is characterized in that, is integrated with the arbitrary described construction combination of claim 1-5 in the genome of described cell.

7. cell as claimed in claim 6 is characterized in that described cell is a liver cell.

8. method for preparing transgenic nonhuman mammal zygote, described zygote being used to prepares space-time adjustable liver damage model, it is characterized in that, and described method comprises:

With the zygote that the described construction 1 of claim 1 is introduced non-human mammal, obtain to have changed over to the zygote of described construction 1; Or

With the zygote that the described construction 2 of claim 1 is introduced non-human mammal, obtain to have changed over to the zygote of described construction 2.

9. method as claimed in claim 8 is characterized in that described non-human mammal is a mouse.

10. a method for preparing space-time adjustable liver damage model is characterized in that, described method comprises:

(1) zygote that the described construction 1 of claim 1 is introduced non-human mammal, the zygote that has changed described construction over to is moved in the uterine tube of false pregnancy non-human mammal, make it to continue to grow, generate the non-human mammal that is integrated with the described construction 1 of claim 1 in the genome;

(2) zygote that the described construction 2 of claim 1 is introduced non-human mammal, the zygote that has changed described construction over to is moved in the uterine tube of false pregnancy non-human mammal, make it to continue to grow, generate the non-human mammal that is integrated with the described construction 2 of claim 1 in the genome; With

The non-human mammal that (1) and (2) is obtained carries out mating, obtains to be integrated with in the genome non-human mammal of described construction 1 of claim 1 and construction 2.

Images