CN103361342B - A kind of method and its application of transgenosis positioning integration - Google Patents
A kind of method and its application of transgenosis positioning integration Download PDFInfo
- Publication number
- CN103361342B CN103361342B CN201210090470.2A CN201210090470A CN103361342B CN 103361342 B CN103361342 B CN 103361342B CN 201210090470 A CN201210090470 A CN 201210090470A CN 103361342 B CN103361342 B CN 103361342B
- Authority
- CN
- China
- Prior art keywords
- cell
- gene
- host cell
- loxp
- construction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The present invention relates to a kind of method and its application of transgenosis positioning integration.Specifically, the present invention provides a kind of loxP elements of variation.It is " CACCT ", the loxP element as to make a variation by " ATAAC " series jump of inverted repeats in the site loxp of wild type.The integration specificity and integration efficiency of cre-loxp system can be greatly improved in the loxP element of the variation.Efficient Gene targeting may be implemented accordingly.
Description
Technical field
The invention belongs to field of biotechnology, in particular it relates to a kind of method of transgenosis positioning integration and its
Using.
Background technique
The method of prepare transgenosis animal has very important effect in basic research and application study.Science at present
Family carried out a variety of transgenic technologys, to improve the integration efficiency of the targeting sum of transgenic animals.But at present big
In animal, the integration efficiency and expression rate of transgenosis are not satisfactory.
Current international transgenic method is microinjection, and the method higher cost, success rate is very low, with regard to transgenosis
For animal-galactophore biological reactor, success rate only 3% or so.Microinjection causes foreign gene random on chromosome
Integration, and the expression of transgenosis is greatly influenced by host genome around.The random integration of foreign gene may cause down
State problem: the probability that 1. integrated transgenes enter in inactive chromosome sequence relatively enlivens chromosomal region height, by integration site shadow
It rings, the expression of most of transgenosis is low or does not express；2. integrated transgene enters high frequency recombination site, it may occur that heredity is unstable
It is fixed；3. random exogenous origin gene integrator often cause endogenous gene be mutated or expression change, influence transgenic animals normal development and
Health；4. the transgenic animals of multiple-sites integration, in offspring because integration site separation cause transgene expression character change and
Breeding is difficult；5. integrating, copy number is too high or too low to be easily led to transgene expression lowly or does not express.
Problem above is that research gene function, creation animal disease model, the commercially valuable model of exploitation and initiative turn base
Because of the key obstacle of breeding new material.The positioning integration method of exploitation transgenosis is possible to costly caused by releasing traditional technology
High, the negative effect of inefficiency promotes the industrialized development of breeding transgenic livestock.But there is presently no control target gene to exist
The method of genome specific position high effective integration, therefore there is an urgent need in the art to develop a kind of efficient transgenosis positioning integration
Method.
Summary of the invention
It is an object of the invention to provide a kind of method and its application of transgenosis positioning integration.
In the first aspect of the present invention, a kind of loxP element of variation is provided, the loxP element of the variation has SEQ
Sequence shown in ID NO.:30.
In the second aspect of the present invention, a kind of construction is provided, the construction from 5 ' to 3 ' is successively containing following
Element:
(a) the loxP element of variation described in first aspect present invention；(b) exogenous gene expression box and/or selection markers table
Up to box；(c) the wild type loxP element with sequence shown in SEQ ID NO.:28；
Wherein, element (a) and element (c) can be interchanged.
In another preferred example, the selection markers are because of neomycin gene or puromycin resistance gene.
In another preferred example, the foreign gene is selected from the group: lysozyme gene, salmon's calcitonin gene or blood
Pure protein gene.
In another preferred example, element (a) and element (c) are to be collectively aligned.In another preferred example, the element
(a) and element (c) is incorgruous arrangement.
In the third aspect of the present invention, a kind of carrier is provided, the carrier contains structure described in second aspect of the present invention
Build object.
In the fourth aspect of the present invention, a kind of host cell is provided, the host cell contains second party of the present invention
Construction described in face or its chromosomal integration have construction described in one or more second aspect of the present invention.
In another preferred example, the cell of host cell behaviour or non-human mammal.In another preferred example,
The non-human mammal is selected from: goat, sheep, pig, ox, dog and rabbit, preferably goat.
In another preferred example, the host cell is goat adult body cell or Goat Fetus body cell or goat
Embryonic stem cell.
In another preferred example, the host cell will be described in second aspect of the present invention with method selected from the group below
Construction imports cell: homologous recombination method, microinjection, electroporation, lipofection, calcium phosphate precipitation, disease
Malicious infection method or sperm-mediated gene transfer.
In the fifth aspect of the invention, a kind of method of prepare transgenosis animal is provided, comprising steps of
(i) existing for the Cre recombinase under the conditions of, the carrier described in the third aspect of the present invention converts fourth aspect institute
The cell stated；The cytothesis of conversion is animal body by (ii), to obtain transgenic animals.
In another preferred example, step (i) is comprising steps of (i-1) Cre expression of enzymes carrier and the third aspect of the present invention institute
Cell described in the carrier cotransformation fourth aspect stated；Or (i-2) with the active TAT-Cre recombinant protein of cell-penetrating
Under effect, the chromosome of the cell described in fourth aspect of the carrier described in the third aspect of the present invention carries out gene integration.
It should be understood that above-mentioned each technical characteristic of the invention and having in below (eg embodiment) within the scope of the present invention
It can be combined with each other between each technical characteristic of body description, to form a new or preferred technical solution.As space is limited, exist
This no longer tires out one by one states.
Detailed description of the invention
Following drawings is for illustrating specific embodiments of the present invention, rather than limits and be defined by the claims
The scope of the invention.
Fig. 1 shows the sex identification to caprine fetal fibroblast cell as a result, M is DL2000 molecular weight standard, band
It is from bottom to top respectively 100,250,500,750,1000,2000bp；N5, N4-A, N37-A and N37-B are the tire of separation
Youngster；For negative sheep control；+ compareed for positive sheep；Water is PCR system control.
Fig. 2 shows that the integrated transgene qualification result to caprine fetal fibroblast cell, M are DL2000 molecular weight mark
Standard, band are respectively 100,250,500,750,1000,2000bp from bottom to top；N5, N4-A, N37-A and N37-B are separation
Fetus；For negative sheep control；+ compareed for positive sheep；Water is PCR system control.
Fig. 3 shows the qualification result of TAT-Cre recombinant protein, and M marker, SF are the ultrasonication of TAT-Cre thallus
Supernatant afterwards, FT are the liquid that flows through of SP-sepharoseTM pillar, and E1 is the eluent of SPsepharoseTM pillar, and E2 is
The eluent of source 15s pillar.
Fig. 4 is the building flow diagram of salmon calcitonin positioning integration plasmid pTM-sCT2.
Fig. 5 shows artificial synthesized double loxp gene orders.
Fig. 6 shows the building schematic diagram of pBLG-sct plasmid.
Fig. 7 shows complete artificial synthesized salmon calcitonin sequence.
Fig. 8 shows that puro expression frame expands electrophoretogram, wherein M D2000marker；1,2 frame expansion is expressed for puro
Increase electrophoretogram.
Fig. 9 shows that PCR method identifies plasmid pMD-Puro；M is D2000marker；11-20 is conversion picked clones；11,
12,13,14,16,17,18,19,20 be positive colony；21 be negative control.
Figure 10, which is shown, identifies plasmid pMD-Puro electrophoretogram with NotI digestion；M:1kb marker；11-20 is that conversion is chosen
Take clone；Wherein 16,17,18,19,20 be positive colony.
Figure 11 shows the PCR identification map of pTM-sCT2；Wherein, M D2000marker；1-23 is picking monoclonal:
2,19,20 be positive colony；24 be negative control.
Figure 12, which is shown, identifies plasmid pTM-sCT2 electrophoretogram with NotI digestion；M is D2000marker；2,19,20 be sun
Property clone.
Figure 13 shows the digestion identification map of pTM-sCT2；Wherein 1 be DL5000 DNA molecular amount Marker, 2 are
The electrophorogram of I digested plasmid pTM-sCT2 of Not.
Figure 14 shows the end of screening and cloning 5 ' detection electrophoretogram；M is D2000, and 66-69,71,73-85,93 are screening gram
Grand 5 ' end detection electrophoretogram, 67,73,74,78,81,85 be the positive, and 0 is negative control
Figure 15 shows the end of screening and cloning 3 ' detection electrophoretogram；M be 1kb DNA Marker, 20,23,24,34,41,47,
50 be the end of screening and cloning 3 ' detection electrophoretogram, and 0 is negative control.
Figure 16 shows that salmon calcitonin functional gene detects electrophoretogram；M is D2000,10,14,20,23,24,34,41,
47,54,59,67,73,74,79,81,85,89 electrophoretogram is detected for functional gene neo, 1 is positive control, and 2 be negative control.
Figure 17 shows that screening-gene neo detects electrophoretogram；M is D2000,20,23,24,34,41,47,54,59,67,
73,74,79,81,85 electrophoretogram is detected for screening and cloning marker gene neo, 79 be neo gene masculine, and 1 is positive control, and 2 are
Negative control.
Figure 18 shows pBS185 genetic test electrophoretogram；M is D2000；23,24,34,47,59,74,78,81,85 are
Screening and cloning pBS185 genetic test electrophoretogram, wherein 24,34,81 be the gene masculine；0 is negative control.
Figure 19 shows that salmon calcitonin positioning integration clones 5 ' sequencing analysis maps.
Figure 20 shows that salmon calcitonin positioning integration clones 3 ' sequencing analysis maps.
Figure 21 shows that salmon calcitonin positioning recombinant clone 5 ' recombinates theoretical sequence.
Figure 22 shows that salmon calcitonin positioning recombinant clone 3 ' recombinates theoretical sequence.
Figure 23 shows the end of screening and cloning cell strain 5 ' detection electrophoretogram；M is D2000marker；1-12 is picked clones
The end of cell strain 5 ' detection electrophoretogram, No. 10 are positive colony.
Figure 24 shows the end of screening and cloning cell strain 3 ' detection electrophoretogram；M is D2000marker；1-12 is picked clones
The end of cell strain 3 ' detection electrophoretogram, No. 10 are positive colony.
Figure 25 shows that functional gene detects electrophoretogram；M is D2000marker, and 10,14 be screening and cloning functional gene
Sct detects electrophoretogram.
Figure 26 shows pTM-sCT2 plasmid frame recycling figure；M is 1kb DNA Ladder；1pTM-sCT2 plasmid frame
Recycling figure.
Figure 27 shows that hsA expresses frame recycling figure；M is 1kb DNA Ladder；1 expresses frame recycling figure for hsA.
Figure 28 shows plasmid pTM-hSA2 electrophoretogram；M is 1kb DNA Ladder；1-12 is is extracted plasmid electrophoresis
Figure；Wherein 3,5 be positive plasmid；13 be plasmid pTM-sCT2 electrophoretogram.
Figure 29 shows that electrophoretogram is identified in plasmid pTM-hSA2 digestion；M is 1kb DNA Ladder；3 express frame for hsA
Reversed insertion plasmid pTM-sCT2 frame electrophoretogram；5, which express frame forward direction for hsA, is inserted into plasmid pTM-sCT2 frame electrophoretogram；
10 be negative control.
Figure 30 shows the direction plasmid pTM-hSA2 qualification figure；M is 1kb DNA Ladder；1 is the plasmid side pTM-hSA2
To identification primer amplification electrophoretogram.
Figure 31 shows pTM-hSA2 part of theory sequence.
Figure 32 shows the direction plasmid pTM-hSA2 identification sequencing sequence analysis map.
Figure 33 shows that picked clones cell strain 5 ' holds electrophoresis detection figure；M1 is D2000marker；1,2,8-24 is picking
5 ' end electrophoresis detection figure of clone, wherein 11,12,14,20,21,1,2 be the positive；26,5 be positive control；27,6 be negative right
According to.
Figure 34 shows that picked clones cell strain 3 ' holds electrophoresis detection figure；M1 is D2000；1-4,8-25 are picked clones 3 '
Electrophoresis detection figure is held, wherein 11,14,17,20,21,1 is the positive；26,5 be positive control；27,6 be negative control.
Figure 35 shows screening and cloning cell strain functional gene test map；M is 1kb DNA Ladder；1 is screening gram
Grand marker gene test map.
Figure 36 shows screening and cloning cell strain marker gene test map；M is D2000；1,2 base is marked for screening and cloning
Because of test map, 1 is positive colony；3: positive control；4: negative control.
Figure 37 shows human serum albumins positioning recombinant clone 5 ' end recombination theoretical sequence.
Figure 38 shows human serum albumins positioning recombinant clone 3 ' end recombination theoretical sequence.
Figure 39 shows 5 ' end sequencing result map of human serum albumins positioning integration clone.
Figure 40 shows 3 ' end sequencing result map of human serum albumins positioning integration clone.
Figure 41 shows efficient positioning recombination method flow diagram of the invention.
Figure 42 shows the qualification result of human serum albumins mammary gland-specific expression vector.
Specific embodiment
The present inventor after extensive and in-depth study, for the first time it was unexpectedly observed that by reversed in the site loxp of wild type
" ATAAC " of repetitive sequence sports " CACCT ", and the integration that can greatly improve the integration system of cre-loxp unexpectedly is special
Property and integration efficiency.Specifically, the mutation is introduced in the inverted repeats of the site loxp side, is imported altogether containing another
When in the inverted repeats of side with the same plasmid for being mutated the site loxp, under the action of Cre enzyme, foreign gene can be inserted
Enter, forms the site loxp that one, both ends are wild types, the other is the structure in the bilateral mutation site loxp, since bilateral is mutated
The site loxp be not the good substrates of Cre enzyme, therefore deletion is prevented to react, improves stable integration efficiency, accordingly can be with
Realize efficient gene site-directed strategy.The present invention is completed on this basis.
Term
Cre-LoxP system
Cre recombinase coding sequence overall length 1029bp (EMBL database login X03453) encodes 38kDa egg
White matter.Cre recombinase is a kind of monomeric protein being made of 343 amino acid.Belong to λ Int enzyme supergene family, it not only has
There is catalytic activity, and similar to restriction enzyme, can identify special DNA sequence dna, the i.e. site loxP, make the gene between the site loxP
Sequence is deleted or recombination.
LoxP (locus of X-over P1) sequence derives from P1 bacteriophage, be there are two 13bp inverted repeats and
The 8bp sequence of midfeather collectively constitutes, and the intervening sequence of 8bp also determines the direction of loxP simultaneously.Cre enzyme is in catalytic dna
With DNA covalent bond in chain exchange process, the inverted repeats of 13bp is the binding domain of Cre enzyme.
Wild type loxP site sequence is as follows: 5 '-ATAACTTCGTATA-ATGTATGC-TATACGAAGTTAT-3 ' (SEQ
ID NO.:28),
Its complementary series are as follows: 3 '-TATTGAAGCATAT-TACATACG-ATATGCTTCAATA-5 ' (SEQ ID NO.:
29)。
As used herein, term " loxP element " refers to two for being identified by Cre recombinant protein repetition site in the same direction.This
Invention provides a kind of loxP element of mutation, and the nucleotide sequence of the element is as follows: CACCTTTCGTATAATGTATGC
TATACGAAGTTAT (SEQ ID NO.:30).
As used herein, term " Cre enzyme " refers to the protease for mediating specificity recombination between 2 sites loxP, it can be with
The nucleotide sequence between the site loxP is caused to be deleted or recombinate.
As used herein, " foreign gene " refers to that effect is the exogenous DNA molecule of interim effect.It can be used for the outer of the application
Source gene is not particularly limited, including the common various foreign genes in transgenic animals field.Representative example includes (but not
It is limited to): lysozyme gene, salmon's calcitonin gene or Serum Albumin Gene.
As used herein, " riddled basins ", which refer to, is used to screening transgenic cell or transgenic animals in transgenic protocol
Gene, the riddled basins that can be used for the application are not particularly limited, including the common various screenings of transgenic field are marked
Remember gene, representative example includes (but being not limited to): neomycin gene or puromycin resistance gene.
The present invention also provides a kind of construction, the construction from 5 ' to 3 ' successively contains following elements:
(a) the loxP element that the present invention makes a variation；
(b) exogenous gene expression box and/or selection markers expression cassette；
(c) unmanifest (wild type) loxP element with sequence shown in SEQ ID NO.:28；
Wherein, element (a) and element (c) can be interchanged.
In a preference of the invention, the direction of element (a) and element (c) is identical or opposite.
As used herein, term " expression cassette " refers to the module containing element needed for gene to be expressed and expression
One section of polynucleotide sequence.For example, in the present invention, term " selection markers expression cassette " refers to the sequence containing coding selection markers
The polynucleotide sequence of the module of element needed for column and expression.Component needed for expression includes promoter and poly- adenosine
Polyadenylation signal sequence.In addition, selection markers expression cassette can also contain or not contain other sequences, including (but being not limited to):
Enhancer, secretion signal peptide sequence etc..
In the present invention, the promoter suitable for exogenous gene expression box and riddled basins expression cassette can be any
A kind of common promoter, it can be constitutive promoter or inducible promoter.Preferably, the promoter is composing type
Other promoters suitable for eukaryotic expression such as strong promoter, such as bovine beta -lactoglobulin promoter.
As used herein, " be operably coupled to " refer to such a situation: i.e. certain parts of linear DNA molecule being capable of shadow
Ring the activity of same linear DNA molecule other parts.For example, if signal peptide DNA is as precursor expression and participates in dividing for polypeptide
It secretes, then signal peptide (secretion leader sequence) DNA is exactly to be operably coupled to polypeptid DNA；If promoter control sequence turns
Record, then it is to be operably coupled to coded sequence；If ribosome bind site is placed in the position that it can be made to translate, that
It is to be operably coupled to coded sequence.Generally, " be operably coupled to " mean it is adjacent, and for secretion leader sequence then
Mean adjacent in reading frame.
Various elements used in construction of the invention are all as known in the art, therefore those skilled in the art can
To obtain corresponding element with conventional method, such as PCR method, full artificial chemistry synthetic method, enzymatic cleavage methods, then by well known
DNA interconnection technique links together, and is formed construction of the invention.
By construction insertion foreign vector (carrier for being especially suitable for transgenic animals operation) of the invention, just constitute
Carrier of the invention.
By carrier and Cre expression of enzymes carrier cotransformation host cell of the invention；Or with have cell-penetrating it is active
TAT-Cre recombinant protein mediates Vectors Host cells chromosome of the invention to be integrated.
The present invention also provides a kind of methods of positioning integration foreign gene, comprising steps of the condition existing for Cre enzyme
Under, cell of the invention is converted with carrier of the invention；It is animal body by the cytothesis of conversion, so that it is dynamic to obtain transgenosis
Object.
In a preference of the invention, include the following steps:
(1) method of gene introduction is utilized, mutation loxp sequence is integrated into the specific position of domestic animal genome, obtains loxp
The cell of positioning integration；(2) it will be placed in transgene frame between multiple sites loxp in the same direction, and be built into transgene carrier；
(3) transgene carrier is imported into loxp positioning integration cell using method of gene introduction, by introducing Cre enzyme gene transfer frame
Frame is incorporated at the site loxp in loxp positioning integration cell, obtains transgenosis positioning integration cell；(4) using modern raw
Transgenosis positioning integration cell is prepared the transgenosis positioning integration animal survived by object technology.
Main advantages of the present invention are:
(1) the method for the present invention can avoid external source base efficiently by exogenous origin gene integrator in the specific position of domestic animal genome
Because the shortcomings that integration site is indefinite, and interference of transgene is expressed caused by random integration；
(2) the method for the present invention is by the plasmid direct transfection cell containing foreign gene, without digestion, gel electrophoresis, recycling
With purifying etc. complex process, substantially increase the operability of plasmid construction, save human and material resources and financial resources；
(3) in the obtained transgenosis positioning integration cell of the method for the present invention, gene integration position is clear, gene integration detection
Simply, the problem of avoiding the complex detection of traditional integrated transgene cell and excessive passage during detection, and repair heredity
The cell of decorations is more suitable for somatic cell clone；
(4) the method for the present invention can significantly simplify the authentication step in transgenic animals safety evaluation and industrialization process, and
It is high-efficient, consistency is good, transgenic fragment size has no significant effect positioning integration efficiency, is easy to amplify；
(6) the invertibity processing that the method for the present invention can integrate transgenosis and knock out, is applicable not only to gene function
With the research of interaction, it may also be used for the removing of harmful transgenosis is deleted.
Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention
Rather than it limits the scope of the invention.In the following examples, the experimental methods for specific conditions are not specified, usually according to conventional strip
Part such as Sambrook et al., molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory
Press, 1989) condition described in, or according to the normal condition proposed by manufacturer.
Embodiment 1 obtains loxp positioning integration cell line
1. the separation of human lysozyme transgenic goat fetal fibroblast
(ram is disclosed in patent for normal commercially available she-goat and the ram of the element of Loxp containing wild type
ZL200510110772.1 the 32-40 days after) breeding, surgically method takes out fetus, is transferred in superclean bench, will
The fetus of acquisition is washed 2 times with the PBS buffer solution containing 1% dual anti-(penicillin 100U/ml, streptomysin 0.1mg/ml), removal head,
Remaining group is woven in 75% ethyl alcohol and impregnates 30s by four limbs and internal organ；Fetal tissue 3-5 is washed with without dual anti-PBS again
It is secondary, then it is cut into 1mm3The tissue block of size is laid on 100mm Tissue Culture Dish, equably spreads out tissue block, using adding
Have the GMEM culture solution (being purchased from Invitrogen company of the U.S.) of 10%FBS, mycillin and nonessential amino acid in 37 DEG C,
4h is stood in 5%CO2 incubator.GMEM culture solution is added around tissue block within 2nd day, submerges tissue block, is observed every 2~3d
And change liquid.Cell, secondary culture are collected in digestion when primitive cell culture to cell 80% converges, and cell count is placed in liquid nitrogen
Middle freezen protective.
2. human lysozyme transgenic goat fetal fibroblast is identified
4 fetuses are obtained altogether, fetus situation is as follows: the sheep placenta that N5 is 32 days；N4-A is 37 days fetuses；N37-A is
37 days fetuses；N37-B is 37 days fetuses.
According to the sequence of goat Y chromosome, pair of primers is designed:
SRY16f (5 '-caatcgtatgcttctgctatgttc-3 ' SEQ ID NO.:1)；
SRY654r (5 '-caatgttaccctatcgtggcc-3 ' SEQ ID NO.:2).
Specific amplification Y chromosome the preceding paragraph 638bp distinguished sequence carries out the sex identification of fetus accordingly, can expand
The sample of the 638bp distinguished sequence is otherwise ewe from ram out.
As a result (Fig. 1) shows: N5, N37-B are ram, and N4-A and N37-A are ewe.
According to human lysozyme gene group sequence, pair of primers is designed:
Lyz983 (5 '-tacatttgaggacctggcagagc-3 ' SEQ ID NO.:3)；
Lyz 1412 (5 '-tcctaccactttgggaggctga-3 ' SEQ ID NO.:4).
Human lysozyme gene group segment to specific amplification 429bp amplifies the 429bp to carry out integration identification
The sample of distinguished sequence is integrated fetus.
As a result (Fig. 2) shows: N5 and N37-B is to integrate male form fetus.
The expression and purification of 2 TAT-Cre enzyme of embodiment
Picking contain TAT-Cre recombinase expression plasmid pET 28.2TAT-Cre (carrier public can freely from
Howard Hughes Medical Institute is obtained, the information such as carrier structure, multiple cloning sites, complete nucleic acid sequence
It comes fromhttp://cmm.ucsd.edu/Lab_Pages/dowdy/Vectors/vector_seq/ pET28.2bTATCRE.txt).Colony inoculation containing TAT-Cre recombinase expression plasmid is in LB training of the 20ml containing kanamycins
It supports in base, 37 DEG C are shaken bacterium and stayed overnight.It is overnight containing having the bacterium solution of purpose plasmid in 2L kana LB culture medium according to 1: 100 inoculation,
37 DEG C, shake bacterium 3h.IPTG is added and carries out induced expression, makes its final concentration of 1mmol/L, 37 DEG C, shakes bacterium 3h.3000 × g, centrifugation
10min harvests thallus.Thallus is resuspended with 100ml pre-cooling PBS, 5000 × g is centrifuged 10min, harvests thallus, so repeatedly three
Time, thallus can be stored in -80 DEG C it is spare.
The mycoprotein lysate of thallus pre-cooling containing destination protein is resuspended, is put on ice for, ultrasound, intensity
10, ultrasonic 10s places 30s to 1min on ice, repeatedly, until thallus all cracks.15000 × g is centrifuged 30min, it takes
Supernatant is placed on ice.With 30% SB buffer (Na2HPO410mmol/L, glycerol 2.5%, beta -mercaptoethanol 10mmol/L,
NaCl 1mol/L, pH7.4) balance SP sepharoseTM pillar, 4ml/min, 30min.Take after cellular lysate supernatant with 0.22
μm filter filtering after loading, loading speed 4ml/min.After end of the sample, column is washed with 30% SB buffer, 4ml/min
Son no longer declines until ultraviolet absorption value is steady.From 30% to 100%SB buffer gradient elution, 2ml/min, elution is always
Volume is 100ml, and automatic fluid collection device collects all eluents.100%SB buffer continues elution until ultraviolet absorption value drops to
100mAU is hereinafter, merge the eluent for being greater than 250mAU, wherein i.e. destination protein TAT-Cre recombinase.
SA buffer (the Na of the eluent and diploid product2HPO410mmol/L, glycerol 2.5%, beta -mercaptoethanol
10mmol/L, pH7.4) careful mixing on ice, there is a small amount of precipitating, after 0.22 μm of filter filtering, is placed in standby on ice
With.Source 15s pillar, 4ml/min, 30min are balanced with 30%SB buffer.Resulting supernatant loading, loading will be filtered
Speed 4ml/min.With 30% to 100%SB buffer gradient elution pillar, until appearance, is collected all greater than 250mAU
Eluent, wherein containing destination protein.By destination protein loading HiPrepTM 26/10Desalting pillar, buffer is replaced
Liquid 10ml/min elution is changed, elution protein peak solution is collected.
Protein peak solution is put into 3000 × g in the super filter tube of millipore MWCO 30000 and is centrifuged 30min, pipe is interior about
After remaining 1/4 protein solution of original volume, protein solution, -80 DEG C of preservations are sucked out.Since each freeze thawing has certain influence to concentration,
TAT-Cre recombinase is quantitatively determining concentration by DC using preceding.
Fig. 3 shows the SDS-Page electrophoresis result of TAT-Cre recombinase, and M marker, SF are super for TAT-Cre thallus
The broken supernatant of sound, FT are the liquid that flows through of SP-sepharoseTM pillar, and E1 is the eluent of SPsepharoseTM pillar,
E2 is the eluent of source 15s pillar.The result shows that inventor has successfully purified TAT-Cre recombinase.
Embodiment 3 introduces the mutational site Loxp and identification
Complete artificial synthesized side is to have the mutation site Loxp, and the other side is the wild type site Loxp in the same direction, and centre is screening
The complete sequence of the expression frame of marker gene neo and TK (sequence is as shown in SEQ ID NO.:31).It is cloned into commercially available
At the site SalI of pGEM-7Z carrier, recombinant plasmid is named as pGEM-2loxp '.Utilize the TAT-Cre obtained in embodiment 2
The element is introduced in human lysozyme transgenic goat fetal fibroblast, replaces cell by the loxp recombination method of mediation
The selection markers of the interior wild type site Loxp span in the same direction.Following carried out transgenosis component positioning integration researchs herein,
Using the human lysozyme transgenic goat fetal fibroblast in such band mutation site loxp.
The building of 4 salmon calcitonin positioning integration plasmid pTM-sCT2 of embodiment
1. the overall plan of vector construction
According to the process of Fig. 4, the mammary gland-specific expression vector pTM- of salmon calcitonin of the building containing double loxp sequences
sCT2.Wherein pbLGpA is that our unit voluntarily constructs, and preparation method discloses in patent ZL200510110772.1, in the plasmid
The mammary gland specifically expressing of beta lactoglobulin promoter containing ox and bovine growth hormone polyA sequence composition regulates and controls frame.
2. the building containing double loxp sites vectors
It is entirely artificial synthesized that sequence is cloned into commercially available pUC18 carrier containing double loxp site sequences (sequence is shown in Fig. 5),
The plasmid is named as pUC18-2loxp.
It joined the multiple cloning sites of SacI, SalI and a NotI composition, between two sites loxp convenient for subsequent
Gene cloning.
3. the building of salmon calcitonin mammary gland-specific expression vector
According to the process of Fig. 6, the mammary gland-specific expression vector pBLG-sCT of salmon calcitonin is constructed.Wherein contain in pbLGpA
Frame is regulated and controled by the mammary gland specifically expressing that the beta lactoglobulin promoter and bovine growth hormone polyA sequence of ox form.Fig. 6 is shown
The building schematic diagram of pBLG-sct plasmid.
The artificial synthesized coded sequence (Fig. 7) of salmon calcitonin (sCT) of Shanghai Jierui Biology Engineering Co., Ltd is entrusted,
To instruct salmon calcitonin to be secreted into milk and facilitating purifying, goat Bcasein is added before salmon calcitonin coding framework
Secretion peptide, 6 × His label and enterokinase three elements of restriction enzyme site, two sides are the site XhoI.SCT sequence is cloned
Enter in pUC18 carrier, forms plasmid pUC18-sCT.Fig. 7 shows artificial synthesized salmon calcitonin sequence.
4. the building of the sCT mammary gland-specific expression vector containing double sites loxp
It is using SalI and SacII double digestion plasmid pBLG-sct and pUC18-2loxp, sCT expression frame insertion is double
Between the site loxp, the sCT mammary gland specifically expressing plasmid p2xGsct containing double sites loxp is obtained.
5. the clone of puromycin resistance gene expression frame
According to plasmid pGL4.20 [luc2/Puro] (be purchased from Promega company, GenBank Accession Number:
DQ1888 40) sequence, design synthesis following primer:
F-puro1183 (5 '-ttgcggccgcgataaggatccg tttgcgta-3 ' SEQ ID NO.:5)；
R-puro1183 (5 '-ttgcggccgcatcggtcgacagcatctagt-3 ' SEQ ID NO.:6).
Therefrom amplify the expression frame of puromycin resistance gene.
After 2% agarose gel electrophoresis detects successfully, is recycled and sieved using TIANGEN DNA purification and recovery kits
Gene expression segment is selected, the band that recycling obtains is connect with carrier pGM-T and is transformed into competence DH5 α, plasmid pMD- is obtained
(Fig. 8, M DL2000marker, band are respectively 100,250,500,750,1000,2000bp to Puro from bottom to top；1,2 are
Puro expresses frame and expands electrophorogram).
Being utilized respectively PCR method, (Fig. 9, M DL2000marker, 11-20 are conversion picked clones；11,12,13,14,16,
17,18,19,20 be positive colony；21 be negative control, purpose band 1183bp) and endonuclease cutting (Figure 10, M 1kb
Ladder, 11-20 are conversion picked clones；16,17,18,19,20 be positive colony, purpose band 1183bp) to pMD-
Puro is identified.
Qualification result shows that the plasmid construction is correct.
6. salmon calcitonin positioning integration plasmid construction
The expression frame that Puro is obtained using NotI digested plasmid pMD-Puro, by insertion NotI linearization for enzyme restriction
In p2xGsct, salmon calcitonin positioning integration plasmid pTM-sCT2 is obtained.
It is identified to show that having 4 in 23 bacterium colonies is positive colony, the amplifiable expection band for obtaining 1183bp of PCR
(Figure 11, M DL2000；1-23 is picking monoclonal: 2,19,20 be positive colony；24 be negative control).
Further qualification result shows: (Figure 12, M are sCT segment of the pTM-sCT2 through the available 180bp of XhoI digestion
D2000；2,19,20 be positive colony), the Puro that can cut out 1183bp through I digestion of Not expresses frame, and (Figure 13,1 is
BM15000DNA Marker II, each band is 500 from top to bottom, 1000,1500,3000,5000,7500,10000,
15000bp；2 be the electrophorogram of I digested plasmid pTM-sCT2 of Not), show plasmid construction success.
5 pBS185 of embodiment and pTM-sCT2 cotransfection method realize positioning integration
The preparation of 1.pTM-sCT2 plasmid and pBS185 plasmid
PBS185 is purchased from Addgene company.
PTM-sCT2 plasmid prepares in embodiment 4.
The a large amount of of plasmid are carried out respectively using the EndoFree Plasmid Maxi Kit (Cat.No.12362) of QIAGEN
Extracting, being finally pumped plasmid pBS185 concentration is 485ng/ μ l, totally 500 μ l, and plasmid pTM-sCT2 concentration is 1.9 μ g/ μ l, altogether
500μl。
2.pBS185 with pTM-sCT2 corotation BLG3 cell
Recovery human lysozyme transgenic goat fetal fibroblast is long in complete medium in 60mm Tissue Culture Dish
Reach 24 orifice plates after full, 4 × 105A cells/well, every hole are added 500 μ l and are free of dual anti-culture medium.It is grown to second day cell
50-80% is reached to convergence degree, can be transfected.
Before transfection, prepare DNA-lipid compound in accordance with the following methods: preparing plasmid (pBS185 and pTM-sCT2 by table 1
The ratio between additional amount is 1: 1), packet numbering (presses 24 orifice plate coordinates), 100 μ l serum-free Opti-MEM of every pipe plasmidI culture
Liquid (being purchased from Invitrogen company of the U.S.) is diluted, and is mixed well.PLUS (is being purchased from U.S. Invitrogen using preceding
Company) reaction solution mixes gently, 1 μ lPLUS reaction solution is added into diluted plasmid, lightly mixes, and then room temperature is transferred
Set 5min.Lightly mix LipofectamineTMLTX (is purchased from Invitrogen company of the U.S.), and being added into above-mentioned each pipe should
Reagent (additional amount such as table 1), mixes well.It is placed at room temperature for 30min.It is prepared that 100 μ l are added dropwise in 24 porocyte plates
Above-mentioned DNA-lipid compound, lightly slides back and forth culture plate, mixes.By the cell of above-mentioned processing in 37 DEG C of incubator (bodies
Fraction 5%CO2) be incubated for 6 hours after it is continued to cultivate with complete medium, after cell is adherent, PBS is washed 3 times, be added
OPTI-MEM dilutes TAT-Cre (2 μM of final concentration), and processing replaces normal culture solution after 3 hours and continues to cultivate.
Table 1
Integrator cell clone strain being selected and identifying: after above-mentioned cell continues culture 24 hours, each hole cell paving one
A 100mm Tissue Culture Dish, totally 16.0.08 μ g/ml of puromycin pressurization screening 10 days, using clone's ring by monoclonal cell
It is transferred in 96 porocyte culture plates, picked clones quantity situation such as table 2.
Table 2
Cell is reached into 48 porocyte culture plates according to normal secondary culture mode.Cell dissociation after covering with is divided into two
Part, for integrating identification, portion continues to expand to be cultivated and freezes for somatic cell clone portion.
The positioning of 3.sCT transgenosis frame recombinates identification
The extraction of 3.1 cellular genomes
It is carried out using TIANGEN Biotech's cellular genome extracts kit (article No. Dp302-02)
Cellular genome is extracted, and adjustment concentration is about 50ng/ μ l.
The identification of 3.2 integrator cells clone
According to recombination theoretical sequence, design such as the detection primer in table 3:
Table 3
It is utilized respectively the mentioned recombinant clone genome of the above primer pair and carries out 5 ' end detections (Figure 14 and Figure 19), 3 ' end detections
(Figure 15 and Figure 20), functional gene (sct) detect (Figure 16), selectable marker gene (Neo) detects (Figure 17), plasmid pBS185 base
Because of detection (Figure 18), detection method used be PCR method (94 DEG C of initial denaturation 5min, 94 DEG C of 30s Tm 30s, 72 DEG C of 1min (/
3min), 72 DEG C of 7min).
Figure 14 shows 5 ' end testing results of recombinant clone, and wherein M is DL2000, and 66-69,71,73-85,93 are
5 ' end testing result of clone, 67,73,74,78,81,85 be the positive, and 0 is negative control.
Figure 15 show recombinant clone 3 ' end testing results, wherein M be 1kb DNA Marker, 20,23,24,34,
41,47,50 be the end of screening and cloning 3 ' detection electrophoretogram, and 0 is negative control.
Figure 16 shows the testing result of salmon calcitonin functional gene, wherein M be DL2000,10,14,20,23,24,
34,41,47,54,59,67,73,74,79,81,85,89 electrophoretogram is detected for functional gene neo, 1 is positive control, and 2 be yin
Property control.
Figure 17 shows screening-gene neoR testing result；Wherein M be DL2000,20,23,24,34,41,47,54,59,
67,73,74,79,81,85 electrophoretogram is detected for screening and cloning marker gene neo, 79 be neo gene masculine, and 1 is positive control,
2 be negative control.
Figure 18 is pBS185 genetic test electrophoretogram, and wherein M is DL2000；23,24,34,47,59,74,78,81,85 are
Screening and cloning pBS185 genetic test electrophoresis result, wherein 24,34,81 be the gene masculine；0 is negative control.
Figure 19 is that salmon calcitonin positioning integration clones 5 ' sequencing analysis maps.
Figure 20 is that salmon calcitonin positioning integration clones 3 ' sequencing analysis maps.
Above-mentioned detection and sequencing result and theoretical sequence (Figure 21 and Figure 22) are consistent.
The present embodiment has detected 44 plants of calcitonin integrated transgene cell clones altogether, obtains 9 positioning integrations in total
Positive colony.Under this 6 kinds of transfection conditions, best positioning integration efficiency is 40% (2/5), other positioning integration efficiency point
It Wei not 20% (1/5,2/10), 23.1% (3/13), 25% (1/4).It finds 4 plants altogether and is integrated with pBS 185, it is impossible to be used in clone
The preparation of sheep.The positive colony that filters out is represented and carries out PCR product sequencing analysis, is compared through BLAST, as a result with theoretical sequence
Unanimously.Result above shows that external source functional gene and human lysozyme transgenic goat genome successfully realize positioning recombination.
6 TAT-Cre of embodiment mediates pTM-sCT2 plasmid to realize positioning integration
1. liposome transfection
Method realizes positioning integration with pBS 185 and pTM-sCT2 cotransfection method.Plasmid additional amount such as table 4.
Table 4
As a result in 49 clones of institute's picking, there are 2 positive cell clone strains, under the conditions of transfection in 6, recombination efficiency is
20% (1/5), 12.5% (1/8).As a result identification such as Figure 13-17.
2. electroporation transfects
Plasmid pTM-sCT2 is quantified, concentration is 1.9 μ g/ μ l, takes 7 μ l spare.
Recovery human lysozyme transgenic goat fetal fibroblast is passaged to after covering in 60mm Tissue Culture Dish
100mm Tissue Culture Dish starts to carry out cell transfecting when cell density reaches 80% or so.It is counted after trypsin digestion cell,
Turn electricity is resuspended in after cell 1000rpm 5min centrifugation in buffer PBS, adjusts cell number 5 × 106~1 × 107A/mL.It takes
The cyclic plasmid pTM-sCT2 of the 12 μ g through the filtering of 0.22 μm of filter is added thereto, is uniformly mixed for 500 μ l cell suspensions,
It is added in the 4mm electricity revolving cup of pre-cooling, is put into electroporation shocks by electricity after standing 5min on ice, pulse voltage 220V, capacitor
950μF.After electric shock, 10min is stood on ice, and cell suspension is moved in the culture plate added with the 100mm of culture solution, 37 DEG C,
5%CO2Culture.After cell is adherent, PBS is washed 3 times, and OPTI-MEM dilution TAT-Cre (2 μM of final concentration) is added, and is handled 3 hours
After replace normal culture solution and continue to cultivate.After 24 hours, vitellophag is reached in 6-8 100mm tissue culture plate, puromycin
(final concentration: 0.08 μ g/ml) pressurization screening 7 days.Monoclonal cell is transferred in 96 porocyte culture plates using clone's ring, is pressed
Photo cell, which normally passes on mode, cultivates it, and after the cell in 48 holes covers with, digestion is divided into two parts, and portion is for integrating
Identification, portion continues to expand culture, and freezes, and prepares for somatic cell clone.
The positioning of 3.sCT transgenosis frame recombinates identification
Extract institute clonal cell line genome, in 4 DEG C preservations.
The result shows that, in 18 cell clones of this time transfection detection, it is obtained as shown in Figure 23, Figure 24 and Figure 25
Positive colony 2, recombination efficiency 2/18=11.1%.
Figure 23 is the end of screening and cloning cell strain 5 ' detection electrophoretogram；M is DL2000；1-12 is the end of picked clones cell strain 5 '
Electrophoretogram is detected, No. 10 are positive colony.
Figure 24 is the end of screening and cloning cell strain 3 ' detection electrophoretogram；M is DL2000；1-12 is the end of picked clones cell strain 3 '
Electrophoretogram is detected, No. 10 are positive colony.
Figure 25 is that functional gene detects electrophoretogram；M is DL2000, and 10,14 detect electrophoresis for screening and cloning functional gene sct
Figure.
The acquisition of the mammary gland specifically expressing frame of 7 human serum albumins mini gene of embodiment
According to the genome sequence of human serum albumins, the complete artificial synthesized mini gene of human serum albumins, overall length
4015bp, includes exon1, intron1, exon2, intron2 and exon3 partial sequence and all cDNA coded sequences later
(complete sequence is as shown in SEQ ID NO.:27), sequent synthesis is complete to be cloned into commercially available pUC19 carrier, and plasmid is named as
pUC19-miniHSA。
PUC19-miniHSA obtains the mini gene of human serum albumins, product recycling orientation insertion through Xho I digestion
The site XhoI of pbLGpA plasmid.Utilize a pair of of direction identification primer HSAg-Fnew (GTGGGTAACCTTTATTTCC) and T7
(TAATACGACTCACTATAGGG) PCR identification (shown in Figure 42) successively is carried out to 55 single colonies, only No. 9 amplify 4394bp
Target fragment, send No. 9 bacterium solutions to sequencing, sequencing analysis carried out to No. 9 plasmids, result is that direction of insertion is correctly cloned.Thus
It obtains cow's milk ball albumin regulation human serum albumins mini gene and realizes that the specifically expressed frame of mammary gland, plasmid are named as
pBLG-minihSA。
Figure 42 shows the qualification result of human serum albumins mammary gland-specific expression vector, and wherein M is λ/HindIII DNA
Marker, each stripe size are respectively 23130.9416.6557.4361.2322.2027.564.125bp.1-32 is plasmid sample
Product；There is the positive band of about 4.3kb in No. 9 samples.
The building of 7 human serum albumins positioning integration plasmid pTM-hSA2 of embodiment
With restriction enzyme XhoI digested plasmid pTM-sCT2, sCT gene is cut off, recycling obtains the plasmid frame that size is 7019bp
Frame (Figure 26), while with XhoI digested plasmid pBLG-minihSA (Figure 27), is recovered to 4015bp hSA expression frame, will more than
Recovery product connection is transformed into competence DH5 α, and picking monoclonal shakes bacterium, extracts plasmid (Figure 28), obtains plasmid pTM-hSA2.
Through the EcoRI digestion plasmid (Figure 29), the purpose item that size is respectively 3.209kb, 3.906kb, 3.872kb is obtained
Band (if hsA express frame to be reversely inserted into, cut purpose band are as follows: 6kb, 0.655kb, 3.872kb).Further to test
The correctness for demonstrate,proving has gene direction of insertion in plasmid pTM-hSA2 holds upstream and hSA in hsA5 ' according to its plasmid theoretical sequence
Interior design pair of primers carries out PCR- sequencing detection to it, sequence such as table 5:
Table 5
Fx691-F 5-TAGAGGAAGCAACCCCAGG-3S EQ ID NO.:17
Fx691-R 5-CAGCAACCAAGAAGACAGAC-3SEQ ID NO.:18
Amplification length is 691bp, and annealing temperature is 58 DEG C.Theoretical size strip is obtained through amplification.Its PCR product is carried out
Sequencing analysis (Figure 30, Figure 32), it is as a result consistent with theoretical sequence (Figure 31).
Result above shows that plasmid pTM-sCT2 building is correct.
9 TAT-Cre of embodiment mediates pTM-hSA2 plasmid to realize positioning integration
Plasmid pTM-hSA2 is largely extracted using the EndoFree Plasmid Maxi Kit of QIAGEN, concentration 1
μ g/1 μ l totally 500 μ l, be stored in after packing -20 DEG C it is spare.And corresponding strain is saved.
Recovery human lysozyme transgenic goat fetal fibroblast is passaged to after covering in 60mm Tissue Culture Dish
100mm Tissue Culture Dish starts to carry out cell transfecting when cell density reaches 80% or so.It is counted after trypsin digestion cell,
Turn electricity is resuspended in after cell 1000rpm 5min centrifugation in buffer PBS, adjusts cell number 5 × 106~1 × 107A/mL.It takes
The cyclic plasmid pTM-hSA2 of the 12 μ g through the filtering of 0.22 μm of filter is added thereto, is uniformly mixed for 500 μ l cell suspensions,
It is added in the 4mm electricity revolving cup of pre-cooling, is put into electroporation shocks by electricity after standing 5min on ice, pulse voltage 220V, capacitor
950μF.After electric shock, 10min is stood on ice, and cell suspension is moved in the culture plate added with the 100mm of culture solution, 37 DEG C,
5%CO2Culture.After cell is adherent, PBS is washed 3 times, and OPTI-MEM dilution TAT-Cre (2 μM of final concentration) is added, and is handled 3 hours
After replace normal culture solution and continue to cultivate.After 24 hours, vitellophag is reached in 6-8 100mm tissue culture plate, puromycin
(final concentration: 0.08 μ g/ml) pressurization screening 7 days.Monoclonal cell is transferred in 96 porocyte culture plates using clone's ring, is pressed
Photo cell, which normally passes on mode, cultivates it, and after the cell in 48 holes covers with, digestion is divided into two parts, and portion is for integrating
Identification, portion, which continues to expand, to be cultivated and freezes, and is prepared for somatic cell clone.
As a result it identifies
Design synthesizes the 5 ' ends, 3 ' ends and its key element (functional gene, selection markers base of following primer pair picked clones
Cause) it is detected.
Table 6
Plasmid pTM-hSA2 transfection rhlyzGFC is total to obtain 25 clones, extracts genome, and utilize the side of PCR amplification
Method (4 DEG C of initial denaturation 5min；94 DEG C of denaturation 30s, renaturation 30s (annealing temperature is referring to upper table), 72 DEG C of extension 30s, totally 30 are followed
Ring；Last 72 DEG C of extensions 5min；) to its 5 ' end (Figure 33), 3 ' ends (Figure 34), functional gene (Figure 35) and marker gene (Figure 36)
Detection, testing result gained positive colony are 1,11,14,20,21, totally 5, position recombination efficiency are as follows: 5/25=20%.To sieve
The positive colony selected is expanded, and product is sent to Invitrogen for sequencing, sequencing result (Figure 39, Figure 40) and theoretical sequence
(Figure 37, Figure 38) unanimously, shows successfully to realize positioning recombination.
Figure 33 is that picked clones cell strain 5 ' holds electrophoresis detection figure；M1 is D2000；1,2,8-24 is the end of picked clones 5 ' electricity
Swimming detection figure, wherein 11,12,14,20,21,1,2 be the positive；26,5 be positive control；27,6 be negative control；Figure 34 is to choose
Clonal cell line 3 ' is taken to hold electrophoresis detection figure；M1 is D2000；1-4,8-25 are the end of picked clones 3 ' electrophoresis detection figure, wherein 11,
14,17,20,21,1 is the positive；26,5 be positive control；27,6 be negative control；Figure 35 is screening and cloning cell strain function base
Because of test map；M is 1kb DNA Ladder；1 is screening and cloning marker gene test map；Figure 36 screening and cloning cell strain mark
Remember genetic test map；M is D2000；1,2 be screening and cloning marker gene test map, and 1 is positioning recombinant clone；3:
Positive control；4: negative control；Figure 37 human serum albumins positions the end of recombinant clone 5 ' recombination theoretical sequence；Figure 38 human seralbumin
Albumen positions the end of recombinant clone 3 ' recombination theoretical sequence.
The somatic cell clone of 10 positioning integration cell clone of embodiment
1. egg mother cell preparation is synchronous with receptor sheep
Pick out the ewe intramuscular injection PG 0.1mg/ head as oocyte donors, interval second of injection after 10~14 days
PG starts super row after second of injection PG 10~13 days, i.e., intramuscular injection FSH first divides 6 times, and 2 times/day, dosage is every
Its 100IU, 80IU, 80IU.It while last time injects FSH, injects a PG (0.1mg/), when interval is after 24 hours
LRH, 25 μ g/ times are injected, 26~28 hours recycling egg mother cells after LRH are injected.
To be synchronous with the donor sheep of egg mother cell is provided, the intramuscular injection PG in two times of receptor sheep interval 9~11 days, in donor
24 hours after the super row's injection PG of sheep, receptor also injects PG simultaneously, and receptor injects time and the same donor of dosage of LRH.
Surgical exposure fallopian tubal rushes ovoscopy under ovum, stereoscope with F-10 nutrient solution.Hyaluronic acid enzymic digestion granular cell,
M16 is washed 4~5 times, is set in the side's M16 cup and is cultivated, spare.
2. the Nature enemy of donor cell
The cell inoculation to starvation in 35mm plate.When Cell abundance is up to 70%~75% or so, culture is sucked
The DMEM liquid containing 0.5%FCS is added in liquid, and after 5 days hungry, cell is collected in conventional method digestion.Then it is put in -85 DEG C of refrigerators and protects
It deposits.6 days before nuclear transfer experiments, takes out 2 tubules and recover and be inoculated in 4 orifice plates.It is hungry after being further cultured for 2 days or 3 days, starvation side
Method is the same.
3. the preparation and activation of reconstructed eggs
Egg mother cell washs 3 times in M16-Hepes (7.5 μ g/ml of 2.8mg/ml containing Hepes, CB) liquid, in M16-
Hepes handles 10min in (containing 7.5 μ g/ml CB)；The cell pancreatin of culture is digested simultaneously, is dispersed into individual cells.It will
Egg mother cell is placed in the 1ml M16-Hepes (contain CB) on sterilizing slide with moving into simultaneously for somatic cell, under the microscope
It is enucleated and is sucked donor cell, it is injected into perivitelline from original notch, so that it is tightly attached to cytoplasmic membrane, using electro photoluminescence
Method merged, fusion matrix be mannitol containing 0.3mM, 0.05mM calcium chloride, 0.1mM magnesium sulfate, 0.5%BSA it is molten
Liquid, fusion conditions DC600-610v/cm, 80 μ s of pulse duration, continued stimulus 3 times.Fused embryo trains in M16
After supporting 5 hours, 5min is handled in the M16 liquid containing 5 μM of ionomycins (ionomycin), 7.5 μ g/ml CB, then containing 2mM
It handles to move back for 5 hours in the M16 liquid of 6- dimethylaminopurine (6-DMAP) and 7.5 μ g/ml CB and be trained in M16 culture solution
It supports, wait embed or transplant.
4. the transplanting of the embedding of reconstructed eggs, recycling and embryonic development
Reconstructed eggs are embedded with 1% Agarose, and are implanted into fallopian tubal, In vivo culture went out adhesive tape after 5 days, will
Embryo in adhesive tape is stripped out, and selection is developed to mulberry fruit and blastula embryo, is transplanted to receptor sheep intrauterine, calculate mulberry fruit and
Blastocyst rate.
5. reconstructed eggs developmental rate and pregnancy rate
Salmon calcitonin positioning integration cell takes ovum donor goat 39 altogether, takes 462 pieces of ovum；It is for nuclear transfer ovum number
423 pieces, co-melting to close 387 pieces, fusion rate 91.56% (387/423) activates 355 pieces of reconstructed embryos, embeds 227 pieces, directly transplanting
127 pieces.After embedding, 216 pieces are recycled altogether, the rate of recovery 95.15%；Several 203 pieces of the spilting of an egg, cleavage rates 93.98%, proper splitting number
114 pieces, account for the 52.78% of total division number；Totally 48 pieces of mulberry blastaea of acquisition, mulberry blastocyst rate 22.22%, uterine transplantation receptor 27；
Fallopian tubal directly transplanting receptor 12,10-12 pieces of reconstructed embryo of every transplanting；Co-transplantation receptor 39 (GPR 39) is only.30-35 days ultrasound diagnosis knots
Fruit: 9 pregnancies (pregnancy rate 33.3%) in 27 uterine transplantation mulberries, blastaea receptors；12 receptors of common oviduct transplantation 1-2 cell
11 pregnancies (pregnancy rate 91.7%).Add up to 39 receptors, 20 pregnancies (pregnancy rate 51.3%).
Seralbumin expresses the positioning integration cell of component, takes ovum donor 32 altogether, takes 441 pieces of ovum；5.2 nuclear transfer
401 pieces, for 375 pieces of fusion, fusion rate 92.27% (346/375) activates 338 pieces, 338 pieces of directly transplanting.Fallopian tubal directly moves
Receptor 35 are planted, 8-12 pieces of reconstructed embryo of every transplanting.B ultrasound gestation detection in 32 days shows there is 20 pregnancies, pregnancy rate after transplanting
57.1%.
The above results show that the somatic cell clone effect of positioning integration cell is normal, reconstructed embryo fusion rate, cleavage rates, mulberry
It is consistent that each link index such as mulberry blastocyst rate and receptor pregnancy rate integrates the efficiency of somatic cell clone with non-locating, and it is fixed to show
The body cell of position integration processing, without obvious adverse effect, can prepare Somatic Cloned Goats with it to somatic cell clone later.
All references mentioned in the present invention is incorporated herein by reference, independent just as each document
It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can
To make various changes or modifications to the present invention, such equivalent forms equally fall within model defined by the application the appended claims
It encloses.
Claims (14)
1. a kind of loxP element of variation, which is characterized in that the sequence of the loxP element of the variation is as follows:
ataacttcgtata atgtatgc tatacgaaaggtg。
2. a kind of construction, which is characterized in that the construction from 5 ' to 3 ' successively contains following three elements:
(a) the loxP element of variation described in claim 1；
(b) exogenous gene expression box and/or selection markers expression cassette；
(c) the wild type loxP element of the sequence as shown in SEQ ID NO.:28；Or
(c) the wild type loxP element of the sequence as shown in SEQ ID NO.:28；
(b) exogenous gene expression box and/or selection markers expression cassette；
(a) the loxP element of variation described in claim 1.
3. construction as claimed in claim 2, which is characterized in that the selection markers are that neomycin gene or purine are mould
Plain resistant gene.
4. construction as claimed in claim 2, which is characterized in that the foreign gene is selected from the group: lysozyme gene, salmon
Fish calcitonin gene or Serum Albumin Gene.
5. construction as claimed in claim 2, which is characterized in that element (a) is to be collectively aligned with element (c).
6. construction as claimed in claim 2, which is characterized in that the element (a) and element (c) is incorgruous arrangement.
7. a kind of carrier, which is characterized in that the carrier contains construction as claimed in claim 2.
8. a kind of host cell, which is characterized in that the host cell contains construction as claimed in claim 2 or its dye
Colour solid is integrated with one or more constructions as claimed in claim 2, and the host cell is body cell.
9. host cell as claimed in claim 8, which is characterized in that the host cell behaviour or non-human mammal
Cell.
10. host cell as claimed in claim 9, which is characterized in that the non-human mammal is selected from: goat, sheep,
Pig, ox, dog and rabbit.
11. host cell as claimed in claim 10, which is characterized in that the host cell be goat adult body cell,
Or Goat Fetus body cell.
12. host cell as claimed in claim 8, which is characterized in that the host cell is with method selected from the group below
Construction as claimed in claim 2 is imported into cell: homologous recombination method, microinjection, electroporation, liposome transfection
Method, calcium phosphate precipitation, viral infection or sperm-mediated gene transfer.
13. a kind of method of prepare transgenosis animal, which is characterized in that comprising steps of
(i) existing for the Cre recombinase under the conditions of, a host cell is converted with carrier as claimed in claim 7, to obtain one
The cell of conversion, wherein the host cell is nonhuman mammalian cells and is body cell；
It (ii) is animal body by the cytothesis of conversion, to obtain transgenic animals.
14. method as claimed in claim 13, which is characterized in that step (i) comprising steps of
(i-1) Cre expression of enzymes carrier and host cell described in carrier cotransformation as claimed in claim 7；Or
(i-2) under the action of TAT-Cre recombinant protein active with cell-penetrating, with carrier pair as claimed in claim 7
The chromosome of the host cell carries out gene integration.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210090470.2A CN103361342B (en) | 2012-03-30 | 2012-03-30 | A kind of method and its application of transgenosis positioning integration |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210090470.2A CN103361342B (en) | 2012-03-30 | 2012-03-30 | A kind of method and its application of transgenosis positioning integration |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103361342A CN103361342A (en) | 2013-10-23 |
| CN103361342B true CN103361342B (en) | 2019-01-25 |
Family
ID=49363600
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210090470.2A Active CN103361342B (en) | 2012-03-30 | 2012-03-30 | A kind of method and its application of transgenosis positioning integration |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103361342B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015042895A1 (en) * | 2013-09-28 | 2015-04-02 | 上海杰隆生物工程股份有限公司 | Method for positioning and integrating transgene and use thereof |
| CN106978416B (en) * | 2016-01-18 | 2020-11-06 | 上海转基因研究中心 | Gene positioning integration expression system and application thereof |
| CN106434750B (en) * | 2016-09-26 | 2019-06-07 | 湖南农业大学 | Target the methods and applications of targeting vector and targeted integration foreign gene to the building mouse embryo stem cell strain of the site MYH9 Intron2 |
| CN112626116B (en) * | 2019-10-08 | 2022-11-15 | 黄菁 | Method for site-specific integration of large-fragment exogenous DNA |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1283233A (en) * | 1997-11-13 | 2001-02-07 | 住友制药株式会社 | Variant loxP sequences and application of the same |
| CN102203249A (en) * | 2008-10-23 | 2011-09-28 | 学校法人福冈大学 | Method for introducing mutated gene, gene having mutation introduced therein, cassette for introducing mutation, vector for introducing mutation, and knock-in non-human mammal |
-
2012
- 2012-03-30 CN CN201210090470.2A patent/CN103361342B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1283233A (en) * | 1997-11-13 | 2001-02-07 | 住友制药株式会社 | Variant loxP sequences and application of the same |
| CN102203249A (en) * | 2008-10-23 | 2011-09-28 | 学校法人福冈大学 | Method for introducing mutated gene, gene having mutation introduced therein, cassette for introducing mutation, vector for introducing mutation, and knock-in non-human mammal |
Non-Patent Citations (1)
| Title |
|---|
| Excision of selectable genes from transgenic goat cells by a protein transducible TAT-Cre recombinase;Yuanyuan Xu等;《Gene》;20080513;第419卷(第1-2期);71-73 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103361342A (en) | 2013-10-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP2020124228A (en) | Fertile transgenic animals useful for producing antibodies bearing human variable regions | |
| JP4518401B2 (en) | Isolation, selection, and expansion of animal transgenic stem cells | |
| ES2436044T3 (en) | Procedure for generating individual VL domain antibodies in transgenic animals | |
| US20140325690A1 (en) | Transgenic Non-Human Assay Vertebrates, Assays and Kits | |
| JP2005245435A (en) | New fluorescent gene fragment and fish | |
| CN104342455A (en) | Mice expressing alight chain with human lambda variable and mouse constant regions | |
| EP3209698A1 (en) | Transgenic mice | |
| US20140331339A1 (en) | Transgenic Non-Human Assay Vertebrates, Assays and Kits | |
| CN103361342B (en) | A kind of method and its application of transgenosis positioning integration | |
| CN110184301A (en) | Efficiently accurate targeted integration is realized by Tild-CRISPR | |
| CN106978416B (en) | Gene positioning integration expression system and application thereof | |
| KR20070081531A (en) | Mammary gland-specific human erythropoietin expression vector, transgenic animal and method for producing human erythropoietin using same | |
| EP4144857A1 (en) | Animal preparation method | |
| JP4845073B2 (en) | Method for producing reconstructed fertilized egg and method for producing transgenic embryo using the same | |
| US10717991B2 (en) | Transgenic pig which simultaneously expresses HO-1 gene and TNFR1-Fc gene, and comprises knocked-out GGTA1 gene, and use thereof | |
| US10036041B2 (en) | Method for positioning and integrating transgene and use thereof | |
| CN101603045B (en) | Human lysozyme efficiently produced by utilizing mammary gland of domestic animal | |
| WO2023176982A1 (en) | Mhc gene group humanized animal | |
| JP5771240B2 (en) | Immunodeficient pig | |
| US20030208785A1 (en) | Transgenic pig containing heat shock protein 70 transgene | |
| KR20230084157A (en) | Method for producing transgenic non-human-animals having genomes containing humanized immunoglobulin loci | |
| KR100502695B1 (en) | A method for mass production of cloned embryos for improving transgenesis in animals | |
| Luche | Towards the identification of the thymus seeding progenitor:" fate mapping" of early T-cell stages using gene" knock-in" strategies | |
| Luche | Towards the identification of the thymus seeding progenitor:" fate mapping" of early T-cell stages using gene" knock-in" strategies | |
| JPH1014573A (en) | Detection of extraneous-gene expression in living body |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200820 Address after: 201210 Shanghai city Pudong New Area Cailun Road No. 88 Patentee after: SHANGHAI TRANSGENICS RESEARCH CENTER Address before: 201210 Shanghai city Pudong New Area Cailun Road No. 88 Co-patentee before: SHANGHAI TRANSGENICS RESEARCH CENTER Patentee before: SHANGHAI GENON BIOENGINEERING Co.,Ltd. |
|
| TR01 | Transfer of patent right |